| Basic Information ▶ | |
| VISDB ID | TVIS42001142 |
|---|---|
| Fusion Name | EBV-BACH2 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Inverse nested PCR (invPCR) |
| Wet Assay | Yes |
| Sample ID | Raji |
| Sample Name | Raji |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | B-cell lymphoma |
| Disease Abbreviation | BCL |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 14982850 |
| Journal | Leukemia |
| Published Year | 2018 |
| Human Genome ▶ | |
| Human Genome Version Description | AL159164 |
| Human Genome RefSeq Accession | AL159164 |
| Human Chromosome | chr6 |
| Cytogenetic Band | q15 |
| Human Strand | |
| Human Integration Location Type | intron1 |
| Hg19 Start | 59672 |
| Hg19 End | - |
| Hg38 Start | - |
| Hg38 End | - |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Epstein-Barr Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | M80517 |
| TaxonomyID | 10376 |
| Virus Abbreviation | EBV |
| Virus Genome | Epstein-Barr virus, artifactual joining of B95-8 complete genome and the sequences from Raji of the large deletion found in B95-8 |
| Virus Genome Length | 184113 |
| Virus Breakpoint1 | 129728 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | GATGCCATCAACCAGCTGGAGCTCTGCCGGGTTGACACCCTCAACCCCCGAGTAGCCGGACGCCTAGCCTCCTCCCTCTACGTGTACGTTGATCCGGCCT| |ATACCAACAACACATCCGCATCAGGCACCGGAATCGCCGCCGTGACTCACGACAGGGCGGACCCTAACAGGGTCATCGTCCTGGGCCTGGAACACTTCTT |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D