| Basic Information ▶ | |
| VISDB ID | TVIS42001140 |
|---|---|
| Fusion Name | EBV-chr2:p13 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Real-time PC |
| Wet Assay | Yes |
| Sample ID | NAB-2 |
| Sample Name | NAB-2 |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | B-cell lymphoma |
| Disease Abbreviation | BCL |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 15241441 |
| Journal | Journal of Cancer |
| Published Year | 2016 |
| Human Genome ▶ | |
| Human Genome Version Description | AC009970 |
| Human Genome RefSeq Accession | AC009970 |
| Human Chromosome | chr2 |
| Cytogenetic Band | p13 |
| Human Strand | |
| Human Integration Location Type | intergenic |
| Hg19 Start | 113504 |
| Hg19 End | - |
| Hg38 Start | - |
| Hg38 End | - |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Epstein-Barr Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | V01555 |
| TaxonomyID | 10376 |
| Virus Abbreviation | EBV |
| Virus Genome | Epstein-Barr virus (EBV) genome, strain B95-8 |
| Virus Genome Length | 172281 |
| Virus Breakpoint1 | 172250 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | CGTGACCAAGGGGCCCGTGGGTGACACAGGCAACCCTGACAAAGGCCCCCCAGGAAAGACCCCCGGGGGGCATCGGGGGGGGTGTTGGCGGGGGCATGGG| |GGGGTCGGATTTCGCCCTTATTGCCCTGTTT |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D