| Basic Information ▶ | |
| VISDB ID | TVIS43000053 |
|---|---|
| Fusion Name | MCV-CASZ1 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Detection of integrated papilloma sequences & PCR (DIPS-PCR) |
| Wet Assay | Yes |
| Sample ID | BroLi |
| Sample Name | BroLi |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Merkel cell carcinoma |
| Disease Abbreviation | MCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 30873613 |
| Journal | International Journal of Cancer |
| Published Year | 2019 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38 |
| Human Genome RefSeq Accession | GCF_000001405.38 |
| Human Chromosome | chr1 |
| Cytogenetic Band | p36.22 |
| Human Strand | |
| Human Integration Location Type | Intron1 |
| Hg19 Start | 10790267 |
| Hg19 End | 10790267 |
| Hg38 Start | 10790267 |
| Hg38 End | 10790267 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | CASZ1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Merkel cell polyomavirus |
| Virus Subtype Name | - |
| Virus Genome Accession | EU375803 |
| TaxonomyID | 493803 |
| Virus Abbreviation | MCV |
| Virus Genome | Merkel cell polyomavirus isolate MCC350, complete genome |
| Virus Genome Length | 5387 |
| Virus Breakpoint1 | 5043 |
| Virus Breakpoint2 | 1529 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | AAGCTAAAAAACAACAGAGAAACTCCTGTTCCTACTAATTTTCCTATTGATGTTTCTGATTATCTTAGCCATGCTGTATATAGTAATAAAACAGTAAGTTGTTTTGCCATTTATACTACTTCTGATAAAGCTATAGAGTTATATGATAAGATTGAGAAATTTAAAGTTGATTTTAAAAGCAGGCATGCCTGTGAATTAGGATGTATTTTATTGTTTATAACTTTATCAAAGCATAGAGTATTTGCTATTAAGAAT |
| ViMIC ID | - |