| Basic Information ▶ | |
| VISDB ID | TVIS43000045 |
|---|---|
| Fusion Name | MCV-PTP4A2 integration |
| Validated | No |
| Curated Way | VISDB1.0 |
| Method | de novo assembly of RNA-seq reads |
| Wet Assay | No |
| Sample ID | Tumor-076 |
| Sample Name | Tumor-076 |
| Sample Type | Tumor |
| Age | 82 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Merkel cell carcinoma |
| Disease Abbreviation | MCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 28049147 |
| Journal | MBio |
| Published Year | 2017 |
| Human Genome ▶ | |
| Human Genome Version Description | hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr1 |
| Cytogenetic Band | p35.2 |
| Human Strand | |
| Human Integration Location Type | Intronic |
| Hg19 Start | 31940936 |
| Hg19 End | 31941056 |
| Hg38 Start | 31468089 |
| Hg38 End | 31468209 |
| Junction Sequence | caggttgtcagtggcctctgtgcttttgggtatttctaaggctatgcccttgtttacactgacaaaaagatggaatggctgcttaaggagggtaaagctaggatggggcagttactaata |
| Target Gene ▶ | |
| Target Gene | ENSG00000305880 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Merkel cell polyomavirus |
| Virus Subtype Name | - |
| Virus Genome Accession | HM355825.1 |
| TaxonomyID | 493803 |
| Virus Abbreviation | MCV |
| Virus Genome | Merkel cell polyomavirus isolate MCVw156, complete genome |
| Virus Genome Length | 5386 |
| Virus Breakpoint1 | - |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D