| Basic Information ▶ | |
| VISDB ID | TVIS42001102 |
|---|---|
| Fusion Name | EBV-chr20:p12.3 integration |
| Validated | No |
| Curated Way | VISDB1.0 |
| Method | GenCap Enrichment+Illumina HiSeq 2000 |
| Wet Assay | No |
| Sample ID | HLT002 |
| Sample Name | HLT002 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hodgkin lymphoma |
| Disease Abbreviation | - |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 30867819 |
| Journal | Journal of Virology |
| Published Year | 2015 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr20 |
| Cytogenetic Band | p12.3 |
| Human Strand | + |
| Human Integration Location Type | Intergenic |
| Hg19 Start | 7411633 |
| Hg19 End | 7411633 |
| Hg38 Start | 7430986 |
| Hg38 End | 7430986 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Epstein-Barr Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC007605 |
| TaxonomyID | 10376 |
| Virus Abbreviation | EBV |
| Virus Genome | Human gammaherpesvirus 4, complete genome |
| Virus Genome Length | 171823 |
| Virus Breakpoint1 | 98547 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | GTTTTCTCCCCCAGATCACGGCTGTCTAGACGCGTGGGCCTCCCAGGGGGTGTTGCTACTCAACACCATCCTGACCGTGCAAAAGGGCAAGCCCGGCTCG| |CACGCAGACATTGGCTGGGCGTGGTTTACTGACCACGTAATTTCATTGCTCTCTGAGCGGTTAAAAGCGTGCGTGTTTATGCTGTGGGGTGCGAAGGCGG |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D