| Basic Information ▶ | |
| VISDB ID | TVIS46000416 |
|---|---|
| Fusion Name | BKPyv-IQCE integration |
| Validated | No |
| Curated Way | Curated |
| Method | Virome capture next-generation sequencing |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | Case16_blood |
| Sample Type | Tumor |
| Age | - |
| Gender | Male |
| Disease Information ▶ | |
| Disease Name | Urothelial carcinoma |
| Disease Abbreviation | UC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 37507072 |
| Journal | American Journal of Transplantation |
| Published Year | 2023 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr7 |
| Cytogenetic Band | p22.3 |
| Human Strand | + |
| Human Integration Location Type | exonic |
| Hg19 Start | 2653515 |
| Hg19 End | 2653515 |
| Hg38 Start | 2613881 |
| Hg38 End | 2613881 |
| Junction Sequence | ACTGCATACTCAGTAATTAATTTCCAAGACACCTGCTTTGTTTCTTCAGGCTCTTCTGGGTTAAAATCATGCTCCTTTAAGCCCCACCTGACTGAGACTAGCGGGCAGAGCCAAGCAGGGCTAAACTCCAACCCAGGGC |
| Target Gene ▶ | |
| Target Gene | IQCE, ENSG00000289352 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | BK polyomavirus |
| Virus Subtype Name | Genotype I, IV |
| Virus Genome Accession | AB217921.1 |
| TaxonomyID | 1417981 |
| Virus Abbreviation | BKPyV |
| Virus Genome | BK polyomavirus DNA, complete genome, isolate: THK-9a |
| Virus Genome Length | 5142 bp |
| Virus Breakpoint1 | 3934 |
| Virus Breakpoint2 | - |
| Virus Gene Name | AB217921.1_large_T |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000623361.3, Transcript 2: ENST00000402050.7, Transcript 3: ENST00000849074.1, Transcript 4: ENST00000849076.1 |
| Transcript 1 Gene Id | ENSG00000106012.20 |
| Transcript 1 Gene Name | IQCE |
| Transcript 1 Region | 3UTR |
| Transcript 1 Impact | noncoding_exon_insertion |
| Transcript 2 Gene Id | ENSG00000106012.20 |
| Transcript 2 Gene Name | IQCE |
| Transcript 2 Region | 3UTR |
| Transcript 2 Impact | noncoding_exon_insertion |
| Transcript 3 Gene Id | ENSG00000289352.3 |
| Transcript 3 Gene Name | ENSG00000289352 |
| Transcript 3 Region | intron |
| Transcript 3 Impact | intronic_insertion |
| Transcript 4 Gene Id | ENSG00000289352.3 |
| Transcript 4 Gene Name | ENSG00000289352 |
| Transcript 4 Region | intron |
| Transcript 4 Impact | intronic_insertion |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.010 | Acceptor Loss: 0.020 | Donor Gain: 0.010 | Donor Loss: 0.010 |
| Delta Score Max | 0.020 |
| Delta Position at Max | -733 |
| Delta Score Flag | LOW |
| Gene | IQCE |
| AlphaGenome Analysis | |
| Window | chr7:2548345-2679417 |
| RNA-seq Change (±2kb) | Mean: -0.003010770073160529 | Peak: 2.19622802734375 |
| ATAC Change (±2kb) | Mean: 0.00782709289342165 | Peak: 18.52197265625 |
| Interpretation | RNA-seq: minimal change -2.8% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: INCREASED 10.8% (REF=0.07, ALT=0.08) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D