Basic Information ▶ | |
VISDB ID | TVIS43000011 |
---|---|
Fusion Name | MCV-chrY:q12 integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | Detection of integrated papilloma sequences & PCR (DIPS-PCR) |
Wet Assay | Yes |
Sample ID | 10 |
Sample Name | 10 |
Sample Type | Tumor |
Age | 83 |
Gender | - |
Disease Information ▶ | |
Disease Name | Merkel cell carcinoma |
Disease Abbreviation | MCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 19291712 |
Journal | Journal of Pathology |
Published Year | 2009 |
Human Genome ▶ | |
Human Genome Version Description | NCBI36/hg18 |
Human Genome RefSeq Accession | GCF_000001405.12 |
Human Chromosome | chrY |
Cytogenetic Band | q12 |
Human Strand | |
Human Integration Location Type | - |
Hg19 Start | - |
Hg19 End | - |
Hg38 Start | - |
Hg38 End | - |
Junction Sequence | - |
Target Gene ▶ | |
Target Gene | - |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Merkel cell polyomavirus |
Virus Subtype Name | - |
Virus Genome Accession | EU375803 |
TaxonomyID | 493803 |
Virus Abbreviation | MCV |
Virus Genome | Merkel cell polyomavirus isolate MCC350, complete genome |
Virus Genome Length | 5387 |
Virus Breakpoint1 | 2980 |
Virus Breakpoint2 | - |
Virus Gene Name | - |
Virus Region Type | - |
Integrated Virus Sequence | ATACAACCTTTAAGCCTTGCTTACAAGAAGAAATTAAAAACTGGAAGCAAATTTTACAGAGTGAAATATCATATGGTAAATTTTGTCAAATGATAGAAAA| |TGTAGAAGCTGGTCAGGACCCTCTGCTCAATATTCTTATTGAGGAAGAGGGCCCTGAGGAAACTGAGGAAACCCAAGATTCTGGTACTTTTTCTCAATAA |
ViMIC ID | - |