| Basic Information ▶ | |
| VISDB ID | TVIS42001572 |
|---|---|
| Fusion Name | EBV-CD96 integration |
| Validated | No |
| Curated Way | Curated |
| Method | EBV capture sequencing, followed by Viral Integration Pathway Analysis (VIPA) pipeline |
| Wet Assay | No |
| Sample ID | SAMEA104127354.3 |
| Sample Name | ERP001026 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Multiple |
| Disease Abbreviation | - |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr3 |
| Cytogenetic Band | q13.13 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 111526355 |
| Hg38 End | 111526355 |
| Junction Sequence | GACACGATCTTTAGCTCGTCGGCCAGCTGTCTGCCACCAGCAGCCCTGCCACCAAACACCCACTCATTCAGCTTGCGGAGGTCCGGCCTCGTGTCAGCGGTCTCTGGCCCGGCCACCAGAAGGGCCCTCTGGAAGCCCGCCGCCACCTGGCCGGAATCGTACTTGCGAAGGGCGTTGTCAAACAGGACACTGTTTGGATTCAGCAGTGGCTGCTCTCTAAAGAAAAACTGGAGGCTTTAACTCCATTTGT |
| Target Gene ▶ | |
| Target Gene | CD96 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Epstein-Barr Virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_009334 |
| TaxonomyID | 10376 |
| Virus Abbreviation | EBV |
| Virus Genome | Human gammaherpesvirus 4, complete genome |
| Virus Genome Length | 172764 bp |
| Virus Breakpoint1 | 2254 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HHV4tp2_gp03 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000153283.15 |
| Gene Name | CD96 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000460744.1 |
| AlphaGenome Analysis | |
| Window | chr3:111460819-111591891 |
| RNA-seq Change (±2kb) | Mean: 2.9441403967211954e-05 | Peak: 0.02454376220703125 |
| ATAC Change (±2kb) | Mean: 0.0005673320847563446 | Peak: 0.8867186903953552 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: no signal in region (REF≈0, ALT≈0) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D