| Basic Information ▶ | |
| VISDB ID | TVIS30001306 |
|---|---|
| Fusion Name | HIV-ZBTB21 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | QiaQuick PCR and Sequencing |
| Wet Assay | No |
| Sample ID | R1 |
| Sample Name | R1 |
| Sample Type | PBMC |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | HIV-infected disease |
| Disease Abbreviation | HID |
| Cancer | No |
| Literature ▶ | |
| PubMed ID | 25011556 |
| Journal | Science |
| Published Year | 2014 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr21 |
| Cytogenetic Band | q22.3 |
| Human Strand | + |
| Human Integration Location Type | UTR3 |
| Hg19 Start | 43410654 |
| Hg19 End | 43411591 |
| Hg38 Start | 41990545 |
| Hg38 End | 41990545 |
| Junction Sequence | GACAGTATTCCACTAATCAATAAAAAACCAAAAACCTCAATTAAATGATTATACTGACACCATGGAATGAGGAACCATGCACACAATCAAGACTAATCCAATTTCAACATTAATGAAATCAAACCATCTTGTTCTTGTAAGGTCCAGAACCACAATATTTTAAAAGCTGTATTTCTAAAGTTAAGGACATTACTAAGTAATTATCAATTTGCCTCCAACTTAATTTCAAGCGTAACAATCTCCAACCTTTATTAT |
| Target Gene ▶ | |
| Target Gene | ZBTB21 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Immunodeficiency Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | Not given |
| TaxonomyID | 11676 |
| Virus Abbreviation | HIV |
| Virus Genome | - |
| Virus Genome Length | 9719 |
| Virus Breakpoint1 | - |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D