| Basic Information ▶ | |
| VISDB ID | TVIS10011038 |
|---|---|
| Fusion Name | HBV-LOC110806263 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | 766 |
| Sample Name | 766Ca |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 30271481 |
| Journal | Journal of Cancer |
| Published Year | 2018 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr5 |
| Cytogenetic Band | p15.33 |
| Human Strand | - |
| Human Integration Location Type | Intronic |
| Hg19 Start | 1297427 |
| Hg19 End | 1297427 |
| Hg38 Start | 1297312 |
| Hg38 End | 1297312 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | ENSG00000300381 |
| Distance | 525 |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_003977 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus (strain ayw) genome |
| Virus Genome Length | 3182 |
| Virus Breakpoint1 | 1693 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | X protein| |
| Integrated Virus Sequence | CACCTCTGCACGTCGCATGGAGACCACCGTGAACGCCCACCAAATATTGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCTCAGCAATGTCAACGACC| |GACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATA |
| ViMIC ID | - |