| Basic Information ▶ | |
| VISDB ID | TVIS20023205 |
|---|---|
| Fusion Name | HPV-LINC03076 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HPV capture sequencing |
| Wet Assay | Yes |
| Sample ID | G160315R80001.1 |
| Sample Name | New sample |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr7 |
| Cytogenetic Band | q31.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 112715992 |
| Hg38 End | 112715992 |
| Junction Sequence | CCTGCTGAGTAACCAATGTACCATATTTTTTTGCAGATGTCCGTGTGGCGGCCTAGTGACAACAAGGTTTATCTACCTCCTCCTCCTGTTTCCAAGGTGGTCAGCACTGATGAATATGTGCAACGCAC |
| Target Gene ▶ | |
| Target Gene | LINC03076 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV42 |
| Virus Genome Accession | M73236 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus ORF E6, ORF E7, ORF E1, ORF E2, ORF E4, ORF E5, ORF L2, and ORF L1 genes, complete cds |
| Virus Genome Length | 7,917 bp |
| Virus Breakpoint1 | 5817 |
| Virus Breakpoint2 | - |
| Virus Gene Name | L2,L1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |