| Basic Information ▶ | |
| VISDB ID | TVIS46001104 |
|---|---|
| Fusion Name | BKPyv-LINC02484 integration |
| Validated | No |
| Curated Way | Curated |
| Method | Whole genome and Virus Capture sequencing |
| Wet Assay | Yes |
| Sample ID | 18R011047 |
| Sample Name | Case2 |
| Sample Type | Tumor |
| Age | 76 |
| Gender | Female |
| Disease Information ▶ | |
| Disease Name | Bladder Cancer |
| Disease Abbreviation | BC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 33051598 |
| Journal | Oncogene |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr4 |
| Cytogenetic Band | p15.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 34191611 |
| Hg19 End | 34191611 |
| Hg38 Start | 34189989 |
| Hg38 End | 34189989 |
| Junction Sequence | TTTTTACTTATGTAAATTTCTGCAGCATGCTTGAATCCCTGCCCCAAAAATGGGTTTTCCTTTTCTACCACATCATCAGGCTCTTCTGGGTTAAAATCATGCTCCTTTAAGCCCCCTTGAATGCTTTCTTCTATTG |
| Target Gene ▶ | |
| Target Gene | LINC02484 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | BK polyomavirus |
| Virus Subtype Name | - |
| Virus Genome Accession | AB211369.1 |
| TaxonomyID | 1417981 |
| Virus Abbreviation | BKPyV |
| Virus Genome | BK polyomavirus DNA, complete genome, isolate: Dik |
| Virus Genome Length | 5141 bp |
| Virus Breakpoint1 | 3897 |
| Virus Breakpoint2 | - |
| Virus Gene Name | AB211369.1_large T |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000248685.7 |
| Gene Name | LINC02484 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000513843.7, Transcript 2: ENST00000658479.1, Transcript 3: ENST00000758395.1, Transcript 4: ENST00000758394.1, Transcript 5: ENST00000514877.2, Transcript 6: ENST00000656859.1, Transcript 7: ENST00000758396.1 |
| AlphaGenome Analysis | |
| Window | chr4:34124453-34255525 |
| RNA-seq Change (±2kb) | Mean: -2.198671063524671e-05 | Peak: 0.018798828125 |
| ATAC Change (±2kb) | Mean: -0.00112056580837816 | Peak: 3.359374523162842 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -3.9% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D