| Basic Information ▶ | |
| VISDB ID | TVIS43000039 |
|---|---|
| Fusion Name | MCV-OFCC1 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Rapid amplification of cDNA ends |
| Wet Assay | Yes |
| Sample ID | MCC345 |
| Sample Name | MCC345 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Merkel cell carcinoma |
| Disease Abbreviation | MCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 23085629 |
| Journal | J Virol Methods |
| Published Year | 2013 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37.p5 |
| Human Genome RefSeq Accession | GCF_000001405.17 |
| Human Chromosome | chr6 |
| Cytogenetic Band | p24.3 |
| Human Strand | |
| Human Integration Location Type | Intron6 |
| Hg19 Start | 9842760 |
| Hg19 End | 9842760 |
| Hg38 Start | 9842527 |
| Hg38 End | 9842527 |
| Junction Sequence | AAAGCACAGCAGGCAGCTGGGTCAATACAATTGATCTCATCGTTTAACATTTTGCATCAGAGAAAAAGTCAGTGGCAAGAGCCTCACCTTCCAGCGGGG |
| Target Gene ▶ | |
| Target Gene | ENSG00000293385, OFCC1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Merkel cell polyomavirus |
| Virus Subtype Name | - |
| Virus Genome Accession | EU375803 |
| TaxonomyID | 493803 |
| Virus Abbreviation | MCV |
| Virus Genome | Merkel cell polyomavirus isolate MCC350, complete genome |
| Virus Genome Length | 5387 |
| Virus Breakpoint1 | 1836 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | TTATTGTTTATAACTTTATCAAAGCATAGAGTATTTGCTATTAAGAATTTTTGCTCTACCTTCTGCACTATAAGCTTTTTAATTTGTAAAGGAGTGAATA| |AGATGCCTGAAATGTATAATAATTTATGCAAGCCCCCTTACAAATTACTGCAAGAGAATAAGCCACTGCTCAATTATGAATTTCAAGAAAAAGAAAAAGA |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D