| Basic Information ▶ | |
| VISDB ID | TVIS20063925 |
|---|---|
| Fusion Name | HPV-LINC01505 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S102 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr9 |
| Cytogenetic Band | q31.2 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 109497337 |
| Hg19 End | 109497337 |
| Hg38 Start | 106735056 |
| Hg38 End | 106735056 |
| Junction Sequence | CTTGCTAGCTTTGTGCCGGGCACGGTGCCAAACACCTCCACATAATTTATCCCACTTCCTCCACCCTCTAGTAATTACCACTTCACATGCAGCCTCACCTACTTCTATTAATAATGGATTATATGATATTTATGCAGATGACTTTATTACAGATACTTCTACAACCCCGGTACCATCTGTACCCTCTACATCTTTATCAGGTTATAT |
| Target Gene ▶ | |
| Target Gene | LINC01505 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | HQ644236 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate AS411, complete genome |
| Virus Genome Length | 7905bp |
| Virus Breakpoint1 | 5284 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp7_L2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000234323.11 |
| Gene Name | LINC01505 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000788680.1, Transcript 2: ENST00000788791.1, Transcript 3: ENST00000701865.1, Transcript 4: ENST00000636028.2, Transcript 5: ENST00000788792.1, Transcript 6: ENST00000788783.1, Transcript 7: ENST00000788785.1, Transcript 8: ENST00000788784.1 |
| AlphaGenome Analysis | |
| Window | chr9:106669520-106800592 |
| RNA-seq Change (±2kb) | Mean: -1.2769034583470784e-05 | Peak: 0.0406494140625 |
| ATAC Change (±2kb) | Mean: 0.001618342474102974 | Peak: 1.964141845703125 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 7.8% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D