| Basic Information ▶ | |
| VISDB ID | TVIS20031009 |
|---|---|
| Fusion Name | HPV-LINC01483 integration |
| Validated | Yes |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | YKD2033 |
| Sample Type | Tumor |
| Age | 53.0 11.4 years |
| Gender | Female |
| Disease Information ▶ | |
| Disease Name | Vaginal intraepithelial neoplasia |
| Disease Abbreviation | VaIN |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38072997 |
| Journal | Journal of Obstetrics and Gynaecology Research |
| Published Year | 2023 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr17 |
| Cytogenetic Band | q24.3 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 67734847 |
| Hg19 End | 67734847 |
| Hg38 Start | 69738706 |
| Hg38 End | 69738706 |
| Junction Sequence | TGTTAATAGTAATGCAGCAGCATTTTTAAGAAGCAATGCACAAGCAAAAATAGTAAAAGACTGTGGCGTTATGTGCAGACATTATAAAAGAGCAGAAAAGCGTGGTATGACAATGGGACAATGGATACAAAGTAGGTGTGAAAAAACAAATGATGGA_TCATTATTGTCATTCAGTTCAATTTTTTAAATTTCCATCTTGATTTTGTTTTTGAGCCAATGCTCATTCAGGAGCAGGTTATTTTATTTCTATGTATTTGCAGGGTTTTGAAGGTTCCTTTTGGGGTTGATT |
| Target Gene ▶ | |
| Target Gene | LINC01483 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16/18 |
| Virus Genome Accession | - |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | - |
| Virus Genome Length | - |
| Virus Breakpoint1 | - |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |