| Basic Information ▶ | |
| VISDB ID | TVIS20063845 |
|---|---|
| Fusion Name | HPV-TLE1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S109 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr9 |
| Cytogenetic Band | q21.32 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 84213552 |
| Hg19 End | 84213552 |
| Hg38 Start | 81598637 |
| Hg38 End | 81598637 |
| Junction Sequence | AGCCCATCCAACAGAAGGAAATGGATACTTTGAGAAAGAAACACATTTCTCTGTCTCACACGCACACAAGTTCTAACAGACATATAAACAACAAACAACACTGAGTCAACATACATACAATACTTACAGCTTACGTTTTTTGCGTT |
| Target Gene ▶ | |
| Target Gene | TLE1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 7202 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp8_L1//downstream |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000196781.17 |
| Gene Name | TLE1 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000946426.1, Transcript 2: ENST00000925488.1, Transcript 3: ENST00000879091.1, Transcript 4: ENST00000879090.1, Transcript 5: ENST00000925496.1, Transcript 6: ENST00000925494.1, Transcript 7: ENST00000925495.1, Transcript 8: ENST00000946436.1, Transcript 9: ENST00000879085.1, Transcript 10: ENST00000376499.8, Transcript 11: ENST00000925490.1, Transcript 12: ENST00000925491.1, Transcript 13: ENST00000879083.1, Transcript 14: ENST00000879082.1, Transcript 15: ENST00000925489.1, Transcript 16: ENST00000879079.1, Transcript 17: ENST00000946428.1, Transcript 18: ENST00000946429.1, Transcript 19: ENST00000946427.1, Transcript 20: ENST00000946437.1, Transcript 21: ENST00000946432.1, Transcript 22: ENST00000946430.1, Transcript 23: ENST00000946441.1, Transcript 24: ENST00000925498.1, Transcript 25: ENST00000946435.1, Transcript 26: ENST00000925492.1, Transcript 27: ENST00000946442.1, Transcript 28: ENST00000946434.1, Transcript 29: ENST00000946433.1, Transcript 30: ENST00000946439.1, Transcript 31: ENST00000925497.1, Transcript 32: ENST00000879086.1, Transcript 33: ENST00000946438.1, Transcript 34: ENST00000925493.1, Transcript 35: ENST00000879084.1, Transcript 36: ENST00000879080.1, Transcript 37: ENST00000879081.1, Transcript 38: ENST00000946431.1, Transcript 39: ENST00000946440.1, Transcript 40: ENST00000879087.1, Transcript 41: ENST00000946445.1, Transcript 42: ENST00000946443.1, Transcript 43: ENST00000946444.1, Transcript 44: ENST00000879092.1, Transcript 45: ENST00000879089.1, Transcript 46: ENST00000879088.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.110 | Donor Loss: 0.000 |
| Delta Score Max | 0.110 |
| Delta Position at Max | 0 |
| Delta Score Flag | LOW |
| Gene | TLE1 |
| AlphaGenome Analysis | |
| Window | chr9:81533101-81664173 |
| RNA-seq Change (±2kb) | Mean: 0.0010794788831844926 | Peak: 0.16943359375 |
| ATAC Change (±2kb) | Mean: -0.0007462651701644063 | Peak: 7.99968147277832 |
| Interpretation | RNA-seq: minimal change 9.2% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -1.1% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D