| Series | GSE67259 |
| Title | Robust In Vitro Induction of Human Germ Cell Fate from Pluripotent Stem Cells |
|---|
| Year | 2015 |
|---|
| Country | Japan |
|---|
| Article | Saitou M,Yamanaka S,Takahashi K,Yamamoto T,Nakagawa M,Woltjen K,Mori T,Yamamoto T,Sakuma T,Sekiguchi K,Nakamura S,Tsuchiya H,Iwatani C,Moritoki Y,Ohta H,Kurimoto K,Yabuta Y,Okamoto I,Nakamura T,Yokobayashi S,Sasaki K.Robust In Vitro Induction of Human Germ Cell Fate from Pluripotent Stem Cells.Cell stem cell.2015 Aug 6 |
|---|
| PMID | 26189426 |
|---|
| Bio Project | BioProject: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA279357 |
|---|
| Sra | SRA: http://www.ncbi.nlm.nih.gov/sra?term=SRP056527 |
|---|
| Overall Desgin | RNAseq analysis of human induced pluripotent stem cells (hiPSC), incipient mesoderm-like cells (iMeLC) and primordial germ cell-like cells (BLIMP1-2A-tdTomato (BT)/TFAP2C-2A-ECFP (AG) expressing cells or EpCAM/CD49f (CSM) positive cells) |
|---|
| Summary | Mechanisms underlying human germ cell development are unclear, partly due to difficulties in studying human embryos and lack of suitable experimental systems. Here, we show that human induced pluripotent stem cells (hiPSCs) differentiate into incipient mesoderm-like cells (iMeLCs), which robustly generate human primordial germ cell-like cells (hPGCLCs) that can be purified using the surface markers EpCAM and INTEGRINα6. The transcriptomes of hPGCLCs and primordial germ cells (PGCs) isolated from non-human primates are similar, and although specification of hPGCLCs and mouse PGCs rely on similar signaling pathways, hPGCLC specification transcriptionally activates germline fate without transiently inducing eminent somatic programs. This includes genes important for naive pluripotency and repression of key epigenetic modifiers, concomitant with epigenetic reprogramming. Accordingly, BLIMP1, which represses somatic programs in mice, activates and stabilizes a germline transcriptional circuit and represses a default neuronal differentiation program. Together, these findings provide a foundation for understanding and reconstituting human germ cell development in vitro. |
|---|
| Experimental Protocol | Total RNA was extracted from hiPSCs, iMeLCs, and hPGCLCs or mESCs, mEpiLCs, and mPGCLCs by using an RNeasy Micro Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Synthesis and amplification of cDNAs using 1 ng of purified total RNA, and construction of cDNA libraries for RNA sequencing (ABI SOLiD 5500XL system; Life Technologies) were performed as described in (Nakamura et al., 2015).; For isolating single cells of cyESCs for the SC3-seq analysis [Nakamura et.al., Nuceic Acids Res. (2015)], cells were first detached as clumps by the CTK solution [0.25% of Trypsin (Life Technologies), 0.1 mg/mL of Collagenase Ⅳ (Life Technologies), 1 mM of CaCl2 (Nacalai Tesque)], were incubated in 0.25% of trypsin/PBS (Sigma-Aldrich) for around 10 min at 37℃, and were then dispersed into single cells in 1% (vol/vol) KSR/PBS. Genital ridges were dissected out and were dissociated into single cells by incubating with 0.25% trypsin/PBS for around 10 min at 37℃ followed by repeated pipetting. The resulting single cells were dispersed in 0.1 mg/ml of PVA/PBS (Sigma-Aldrich) and were processed for the SC3-seq analysis (Nakamura et al., 2015).; cDNA synthesis and amplification from isolated RNAs/single cells were perfomed essentially as reported in [Kurimoto, K.et.al., Nucleic Acids Research, 34(5), e42.]. Library constructions for SOLiD System were performed as reported in [Nakamura et.al., Nuceic Acids Res. (2015)].
|
|---|
| Data processing | All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options -c -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA. The trimmed reads with less than 30 bp were discarded.; Untrimmed and trimmed reads of 30 bp or longer were mapped onto the mouse genome mm10 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search†option.; Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-normâ€, “—no-length-correction†and “—library-type fr-secondstrand†options and mm10 reference gene annotations with extended TTSs. We also set the cufflinks option “—max-mle-iterations†to 50,000, because default iterations (5,000) resulted in “FAILED†when estimating the expression levels of some genes. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.; Genome_build: mm10; Genome_build: hg19; Genome_build: Macaca_fascicularis_5.0; Supplementary_files_format_and_content: tab-delimited text files include RPM values for each Sample.
|
|---|
| Platform | GPL15907;GPL16288;GPL19944 |
|---|
| Public On | Public on Jul 20 2015 |
|---|
