Details for VISDB ID: TVIS10011319

Basic Information

• VISDB ID: TVIS10011319
• Fusion Name: HBV-chr3 integration
• Validated: No
• Curated Way: VISDB1.0
• Method: Next generation sequencing
• Wet Assay: No
• Sample ID: 768
• Sample Name: 768P
• Sample Type: Nontumor
• Age: -
• Gender: -

Disease Information

• Disease Name: Hepatocellular carcinoma
• Disease Abbreviation: HCC
• Cancer: Yes

Literature

• PubMed ID: 30271481
• Journal: Journal of Cancer
• Published Year: 2018

Human Genome

• Human Genome Version Description: GRCh37/hg19
• Human Genome RefSeq Accession: GCF_000001405.13
• Human Chromosome: chr3
• Cytogenetic Band: q21.1
• Human Strand: +
• Human Integration Location Type: Intergenic
• Hg19 Start: 122619062
• Hg19 End: 122619062
• Hg38 Start: 122900215
• Hg38 End: 122900215
• Junction Sequence: -

Target Gene

• Target Gene: -
• Nearby Gene: LINC02035
• Distance: 7792

Virus Information

• Virus Name: Hepatitis B virus
• Virus Subtype Name: -
• Virus Genome Accession: NC_003977
• TaxonomyID: 10407
• Virus Abbreviation: HBV
• Virus Genome: Hepatitis B virus (strain ayw) genome
• Virus Genome Length: 3182
• Virus Breakpoint1: 2123
• Virus Breakpoint2: -
• Virus Gene Name: -
• Virus Region Type: precore/core protein|Core and e antigen|
• Integrated Virus Sequence: CCTTAGAGTCTCCTGAGCATTGTTCACCTCACCATACTGCACTCAGGCAAGCAATTCTTTGCTGGGGGGAACTAATGACTCTAGCTACCTGGGTGGGTGT| |TAATTTGGAAGATCCAGCGTCTAGAGACCTAGTAGTCAGTTATGTCAACACTAATATGGGCCTAAAGTTCAGGCAACTCTTGTGGTTTCACATTTCTTGT
• ViMIC ID: -