| Basic Information ▶ | |
| VISDB ID | TVIS20014706 |
|---|---|
| Fusion Name | HPV-COMT integration |
| Validated | Yes |
| Curated Way | Curated |
| Method | RNA sequencing, followed by integration sites detection using ChimeraScan, deFuse and SOAPFuse |
| Wet Assay | Yes |
| Sample ID | RC88 |
| Sample Name | ZJU |
| Sample Type | Tumor |
| Age | 49 |
| Gender | Female |
| Disease Information ▶ | |
| Disease Name | Cervical Cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 33785400 |
| Journal | Genomics |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr22 |
| Cytogenetic Band | q11.21 |
| Human Strand | |
| Human Integration Location Type | exonic |
| Hg19 Start | 19948722 |
| Hg19 End | 19948722 |
| Hg38 Start | 19961199 |
| Hg38 End | 19961199 |
| Junction Sequence | GTTCAGGATGCGCTGCTCCTTGGTGTCACCCATGAGCAGGTTGTGGATGGGCTGCAGGATGAACTCGTTCCAGCCGATAAGGCACAGGCCCCAGCCCCAGTGCCTcagaagcagcagcagcaccaccagcagcaccaggcccagcaacacagctgccaacagcagAGGCGGGGCCTCCGGCATCTTCAAAGCACCTCTGAGCAGGCTCCAGCCCTCTGGCTGCGGGAGGGGTCTGGGGTCTCCTCTGAGCTCGGCAGCAAAGCAGATGTTATTT|CTGCAGGATCAGCCATGGTAGATTATGGTTTCTGAGAACAGATGGGGCACACAATTCCTAGTGTGCCCATTAACAGGTCTTCCAAAGTACGAATGTCTACGTGTGTGCTTTGTACGCACAACCGAAGCGTAGAGTCACACTTGCAACAAAAGGTTACAATATTGTAATGGGCTCTGTCCGGTTCTGCTTGTCCAGCTGGACCATCTATTTCATCCTCCTCCTCTGAGCTGTCATTTAATTGCTCATAACAGTAGAGATCAGTTGTCTCTGGTTGCAAATC |
| Target Gene ▶ | |
| Target Gene | COMT |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | - |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | - |
| Virus Genome Length | - |
| Virus Breakpoint1 | 880 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000093010.16 |
| Gene Name | COMT |
| Transcript | Transcript 1: ENST00000676678.1, Transcript 2: ENST00000403184.5, Transcript 3: ENST00000361682.11, Transcript 4: ENST00000403710.5, Transcript 5: ENST00000407537.5, Transcript 6: ENST00000467943.5, Transcript 7: ENST00000852828.1, Transcript 8: ENST00000964897.1, Transcript 9: ENST00000678868.1, Transcript 10: ENST00000678769.1, Transcript 11: ENST00000964893.1, Transcript 12: ENST00000964894.1, Transcript 13: ENST00000964895.1, Transcript 14: ENST00000428707.2, Transcript 15: ENST00000964896.1, Transcript 16: ENST00000412786.5, Transcript 17: ENST00000207636.9, Transcript 18: ENST00000406520.7, Transcript 19: ENST00000964899.1, Transcript 20: ENST00000964898.1, Transcript 21: ENST00000852829.1, Transcript 22: ENST00000678255.1, Transcript 23: ENST00000852830.1, Transcript 24: ENST00000449653.5, Transcript 25: ENST00000677397.1, Transcript 26: ENST00000678240.1, Transcript 27: ENST00000677675.1 |
| Transcript 1 Region | splice_site |
| Transcript 1 Impact | splice_site_proximal |
| Transcript 2 Region | splice_site |
| Transcript 2 Impact | splice_site_proximal |
| Transcript 3 Region | splice_site |
| Transcript 3 Impact | splice_site_proximal |
| Transcript 4 Region | splice_site |
| Transcript 4 Impact | splice_site_proximal |
| Transcript 5 Region | splice_site |
| Transcript 5 Impact | splice_site_proximal |
| Transcript 6 Region | splice_site |
| Transcript 6 Impact | splice_site_proximal |
| Transcript 7 Region | splice_site |
| Transcript 7 Impact | splice_site_proximal |
| Transcript 8 Region | splice_site |
| Transcript 8 Impact | splice_site_proximal |
| Transcript 9 Region | splice_site |
| Transcript 9 Impact | splice_site_proximal |
| Transcript 10 Region | splice_site |
| Transcript 10 Impact | splice_site_proximal |
| Transcript 11 Region | splice_site |
| Transcript 11 Impact | splice_site_proximal |
| Transcript 12 Region | splice_site |
| Transcript 12 Impact | splice_site_proximal |
| Transcript 13 Region | splice_site |
| Transcript 13 Impact | splice_site_proximal |
| Transcript 14 Region | splice_site |
| Transcript 14 Impact | splice_site_proximal |
| Transcript 15 Region | splice_site |
| Transcript 15 Impact | splice_site_proximal |
| Transcript 16 Region | splice_site |
| Transcript 16 Impact | splice_site_proximal |
| Transcript 17 Region | splice_site |
| Transcript 17 Impact | splice_site_proximal |
| Transcript 18 Region | splice_site |
| Transcript 18 Impact | splice_site_proximal |
| Transcript 19 Region | splice_site |
| Transcript 19 Impact | splice_site_proximal |
| Transcript 20 Region | splice_site |
| Transcript 20 Impact | splice_site_proximal |
| Transcript 21 Region | splice_site |
| Transcript 21 Impact | splice_site_proximal |
| Transcript 22 Region | splice_site |
| Transcript 22 Impact | splice_site_proximal |
| Transcript 23 Region | splice_site |
| Transcript 23 Impact | splice_site_proximal |
| Transcript 24 Region | promoter |
| Transcript 24 Impact | promoter_insertion |
| Transcript 25 Region | promoter |
| Transcript 25 Impact | promoter_insertion |
| Transcript 26 Region | promoter |
| Transcript 26 Impact | promoter_insertion |
| Transcript 27 Region | promoter |
| Transcript 27 Impact | promoter_insertion |
| AlphaGenome Analysis | |
| Chromosome | chr22 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D