| Basic Information ▶ | |
| VISDB ID | TVIS20064639 |
|---|---|
| Fusion Name | HPV-RPS6KA3 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S102 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chrX |
| Cytogenetic Band | p22.12 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 20181885 |
| Hg19 End | 20181885 |
| Hg38 Start | 20163767 |
| Hg38 End | 20163767 |
| Junction Sequence | GTAACAGAAAGCATAGACTACTTTTTAAAGAGGCTTTGTGTTGAAAGGATGCAGGAAGATGGATAAAATATAGATGTGATAGGGTAGATGATGGAGGTGATTGGAAGCAAATTGTTATGTTTTTAAGGTATCAAGGTGTAGAGTTTATGTCATTTTTAACTGCATTAAAAAGATTTTTGCAAGGCATACCTAAAAA |
| Target Gene ▶ | |
| Target Gene | RPS6KA3 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | HQ644236 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate AS411, complete genome |
| Virus Genome Length | 7905bp |
| Virus Breakpoint1 | 2135 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000177189.15 |
| Gene Name | RPS6KA3 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000379565.9, Transcript 2: ENST00000643085.1, Transcript 3: ENST00000952699.1, Transcript 4: ENST00000952698.1, Transcript 5: ENST00000645270.1, Transcript 6: ENST00000916291.1, Transcript 7: ENST00000643402.1, Transcript 8: ENST00000952701.1, Transcript 9: ENST00000952700.1, Transcript 10: ENST00000952702.1, Transcript 11: ENST00000916292.1, Transcript 12: ENST00000644368.1, Transcript 13: ENST00000647265.1, Transcript 14: ENST00000645268.1, Transcript 15: ENST00000916294.1, Transcript 16: ENST00000916295.1, Transcript 17: ENST00000916293.1, Transcript 18: ENST00000952703.1, Transcript 19: ENST00000457145.6, Transcript 20: ENST00000643073.1, Transcript 21: ENST00000646610.1, Transcript 22: ENST00000643337.1, Transcript 23: ENST00000642835.1, Transcript 24: ENST00000644893.1, Transcript 25: ENST00000479809.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.010 | Donor Gain: 0.010 | Donor Loss: 0.010 |
| Delta Score Max | 0.010 |
| Delta Position at Max | 382 |
| Delta Score Flag | LOW |
| Gene | RPS6KA3 |
| AlphaGenome Analysis | |
| Window | chrX:20098231-20229303 |
| RNA-seq Change (±2kb) | Mean: -0.0015750265447422862 | Peak: 10.48468017578125 |
| ATAC Change (±2kb) | Mean: -0.0004710098437499255 | Peak: 2.0584716796875 |
| Interpretation | RNA-seq: minimal change -2.8% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -2.3% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D