Basic Information ▶ | |
VISDB ID | TVIS43000051 |
---|---|
Fusion Name | MCV-CDKAL1 integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | Detection of integrated papilloma sequences & PCR (DIPS-PCR) |
Wet Assay | Yes |
Sample ID | WaGa |
Sample Name | WaGa |
Sample Type | Cell line |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | Merkel cell carcinoma |
Disease Abbreviation | MCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 30873613 |
Journal | International Journal of Cancer |
Published Year | 2019 |
Human Genome ▶ | |
Human Genome Version Description | GRCh38 |
Human Genome RefSeq Accession | GCF_000001405.38 |
Human Chromosome | chr6 |
Cytogenetic Band | p22.2 |
Human Strand | |
Human Integration Location Type | Intron4 |
Hg19 Start | 20635170 |
Hg19 End | 20635170 |
Hg38 Start | 20635170 |
Hg38 End | 20635170 |
Junction Sequence | - |
Target Gene ▶ | |
Target Gene | CDKAL1 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Merkel cell polyomavirus |
Virus Subtype Name | - |
Virus Genome Accession | EU375803 |
TaxonomyID | 493803 |
Virus Abbreviation | MCV |
Virus Genome | Merkel cell polyomavirus isolate MCC350, complete genome |
Virus Genome Length | 5387 |
Virus Breakpoint1 | 4078 |
Virus Breakpoint2 | 2067 |
Virus Gene Name | - |
Virus Region Type | - |
Integrated Virus Sequence | GCCTCAAACCTCACAAGGCTCATGAGGCTCATCATTCTAATGCTAAGCTATTTTATGAATCTAAATCTCAGAAAACCATTTGCCAACAAGCCGCAGACACTGTTCTAGCCAAAAGGAGGTTAGAGATGCTGGAAATGACCAGGACAGAAATGCTATGTAAGAAGTTTAAGAAGCACCTAGAGAGATTAAGAGATTTAGATACAATAGATCTACTGTATTATATGGGTGGTGTGGCCTGGTACTGCTGCTTATTTG |
ViMIC ID | - |