| Basic Information ▶ | |
| VISDB ID | TVIS46000977 |
|---|---|
| Fusion Name | BKPyV-chr20:23696849 integration |
| Validated | No |
| Curated Way | Curated |
| Method | Virome capture next-generation sequencing |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | Case9_blood |
| Sample Type | Tumor |
| Age | - |
| Gender | Female |
| Disease Information ▶ | |
| Disease Name | Urothelial carcinoma |
| Disease Abbreviation | UC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 37507072 |
| Journal | American Journal of Transplantation |
| Published Year | 2023 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr20 |
| Cytogenetic Band | p11.21 |
| Human Strand | + |
| Human Integration Location Type | intergenic |
| Hg19 Start | 23677486 |
| Hg19 End | 23677486 |
| Hg38 Start | 23696849 |
| Hg38 End | 23696849 |
| Junction Sequence | TATATTTAGAAAACCCCATCGACTCAACCCAAAATCTCCTTAAGGTGAGAAGCAACTTCAGCAAAGTCTCAGGATACAAAATCCTCCTCAAACATATGCTGTAATTGCTGGTGCTCCAGGGGCTATTGCTGGGTTTGCTG |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | CST4 |
| Distance | 7811 |
| Virus Information ▶ | |
| Virus Name | BK polyomavirus |
| Virus Subtype Name | Genotype I, IV |
| Virus Genome Accession | AB217919.1 |
| TaxonomyID | 1417981 |
| Virus Abbreviation | BKPyV |
| Virus Genome | BK polyomavirus DNA, complete genome, isolate: TW-3a |
| Virus Genome Length | 5146 bp |
| Virus Breakpoint1 | 695 |
| Virus Breakpoint2 | - |
| Virus Gene Name | AB217919.1_VP2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D