Basic Information ▶ | |
VISDB ID | TVIS43000016 |
---|---|
Fusion Name | MCV-chr8 integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | PCR and Sanger sequencing |
Wet Assay | Yes |
Sample ID | 12 |
Sample Name | 12 |
Sample Type | Tumor |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | Merkel cell carcinoma |
Disease Abbreviation | MCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 21497292 |
Journal | Journal of Molecular Diagnostics |
Published Year | 2011 |
Human Genome ▶ | |
Human Genome Version Description | NCBI36/hg18 |
Human Genome RefSeq Accession | GCF_000001405.12 |
Human Chromosome | chr8 |
Cytogenetic Band | - |
Human Strand | |
Human Integration Location Type | - |
Hg19 Start | 65568962 |
Hg19 End | 65566806 |
Hg38 Start | 64491695 |
Hg38 End | 64493851 |
Junction Sequence | gacatttatgacaaacccacagccaatatcataccgagtgggcaaaaactggaagcactccctataaaaaccagcacaagacaaggataccctctctcaccacttttattcaacatagtattggaagttctggccagggcaatcaggcaagagaaagaaataaagggtattcaaataggaaaagagaaagtcaaattgtctctatttgcagatgacatgattgtatatttggaaaactccattgtctcagcccaa |
Target Gene ▶ | |
Target Gene | - |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Merkel cell polyomavirus |
Virus Subtype Name | - |
Virus Genome Accession | NC_010277 |
TaxonomyID | 493803 |
Virus Abbreviation | MCV |
Virus Genome | Merkel cell polyomavirus isolate R17b, complete genome |
Virus Genome Length | 5387 |
Virus Breakpoint1 | - |
Virus Breakpoint2 | - |
Virus Gene Name | - |
Virus Region Type | - |
Integrated Virus Sequence | - |
ViMIC ID | - |