Virus Integration Site Database Data Release 2.0

Details for VISDB ID: TVIS46001368

Genomic Region Visualization (IGV)

Basic Information ▶
VISDB IDTVIS46001368
Fusion NameBKPyv-ENSG00000295935 integration
ValidatedNo
Curated WayCurated
MethodVirome capture next-generation sequencing
Wet AssayYes
Sample ID-
Sample NameCase2_primary
Sample TypeTumor
Age-
Gender-
Disease Information ▶
Disease NameUrothelial Carcinoma
Disease AbbreviationUC
CancerYes
Literature ▶
PubMed ID32724161
JournalOncogene
Published Year2020
Human Genome ▶
Human Genome Version DescriptionGRCh37/hg19
Human Genome RefSeq AccessionGCF_000001405.13
Human Chromosomechr5
Cytogenetic Bandq33.3
Human Strand+
Human Integration Location Typeintronic
Hg19 Start157286753
Hg19 End157286753
Hg38 Start157859745
Hg38 End157859745
Junction SequenceTCCTTTTCCGCTCTAATTCTATGATACAATGTTTTATATTTAGACAACTACCTGAAATCCTTGTTAAATGCTTTACTATAAACCTCAGAAACTCAGTTCACACTCCACACCACCCAAGAAAAAGAGAAAGGTAGAAGACCCTAAAGACTTTCCTTCTGATCTACACCAGTT
Target Gene ▶
Target GeneENSG00000295935
Nearby Gene-
Distance-
Virus Information ▶
Virus NameBK polyomavirus
Virus Subtype Name-
Virus Genome AccessionDQ989813.1
TaxonomyID1417981
Virus AbbreviationBKPyV
Virus GenomeBK polyomavirus isolate PittNP1, complete coding regions
Virus Genome Length4766 bp
Virus Breakpoint14053
Virus Breakpoint2-
Virus Gene NameDQ989813.1_large T
Virus Region Type-
Integrated Virus Sequence-
ViMIC ID-
Predicted VIS Effect ▶
TranscriptTranscript 1: ENST00000523094.5, Transcript 2: ENST00000411809.7, Transcript 3: ENST00000930851.1, Transcript 4: ENST00000930861.1, Transcript 5: ENST00000930859.1, Transcript 6: ENST00000930860.1, Transcript 7: ENST00000530742.5, Transcript 8: ENST00000930857.1, Transcript 9: ENST00000930856.1, Transcript 10: ENST00000904380.1, Transcript 11: ENST00000930855.1, Transcript 12: ENST00000904378.1, Transcript 13: ENST00000930854.1, Transcript 14: ENST00000904377.1, Transcript 15: ENST00000930853.1, Transcript 16: ENST00000904376.1, Transcript 17: ENST00000930852.1, Transcript 18: ENST00000960220.1, Transcript 19: ENST00000930862.1, Transcript 20: ENST00000904381.1, Transcript 21: ENST00000904382.1, Transcript 22: ENST00000960221.1, Transcript 23: ENST00000960219.1, Transcript 24: ENST00000904383.1, Transcript 25: ENST00000930858.1, Transcript 26: ENST00000904379.1, Transcript 27: ENST00000904385.1, Transcript 28: ENST00000904384.1, Transcript 29: ENST00000523908.5, Transcript 30: ENST00000734152.1
Transcript 1 Gene IdENSG00000113282.15
Transcript 1 Gene NameCLINT1
Transcript 1 Regionpromoter
Transcript 1 Impactpromoter_insertion
Transcript 2 Gene IdENSG00000113282.15
Transcript 2 Gene NameCLINT1
Transcript 2 Regionpromoter
Transcript 2 Impactpromoter_insertion
Transcript 3 Gene IdENSG00000113282.15
Transcript 3 Gene NameCLINT1
Transcript 3 Regionpromoter
Transcript 3 Impactpromoter_insertion
Transcript 4 Gene IdENSG00000113282.15
Transcript 4 Gene NameCLINT1
Transcript 4 Regionpromoter
Transcript 4 Impactpromoter_insertion
Transcript 5 Gene IdENSG00000113282.15
Transcript 5 Gene NameCLINT1
Transcript 5 Regionpromoter
Transcript 5 Impactpromoter_insertion
Transcript 6 Gene IdENSG00000113282.15
Transcript 6 Gene NameCLINT1
Transcript 6 Regionpromoter
Transcript 6 Impactpromoter_insertion
Transcript 7 Gene IdENSG00000113282.15
Transcript 7 Gene NameCLINT1
Transcript 7 Regionpromoter
Transcript 7 Impactpromoter_insertion
Transcript 8 Gene IdENSG00000113282.15
Transcript 8 Gene NameCLINT1
Transcript 8 Regionpromoter
Transcript 8 Impactpromoter_insertion
Transcript 9 Gene IdENSG00000113282.15
Transcript 9 Gene NameCLINT1
Transcript 9 Regionpromoter
Transcript 9 Impactpromoter_insertion
Transcript 10 Gene IdENSG00000113282.15
Transcript 10 Gene NameCLINT1
Transcript 10 Regionpromoter
Transcript 10 Impactpromoter_insertion
Transcript 11 Gene IdENSG00000113282.15
Transcript 11 Gene NameCLINT1
Transcript 11 Regionpromoter
Transcript 11 Impactpromoter_insertion
Transcript 12 Gene IdENSG00000113282.15
Transcript 12 Gene NameCLINT1
Transcript 12 Regionpromoter
Transcript 12 Impactpromoter_insertion
Transcript 13 Gene IdENSG00000113282.15
Transcript 13 Gene NameCLINT1
Transcript 13 Regionpromoter
Transcript 13 Impactpromoter_insertion
Transcript 14 Gene IdENSG00000113282.15
Transcript 14 Gene NameCLINT1
Transcript 14 Regionpromoter
Transcript 14 Impactpromoter_insertion
Transcript 15 Gene IdENSG00000113282.15
Transcript 15 Gene NameCLINT1
Transcript 15 Regionpromoter
Transcript 15 Impactpromoter_insertion
Transcript 16 Gene IdENSG00000113282.15
Transcript 16 Gene NameCLINT1
Transcript 16 Regionpromoter
Transcript 16 Impactpromoter_insertion
Transcript 17 Gene IdENSG00000113282.15
Transcript 17 Gene NameCLINT1
Transcript 17 Regionpromoter
Transcript 17 Impactpromoter_insertion
Transcript 18 Gene IdENSG00000113282.15
Transcript 18 Gene NameCLINT1
Transcript 18 Regionpromoter
Transcript 18 Impactpromoter_insertion
Transcript 19 Gene IdENSG00000113282.15
Transcript 19 Gene NameCLINT1
Transcript 19 Regionpromoter
Transcript 19 Impactpromoter_insertion
Transcript 20 Gene IdENSG00000113282.15
Transcript 20 Gene NameCLINT1
Transcript 20 Regionpromoter
Transcript 20 Impactpromoter_insertion
Transcript 21 Gene IdENSG00000113282.15
Transcript 21 Gene NameCLINT1
Transcript 21 Regionpromoter
Transcript 21 Impactpromoter_insertion
Transcript 22 Gene IdENSG00000113282.15
Transcript 22 Gene NameCLINT1
Transcript 22 Regionpromoter
Transcript 22 Impactpromoter_insertion
Transcript 23 Gene IdENSG00000113282.15
Transcript 23 Gene NameCLINT1
Transcript 23 Regionpromoter
Transcript 23 Impactpromoter_insertion
Transcript 24 Gene IdENSG00000113282.15
Transcript 24 Gene NameCLINT1
Transcript 24 Regionpromoter
Transcript 24 Impactpromoter_insertion
Transcript 25 Gene IdENSG00000113282.15
Transcript 25 Gene NameCLINT1
Transcript 25 Regionpromoter
Transcript 25 Impactpromoter_insertion
Transcript 26 Gene IdENSG00000113282.15
Transcript 26 Gene NameCLINT1
Transcript 26 Regionpromoter
Transcript 26 Impactpromoter_insertion
Transcript 27 Gene IdENSG00000113282.15
Transcript 27 Gene NameCLINT1
Transcript 27 Regionpromoter
Transcript 27 Impactpromoter_insertion
Transcript 28 Gene IdENSG00000113282.15
Transcript 28 Gene NameCLINT1
Transcript 28 Regionpromoter
Transcript 28 Impactpromoter_insertion
Transcript 29 Gene IdENSG00000113282.15
Transcript 29 Gene NameCLINT1
Transcript 29 Regionpromoter
Transcript 29 Impactpromoter_insertion
Transcript 30 Gene IdENSG00000295935.1
Transcript 30 Gene NameENSG00000295935
Transcript 30 Regionintron
Transcript 30 Impactintronic_insertion
AlphaGenome Analysis
Windowchr5:157794209-157925281
RNA-seq Change (±2kb)Mean: -1.8506096921555582e-06 | Peak: 0.25
ATAC Change (±2kb)Mean: -0.0018370419275015593 | Peak: 48.463623046875
InterpretationRNA-seq: minimal change -0.0% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -0.4%
Visualization
Related Links: VISDB1.0  |  UCSC  |  NCBI  |  Ensembl  |  OncoKB  |  ONGene  |  HumCFS  |  COSMIC  |  miRTarBase  |  NPInter  |  ATACdb  |  ENCODE  |  Cytoscape
UTHealth Logo

Center for Precision Health

McWilliams School of Biomedical Informatics at UTHealth Houston

7000 Fannin Street, Suite 600, Houston, TX 77030

Email: Zhongming Zhao, Ph.D

Copyright © 2025   Bioinformatics and Systems Medicine Lab.   All Rights Reserved.
Site Policies  |   Emergency Information  |   Campus Carry  |   CPH