| Basic Information ▶ | |
| VISDB ID | TVIS46000421 |
|---|---|
| Fusion Name | BKPyv-AGBL4 integration |
| Validated | No |
| Curated Way | Curated |
| Method | Virome capture next-generation sequencing |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | Case16_blood |
| Sample Type | Tumor |
| Age | - |
| Gender | Male |
| Disease Information ▶ | |
| Disease Name | Urothelial carcinoma |
| Disease Abbreviation | UC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 37507072 |
| Journal | American Journal of Transplantation |
| Published Year | 2023 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr1 |
| Cytogenetic Band | p33 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 50255162 |
| Hg19 End | 50255162 |
| Hg38 Start | 49789490 |
| Hg38 End | 49789490 |
| Junction Sequence | CACTGTAGGCCTCTATCAGCAATCAGGCATGGCTTTGGAATTGTTTAACCCAGATGAGTACTATGATATTTTGTTTCCTGGTGTAAATACTTTTGTAAATAATATTCAATATTGAGACTTTGCTGAAGTTGCTTATCAGCT |
| Target Gene ▶ | |
| Target Gene | AGBL4 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | BK polyomavirus |
| Virus Subtype Name | Genotype I, IV |
| Virus Genome Accession | AB217921.1 |
| TaxonomyID | 1417981 |
| Virus Abbreviation | BKPyV |
| Virus Genome | BK polyomavirus DNA, complete genome, isolate: THK-9a |
| Virus Genome Length | 5142 bp |
| Virus Breakpoint1 | 942 |
| Virus Breakpoint2 | - |
| Virus Gene Name | AB217921.1_VP2;AB217921.1_VP3 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000186094.18 |
| Gene Name | AGBL4 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000371839.6, Transcript 2: ENST00000371838.5, Transcript 3: ENST00000371836.1, Transcript 4: ENST00000497451.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.000 |
| Delta Position at Max | 866 |
| Delta Score Flag | LOW |
| Gene | AGBL4 |
| AlphaGenome Analysis | |
| Window | chr1:49723954-49855026 |
| RNA-seq Change (±2kb) | Mean: 0.00018250156426802278 | Peak: 0.050537109375 |
| ATAC Change (±2kb) | Mean: -0.0002195711713284254 | Peak: 0.625 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -1.5% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D