CleftGeneDB-Search

Gene: BMPR1B

Basic information

Tag	Content
Uniprot ID	O00238; B2R953; B4DSV1; P78366;
Entrez ID	658
Genbank protein ID	AAH69796.1; BAG36400.1; BAA19765.1; AAH69803.1; EAX06060.1; AAC28131.1; AAH47773.1; BAG61763.1;
Genbank nucleotide ID	NM_001256793.1; NM_001256794.1; XM_011532201.2; XM_017008559.1; NM_001203.2; XM_017008560.1; XM_017008558.1; NM_001256792.1; XM_017008561.1;
Ensembl protein ID	ENSP00000421671; ENSP00000426617; ENSP00000264568; ENSP00000425444; ENSP00000401907; ENSP00000500035; ENSP00000378389;
Ensembl nucleotide ID	ENSG00000138696
Gene name	Bone morphogenetic protein receptor type-1B
Gene symbol	BMPR1B
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Manually collected
Reference	14755461
Functional description	On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for BMP7/OP-1 and GDF5. Positively regulates chondrocyte differentiation through GDF5 interaction.
Sequence	MLLRSAGKLN VGTKKEDGES TAPTPRPKVL RCKCHHHCPE DSVNNICSTD GYCFTMIEED 60 DSGLPVVTSG CLGLEGSDFQ CRDTPIPHQR RSIECCTERN ECNKDLHPTL PPLKNRDFVD 120 GPIHHRALLI SVTVCSLLLV LIILFCYFRY KRQETRPRYS IGLEQDETYI PPGESLRDLI 180 EQSQSSGSGS GLPLLVQRTI AKQIQMVKQI GKGRYGEVWM GKWRGEKVAV KVFFTTEEAS 240 WFRETEIYQT VLMRHENILG FIAADIKGTG SWTQLYLITD YHENGSLYDY LKSTTLDAKS 300 MLKLAYSSVS GLCHLHTEIF STQGKPAIAH RDLKSKNILV KKNGTCCIAD LGLAVKFISD 360 TNEVDIPPNT RVGTKRYMPP EVLDESLNRN HFQSYIMADM YSFGLILWEV ARRCVSGGIV 420 EEYQLPYHDL VPSDPSYEDM REIVCIKKLR PSFPNRWSSD ECLRQMGKLM TECWAHNPAS 480 RLTALRVKKT LAKMSESQDI KL 502

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
3MDY

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Species	Evidence	Details
1:1 ortholog	BMPR1B	407128	A7YWG6	Bos taurus	Prediction	More>>
1:1 ortholog	BMPR1B	100861211	B5AFX6	Capra hircus	Prediction	More>>
1:1 ortholog	BMPR1B	658	O00238	Homo sapiens	Publication	More>>
1:1 ortholog	Bmpr1b	12167	P36898	Mus musculus	Prediction	More>>
1:1 ortholog	BMPR1B	396691	Q95L23	Sus scrofa	Prediction	More>>
1:1 ortholog	BMPR1B	100351275	G1T8L9	Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Bmpr1b	310914	M0R3J4	Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs150974461	p.Arg4Gln	missense variant	-	NC_000004.12:g.95104435G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs150974461	p.Arg4Pro	missense variant	-	NC_000004.12:g.95104435G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1466418430	p.Ser5Arg	missense variant	-	NC_000004.12:g.95104439T>G	TOPMed,gnomAD
rs143885868	p.Ala6Thr	missense variant	-	NC_000004.12:g.95104440G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1279515650	p.Gly7Arg	missense variant	-	NC_000004.12:g.95104443G>A	TOPMed
rs1374698890	p.Thr13Ile	missense variant	-	NC_000004.12:g.95104462C>T	TOPMed
rs763496728	p.Lys14Gln	missense variant	-	NC_000004.12:g.95104464A>C	ExAC,gnomAD
rs1346115955	p.Lys15Glu	missense variant	-	NC_000004.12:g.95104467A>G	TOPMed,gnomAD
rs773850751	p.Glu19Asp	missense variant	-	NC_000004.12:g.95104481G>C	ExAC,gnomAD
rs1281247073	p.Ser20Gly	missense variant	-	NC_000004.12:g.95104482A>G	gnomAD
rs190883013	p.Thr21Ile	missense variant	-	NC_000004.12:g.95104486C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs754365645	p.Thr24Ala	missense variant	-	NC_000004.12:g.95104494A>G	ExAC,gnomAD
rs912115035	p.Thr24Ile	missense variant	-	NC_000004.12:g.95104495C>T	-
rs912115035	p.Thr24Ile	missense variant	-	NC_000004.12:g.95104495C>T	NCI-TCGA
RCV000425791	p.Thr24Ala	missense variant	-	NC_000004.12:g.95104494A>G	ClinVar
rs145700191	p.Pro25Arg	missense variant	-	NC_000004.12:g.95104498C>G	ESP,ExAC,TOPMed,gnomAD
rs145700191	p.Pro25His	missense variant	-	NC_000004.12:g.95104498C>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg26ProPheSerTerUnk	frameshift	-	NC_000004.12:g.95104494_95104495insC	NCI-TCGA
rs377000102	p.Arg26Pro	missense variant	-	NC_000004.12:g.95104501G>C	ExAC,TOPMed,gnomAD
rs758706811	p.Arg26Cys	missense variant	-	NC_000004.12:g.95104500C>T	ExAC,gnomAD
rs377000102	p.Arg26His	missense variant	-	NC_000004.12:g.95104501G>A	ExAC,TOPMed,gnomAD
COSM5083601	p.Arg26ValPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.95104495C>-	NCI-TCGA Cosmic
rs758706811	p.Arg26Cys	missense variant	-	NC_000004.12:g.95104500C>T	NCI-TCGA,NCI-TCGA Cosmic
rs757312834	p.Pro27Arg	missense variant	-	NC_000004.12:g.95104504C>G	ExAC,gnomAD
RCV000625922	p.Pro27Arg	missense variant	Primary pulmonary hypertension 3 (PPH3)	NC_000004.12:g.95104504C>G	ClinVar
NCI-TCGA novel	p.Val29Ile	missense variant	-	NC_000004.12:g.95104509G>A	NCI-TCGA
rs773417270	p.Val29Phe	missense variant	-	NC_000004.12:g.95104509G>T	ExAC,TOPMed,gnomAD
rs745854387	p.Arg31Ser	missense variant	-	NC_000004.12:g.95104515C>A	ExAC,TOPMed,gnomAD
rs200035802	p.Arg31His	missense variant	-	NC_000004.12:g.95104516G>A	UniProt,dbSNP
VAR_041401	p.Arg31His	missense variant	-	NC_000004.12:g.95104516G>A	UniProt
rs200035802	p.Arg31His	missense variant	-	NC_000004.12:g.95104516G>A	1000Genomes,ExAC,TOPMed,gnomAD
RCV000263624	p.Arg31His	missense variant	Brachydactyly	NC_000004.12:g.95104516G>A	ClinVar
rs745854387	p.Arg31Cys	missense variant	Acromesomelic dysplasia, Demirhan type (AMDD)	NC_000004.12:g.95104515C>T	UniProt,dbSNP
VAR_075520	p.Arg31Cys	missense variant	Acromesomelic dysplasia, Demirhan type (AMDD)	NC_000004.12:g.95104515C>T	UniProt
rs745854387	p.Arg31Cys	missense variant	-	NC_000004.12:g.95104515C>T	ExAC,TOPMed,gnomAD
RCV000201128	p.Arg31Cys	missense variant	Acromesomelic dysplasia, Demirhan type (AMDD)	NC_000004.12:g.95104515C>T	ClinVar
rs1409575151	p.His37Tyr	missense variant	-	NC_000004.12:g.95104533C>T	TOPMed,gnomAD
rs1381581400	p.Glu40Gly	missense variant	-	NC_000004.12:g.95104543A>G	TOPMed
rs775495653	p.Asp41Tyr	missense variant	-	NC_000004.12:g.95104545G>T	ExAC,TOPMed,gnomAD
rs749047942	p.Asn45Tyr	missense variant	-	NC_000004.12:g.95104557A>T	ExAC,gnomAD
rs749047942	p.Asn45Asp	missense variant	-	NC_000004.12:g.95104557A>G	ExAC,gnomAD
rs1245250823	p.Gly51Val	missense variant	-	NC_000004.12:g.95114728G>T	gnomAD
rs863225041	p.Cys53Arg	missense variant	-	NC_000004.12:g.95114733T>C	-
RCV000201167	p.Cys53Arg	missense variant	Acromesomelic dysplasia, Demirhan type (AMDD)	NC_000004.12:g.95114733T>C	ClinVar
COSM1431866	p.Cys53Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95114734G>T	NCI-TCGA Cosmic
rs1033648877	p.Thr55Met	missense variant	-	NC_000004.12:g.95114740C>T	gnomAD
rs1191790811	p.Met56Thr	missense variant	-	NC_000004.12:g.95114743T>C	TOPMed
rs1470243376	p.Ile57Val	missense variant	-	NC_000004.12:g.95114745A>G	TOPMed
rs1364478234	p.Ile57Thr	missense variant	-	NC_000004.12:g.95114746T>C	gnomAD
rs1553939371	p.Asp61Ala	missense variant	-	NC_000004.12:g.95114758A>C	-
RCV000596072	p.Asp61Ala	missense variant	-	NC_000004.12:g.95114758A>C	ClinVar
NCI-TCGA novel	p.Ser62Cys	missense variant	-	NC_000004.12:g.95114761C>G	NCI-TCGA
COSM448356	p.Pro65Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95114769C>T	NCI-TCGA Cosmic
rs1176860852	p.Val66Met	missense variant	-	NC_000004.12:g.95114772G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Val67Phe	missense variant	-	NC_000004.12:g.95114775G>T	NCI-TCGA
NCI-TCGA novel	p.Gly70Val	missense variant	-	NC_000004.12:g.95114785G>T	NCI-TCGA
NCI-TCGA novel	p.Leu74GluPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.95114794_95114795insGGAAAAGGAAATA	NCI-TCGA
NCI-TCGA novel	p.Gly76Cys	missense variant	-	NC_000004.12:g.95114802G>T	NCI-TCGA
rs200702974	p.Ser77Ala	missense variant	-	NC_000004.12:g.95114805T>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp78Asn	missense variant	-	NC_000004.12:g.95114808G>A	NCI-TCGA
COSM481693	p.Cys81Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95114818G>T	NCI-TCGA Cosmic
COSM6168235	p.Arg82Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95114820C>T	NCI-TCGA Cosmic
COSM1431869	p.Arg82Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95114821G>C	NCI-TCGA Cosmic
rs140970485	p.Asp83Gly	missense variant	-	NC_000004.12:g.95115686A>G	ESP,ExAC,TOPMed,gnomAD
rs369807264	p.Asp83Tyr	missense variant	-	NC_000004.12:g.95115685G>T	ESP,ExAC,TOPMed,gnomAD
rs140970485	p.Asp83Val	missense variant	-	NC_000004.12:g.95115686A>T	ESP,ExAC,TOPMed,gnomAD
rs140970485	p.Asp83Ala	missense variant	-	NC_000004.12:g.95115686A>C	ESP,ExAC,TOPMed,gnomAD
rs369807264	p.Asp83Asn	missense variant	-	NC_000004.12:g.95115685G>A	ESP,ExAC,TOPMed,gnomAD
rs890305622	p.Asp83Glu	missense variant	-	NC_000004.12:g.95115687C>A	TOPMed
rs369807264	p.Asp83His	missense variant	-	NC_000004.12:g.95115685G>C	ESP,ExAC,TOPMed,gnomAD
rs200083866	p.Thr84Ile	missense variant	-	NC_000004.12:g.95115689C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs192392906	p.Thr84Ala	missense variant	-	NC_000004.12:g.95115688A>G	1000Genomes,ExAC,gnomAD
rs192392906	p.Thr84Ser	missense variant	-	NC_000004.12:g.95115688A>T	1000Genomes,ExAC,gnomAD
rs762270033	p.Pro85Ser	missense variant	-	NC_000004.12:g.95115691C>T	ExAC,gnomAD
rs767805662	p.Pro85Arg	missense variant	-	NC_000004.12:g.95115692C>G	ExAC,gnomAD
rs767805662	p.Pro85Leu	missense variant	-	NC_000004.12:g.95115692C>T	ExAC,gnomAD
NCI-TCGA novel	p.Ile86Thr	missense variant	-	NC_000004.12:g.95115695T>C	NCI-TCGA
rs1200081382	p.Ile86Phe	missense variant	-	NC_000004.12:g.95115694A>T	gnomAD
COSM3607134	p.Pro87Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95115697C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.His88Arg	missense variant	-	NC_000004.12:g.95115701A>G	NCI-TCGA
rs558142045	p.Gln89His	missense variant	-	NC_000004.12:g.95115705A>T	1000Genomes
rs1486216727	p.Arg90Lys	missense variant	-	NC_000004.12:g.95115707G>A	gnomAD
rs376183647	p.Arg91Ile	missense variant	-	NC_000004.12:g.95115710G>T	ESP,ExAC,TOPMed,gnomAD
rs139161475	p.Glu94Ala	missense variant	-	NC_000004.12:g.95115719A>C	ExAC,gnomAD
rs139161475	p.Glu94Val	missense variant	-	NC_000004.12:g.95115719A>T	ExAC,gnomAD
rs200886063	p.Glu94Lys	missense variant	-	NC_000004.12:g.95115718G>A	ExAC,TOPMed,gnomAD
rs151289886	p.Thr97Lys	missense variant	-	NC_000004.12:g.95115728C>A	ESP,ExAC,TOPMed,gnomAD
rs759423600	p.Thr97Ser	missense variant	-	NC_000004.12:g.95115727A>T	ExAC,TOPMed,gnomAD
rs151289886	p.Thr97Arg	missense variant	-	NC_000004.12:g.95115728C>G	ESP,ExAC,TOPMed,gnomAD
rs151289886	p.Thr97Ile	missense variant	-	NC_000004.12:g.95115728C>T	ESP,ExAC,TOPMed,gnomAD
RCV000304200	p.Thr97Ala	missense variant	-	NC_000004.12:g.95115727A>G	ClinVar
rs759423600	p.Thr97Ala	missense variant	-	NC_000004.12:g.95115727A>G	ExAC,TOPMed,gnomAD
COSM274143	p.Glu101Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95115739G>A	NCI-TCGA Cosmic
rs746713318	p.His107Leu	missense variant	-	NC_000004.12:g.95115758A>T	ExAC,TOPMed,gnomAD
rs1386616728	p.Thr109Ile	missense variant	-	NC_000004.12:g.95115764C>T	gnomAD
rs1225550138	p.Pro112Ser	missense variant	-	NC_000004.12:g.95115772C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Arg116Ile	missense variant	-	NC_000004.12:g.95115785G>T	NCI-TCGA
rs571763786	p.Asp117Asn	missense variant	-	NC_000004.12:g.95115787G>A	1000Genomes,ExAC,gnomAD
rs1185014709	p.Phe118Leu	missense variant	-	NC_000004.12:g.95123812T>C	gnomAD
rs541202129	p.Val119Gly	missense variant	-	NC_000004.12:g.95123816T>G	1000Genomes,ExAC,gnomAD
rs1422671894	p.Asp120Asn	missense variant	-	NC_000004.12:g.95123818G>A	gnomAD
RCV000006935	p.Gly121Ter	frameshift	Acromesomelic dysplasia, Demirhan type (AMDD)	NC_000004.12:g.95123821_95123828del	ClinVar
NCI-TCGA novel	p.Pro122His	missense variant	-	NC_000004.12:g.95123825C>A	NCI-TCGA
rs759803347	p.His124Tyr	missense variant	-	NC_000004.12:g.95123830C>T	ExAC,TOPMed,gnomAD
rs1397484175	p.His124Arg	missense variant	-	NC_000004.12:g.95123831A>G	TOPMed
rs1366056747	p.Arg126Lys	missense variant	-	NC_000004.12:g.95123837G>A	gnomAD
rs755669488	p.Leu129Phe	missense variant	-	NC_000004.12:g.95123845C>T	ExAC,gnomAD
rs561117066	p.Ser131Thr	missense variant	-	NC_000004.12:g.95123851T>A	1000Genomes,ExAC,gnomAD
COSM3776082	p.Ser131Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95123852C>T	NCI-TCGA Cosmic
rs931491708	p.Val132Leu	missense variant	-	NC_000004.12:g.95123854G>T	TOPMed
rs150002205	p.Val132Gly	missense variant	-	NC_000004.12:g.95123855T>G	ESP,ExAC,TOPMed,gnomAD
rs772559135	p.Thr133Pro	missense variant	-	NC_000004.12:g.95123857A>C	ExAC
rs747412096	p.Val134Ile	missense variant	-	NC_000004.12:g.95123860G>A	ExAC,gnomAD
rs1392029669	p.Val134Ala	missense variant	-	NC_000004.12:g.95123861T>C	gnomAD
rs145201971	p.Cys135Gly	missense variant	-	NC_000004.12:g.95123863T>G	ESP,ExAC,TOPMed
COSM448358	p.Cys135ValPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.95123858_95123861CTGT>-	NCI-TCGA Cosmic
rs1250134332	p.Leu139Phe	missense variant	-	NC_000004.12:g.95123877G>T	TOPMed
rs1324227207	p.Leu139Met	missense variant	-	NC_000004.12:g.95123875T>A	TOPMed,gnomAD
rs138801821	p.Val140Ile	missense variant	-	NC_000004.12:g.95123878G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000202696	p.Val140Ile	missense variant	-	NC_000004.12:g.95123878G>A	ClinVar
rs1346621381	p.Leu141Val	missense variant	-	NC_000004.12:g.95123881C>G	gnomAD
COSM3607137	p.Ile142Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95123884A>C	NCI-TCGA Cosmic
COSM3826460	p.Cys146Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95123897G>A	NCI-TCGA Cosmic
rs775375747	p.Phe148Leu	missense variant	-	NC_000004.12:g.95123904C>A	ExAC,TOPMed,gnomAD
rs775375747	p.Phe148Leu	missense variant	-	NC_000004.12:g.95123904C>G	ExAC,TOPMed,gnomAD
rs34231464	p.Arg149Trp	missense variant	-	NC_000004.12:g.95123905C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000333918	p.Arg149Trp	missense variant	Brachydactyly	NC_000004.12:g.95123905C>T	ClinVar
rs1197682678	p.Gln153Arg	missense variant	-	NC_000004.12:g.95124994A>G	gnomAD
rs1172006396	p.Glu154Lys	missense variant	-	NC_000004.12:g.95124996G>A	TOPMed,gnomAD
rs140360809	p.Thr155Asn	missense variant	-	NC_000004.12:g.95125000C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs769863111	p.Arg156Thr	missense variant	-	NC_000004.12:g.95125003G>C	ExAC,gnomAD
rs779609471	p.Pro157Ser	missense variant	-	NC_000004.12:g.95125005C>T	ExAC,TOPMed,gnomAD
rs779609471	p.Pro157Thr	missense variant	-	NC_000004.12:g.95125005C>A	ExAC,TOPMed,gnomAD
RCV000424734	p.Pro157Ser	missense variant	-	NC_000004.12:g.95125005C>T	ClinVar
rs761486688	p.Arg158Gln	missense variant	-	NC_000004.12:g.95125009G>A	ExAC,gnomAD
rs774364369	p.Arg158Gly	missense variant	-	NC_000004.12:g.95125008C>G	ExAC,gnomAD
rs1366100450	p.Tyr159Asp	missense variant	-	NC_000004.12:g.95125011T>G	gnomAD
NCI-TCGA novel	p.Ser160Ile	missense variant	-	NC_000004.12:g.95125015G>T	NCI-TCGA
rs149589961	p.Ser160Asn	missense variant	-	NC_000004.12:g.95125015G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs750037039	p.Ser160Cys	missense variant	-	NC_000004.12:g.95125014A>T	ExAC,gnomAD
rs766140919	p.Ile161Ser	missense variant	-	NC_000004.12:g.95125018T>G	ExAC,gnomAD
rs1438025940	p.Leu163Ile	missense variant	-	NC_000004.12:g.95125023T>A	TOPMed
rs754565613	p.Glu164Lys	missense variant	-	NC_000004.12:g.95125026G>A	ExAC,gnomAD
rs754565613	p.Glu164Gln	missense variant	-	NC_000004.12:g.95125026G>C	ExAC,gnomAD
rs752156962	p.Asp166His	missense variant	-	NC_000004.12:g.95125032G>C	ExAC,TOPMed,gnomAD
rs752156962	p.Asp166Asn	missense variant	-	NC_000004.12:g.95125032G>A	ExAC,TOPMed,gnomAD
rs781670372	p.Asp166Ala	missense variant	-	NC_000004.12:g.95125033A>C	ExAC,TOPMed,gnomAD
rs781670372	p.Asp166Val	missense variant	-	NC_000004.12:g.95125033A>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu167Gln	missense variant	-	NC_000004.12:g.95125035G>C	NCI-TCGA
rs1490974342	p.Glu167Ala	missense variant	-	NC_000004.12:g.95125036A>C	gnomAD
rs373998952	p.Thr168Ser	missense variant	-	NC_000004.12:g.95125039C>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Tyr169Ter	frameshift	-	NC_000004.12:g.95125043C>-	NCI-TCGA
rs769948288	p.Tyr169Ser	missense variant	-	NC_000004.12:g.95125042A>C	ExAC,TOPMed,gnomAD
rs1022330839	p.Ile170Thr	missense variant	-	NC_000004.12:g.95125045T>C	TOPMed,gnomAD
rs1022330839	p.Ile170Ser	missense variant	-	NC_000004.12:g.95125045T>G	TOPMed,gnomAD
rs778170724	p.Ile170Val	missense variant	-	NC_000004.12:g.95125044A>G	ExAC,TOPMed,gnomAD
rs768768926	p.Ile170Met	missense variant	-	NC_000004.12:g.95125046T>G	ExAC,gnomAD
rs778170724	p.Ile170Phe	missense variant	-	NC_000004.12:g.95125044A>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro171Thr	missense variant	-	NC_000004.12:g.95125047C>A	NCI-TCGA
NCI-TCGA novel	p.Ser175AlaPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.95125058_95125077ATCCCTGAGAGACTTAATTG>-	NCI-TCGA
rs143554488	p.Ser175Ala	missense variant	-	NC_000004.12:g.95125059T>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs143554488	p.Ser175Pro	missense variant	-	NC_000004.12:g.95125059T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs367777041	p.Ser175Phe	missense variant	-	NC_000004.12:g.95125060C>T	ESP,ExAC,TOPMed,gnomAD
rs367777041	p.Ser175Cys	missense variant	-	NC_000004.12:g.95125060C>G	ESP,ExAC,TOPMed,gnomAD
rs1337920731	p.Leu176Val	missense variant	-	NC_000004.12:g.95125062C>G	TOPMed
rs771747962	p.Leu176Pro	missense variant	-	NC_000004.12:g.95125063T>C	ExAC,TOPMed,gnomAD
rs773000162	p.Arg177Gly	missense variant	-	NC_000004.12:g.95125065A>G	ExAC,TOPMed,gnomAD
COSM3826463	p.Arg177Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95125066G>A	NCI-TCGA Cosmic
rs1442468616	p.Asp178Asn	missense variant	-	NC_000004.12:g.95125068G>A	gnomAD
rs766089514	p.Leu179Phe	missense variant	-	NC_000004.12:g.95125073A>C	ExAC,gnomAD
rs911866039	p.Leu179Ser	missense variant	-	NC_000004.12:g.95125072T>C	TOPMed,gnomAD
rs776445882	p.Ile180Asn	missense variant	-	NC_000004.12:g.95125075T>A	ExAC
rs776445882	p.Ile180Thr	missense variant	-	NC_000004.12:g.95125075T>C	ExAC
rs1384205404	p.Gln182Arg	missense variant	-	NC_000004.12:g.95125081A>G	TOPMed
rs1362547455	p.Gln182His	missense variant	-	NC_000004.12:g.95125082G>T	gnomAD
RCV000664165	p.Ser183Pro	missense variant	Pulmonary arterial hypertension associated with congenital heart disease	NC_000004.12:g.95125083T>C	ClinVar
rs141691706	p.Ser183Thr	missense variant	-	NC_000004.12:g.95125083T>A	ESP,ExAC,TOPMed,gnomAD
rs141691706	p.Ser183Pro	missense variant	-	NC_000004.12:g.95125083T>C	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln184Ter	stop gained	-	NC_000004.12:g.95125086C>T	NCI-TCGA
rs200839585	p.Gly187Ala	missense variant	-	NC_000004.12:g.95125096G>C	1000Genomes,ExAC,gnomAD
rs767925715	p.Leu194Arg	missense variant	-	NC_000004.12:g.95125117T>G	ExAC,TOPMed,gnomAD
rs767925715	p.Leu194Pro	missense variant	-	NC_000004.12:g.95125117T>C	ExAC,TOPMed,gnomAD
rs767925715	p.Leu194Gln	missense variant	-	NC_000004.12:g.95125117T>A	ExAC,TOPMed,gnomAD
rs757843329	p.Leu194Val	missense variant	-	NC_000004.12:g.95125116C>G	ExAC,TOPMed,gnomAD
rs121434417	p.Ile200Lys	missense variant	Brachydactyly A2 (BDA2)	NC_000004.12:g.95129875T>A	UniProt,dbSNP
VAR_023819	p.Ile200Lys	missense variant	Brachydactyly A2 (BDA2)	NC_000004.12:g.95129875T>A	UniProt
rs121434417	p.Ile200Lys	missense variant	-	NC_000004.12:g.95129875T>A	-
RCV000006933	p.Ile200Lys	missense variant	Type A2 brachydactyly (BDA2)	NC_000004.12:g.95129875T>A	ClinVar
rs750954022	p.Ile200Val	missense variant	-	NC_000004.12:g.95129874A>G	ExAC,gnomAD
COSM5834894	p.Ala201Ter	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.95129872_95129873insTA	NCI-TCGA Cosmic
rs185062260	p.Lys202Arg	missense variant	-	NC_000004.12:g.95129881A>G	1000Genomes,ExAC,gnomAD
RCV000766164	p.Lys202Arg	missense variant	-	NC_000004.12:g.95129881A>G	ClinVar
rs766791531	p.Gln205Glu	missense variant	-	NC_000004.12:g.95129889C>G	ExAC,gnomAD
rs1344379581	p.Met206Val	missense variant	-	NC_000004.12:g.95129892A>G	TOPMed
rs1260652488	p.Lys208Gln	missense variant	-	NC_000004.12:g.95129898A>C	gnomAD
rs1299044974	p.Gln209Glu	missense variant	-	NC_000004.12:g.95129901C>G	TOPMed
rs1176798119	p.Gln209Pro	missense variant	-	NC_000004.12:g.95129902A>C	gnomAD
rs754044696	p.Ile210Val	missense variant	-	NC_000004.12:g.95129904A>G	ExAC,gnomAD
COSM1310393	p.Gly211Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95129908G>A	NCI-TCGA Cosmic
rs755131943	p.Arg214His	missense variant	-	NC_000004.12:g.95129917G>A	ExAC,TOPMed,gnomAD
rs1553941890	p.Arg214Ser	missense variant	-	NC_000004.12:g.95129916C>A	-
RCV000519599	p.Arg214Ser	missense variant	Type A2 brachydactyly (BDA2)	NC_000004.12:g.95129916C>A	ClinVar
NCI-TCGA novel	p.Tyr215Ser	missense variant	-	NC_000004.12:g.95129920A>C	NCI-TCGA
rs779006691	p.Gly216Ala	missense variant	-	NC_000004.12:g.95129923G>C	ExAC,gnomAD
rs748217063	p.Glu217Lys	missense variant	-	NC_000004.12:g.95129925G>A	ExAC,gnomAD
rs1303785017	p.Val218Asp	missense variant	-	NC_000004.12:g.95129929T>A	TOPMed
NCI-TCGA novel	p.Trp219Cys	missense variant	-	NC_000004.12:g.95129933G>T	NCI-TCGA
rs863225042	p.Trp219Ter	stop gained	-	NC_000004.12:g.95129933G>A	-
RCV000201044	p.Trp219Ter	nonsense	Acromesomelic dysplasia, Demirhan type (AMDD)	NC_000004.12:g.95129933G>A	ClinVar
NCI-TCGA novel	p.Lys222ArgPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.95129940_95129941insG	NCI-TCGA
rs957165736	p.Lys222Thr	missense variant	-	NC_000004.12:g.95129941A>C	TOPMed,gnomAD
rs758429876	p.Lys222Glu	missense variant	-	NC_000004.12:g.95129940A>G	ExAC,TOPMed,gnomAD
rs1295971366	p.Trp223Cys	missense variant	-	NC_000004.12:g.95129945G>C	TOPMed
rs35973133	p.Arg224Leu	missense variant	-	NC_000004.12:g.95129947G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs35973133	p.Arg224His	missense variant	-	NC_000004.12:g.95129947G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs35973133	p.Arg224His	missense variant	-	NC_000004.12:g.95129947G>A	UniProt,dbSNP
VAR_041403	p.Arg224His	missense variant	-	NC_000004.12:g.95129947G>A	UniProt
rs777745046	p.Arg224Cys	missense variant	-	NC_000004.12:g.95129946C>T	ExAC,TOPMed,gnomAD
RCV000386085	p.Arg224His	missense variant	Brachydactyly	NC_000004.12:g.95129947G>A	ClinVar
rs777745046	p.Arg224Cys	missense variant	-	NC_000004.12:g.95129946C>T	NCI-TCGA,NCI-TCGA Cosmic
COSM1059073	p.Glu226Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.95129952G>T	NCI-TCGA Cosmic
rs1200045028	p.Lys227Asn	missense variant	-	NC_000004.12:g.95129957G>T	TOPMed,gnomAD
rs574398307	p.Lys227Gln	missense variant	-	NC_000004.12:g.95129955A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs574398307	p.Lys227Glu	missense variant	-	NC_000004.12:g.95129955A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs372556235	p.Lys227Met	missense variant	-	NC_000004.12:g.95129956A>T	ESP,ExAC,TOPMed,gnomAD
rs745674753	p.Val228Ile	missense variant	-	NC_000004.12:g.95129958G>A	ExAC,gnomAD
rs769423606	p.Ala229Val	missense variant	-	NC_000004.12:g.95129962C>T	ExAC,gnomAD
rs1207219833	p.Lys231Ter	stop gained	-	NC_000004.12:g.95129967A>T	gnomAD
rs536641256	p.Phe234Leu	missense variant	-	NC_000004.12:g.95129978C>A	1000Genomes,ExAC,gnomAD
rs1468067202	p.Thr236Ala	missense variant	-	NC_000004.12:g.95129982A>G	gnomAD
rs773700021	p.Ala239Ser	missense variant	-	NC_000004.12:g.95129991G>T	ExAC,gnomAD
rs754133041	p.Phe242Tyr	missense variant	-	NC_000004.12:g.95130001T>A	ExAC,TOPMed,gnomAD
rs761226009	p.Phe242Val	missense variant	-	NC_000004.12:g.95130000T>G	ExAC,TOPMed,gnomAD
rs761226009	p.Phe242Ile	missense variant	-	NC_000004.12:g.95130000T>A	ExAC,TOPMed,gnomAD
rs761226009	p.Phe242Leu	missense variant	-	NC_000004.12:g.95130000T>C	ExAC,TOPMed,gnomAD
rs754133041	p.Phe242Ser	missense variant	-	NC_000004.12:g.95130001T>C	ExAC,TOPMed,gnomAD
rs376819253	p.Phe242Leu	missense variant	-	NC_000004.12:g.95130002C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs376819253	p.Phe242Leu	missense variant	-	NC_000004.12:g.95130002C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs754133041	p.Phe242Cys	missense variant	-	NC_000004.12:g.95130001T>G	ExAC,TOPMed,gnomAD
RCV000328112	p.Arg243Lys	missense variant	Brachydactyly	NC_000004.12:g.95130004G>A	ClinVar
NCI-TCGA novel	p.Arg243Ter	stop gained	-	NC_000004.12:g.95130003A>T	NCI-TCGA
rs1306782325	p.Arg243Ser	missense variant	-	NC_000004.12:g.95130005A>T	TOPMed,gnomAD
rs886059731	p.Arg243Lys	missense variant	-	NC_000004.12:g.95130004G>A	gnomAD
rs755476693	p.Arg243Gly	missense variant	-	NC_000004.12:g.95130003A>G	ExAC,TOPMed,gnomAD
rs751532146	p.Thr245Lys	missense variant	-	NC_000004.12:g.95130010C>A	ExAC,TOPMed,gnomAD
rs751532146	p.Thr245Arg	missense variant	-	NC_000004.12:g.95130010C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu246Ter	stop gained	-	NC_000004.12:g.95130012G>T	NCI-TCGA
rs369168607	p.Glu246Lys	missense variant	-	NC_000004.12:g.95130012G>A	ESP,ExAC,TOPMed,gnomAD
rs779737736	p.Glu246Ala	missense variant	-	NC_000004.12:g.95130013A>C	ExAC,TOPMed,gnomAD
rs748957679	p.Glu246Asp	missense variant	-	NC_000004.12:g.95130014A>T	ExAC,gnomAD
rs369168607	p.Glu246Gln	missense variant	-	NC_000004.12:g.95130012G>C	ESP,ExAC,TOPMed,gnomAD
rs779737736	p.Glu246Gly	missense variant	-	NC_000004.12:g.95130013A>G	ExAC,TOPMed,gnomAD
rs779737736	p.Glu246Val	missense variant	-	NC_000004.12:g.95130013A>T	ExAC,TOPMed,gnomAD
rs1270927104	p.Ile247Met	missense variant	-	NC_000004.12:g.95130017A>G	gnomAD
rs142696562	p.Gln249Ter	stop gained	-	NC_000004.12:g.95130021C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs887578785	p.Gln249His	missense variant	-	NC_000004.12:g.95130023G>C	TOPMed,gnomAD
rs887578785	p.Gln249His	missense variant	-	NC_000004.12:g.95130023G>T	TOPMed,gnomAD
rs142696562	p.Gln249Glu	missense variant	-	NC_000004.12:g.95130021C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs142696562	p.Gln249Ter	stop gained	-	NC_000004.12:g.95130021C>T	NCI-TCGA
rs187868598	p.Gln249Leu	missense variant	-	NC_000004.12:g.95130022A>T	1000Genomes,ExAC,gnomAD
rs187868598	p.Gln249Arg	missense variant	-	NC_000004.12:g.95130022A>G	1000Genomes,ExAC,gnomAD
rs771385869	p.Thr250Ile	missense variant	-	NC_000004.12:g.95130025C>T	ExAC,gnomAD
rs1223084316	p.Thr250Pro	missense variant	-	NC_000004.12:g.95130024A>C	gnomAD
rs1463003460	p.Val251Gly	missense variant	-	NC_000004.12:g.95130028T>G	TOPMed,gnomAD
rs1044164391	p.Met253Thr	missense variant	-	NC_000004.12:g.95130034T>C	gnomAD
rs948475886	p.Met253Leu	missense variant	-	NC_000004.12:g.95130033A>T	TOPMed,gnomAD
rs200446727	p.Met253Ile	missense variant	-	NC_000004.12:g.95130035G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs200446727	p.Met253Ile	missense variant	-	NC_000004.12:g.95130035G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs200198618	p.Arg254Ser	missense variant	-	NC_000004.12:g.95130038G>T	ESP,ExAC,TOPMed,gnomAD
RCV000384921	p.Arg254Ser	missense variant	Brachydactyly	NC_000004.12:g.95130038G>T	ClinVar
rs201034260	p.Asn257Asp	missense variant	-	NC_000004.12:g.95130045A>G	ExAC,TOPMed,gnomAD
RCV000480897	p.Asn257Asp	missense variant	-	NC_000004.12:g.95130045A>G	ClinVar
rs1473660478	p.Ile258Val	missense variant	-	NC_000004.12:g.95130048A>G	TOPMed
rs1268550390	p.Gly260Asp	missense variant	-	NC_000004.12:g.95131215G>A	TOPMed,gnomAD
rs1268550390	p.Gly260Val	missense variant	-	NC_000004.12:g.95131215G>T	TOPMed,gnomAD
rs375308110	p.Phe261Tyr	missense variant	-	NC_000004.12:g.95131218T>A	ESP,ExAC
rs761965542	p.Ile262Val	missense variant	-	NC_000004.12:g.95131220A>G	ExAC,gnomAD
rs767750336	p.Ala264Ser	missense variant	-	NC_000004.12:g.95131226G>T	ExAC,gnomAD
rs767750336	p.Ala264Thr	missense variant	-	NC_000004.12:g.95131226G>A	ExAC,gnomAD
rs1267095165	p.Ile266Val	missense variant	-	NC_000004.12:g.95131232A>G	gnomAD
COSM3607143	p.Gly268Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131239G>A	NCI-TCGA Cosmic
rs750357066	p.Gly270Glu	missense variant	-	NC_000004.12:g.95131245G>A	ExAC,gnomAD
rs1183108551	p.Gln274Glu	missense variant	-	NC_000004.12:g.95131256C>G	gnomAD
rs1414676286	p.Gln274His	missense variant	-	NC_000004.12:g.95131258G>C	gnomAD
rs755942515	p.Leu277Val	missense variant	-	NC_000004.12:g.95131265C>G	ExAC,TOPMed,gnomAD
rs147336783	p.Thr279Ile	missense variant	-	NC_000004.12:g.95131272C>T	ESP,ExAC,TOPMed,gnomAD
COSM4939291	p.Thr279Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131271A>G	NCI-TCGA Cosmic
rs147336783	p.Thr279Ile	missense variant	-	NC_000004.12:g.95131272C>T	NCI-TCGA,NCI-TCGA Cosmic
rs551370449	p.Asp280Asn	missense variant	-	NC_000004.12:g.95131274G>A	ExAC,TOPMed,gnomAD
rs1401526219	p.Asp280Glu	missense variant	-	NC_000004.12:g.95131276C>G	gnomAD
rs1395395990	p.Tyr281Cys	missense variant	-	NC_000004.12:g.95131278A>G	TOPMed,gnomAD
rs556937566	p.His282Tyr	missense variant	-	NC_000004.12:g.95131280C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs371779248	p.His282Gln	missense variant	-	NC_000004.12:g.95131282T>A	ESP,ExAC,TOPMed,gnomAD
rs1226334806	p.Gly285Asp	missense variant	-	NC_000004.12:g.95131290G>A	gnomAD
rs1478767431	p.Leu287Val	missense variant	-	NC_000004.12:g.95131295C>G	TOPMed
rs746544755	p.Tyr288Asn	missense variant	-	NC_000004.12:g.95131298T>A	ExAC,gnomAD
rs746544755	p.Tyr288His	missense variant	-	NC_000004.12:g.95131298T>C	ExAC,gnomAD
rs770135176	p.Tyr290His	missense variant	-	NC_000004.12:g.95131304T>C	ExAC,TOPMed,gnomAD
rs1001539320	p.Lys292Arg	missense variant	-	NC_000004.12:g.95131311A>G	gnomAD
rs1180765631	p.Lys292Asn	missense variant	-	NC_000004.12:g.95131312G>T	TOPMed
NCI-TCGA novel	p.Ser293Pro	missense variant	-	NC_000004.12:g.95131313T>C	NCI-TCGA
rs1206508270	p.Ser293Cys	missense variant	-	NC_000004.12:g.95131314C>G	gnomAD
rs1471841789	p.Thr294Ser	missense variant	-	NC_000004.12:g.95131317C>G	gnomAD
rs1481774294	p.Thr295Ile	missense variant	-	NC_000004.12:g.95131320C>T	TOPMed
rs1205132180	p.Asp297His	missense variant	-	NC_000004.12:g.95131325G>C	TOPMed
rs1435147011	p.Asp297Gly	missense variant	-	NC_000004.12:g.95131326A>G	gnomAD
rs112111860	p.Asp297Glu	missense variant	-	NC_000004.12:g.95131327C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1435147011	p.Asp297Ala	missense variant	-	NC_000004.12:g.95131326A>C	gnomAD
COSM21140	p.Asp297Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131325G>A	NCI-TCGA Cosmic
VAR_041404	p.Asp297Asn	Missense	-	-	UniProt
rs373000965	p.Ala298Thr	missense variant	-	NC_000004.12:g.95131328G>A	NCI-TCGA
rs373000965	p.Ala298Thr	missense variant	-	NC_000004.12:g.95131328G>A	ESP,ExAC,TOPMed,gnomAD
rs773095683	p.Lys299Arg	missense variant	-	NC_000004.12:g.95131332A>G	ExAC,TOPMed,gnomAD
rs762320529	p.Lys299Glu	missense variant	-	NC_000004.12:g.95131331A>G	ExAC,TOPMed,gnomAD
rs762320529	p.Lys299Gln	missense variant	-	NC_000004.12:g.95131331A>C	ExAC,TOPMed,gnomAD
rs760837301	p.Lys299Asn	missense variant	-	NC_000004.12:g.95131333A>C	ExAC,gnomAD
rs199613098	p.Met301Val	missense variant	-	NC_000004.12:g.95131337A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs753862322	p.Met301Ile	missense variant	-	NC_000004.12:g.95131339G>A	ExAC,gnomAD
rs370428276	p.Lys303Gln	missense variant	-	NC_000004.12:g.95131343A>C	ESP,ExAC,TOPMed,gnomAD
rs765766633	p.Ala305Thr	missense variant	-	NC_000004.12:g.95131349G>A	ExAC,gnomAD
rs1228462504	p.Tyr306Cys	missense variant	-	NC_000004.12:g.95131353A>G	gnomAD
rs757988979	p.Val309Ile	missense variant	-	NC_000004.12:g.95131361G>A	ExAC,gnomAD
NCI-TCGA novel	p.Ser310Arg	missense variant	-	NC_000004.12:g.95131364A>C	NCI-TCGA
rs777487568	p.Ser310Gly	missense variant	-	NC_000004.12:g.95131364A>G	ExAC,TOPMed,gnomAD
COSM271130	p.Leu315Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131380T>C	NCI-TCGA Cosmic
rs1358949370	p.Thr317Ile	missense variant	-	NC_000004.12:g.95131386C>T	TOPMed
rs750995828	p.Glu318Gln	missense variant	-	NC_000004.12:g.95131388G>C	ExAC,gnomAD
rs756816303	p.Phe320Ser	missense variant	-	NC_000004.12:g.95131395T>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser321Arg	missense variant	-	NC_000004.12:g.95131397A>C	NCI-TCGA
rs1332563913	p.Thr322Ile	missense variant	-	NC_000004.12:g.95131401C>T	TOPMed
rs869025614	p.Lys325Asn	missense variant	-	NC_000004.12:g.95131411A>C	-
RCV000208782	p.Lys325Asn	missense variant	Brachydactyly, type a1, d (BDA1D)	NC_000004.12:g.95131411A>C	ClinVar
COSM4126809	p.Pro326Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131413C>T	NCI-TCGA Cosmic
rs141032424	p.Ala327Thr	missense variant	-	NC_000004.12:g.95131415G>A	ESP,ExAC,TOPMed,gnomAD
rs141032424	p.Ala327Ser	missense variant	-	NC_000004.12:g.95131415G>T	ESP,ExAC,TOPMed,gnomAD
rs1157918508	p.Ala327Val	missense variant	-	NC_000004.12:g.95131416C>T	TOPMed
rs1170531805	p.Ile328Val	missense variant	-	NC_000004.12:g.95131418A>G	gnomAD
rs1471363374	p.Ala329Val	missense variant	-	NC_000004.12:g.95131422C>T	TOPMed
rs1471363374	p.Ala329Val	missense variant	-	NC_000004.12:g.95131422C>T	NCI-TCGA Cosmic
rs1177728492	p.His330Tyr	missense variant	-	NC_000004.12:g.95131424C>T	TOPMed
rs1427765668	p.Arg331Gln	missense variant	-	NC_000004.12:g.95131428G>A	gnomAD
rs1427765668	p.Arg331Gln	missense variant	-	NC_000004.12:g.95131428G>A	NCI-TCGA
rs376126706	p.Arg331Gly	missense variant	-	NC_000004.12:g.95131427C>G	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Asp332Asn	missense variant	-	NC_000004.12:g.95131430G>A	NCI-TCGA
rs978472184	p.Leu333Val	missense variant	-	NC_000004.12:g.95131433C>G	TOPMed,gnomAD
rs1167826885	p.Ile338Val	missense variant	-	NC_000004.12:g.95131448A>G	TOPMed,gnomAD
rs1167826885	p.Ile338Leu	missense variant	-	NC_000004.12:g.95131448A>C	TOPMed,gnomAD
NCI-TCGA novel	p.Leu339Val	missense variant	-	NC_000004.12:g.95131451C>G	NCI-TCGA
rs779359224	p.Val340Met	missense variant	-	NC_000004.12:g.95131454G>A	ExAC,gnomAD
rs1438345481	p.Lys341Met	missense variant	-	NC_000004.12:g.95131458A>T	gnomAD
rs748524936	p.Lys342Glu	missense variant	-	NC_000004.12:g.95131460A>G	ExAC,TOPMed,gnomAD
COSM1059077	p.Lys342Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131461A>T	NCI-TCGA Cosmic
rs748524936	p.Lys342Gln	missense variant	-	NC_000004.12:g.95131460A>C	ExAC,TOPMed,gnomAD
rs1264056613	p.Asn343Asp	missense variant	-	NC_000004.12:g.95131463A>G	TOPMed
rs773503299	p.Thr345Ser	missense variant	-	NC_000004.12:g.95131470C>G	ExAC,gnomAD
rs1339367828	p.Ile348Val	missense variant	-	NC_000004.12:g.95131478A>G	gnomAD
COSM1059079	p.Leu351Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95131487C>A	NCI-TCGA Cosmic
rs1224854340	p.Val355Leu	missense variant	-	NC_000004.12:g.95131499G>C	TOPMed
rs1282921509	p.Lys356Thr	missense variant	-	NC_000004.12:g.95131503A>C	TOPMed
NCI-TCGA novel	p.Phe357Leu	missense variant	-	NC_000004.12:g.95131507T>A	NCI-TCGA
rs528180688	p.Phe357Cys	missense variant	-	NC_000004.12:g.95131506T>G	1000Genomes,ExAC,gnomAD
rs1454953723	p.Ile358Val	missense variant	-	NC_000004.12:g.95131508A>G	TOPMed
rs201289177	p.Ser359Gly	missense variant	-	NC_000004.12:g.95131511A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs763992306	p.Asp360Gly	missense variant	-	NC_000004.12:g.95148750A>G	ExAC,gnomAD
rs1416896677	p.Thr361Lys	missense variant	-	NC_000004.12:g.95148753C>A	TOPMed,gnomAD
rs1179983257	p.Thr361Ala	missense variant	-	NC_000004.12:g.95148752A>G	gnomAD
COSM274145	p.Glu363Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.95148758G>T	NCI-TCGA Cosmic
rs1416959162	p.Val364Phe	missense variant	-	NC_000004.12:g.95148761G>T	gnomAD
rs773874757	p.Val364Ala	missense variant	-	NC_000004.12:g.95148762T>C	ExAC,TOPMed,gnomAD
rs1416959162	p.Val364Phe	missense variant	-	NC_000004.12:g.95148761G>T	NCI-TCGA
rs761588488	p.Asp365Asn	missense variant	-	NC_000004.12:g.95148764G>A	ExAC,gnomAD
rs1385960904	p.Asp365Val	missense variant	-	NC_000004.12:g.95148765A>T	gnomAD
rs1456285512	p.Asp365Glu	missense variant	-	NC_000004.12:g.95148766C>A	gnomAD
rs1025931662	p.Ile366Arg	missense variant	-	NC_000004.12:g.95148768T>G	TOPMed,gnomAD
rs767077000	p.Ile366Val	missense variant	-	NC_000004.12:g.95148767A>G	ExAC,gnomAD
rs1025931662	p.Ile366Thr	missense variant	-	NC_000004.12:g.95148768T>C	TOPMed,gnomAD
rs148550671	p.Pro367Ser	missense variant	-	NC_000004.12:g.95148770C>T	ESP,ExAC,TOPMed,gnomAD
rs1284054241	p.Pro367Arg	missense variant	-	NC_000004.12:g.95148771C>G	TOPMed,gnomAD
rs148550671	p.Pro367Thr	missense variant	-	NC_000004.12:g.95148770C>A	ESP,ExAC,TOPMed,gnomAD
rs1286747826	p.Pro368Arg	missense variant	-	NC_000004.12:g.95148774C>G	gnomAD
rs577188671	p.Pro368Ser	missense variant	-	NC_000004.12:g.95148773C>T	1000Genomes,ExAC,TOPMed,gnomAD
RCV000379873	p.Pro368Ser	missense variant	Brachydactyly	NC_000004.12:g.95148773C>T	ClinVar
rs747347346	p.Asn369Ser	missense variant	-	NC_000004.12:g.95148777A>G	ExAC,gnomAD
rs778257341	p.Asn369Asp	missense variant	-	NC_000004.12:g.95148776A>G	ExAC,TOPMed,gnomAD
RCV000283012	p.Asn369Asp	missense variant	Brachydactyly	NC_000004.12:g.95148776A>G	ClinVar
NCI-TCGA novel	p.Thr370Asn	missense variant	-	NC_000004.12:g.95148780C>A	NCI-TCGA
rs781424907	p.Thr370Ile	missense variant	-	NC_000004.12:g.95148780C>T	ExAC,TOPMed,gnomAD
rs757434006	p.Thr370Ser	missense variant	-	NC_000004.12:g.95148779A>T	ExAC,gnomAD
NCI-TCGA novel	p.Arg371Ter	stop gained	-	NC_000004.12:g.95148782C>T	NCI-TCGA
rs34970181	p.Arg371Gln	missense variant	-	NC_000004.12:g.95148783G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs34970181	p.Arg371Gln	missense variant	-	NC_000004.12:g.95148783G>A	UniProt,dbSNP
VAR_041405	p.Arg371Gln	missense variant	-	NC_000004.12:g.95148783G>A	UniProt
RCV000685866	p.Arg371Gln	missense variant	Type A2 brachydactyly (BDA2)	NC_000004.12:g.95148783G>A	ClinVar
rs34970181	p.Arg371Pro	missense variant	-	NC_000004.12:g.95148783G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs34970181	p.Arg371Leu	missense variant	-	NC_000004.12:g.95148783G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000340460	p.Arg371Leu	missense variant	Brachydactyly	NC_000004.12:g.95148783G>T	ClinVar
NCI-TCGA novel	p.Arg376Ser	missense variant	-	NC_000004.12:g.95148797C>A	NCI-TCGA
rs768328319	p.Arg376Cys	missense variant	-	NC_000004.12:g.95148797C>T	ExAC,gnomAD
rs768328319	p.Arg376Cys	missense variant	-	NC_000004.12:g.95148797C>T	NCI-TCGA,NCI-TCGA Cosmic
rs559805218	p.Tyr377Cys	missense variant	-	NC_000004.12:g.95148801A>G	1000Genomes
rs1292399504	p.Met378Arg	missense variant	-	NC_000004.12:g.95148804T>G	TOPMed
COSM256407	p.Asp384Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95148822A>G	NCI-TCGA Cosmic
rs1204148833	p.Ser386Thr	missense variant	-	NC_000004.12:g.95148828G>C	gnomAD
rs1426672160	p.Leu387Phe	missense variant	-	NC_000004.12:g.95148832G>T	TOPMed,gnomAD
rs760241910	p.Arg389Gly	missense variant	-	NC_000004.12:g.95148836A>G	ExAC,gnomAD
COSM274147	p.Arg389Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95148837G>T	NCI-TCGA Cosmic
rs766046737	p.Asn390Ser	missense variant	-	NC_000004.12:g.95148840A>G	ExAC,gnomAD
rs943183996	p.His391Pro	missense variant	-	NC_000004.12:g.95148843A>C	gnomAD
rs943183996	p.His391Arg	missense variant	-	NC_000004.12:g.95148843A>G	gnomAD
rs1412113319	p.Phe392Leu	missense variant	-	NC_000004.12:g.95148847C>G	gnomAD
rs1464900722	p.Phe392Val	missense variant	-	NC_000004.12:g.95148845T>G	TOPMed
rs1464900722	p.Phe392Val	missense variant	-	NC_000004.12:g.95148845T>G	NCI-TCGA Cosmic
rs753253207	p.Phe392Ser	missense variant	-	NC_000004.12:g.95148846T>C	ExAC,gnomAD
rs758874215	p.Gln393His	missense variant	-	NC_000004.12:g.95148850G>T	ExAC,gnomAD
NCI-TCGA novel	p.Tyr395Asp	missense variant	-	NC_000004.12:g.95148854T>G	NCI-TCGA
rs1350190350	p.Tyr395Ser	missense variant	-	NC_000004.12:g.95148855A>C	gnomAD
rs548452438	p.Met397Val	missense variant	-	NC_000004.12:g.95148860A>G	1000Genomes,ExAC,gnomAD
rs1276820746	p.Ala398Thr	missense variant	-	NC_000004.12:g.95148863G>A	TOPMed,gnomAD
rs1276820746	p.Ala398Ser	missense variant	-	NC_000004.12:g.95148863G>T	TOPMed,gnomAD
NCI-TCGA novel	p.Asp399Glu	missense variant	-	NC_000004.12:g.95148868C>A	NCI-TCGA
rs1279570525	p.Met400Ile	missense variant	-	NC_000004.12:g.95148871G>A	gnomAD
rs757593146	p.Met400Val	missense variant	-	NC_000004.12:g.95148869A>G	ExAC,gnomAD
COSM1059081	p.Ser402Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95148875A>G	NCI-TCGA Cosmic
rs1207154351	p.Phe403Val	missense variant	-	NC_000004.12:g.95148878T>G	gnomAD
NCI-TCGA novel	p.Gly404Ser	missense variant	-	NC_000004.12:g.95148881G>A	NCI-TCGA
COSM5179134	p.Leu407Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95148890C>A	NCI-TCGA Cosmic
rs746134819	p.Val410Phe	missense variant	-	NC_000004.12:g.95148899G>T	ExAC,TOPMed,gnomAD
rs746134819	p.Val410Leu	missense variant	-	NC_000004.12:g.95148899G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala411Asp	missense variant	-	NC_000004.12:g.95148903C>A	NCI-TCGA
rs969503674	p.Ala411Thr	missense variant	-	NC_000004.12:g.95148902G>A	TOPMed
rs969503674	p.Ala411Thr	missense variant	-	NC_000004.12:g.95148902G>A	NCI-TCGA
rs561948192	p.Arg412Lys	missense variant	-	NC_000004.12:g.95148906G>A	1000Genomes,TOPMed
rs1190618723	p.Arg412Gly	missense variant	-	NC_000004.12:g.95148905A>G	TOPMed
rs780171269	p.Arg413Thr	missense variant	-	NC_000004.12:g.95148909G>C	ExAC,gnomAD
rs186299744	p.Arg413Ser	missense variant	-	NC_000004.12:g.95148910A>T	1000Genomes,ExAC,TOPMed,gnomAD
rs980823830	p.Cys414Arg	missense variant	-	NC_000004.12:g.95148911T>C	TOPMed
rs1476786316	p.Cys414Tyr	missense variant	-	NC_000004.12:g.95148912G>A	gnomAD
COSM462104	p.Ser416Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.95148918C>G	NCI-TCGA Cosmic
rs1248109194	p.Gly418Asp	missense variant	-	NC_000004.12:g.95152643G>A	gnomAD
rs1450785068	p.Ile419Thr	missense variant	-	NC_000004.12:g.95152646T>C	gnomAD
COSM1059083	p.Ile419Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95152647A>G	NCI-TCGA Cosmic
rs1249589876	p.Val420Ala	missense variant	-	NC_000004.12:g.95152649T>C	TOPMed
rs1313808319	p.His428Gln	missense variant	-	NC_000004.12:g.95152674T>A	gnomAD
rs1447783996	p.His428Asp	missense variant	-	NC_000004.12:g.95152672C>G	TOPMed
rs1208101811	p.Leu430Val	missense variant	-	NC_000004.12:g.95152678C>G	TOPMed
rs1458772834	p.Pro432Leu	missense variant	-	NC_000004.12:g.95152685C>T	gnomAD
rs1165392388	p.Ser433Asn	missense variant	-	NC_000004.12:g.95152688G>A	gnomAD
rs985981901	p.Pro435Leu	missense variant	-	NC_000004.12:g.95152694C>T	TOPMed
COSM4820136	p.Ser436Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95152697C>G	NCI-TCGA Cosmic
COSM3918378	p.Tyr437His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95152699T>C	NCI-TCGA Cosmic
rs376221874	p.Met440Val	missense variant	-	NC_000004.12:g.95152708A>G	ESP,ExAC,TOPMed,gnomAD
rs376221874	p.Met440Leu	missense variant	-	NC_000004.12:g.95152708A>T	ESP,ExAC,TOPMed,gnomAD
rs879008149	p.Arg441Lys	missense variant	-	NC_000004.12:g.95152712G>A	TOPMed,gnomAD
rs879008149	p.Arg441Thr	missense variant	-	NC_000004.12:g.95152712G>C	TOPMed,gnomAD
rs752045710	p.Ile443Thr	missense variant	-	NC_000004.12:g.95152718T>C	ExAC,TOPMed,gnomAD
rs1432975995	p.Ile443Met	missense variant	-	NC_000004.12:g.95152719T>G	gnomAD
rs1325757207	p.Ile446Leu	missense variant	-	NC_000004.12:g.95152726A>C	gnomAD
NCI-TCGA novel	p.Lys447Asn	missense variant	-	NC_000004.12:g.95152731G>T	NCI-TCGA
rs371436999	p.Lys447Arg	missense variant	-	NC_000004.12:g.95152730A>G	ESP,ExAC,TOPMed,gnomAD
rs1321058552	p.Pro451Ser	missense variant	-	NC_000004.12:g.95152741C>T	TOPMed
rs756258100	p.Asn455His	missense variant	-	NC_000004.12:g.95152753A>C	ExAC,TOPMed,gnomAD
rs140047318	p.Arg456Pro	missense variant	-	NC_000004.12:g.95152757G>C	ESP,ExAC,TOPMed,gnomAD
rs140047318	p.Arg456Leu	missense variant	-	NC_000004.12:g.95152757G>T	ESP,ExAC,TOPMed,gnomAD
rs780280883	p.Arg456Gly	missense variant	-	NC_000004.12:g.95152756C>G	ExAC,TOPMed,gnomAD
rs780280883	p.Arg456Trp	missense variant	-	NC_000004.12:g.95152756C>T	ExAC,TOPMed,gnomAD
rs140047318	p.Arg456Gln	missense variant	-	NC_000004.12:g.95152757G>A	ESP,ExAC,TOPMed,gnomAD
rs1260383981	p.Ser458Asn	missense variant	-	NC_000004.12:g.95152763G>A	gnomAD
rs1424924349	p.Ser459Gly	missense variant	-	NC_000004.12:g.95152765A>G	gnomAD
rs1424924349	p.Ser459Arg	missense variant	-	NC_000004.12:g.95152765A>C	gnomAD
rs1190153129	p.Ser459Asn	missense variant	-	NC_000004.12:g.95152766G>A	gnomAD
rs1367092167	p.Glu461Lys	missense variant	-	NC_000004.12:g.95152771G>A	TOPMed,gnomAD
rs766596192	p.Cys462Phe	missense variant	-	NC_000004.12:g.95154549G>T	ExAC,gnomAD
rs766596192	p.Cys462Tyr	missense variant	-	NC_000004.12:g.95154549G>A	ExAC,gnomAD
rs1308433194	p.Arg464Ser	missense variant	-	NC_000004.12:g.95154556G>T	gnomAD
rs369609245	p.Gln465Arg	missense variant	-	NC_000004.12:g.95154558A>G	ExAC,TOPMed,gnomAD
rs778929099	p.Met466Leu	missense variant	-	NC_000004.12:g.95154560A>T	ExAC,gnomAD
rs1305848208	p.Gly467Ala	missense variant	-	NC_000004.12:g.95154564G>C	gnomAD
NCI-TCGA novel	p.Lys468Asn	missense variant	-	NC_000004.12:g.95154568A>C	NCI-TCGA
COSM6101133	p.Leu469Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95154569C>A	NCI-TCGA Cosmic
rs1234757133	p.Met470Thr	missense variant	-	NC_000004.12:g.95154573T>C	gnomAD
rs752827445	p.Thr471Ala	missense variant	-	NC_000004.12:g.95154575A>G	ExAC,gnomAD
COSM1671148	p.Trp474Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95154586G>T	NCI-TCGA Cosmic
rs746760963	p.Ala479Ser	missense variant	-	NC_000004.12:g.95154599G>T	ExAC,TOPMed,gnomAD
rs1241726567	p.Ala479Val	missense variant	-	NC_000004.12:g.95154600C>T	TOPMed
rs746760963	p.Ala479Thr	missense variant	-	NC_000004.12:g.95154599G>A	ExAC,TOPMed,gnomAD
rs1435017955	p.Thr483Ala	missense variant	-	NC_000004.12:g.95154611A>G	gnomAD
rs1057521819	p.Thr483Ile	missense variant	-	NC_000004.12:g.95154612C>T	-
RCV000444497	p.Thr483Ile	missense variant	-	NC_000004.12:g.95154612C>T	ClinVar
rs769339843	p.Ala484Ser	missense variant	-	NC_000004.12:g.95154614G>T	ExAC,gnomAD
rs1394503432	p.Ala484Val	missense variant	-	NC_000004.12:g.95154615C>T	gnomAD
COSM5759298	p.Ala484Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95154614G>A	NCI-TCGA Cosmic
rs121434419	p.Arg486Gln	missense variant	-	NC_000004.12:g.95154621G>A	-
rs121434419	p.Arg486Gln	missense variant	Brachydactyly A2 (BDA2)	NC_000004.12:g.95154621G>A	UniProt,dbSNP
VAR_037967	p.Arg486Gln	missense variant	Brachydactyly A2 (BDA2)	NC_000004.12:g.95154621G>A	UniProt
rs121434418	p.Arg486Trp	missense variant	Brachydactyly A2 (BDA2)	NC_000004.12:g.95154620C>T	UniProt,dbSNP
VAR_023820	p.Arg486Trp	missense variant	Brachydactyly A2 (BDA2)	NC_000004.12:g.95154620C>T	UniProt
rs121434418	p.Arg486Trp	missense variant	-	NC_000004.12:g.95154620C>T	-
RCV000006936	p.Arg486Gln	missense variant	Type A2 brachydactyly (BDA2)	NC_000004.12:g.95154621G>A	ClinVar
RCV000006934	p.Arg486Trp	missense variant	Type A2 brachydactyly (BDA2)	NC_000004.12:g.95154620C>T	ClinVar
rs369899177	p.Val487Ile	missense variant	-	NC_000004.12:g.95154623G>A	ESP
NCI-TCGA novel	p.Lys488Asn	missense variant	-	NC_000004.12:g.95154628G>T	NCI-TCGA
COSM4126816	p.Lys488Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95154627A>G	NCI-TCGA Cosmic
COSM3826466	p.Lys489Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.95154631A>C	NCI-TCGA Cosmic
rs748806114	p.Leu491Val	missense variant	-	NC_000004.12:g.95154635C>G	ExAC,gnomAD
NCI-TCGA novel	p.Ser497Phe	missense variant	-	NC_000004.12:g.95154654C>T	NCI-TCGA
rs1460265958	p.Ser497Ala	missense variant	-	NC_000004.12:g.95154653T>G	gnomAD
rs773752951	p.Gln498Arg	missense variant	-	NC_000004.12:g.95154657A>G	ExAC,TOPMed,gnomAD
rs1297303851	p.Gln498Ter	stop gained	-	NC_000004.12:g.95154656C>T	gnomAD
NCI-TCGA novel	p.Asp499Val	missense variant	-	NC_000004.12:g.95154660A>T	NCI-TCGA
rs1300655982	p.Ile500Val	missense variant	-	NC_000004.12:g.95154662A>G	TOPMed,gnomAD
rs761009116	p.Ile500Thr	missense variant	-	NC_000004.12:g.95154663T>C	ExAC,gnomAD
rs766714132	p.Lys501Arg	missense variant	-	NC_000004.12:g.95154666A>G	ExAC,TOPMed,gnomAD
rs766714132	p.Lys501Thr	missense variant	-	NC_000004.12:g.95154666A>C	ExAC,TOPMed,gnomAD
rs1229797838	p.Lys501Glu	missense variant	-	NC_000004.12:g.95154665A>G	NCI-TCGA Cosmic
rs1229797838	p.Lys501Glu	missense variant	-	NC_000004.12:g.95154665A>G	TOPMed,gnomAD
rs1443065466	p.LeuTer502LeuUnk	stop lost	-	NC_000004.12:g.95154670_95154671del	TOPMed

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0004096	Asthma	disease	LHGDN
C0005941	Bone Diseases, Developmental	group	CTD_human
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0006386	Bunion	phenotype	HPO
C0007113	Rectal Carcinoma	disease	BEFREE
C0009081	Congenital clubfoot	disease	HPO
C0014175	Endometriosis	disease	BEFREE
C0015393	Eye Abnormalities	group	CTD_human
C0017636	Glioblastoma	disease	BEFREE
C0018536	Hallux Valgus	phenotype	HPO
C0020542	Pulmonary Hypertension	phenotype	LHGDN
C0023012	Language Delay	phenotype	HPO
C0025995	Micromelia	disease	HPO
C0029422	Osteochondrodysplasias	group	HPO
C0029434	Osteogenesis Imperfecta	disease	GENOMICS_ENGLAND
C0029456	Osteoporosis	disease	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0031900	Pierre Robin Syndrome	disease	BEFREE
C0033578	Prostatic Neoplasms	group	CTD_human;LHGDN
C0039075	Syndactyly	disease	BEFREE
C0152171	Idiopathic pulmonary hypertension	disease	BEFREE
C0162298	Joint stiffness	phenotype	HPO
C0206762	Limb Deformities, Congenital	group	BEFREE
C0220620	Gastrointestinal Carcinoid Tumor	disease	BEFREE
C0221357	Brachydactyly	disease	BEFREE;HPO
C0231679	Ulnar deviation of the fingers	phenotype	HPO
C0232939	Primary physiologic amenorrhea	disease	HPO
C0233715	Speech impairment	phenotype	HPO
C0239594	Short finger	phenotype	HPO
C0241210	Speech Delay	phenotype	HPO
C0265260	Chondrodysplasia, Grebe type	disease	BEFREE;ORPHANET
C0265654	Tarsal Coalition	disease	HPO
C0266399	Infantile uterus	disease	HPO
C0278701	Gastric Adenocarcinoma	disease	UNIPROT
C0278883	Metastatic melanoma	disease	UNIPROT
C0279702	Conventional (Clear Cell) Renal Cell Carcinoma	disease	BEFREE
C0343284	Chondrodysplasia	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0376358	Malignant neoplasm of prostate	disease	CTD_human
C0376634	Craniofacial Abnormalities	group	CTD_human
C0426422	Narrow nose	phenotype	HPO
C0431863	Carpal synostosis	disease	HPO
C0431890	Hypoplasia of thumb	disease	HPO
C0431904	Ulnar polydactyly of fingers	disease	HPO
C0432040	Simple syndactyly of toes, first web space	disease	HPO
C0454644	Delayed speech and language development	phenotype	HPO
C0575897	Thumb deformity	phenotype	HPO
C0678222	Breast Carcinoma	disease	BEFREE
C0877165	Short phalanx of finger	phenotype	HPO
C0948896	Primary hypogonadism	disease	HPO
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1261473	Sarcoma	group	HPO
C1300268	Brachydactyly syndrome type C	disease	ORPHANET
C1832119	Fibular hypoplasia	phenotype	HPO
C1832702	BRACHYDACTYLY, TYPE A2	disease	BEFREE;CLINVAR;CTD_human;HPO;ORPHANET;UNIPROT
C1834034	Aplasia/Hypoplasia of the middle phalanx of the 5th finger	phenotype	HPO
C1834060	Short middle phalanx of the 5th finger	phenotype	HPO
C1836182	Chondrodysplasia, acromesomelic, with genital anomalies	disease	CTD_human
C1836184	Short femoral neck	phenotype	HPO
C1836186	Fibular aplasia	phenotype	HPO
C1836187	Widened proximal tibial metaphyses	phenotype	HPO
C1836189	Radial deviation of finger	phenotype	HPO
C1836192	Aplasia/Hypoplasia involving the metacarpal bones	phenotype	HPO
C1836193	Synostosis of carpal bones	phenotype	HPO
C1836195	Short toe	phenotype	HPO
C1844548	Hypoplastic finger	phenotype	HPO
C1844709	Radial deviation of the 2nd finger	phenotype	HPO
C1844891	Ulnar deviation of the 2nd finger	phenotype	HPO
C1846950	Short middle phalanx of finger	phenotype	HPO
C1848453	Poor motor coordination	phenotype	HPO
C1848673	Hypoplastic feet	phenotype	HPO
C1849020	Short metatarsal	phenotype	HPO
C1849937	Disproportionate short-limb short stature	phenotype	HPO
C1850049	Clinodactyly of the 5th finger	disease	HPO
C1850259	Short tibia	phenotype	HPO
C1855091	Short proximal phalanx of thumb	phenotype	HPO
C1855340	Bowing of the long bones	phenotype	HPO
C1856732	Aplasia/Hypoplasia of the fibula	phenotype	HPO
C1856738	Fibular hypoplasia and complex brachydactyly	disease	ORPHANET
C1857108	Limitation of joint mobility	phenotype	HPO
C1860606	Short proximal phalanx of finger	phenotype	HPO
C1860614	ULNAR HYPOPLASIA	phenotype	HPO
C1862095	Bilateral single transverse palmar creases	phenotype	HPO
C1862103	Brachydactyly type C	disease	BEFREE;HPO;ORPHANET
C1862132	Short ulnae	phenotype	HPO
C1862140	Brachydactyly type A3	disease	HPO
C1862142	Short 2nd finger	phenotype	HPO
C1862144	Aplasia/Hypoplasia of the middle phalanx of the 2nd finger	phenotype	HPO
C1862147	Medially deviated second toe	phenotype	HPO
C1862151	BRACHYDACTYLY, TYPE A1 (disorder)	disease	BEFREE;ORPHANET
C1862313	Short distal phalanx of the thumb	phenotype	HPO
C1865037	Cone-shaped epiphysis	phenotype	HPO
C1865992	Short hallux	phenotype	HPO
C1866241	Broad foot	phenotype	HPO
C1867131	Broad hallux	phenotype	HPO
C1956346	Coronary Artery Disease	disease	GWASCAT
C2930970	Acromesomelic dysplasia Hunter-Thompson type	disease	BEFREE
C2973725	Pulmonary arterial hypertension	disease	GENOMICS_ENGLAND
C3179508	Aplasia/Hypoplasia of the thumb	phenotype	HPO
C3203102	Idiopathic pulmonary arterial hypertension	disease	BEFREE;GENOMICS_ENGLAND
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND
C3714899	SYMPHALANGISM, PROXIMAL, 1A	disease	BEFREE
C4020891	Pinched nasal bridge	phenotype	HPO
C4021302	Aplasia of the proximal phalanges of the hand	phenotype	HPO
C4021427	Complete duplication of distal phalanx of the thumb	phenotype	HPO
C4021438	Short distal phalanx of the 2nd finger	phenotype	HPO
C4021465	Pseudoepiphyses of the 2nd finger	phenotype	HPO
C4021611	Abnormality of epiphysis morphology	phenotype	HPO
C4021735	Abnormality of the hip bone	phenotype	HPO
C4021782	Abnormality of the fingernails	phenotype	HPO
C4022107	Aplasia of the middle phalanges of the toes	phenotype	HPO
C4023976	Aplasia/Hypoplasia of the middle phalanges of the toes	phenotype	HPO
C4024098	Aplasia/Hypoplasia of the 1st metacarpal	phenotype	HPO
C4024235	Stippling of the epiphysis of the distal phalanx of the thumb	phenotype	HPO
C4024283	Triangular shaped middle phalanx of the 2nd finger	phenotype	HPO
C4024318	Bracket epiphysis of the middle phalanx of the 2nd finger	phenotype	HPO
C4024536	Bracket epiphysis of the middle phalanx of the 5th finger	phenotype	HPO
C4024552	Triangular shaped middle phalanx of the 5th finger	phenotype	HPO
C4025662	Abnormality of the ulna	phenotype	HPO
C4025663	Abnormality of tibia morphology	phenotype	HPO
C4025675	Abnormality of the radius	phenotype	HPO
C4225183	BRACHYDACTYLY, TYPE A1, D	disease	CLINVAR;CTD_human;UNIPROT
C4225404	ACROMESOMELIC DYSPLASIA, DEMIRHAN TYPE	disease	CLINVAR;UNIPROT
C4280538	Curvature of little finger	phenotype	HPO
C4280567	Abnormal skeletal development	phenotype	HPO
C4280630	Pinched bridge of nose	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0004674	protein serine/threonine kinase activity	IDA
GO:0004674	protein serine/threonine kinase activity	IBA
GO:0004675	transmembrane receptor protein serine/threonine kinase activity	NAS
GO:0004675	transmembrane receptor protein serine/threonine kinase activity	IMP
GO:0005025	transforming growth factor beta receptor activity, type I	IBA
GO:0005515	protein binding	IPI
GO:0005524	ATP binding	IDA
GO:0046332	SMAD binding	IDA
GO:0046332	SMAD binding	IBA
GO:0046872	metal ion binding	IEA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001501	skeletal system development	IMP
GO:0001502	cartilage condensation	NAS
GO:0001550	ovarian cumulus expansion	ISS
GO:0001654	eye development	ISS
GO:0002063	chondrocyte development	ISS
GO:0006468	protein phosphorylation	IDA
GO:0006468	protein phosphorylation	IBA
GO:0006954	inflammatory response	IEA
GO:0009953	dorsal/ventral pattern formation	IBA
GO:0030166	proteoglycan biosynthetic process	ISS
GO:0030501	positive regulation of bone mineralization	IMP
GO:0030509	BMP signaling pathway	NAS
GO:0030509	BMP signaling pathway	IDA
GO:0030509	BMP signaling pathway	IBA
GO:0030509	BMP signaling pathway	TAS
GO:0031290	retinal ganglion cell axon guidance	IEA
GO:0032332	positive regulation of chondrocyte differentiation	ISS
GO:0035108	limb morphogenesis	IMP
GO:0042698	ovulation cycle	ISS
GO:0045597	positive regulation of cell differentiation	IMP
GO:0045669	positive regulation of osteoblast differentiation	IMP
GO:0045944	positive regulation of transcription by RNA polymerase II	IMP
GO:0060041	retina development in camera-type eye	IEA
GO:0060350	endochondral bone morphogenesis	ISS
GO:0061036	positive regulation of cartilage development	ISS
GO:0071363	cellular response to growth factor stimulus	IBA
GO:0071773	cellular response to BMP stimulus	IMP
GO:1902043	positive regulation of extrinsic apoptotic signaling pathway via death domain receptors	IEA
GO:1902731	negative regulation of chondrocyte proliferation	ISS

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005886	plasma membrane	ISS
GO:0005886	plasma membrane	IBA
GO:0005886	plasma membrane	TAS
GO:0005887	integral component of plasma membrane	IC
GO:0030425	dendrite	IEA
GO:0043025	neuronal cell body	IEA
GO:0043235	receptor complex	TAS
GO:0043235	receptor complex	IBA
GO:1990712	HFE-transferrin receptor complex	IC

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-162582	Signal Transduction	TAS
R-HSA-201451	Signaling by BMP	TAS
R-HSA-9006936	Signaling by TGF-beta family members	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
C026486	1,2,5,6-dibenzanthracene	1,2,5,6-dibenzanthracene results in decreased expression of BMPR1B mRNA	26377693
C548651	2-(1'H-indole-3'-carbonyl)thiazole-4-carboxylic acid methyl ester	2-(1'H-indole-3'-carbonyl)thiazole-4-carboxylic acid methyl ester results in decreased expression of BMPR1B mRNA	19933214
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of BMPR1B mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BMPR1B mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BMPR1B mRNA	27188386
C035763	5,5'-bis(8-(phenylamino)-1-naphthalenesulfonate)	5,5'-bis(8-(phenylamino)-1-naphthalenesulfonate) binds to BMPR1B protein	17363346
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide affects the expression of BMPR1B mRNA	20382639
C052410	9-chloro-2-(2-furyl)-(1,2,4)triazolo(1,5-c)quinazolin-5-imine	9-chloro-2-(2-furyl)-(1,2,4)triazolo(1,5-c)quinazolin-5-imine results in increased expression of BMPR1B mRNA	25633564
D020106	Acrylamide	Acrylamide affects the expression of BMPR1B mRNA	28959563
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of BMPR1B gene	27153756
D016604	Aflatoxin B1	Aflatoxin B1 results in increased methylation of BMPR1B intron	30157460
D018501	Antirheumatic Agents	Antirheumatic Agents results in increased expression of BMPR1B mRNA	24449571
D001104	Arbutin	Arbutin results in decreased expression of BMPR1B mRNA	17103032
D001151	Arsenic	Arsenic results in increased methylation of BMPR1B gene	24525453
D001205	Ascorbic Acid	Ascorbic Acid results in increased expression of BMPR1B mRNA	15305145
D001280	Atrazine	Atrazine results in increased expression of BMPR1B mRNA	25929836
D001397	Azoxymethane	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of BMPR1B mRNA	29950665
C487081	belinostat	belinostat results in decreased expression of BMPR1B mRNA	26272509
D001564	Benzo(a)pyrene	Benzo(a)pyrene affects the localization of BMPR1B protein	27740625
D001564	Benzo(a)pyrene	Benzo(a)pyrene affects the methylation of BMPR1B intron	30157460
D001564	Benzo(a)pyrene	AHR protein promotes the reaction [Benzo(a)pyrene results in decreased expression of BMPR1B mRNA]	15034205
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of BMPR1B mRNA	15034205
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of BMPR1B mRNA	22228805; 27195522;
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of BMPR1B mRNA	30951980
C006780	bisphenol A	bisphenol A affects the localization of BMPR1B protein	27740625
C006780	bisphenol A	bisphenol A results in increased expression of BMPR1B mRNA	18007998
C006780	bisphenol A	[bisphenol A co-treated with FSHB protein] results in decreased expression of BMPR1B mRNA	25778539
C006780	bisphenol A	[bisphenol A co-treated with Estradiol] results in decreased expression of BMPR1B mRNA	26496021
C006780	bisphenol A	[bisphenol A co-treated with tributyltin] results in increased expression of BMPR1B mRNA	31129395
C006780	bisphenol A	bisphenol A results in increased expression of BMPR1B mRNA	29097150
C018475	butyraldehyde	butyraldehyde results in decreased expression of BMPR1B mRNA	26079696
D002117	Calcitriol	Calcitriol results in increased expression of BMPR1B mRNA	21592394
D002117	Calcitriol	[Testosterone co-treated with Calcitriol] results in increased expression of BMPR1B mRNA	21592394
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in decreased expression of BMPR1B mRNA	27392435
D002945	Cisplatin	Cisplatin results in decreased expression of BMPR1B mRNA	27392435
D000077209	Decitabine	Decitabine results in decreased expression of BMPR1B mRNA	27915011
D016264	Dextran Sulfate	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of BMPR1B mRNA	29950665
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in increased expression of BMPR1B mRNA	21266533
D004041	Dietary Fats	Dietary Fats results in decreased expression of BMPR1B mRNA	25016146
D013196	Dihydrotestosterone	Dihydrotestosterone results in increased expression of BMPR1B mRNA	18007998; 29581250;
C516138	dorsomorphin	dorsomorphin results in increased expression of BMPR1B mRNA	25633564
C516138	dorsomorphin	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of BMPR1B mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BMPR1B mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BMPR1B mRNA	27188386
D052244	Endocrine Disruptors	Endocrine Disruptors results in increased expression of BMPR1B mRNA	25198161
C118739	entinostat	entinostat results in decreased expression of BMPR1B mRNA	26272509
C118739	entinostat	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of BMPR1B mRNA	27188386
D004958	Estradiol	EGF protein inhibits the reaction [Estradiol results in decreased expression of BMPR1B mRNA]	24758408
D004958	Estradiol	Estradiol results in decreased expression of BMPR1B mRNA	24758408
D004958	Estradiol	[bisphenol A co-treated with Estradiol] results in decreased expression of BMPR1B mRNA	26496021
D000431	Ethanol	Ethanol results in increased expression of BMPR1B mRNA	30319688
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of BMPR1B mRNA	17606305
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in decreased expression of BMPR1B mRNA	27392435
C561695	(+)-JQ1 compound	(+)-JQ1 compound affects the expression of BMPR1B mRNA	26733615
C561695	(+)-JQ1 compound	(+)-JQ1 compound promotes the reaction [Panobinostat affects the expression of BMPR1B mRNA]	26733615
C561695	(+)-JQ1 compound	Panobinostat promotes the reaction [(+)-JQ1 compound affects the expression of BMPR1B mRNA]	26733615
D008044	Linuron	Linuron results in decreased expression of BMPR1B mRNA	12730624
C540278	MDV 3100	MDV 3100 results in decreased expression of BMPR1B mRNA	29581250
D009151	Mustard Gas	Mustard Gas results in increased expression of BMPR1B mRNA	15674844
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in decreased expression of BMPR1B mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in decreased expression of BMPR1B mRNA	25554681
D000077767	Panobinostat	(+)-JQ1 compound promotes the reaction [Panobinostat affects the expression of BMPR1B mRNA]	26733615
D000077767	Panobinostat	Panobinostat affects the expression of BMPR1B mRNA	26733615
D000077767	Panobinostat	Panobinostat promotes the reaction [(+)-JQ1 compound affects the expression of BMPR1B mRNA]	26733615
C011272	perfosfamide	perfosfamide results in decreased expression of BMPR1B mRNA	19429390
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BMPR1B mRNA	27188386
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in increased expression of BMPR1B mRNA	26272509
D000077185	Resveratrol	Resveratrol results in increased expression of BMPR1B mRNA	25866375
C028632	rutecarpine	rutecarpine results in decreased expression of BMPR1B mRNA	25633564
D012822	Silicon Dioxide	Silicon Dioxide analog results in increased expression of BMPR1B mRNA	23806026
D012822	Silicon Dioxide	Silicon Dioxide results in decreased expression of BMPR1B mRNA	25351596
D053260	Soot	Soot results in decreased expression of BMPR1B mRNA	26551751
C433985	SU 9516	SU 9516 results in increased expression of BMPR1B mRNA	25633564
D013739	Testosterone	[Testosterone co-treated with Calcitriol] results in increased expression of BMPR1B mRNA	21592394
D013739	Testosterone	Testosterone results in increased expression of BMPR1B mRNA	21592394
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of BMPR1B mRNA	21570461
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of BMPR1B mRNA	19933214
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of BMPR1B mRNA	30172648
C009495	titanium dioxide	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of BMPR1B mRNA	29950665
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased methylation of BMPR1B gene	26756918
D014118	Toxins, Biological	Toxins, Biological affects the expression of BMPR1B mRNA	19682533
D014212	Tretinoin	Tretinoin results in increased expression of BMPR1B mRNA	21934132
D014212	Tretinoin	Tretinoin results in increased expression of BMPR1B protein	16894153
C011559	tributyltin	[bisphenol A co-treated with tributyltin] results in increased expression of BMPR1B mRNA	31129395
D014241	Trichloroethylene	Trichloroethylene results in decreased methylation of BMPR1B gene	27618143
C012589	trichostatin A	trichostatin A results in decreased expression of BMPR1B mRNA	28542535
C012589	trichostatin A	trichostatin A results in increased expression of BMPR1B mRNA	24935251
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BMPR1B mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of BMPR1B mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in decreased methylation of BMPR1B gene	29154799
D014635	Valproic Acid	Valproic Acid results in increased expression of BMPR1B mRNA	23179753; 24383497; 24935251; 26272509; 28001369;
D001335	Vehicle Emissions	Vehicle Emissions affects the methylation of BMPR1B gene	25560391
C029297	vinylidene chloride	vinylidene chloride results in decreased expression of BMPR1B mRNA	26682919
D014874	Water Pollutants, Chemical	Water Pollutants, Chemical results in increased expression of BMPR1B mRNA	25198161

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0025	Alternative splicing
KW-0067	ATP-binding
KW-1003	Cell membrane
KW-0891	Chondrogenesis
KW-0225	Disease mutation
KW-1015	Disulfide bond
KW-0242	Dwarfism
KW-0418	Kinase
KW-0460	Magnesium
KW-0464	Manganese
KW-0472	Membrane
KW-0479	Metal-binding
KW-0547	Nucleotide-binding
KW-0621	Polymorphism
KW-0675	Receptor
KW-1185	Reference proteome
KW-0723	Serine/threonine-protein kinase
KW-0732	Signal
KW-0808	Transferase
KW-0812	Transmembrane
KW-1133	Transmembrane helix

Interpro

InterPro ID	InterPro Term
IPR000472	Activin_recp
IPR003605	GS_dom
IPR011009	Kinase-like_dom_sf
IPR000719	Prot_kinase_dom
IPR017441	Protein_kinase_ATP_BS
IPR001245	Ser-Thr/Tyr_kinase_cat_dom
IPR008271	Ser/Thr_kinase_AS
IPR000333	TGFB_receptor

PROSITE

PROSITE ID	PROSITE Term
PS51256	GS
PS00107	PROTEIN_KINASE_ATP
PS50011	PROTEIN_KINASE_DOM
PS00108	PROTEIN_KINASE_ST

Pfam

Pfam ID	Pfam Term
PF01064	Activin_recp
PF07714	Pkinase_Tyr
PF08515	TGF_beta_GS

Gene: BMPR1B

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction