| Basic Information ▶ | |
| VISDB ID | TVIS30001188 |
|---|---|
| Fusion Name | HIV-AASS integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | QiaQuick PCR and Sequencing |
| Wet Assay | No |
| Sample ID | L1 |
| Sample Name | L1 |
| Sample Type | PBMC |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | HIV-infected disease |
| Disease Abbreviation | HID |
| Cancer | No |
| Literature ▶ | |
| PubMed ID | 25011556 |
| Journal | Science |
| Published Year | 2014 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr7 |
| Cytogenetic Band | q31.32 |
| Human Strand | + |
| Human Integration Location Type | Intronic |
| Hg19 Start | 121754906 |
| Hg19 End | 121755681 |
| Hg38 Start | 122114852 |
| Hg38 End | 122114852 |
| Junction Sequence | GAAACATAACAAGACCCCATCTCTAAAGATAAATATATACAATAAAATTTTAAAAAAAAAAGGAGAGATGGTTAACAGTGTTGAGTACTGCCAAGAGGTCAAGAAAGATAAGGCAGAGAAGTAGTCATTAGAAATCAAGTCCTCTGATATGTGATATTTGATCCTCTAATAATGGAAGCAGCTGGTCAAAACTACTATCGTTGCTGAAGTAGAGTCCTTACTTGTGTGGTAATGCAGGGCAGCCTTCCACACCAG |
| Target Gene ▶ | |
| Target Gene | AASS |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Immunodeficiency Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | Not given |
| TaxonomyID | 11676 |
| Virus Abbreviation | HIV |
| Virus Genome | - |
| Virus Genome Length | 9719 |
| Virus Breakpoint1 | - |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000008311.17 |
| Gene Name | AASS |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000679864.1, Transcript 2: ENST00000912145.1, Transcript 3: ENST00000912146.1, Transcript 4: ENST00000417368.7, Transcript 5: ENST00000912147.1, Transcript 6: ENST00000681708.1, Transcript 7: ENST00000679511.1, Transcript 8: ENST00000679579.1, Transcript 9: ENST00000679847.1, Transcript 10: ENST00000681434.1, Transcript 11: ENST00000881844.1, Transcript 12: ENST00000681314.1, Transcript 13: ENST00000881845.1, Transcript 14: ENST00000962616.1, Transcript 15: ENST00000393376.5, Transcript 16: ENST00000473553.5, Transcript 17: ENST00000912149.1, Transcript 18: ENST00000912148.1, Transcript 19: ENST00000358954.6, Transcript 20: ENST00000431170.5, Transcript 21: ENST00000679402.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.010 | Acceptor Loss: 0.030 | Donor Gain: 0.020 | Donor Loss: 0.020 |
| Delta Score Max | 0.030 |
| Delta Position at Max | -435 |
| Delta Score Flag | LOW |
| Gene | AASS |
| AlphaGenome Analysis | |
| Window | chr7:122049316-122180388 |
| RNA-seq Change (±2kb) | Mean: -0.019608881324529648 | Peak: 8.4869384765625 |
| ATAC Change (±2kb) | Mean: 0.00020232702081557363 | Peak: 1.164027214050293 |
| Interpretation | RNA-seq: DECREASED 20.3% (REF=0.10, ALT=0.08) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 0.8% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D