| Basic Information ▶ | |
| VISDB ID | TVIS20065629 |
|---|---|
| Fusion Name | HPV-ENSG00000295861 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S102 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr4 |
| Cytogenetic Band | q25 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 109131936 |
| Hg19 End | 109131936 |
| Hg38 Start | 108210780 |
| Hg38 End | 108210780 |
| Junction Sequence | GTGGGAAGTAAATTTAAAGGAAAAGTTTTCTGCAGACCTAGATCAGTTTCCTTTAGGACGCAAATTTTTACTACAAGCAGGATTAAAGGCCAAACCAAAATTTACATTAGGAAAACGAAAAGCTACACCCACCACCTCATACTACCAGGGACTCAAACAGAAAGGAGCACCATTCTTTGC |
| Target Gene ▶ | |
| Target Gene | ENSG00000295861, LEF1-AS1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | HQ644236 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate AS411, complete genome |
| Virus Genome Length | 7905bp |
| Virus Breakpoint1 | 7113 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp8_L1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000732957.1, Transcript 2: ENST00000732958.1, Transcript 3: ENST00000732979.1, Transcript 4: ENST00000665040.3, Transcript 5: ENST00000693123.2, Transcript 6: ENST00000732954.1, Transcript 7: ENST00000732981.1, Transcript 8: ENST00000732959.1, Transcript 9: ENST00000732960.1, Transcript 10: ENST00000732955.1, Transcript 11: ENST00000732961.1, Transcript 12: ENST00000732962.1, Transcript 13: ENST00000732980.1, Transcript 14: ENST00000732963.1, Transcript 15: ENST00000732964.1, Transcript 16: ENST00000732965.1, Transcript 17: ENST00000732966.1, Transcript 18: ENST00000732967.1, Transcript 19: ENST00000732968.1, Transcript 20: ENST00000732969.1, Transcript 21: ENST00000732970.1, Transcript 22: ENST00000732971.1, Transcript 23: ENST00000732972.1, Transcript 24: ENST00000732973.1, Transcript 25: ENST00000732983.1, Transcript 26: ENST00000732975.1, Transcript 27: ENST00000732976.1, Transcript 28: ENST00000732953.1, Transcript 29: ENST00000732977.1, Transcript 30: ENST00000732978.1, Transcript 31: ENST00000732974.1, Transcript 32: ENST00000732956.1, Transcript 33: ENST00000512129.2, Transcript 34: ENST00000732982.1, Transcript 35: ENST00000733269.1 |
| Transcript 1 Gene Id | ENSG00000232021.10 |
| Transcript 1 Gene Name | LEF1-AS1 |
| Transcript 2 Gene Id | ENSG00000232021.10 |
| Transcript 2 Gene Name | LEF1-AS1 |
| Transcript 3 Gene Id | ENSG00000232021.10 |
| Transcript 3 Gene Name | LEF1-AS1 |
| Transcript 4 Gene Id | ENSG00000232021.10 |
| Transcript 4 Gene Name | LEF1-AS1 |
| Transcript 5 Gene Id | ENSG00000232021.10 |
| Transcript 5 Gene Name | LEF1-AS1 |
| Transcript 6 Gene Id | ENSG00000232021.10 |
| Transcript 6 Gene Name | LEF1-AS1 |
| Transcript 7 Gene Id | ENSG00000232021.10 |
| Transcript 7 Gene Name | LEF1-AS1 |
| Transcript 8 Gene Id | ENSG00000232021.10 |
| Transcript 8 Gene Name | LEF1-AS1 |
| Transcript 9 Gene Id | ENSG00000232021.10 |
| Transcript 9 Gene Name | LEF1-AS1 |
| Transcript 10 Gene Id | ENSG00000232021.10 |
| Transcript 10 Gene Name | LEF1-AS1 |
| Transcript 11 Gene Id | ENSG00000232021.10 |
| Transcript 11 Gene Name | LEF1-AS1 |
| Transcript 12 Gene Id | ENSG00000232021.10 |
| Transcript 12 Gene Name | LEF1-AS1 |
| Transcript 13 Gene Id | ENSG00000232021.10 |
| Transcript 13 Gene Name | LEF1-AS1 |
| Transcript 14 Gene Id | ENSG00000232021.10 |
| Transcript 14 Gene Name | LEF1-AS1 |
| Transcript 15 Gene Id | ENSG00000232021.10 |
| Transcript 15 Gene Name | LEF1-AS1 |
| Transcript 16 Gene Id | ENSG00000232021.10 |
| Transcript 16 Gene Name | LEF1-AS1 |
| Transcript 17 Gene Id | ENSG00000232021.10 |
| Transcript 17 Gene Name | LEF1-AS1 |
| Transcript 18 Gene Id | ENSG00000232021.10 |
| Transcript 18 Gene Name | LEF1-AS1 |
| Transcript 19 Gene Id | ENSG00000232021.10 |
| Transcript 19 Gene Name | LEF1-AS1 |
| Transcript 20 Gene Id | ENSG00000232021.10 |
| Transcript 20 Gene Name | LEF1-AS1 |
| Transcript 21 Gene Id | ENSG00000232021.10 |
| Transcript 21 Gene Name | LEF1-AS1 |
| Transcript 22 Gene Id | ENSG00000232021.10 |
| Transcript 22 Gene Name | LEF1-AS1 |
| Transcript 23 Gene Id | ENSG00000232021.10 |
| Transcript 23 Gene Name | LEF1-AS1 |
| Transcript 24 Gene Id | ENSG00000232021.10 |
| Transcript 24 Gene Name | LEF1-AS1 |
| Transcript 25 Gene Id | ENSG00000232021.10 |
| Transcript 25 Gene Name | LEF1-AS1 |
| Transcript 26 Gene Id | ENSG00000232021.10 |
| Transcript 26 Gene Name | LEF1-AS1 |
| Transcript 27 Gene Id | ENSG00000232021.10 |
| Transcript 27 Gene Name | LEF1-AS1 |
| Transcript 28 Gene Id | ENSG00000232021.10 |
| Transcript 28 Gene Name | LEF1-AS1 |
| Transcript 29 Gene Id | ENSG00000232021.10 |
| Transcript 29 Gene Name | LEF1-AS1 |
| Transcript 30 Gene Id | ENSG00000232021.10 |
| Transcript 30 Gene Name | LEF1-AS1 |
| Transcript 31 Gene Id | ENSG00000232021.10 |
| Transcript 31 Gene Name | LEF1-AS1 |
| Transcript 32 Gene Id | ENSG00000232021.10 |
| Transcript 32 Gene Name | LEF1-AS1 |
| Transcript 33 Gene Id | ENSG00000232021.10 |
| Transcript 33 Gene Name | LEF1-AS1 |
| Transcript 34 Gene Id | ENSG00000232021.10 |
| Transcript 34 Gene Name | LEF1-AS1 |
| Transcript 35 Gene Id | ENSG00000295861.1 |
| Transcript 35 Gene Name | ENSG00000295861 |
| AlphaGenome Analysis | |
| Chromosome | chr4 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D