| Basic Information ▶ | |
| VISDB ID | TVIS42001638 |
|---|---|
| Fusion Name | EBV-chr2:155301933 integration |
| Validated | No |
| Curated Way | Curated |
| Method | EBV capture sequencing, followed by Viral Integration Pathway Analysis (VIPA) pipeline |
| Wet Assay | No |
| Sample ID | SRR8574905.1 |
| Sample Name | SRP185895 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Multiple |
| Disease Abbreviation | - |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr2 |
| Cytogenetic Band | q24.1 |
| Human Strand | + |
| Human Integration Location Type | intergenic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 155301933 |
| Hg38 End | 155301933 |
| Junction Sequence | CCCCCCCCACTGGCTCTCCCCCCTTGGCGGTCGTGTAGGTACTGACCCCCTTGAGTAGTTAAGCTTTCAGATATCATAATGAGGCTCACTTTTTCTTCTG |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | MTND4P28 |
| Distance | 9090 |
| Virus Information ▶ | |
| Virus Name | Epstein-Barr Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_007605 |
| TaxonomyID | 10376 |
| Virus Abbreviation | EBV |
| Virus Genome | Human gammaherpesvirus 4, complete genome |
| Virus Genome Length | 171823 bp |
| Virus Breakpoint1 | 124398 |
| Virus Breakpoint2 | - |
| Virus Gene Name | BcLF1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D