| Basic Information ▶ | |
| VISDB ID | TVIS43000017 |
|---|---|
| Fusion Name | MCV-chr8 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | 23 |
| Sample Name | 23 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Merkel cell carcinoma |
| Disease Abbreviation | MCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 21497292 |
| Journal | Journal of Molecular Diagnostics |
| Published Year | 2011 |
| Human Genome ▶ | |
| Human Genome Version Description | NCBI36/hg18 |
| Human Genome RefSeq Accession | GCF_000001405.12 |
| Human Chromosome | chr8 |
| Cytogenetic Band | - |
| Human Strand | |
| Human Integration Location Type | - |
| Hg19 Start | 65568962 |
| Hg19 End | 65566806 |
| Hg38 Start | 64491695 |
| Hg38 End | 64493851 |
| Junction Sequence | gacatttatgacaaacccacagccaatatcataccgagtgggcaaaaactggaagcactccctataaaaaccagcacaagacaaggataccctctctcaccacttttattcaacatagtattggaagttctggccagggcaatcaggcaagagaaagaaataaagggtattcaaataggaaaagagaaagtcaaattgtctctatttgcagatgacatgattgtatatttggaaaactccattgtctcagcccaa |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Merkel cell polyomavirus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_010277 |
| TaxonomyID | 493803 |
| Virus Abbreviation | MCV |
| Virus Genome | Merkel cell polyomavirus isolate R17b, complete genome |
| Virus Genome Length | 5387 |
| Virus Breakpoint1 | - |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |