| Basic Information ▶ | |
| VISDB ID | TVIS10012219 |
|---|---|
| Fusion Name | HBV-chr12 integration |
| Validated | No |
| Curated Way | VISDB1.0 |
| Method | Next generation sequencing |
| Wet Assay | No |
| Sample ID | 791 |
| Sample Name | 791P |
| Sample Type | Nontumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 30271481 |
| Journal | Journal of Cancer |
| Published Year | 2018 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr12 |
| Cytogenetic Band | q13.13 |
| Human Strand | + |
| Human Integration Location Type | Intergenic |
| Hg19 Start | 53640825 |
| Hg19 End | 53640825 |
| Hg38 Start | 53247041 |
| Hg38 End | 53247041 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | MFSD5 |
| Distance | 4210 |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_003977 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus (strain ayw) genome |
| Virus Genome Length | 3182 |
| Virus Breakpoint1 | 2228 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | precore/core protein|Core and e antigen| |
| Integrated Virus Sequence | TGGAAGATCCAGCGTCTAGAGACCTAGTAGTCAGTTATGTCAACACTAATATGGGCCTAAAGTTCAGGCAACTCTTGTGGTTTCACATTTCTTGTCTCAC| |TTTTGGAAGAGAAACAGTTATAGAGTATTTGGTGTCTTTCGGAGTGTGGATTCGCACTCCTCCAGCTTATAGACCACCAAATGCCCCTATCCTATCAACA |
| ViMIC ID | - |