Basic Information ▶ | |
VISDB ID | TVIS42000001 |
---|---|
Fusion Name | EBV-BACH2 integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | de novo assembly of RNA-seq reads |
Wet Assay | No |
Sample ID | Raji |
Sample Name | Raji |
Sample Type | Cell line |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | B-cell lymphoma |
Disease Abbreviation | BCL |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 25355872 |
Journal | Journal of Virology |
Published Year | 2015 |
Human Genome ▶ | |
Human Genome Version Description | GRCh37/hg19 |
Human Genome RefSeq Accession | GCF_000001405.13 |
Human Chromosome | chr6 |
Cytogenetic Band | q15 |
Human Strand | |
Human Integration Location Type | Intronic |
Hg19 Start | 91004306 |
Hg19 End | 91005711 |
Hg38 Start | 90294587 |
Hg38 End | 90295992 |
Junction Sequence | GGCAATCTCTCTTACAGACTAAAGACTAATTCTAACAAGATGTCATTTTGACTCACGTTTATTATTACCTGCAAGAATGAAAAACGCCGTTTACTCGGGAGGTGCCCGAGAACCAGGGTGGGGCGATCTCACATTTTAAGCAAGACGCCCGCTGCCTTACCAAAATAGCCCTCTCCGCCAAAGGAGGGGCAGCCTTTCACGCTCAGCTTCTTTCATGTCAGCCCGAGCCTTTGCAGCAAGACGTGCCTTTCCTAC |
Target Gene ▶ | |
Target Gene | ENSG00000260271, BACH2 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Epstein-Barr Virus |
Virus Subtype Name | - |
Virus Genome Accession | KC207813 |
TaxonomyID | 10376 |
Virus Abbreviation | EBV |
Virus Genome | Human herpesvirus 4 strain Akata, complete genome |
Virus Genome Length | 171323 |
Virus Breakpoint1 | - |
Virus Breakpoint2 | - |
Virus Gene Name | - |
Virus Region Type | - |
Integrated Virus Sequence | - |
ViMIC ID | - |