| Basic Information ▶ | |
| VISDB ID | TVIS46000481 |
|---|---|
| Fusion Name | BKPyv-ENSG00000251095 integration |
| Validated | No |
| Curated Way | Curated |
| Method | Virome capture next-generation sequencing |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | Case9_blood |
| Sample Type | Tumor |
| Age | - |
| Gender | Female |
| Disease Information ▶ | |
| Disease Name | Urothelial carcinoma |
| Disease Abbreviation | UC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 37507072 |
| Journal | American Journal of Transplantation |
| Published Year | 2023 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr4 |
| Cytogenetic Band | q22.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 90618956 |
| Hg19 End | 90618956 |
| Hg38 Start | 89697805 |
| Hg38 End | 89697805 |
| Junction Sequence | TCATCTTCACTATGGGGGTCTAGCCTTTGGGAATCTTCAGCAGGGGCTGAAGTATCTGAGACTTGGGAAGAGCATTGTGATTGTGATTCAGTGCTTGATCCATGTCCAGAGTCTTCAGTTTCTGAATCTTCTTCTCTTGAAGAATTATTTCTTAGTGAGCTATCATCATTTTTGTACA |
| Target Gene ▶ | |
| Target Gene | ENSG00000251095, ENSG00000288563 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | BK polyomavirus |
| Virus Subtype Name | Genotype I, IV |
| Virus Genome Accession | AB217919.1 |
| TaxonomyID | 1417981 |
| Virus Abbreviation | BKPyV |
| Virus Genome | BK polyomavirus DNA, complete genome, isolate: TW-3a |
| Virus Genome Length | 5146 bp |
| Virus Breakpoint1 | 2800 |
| Virus Breakpoint2 | - |
| Virus Gene Name | AB217919.1_large T |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000776682.1, Transcript 2: ENST00000659878.1, Transcript 3: ENST00000776683.1, Transcript 4: ENST00000508021.5, Transcript 5: ENST00000776684.1, Transcript 6: ENST00000507916.6, Transcript 7: ENST00000776694.1, Transcript 8: ENST00000691837.2, Transcript 9: ENST00000689416.2, Transcript 10: ENST00000776700.1, Transcript 11: ENST00000776699.1, Transcript 12: ENST00000776695.1, Transcript 13: ENST00000673949.1 |
| Transcript 1 Gene Id | ENSG00000251095.9 |
| Transcript 1 Gene Name | ENSG00000251095 |
| Transcript 2 Gene Id | ENSG00000251095.9 |
| Transcript 2 Gene Name | ENSG00000251095 |
| Transcript 3 Gene Id | ENSG00000251095.9 |
| Transcript 3 Gene Name | ENSG00000251095 |
| Transcript 4 Gene Id | ENSG00000251095.9 |
| Transcript 4 Gene Name | ENSG00000251095 |
| Transcript 5 Gene Id | ENSG00000251095.9 |
| Transcript 5 Gene Name | ENSG00000251095 |
| Transcript 6 Gene Id | ENSG00000251095.9 |
| Transcript 6 Gene Name | ENSG00000251095 |
| Transcript 7 Gene Id | ENSG00000251095.9 |
| Transcript 7 Gene Name | ENSG00000251095 |
| Transcript 8 Gene Id | ENSG00000251095.9 |
| Transcript 8 Gene Name | ENSG00000251095 |
| Transcript 9 Gene Id | ENSG00000251095.9 |
| Transcript 9 Gene Name | ENSG00000251095 |
| Transcript 10 Gene Id | ENSG00000251095.9 |
| Transcript 10 Gene Name | ENSG00000251095 |
| Transcript 11 Gene Id | ENSG00000251095.9 |
| Transcript 11 Gene Name | ENSG00000251095 |
| Transcript 12 Gene Id | ENSG00000251095.9 |
| Transcript 12 Gene Name | ENSG00000251095 |
| Transcript 13 Gene Id | ENSG00000288563.1 |
| Transcript 13 Gene Name | ENSG00000288563 |
| AlphaGenome Analysis | |
| Window | chr4:89632269-89763341 |
| RNA-seq Change (±2kb) | Mean: 0.00011272541451035067 | Peak: 0.13525390625 |
| ATAC Change (±2kb) | Mean: 0.0003759156388696283 | Peak: 0.980468213558197 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 1.6% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D