CleftGeneDB-Search

Gene: TBX3

Basic information

Tag	Content
Uniprot ID	O15119; Q8TB20; Q9UKF8;
Entrez ID	6926
Genbank protein ID	AAH25258.1; AAF61816.1; AAC12947.1; AAF61207.1; AAD50989.2;
Genbank nucleotide ID	NM_005996.3; NM_016569.3;
Ensembl protein ID	ENSP00000257566; ENSP00000257567;
Ensembl nucleotide ID	ENSG00000135111
Gene name	T-box transcription factor TBX3
Gene symbol	TBX3
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Transcriptional repressor involved in developmental processes. Probably plays a role in limb pattern formation. Acts as a negative regulator of PML function in cellular senescence.
Sequence	MSLSMRDPVI PGTSMAYHPF LPHRAPDFAM SAVLGHQPPF FPALTLPPNG AAALSLPGAL 60 AKPIMDQLVG AAETGIPFSS LGPQAHLRPL KTMEPEEEVE DDPKVHLEAK ELWDQFHKRG 120 TEMVITKSGR RMFPPFKVRC SGLDKKAKYI LLMDIIAADD CRYKFHNSRW MVAGKADPEM 180 PKRMYIHPDS PATGEQWMSK VVTFHKLKLT NNISDKHGFT LAFPSDHATW QGNYSFGTQT 240 ILNSMHKYQP RFHIVRANDI LKLPYSTFRT YLFPETEFIA VTAYQNDKIT QLKIDNNPFA 300 KGFRDTGNGR REKRKQLTLQ SMRVFDERHK KENGTSDESS SEQAAFNCFA QASSPAASTV 360 GTSNLKDLCP SEGESDAEAE SKEEHGPEAC DAAKISTTTS EEPCRDKGSP AVKAHLFAAE 420 RPRDSGRLDK ASPDSRHSPA TISSSTRGLG AEERRSPVRE GTAPAKVEEA RALPGKEAFA 480 PLTVQTDAAA AHLAQGPLPG LGFAPGLAGQ QFFNGHPLFL HPSQFAMGGA FSSMAAAGMG 540 PLLATVSGAS TGVSGLDSTA MASAAAAQGL SGASAATLPF HLQQHVLASQ GLAMSPFGSL 600 FPYPYTYMAA AAAASSAAAS SSVHRHPFLN LNTMRPRLRY SPYSIPVPVP DGSSLLTTAL 660 PSMAAAAGPL DGKVAALAAS PASVAVDSGS ELNSRSSTLS SSSMSLSPKL CAEKEAATSE 720 LQSIQRLVSG LEAKPDRSRS ASP 743

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1H6F

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	TBX3	102185207	A0A452EBG9		Capra hircus	Prediction	More>>
1:1 ortholog	TBX3	6926	O15119		Homo sapiens	Prediction	More>>
1:1 ortholog	Tbx3	21386	P70324	CPO	Mus musculus	Publication	More>>
1:1 ortholog	TBX3	740308	A0A2I3T7H8		Pan troglodytes	Prediction	More>>
1:1 ortholog	Tbx3	353305	Q7TST9		Rattus norvegicus	Prediction	More>>
1:1 ortholog	tbx3a	556870	B8JKS6		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
NCI-TCGA novel	p.Ser2Arg	missense variant	-	NC_000012.12:g.114683195G>T	NCI-TCGA
rs749690877	p.Ser4Phe	missense variant	-	NC_000012.12:g.114683190G>A	ExAC,gnomAD
rs771057510	p.Ser4Pro	missense variant	-	NC_000012.12:g.114683191A>G	ExAC,gnomAD
NCI-TCGA novel	p.Met5Ile	missense variant	-	NC_000012.12:g.114683186C>T	NCI-TCGA
rs778445850	p.Met5Leu	missense variant	-	NC_000012.12:g.114683188T>G	ExAC,gnomAD
rs1475498518	p.Arg6Gly	missense variant	-	NC_000012.12:g.114683185T>C	TOPMed,gnomAD
rs770471600	p.Pro8Thr	missense variant	-	NC_000012.12:g.114683179G>T	ExAC,gnomAD
rs748492156	p.Val9Ile	missense variant	-	NC_000012.12:g.114683176C>T	ExAC,gnomAD
rs748492156	p.Val9Leu	missense variant	-	NC_000012.12:g.114683176C>G	ExAC,gnomAD
rs781731495	p.Pro11Thr	missense variant	-	NC_000012.12:g.114683170G>T	ExAC,gnomAD
rs1197831255	p.Thr13Arg	missense variant	-	NC_000012.12:g.114683163G>C	gnomAD
rs757971486	p.Met15Thr	missense variant	-	NC_000012.12:g.114683157A>G	ExAC,gnomAD
NCI-TCGA novel	p.Ala16Thr	missense variant	-	NC_000012.12:g.114683155C>T	NCI-TCGA
rs750101328	p.Ala16Asp	missense variant	-	NC_000012.12:g.114683154G>T	ExAC,gnomAD
rs778215802	p.His18Arg	missense variant	-	NC_000012.12:g.114683148T>C	ExAC,gnomAD
rs753730951	p.His23Gln	missense variant	-	NC_000012.12:g.114683132G>T	ExAC,gnomAD
rs1414698447	p.Arg24Pro	missense variant	-	NC_000012.12:g.114683130C>G	gnomAD
rs763999960	p.Pro26Ser	missense variant	-	NC_000012.12:g.114683125G>A	ExAC,gnomAD
COSM72930	p.Asp27Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114683122C>A	NCI-TCGA Cosmic
rs1393790676	p.Met30Val	missense variant	-	NC_000012.12:g.114683113T>C	TOPMed,gnomAD
rs760649529	p.Ser31Thr	missense variant	-	NC_000012.12:g.114683109C>G	ExAC,gnomAD
rs1029030166	p.Ala32Val	missense variant	-	NC_000012.12:g.114683106G>A	gnomAD
rs1410475056	p.Ala32Ser	missense variant	-	NC_000012.12:g.114683107C>A	gnomAD
rs147270297	p.Val33Leu	missense variant	-	NC_000012.12:g.114683104C>A	ESP,ExAC,TOPMed,gnomAD
rs770877136	p.Pro38Thr	missense variant	-	NC_000012.12:g.114683089G>T	ExAC,TOPMed,gnomAD
rs1436293096	p.Pro39Leu	missense variant	-	NC_000012.12:g.114683085G>A	TOPMed,gnomAD
rs1214536516	p.Phe41Ser	missense variant	-	NC_000012.12:g.114683079A>G	gnomAD
rs773465438	p.Phe41Leu	missense variant	-	NC_000012.12:g.114683080A>G	ExAC,gnomAD
rs1337484837	p.Pro42Ser	missense variant	-	NC_000012.12:g.114683077G>A	TOPMed,gnomAD
rs1337484837	p.Pro42Ala	missense variant	-	NC_000012.12:g.114683077G>C	TOPMed,gnomAD
rs978439271	p.Ala43Thr	missense variant	-	NC_000012.12:g.114683074C>T	TOPMed,gnomAD
rs555062169	p.Ala43Val	missense variant	-	NC_000012.12:g.114683073G>A	1000Genomes,ExAC,gnomAD
rs781639524	p.Thr45Met	missense variant	-	NC_000012.12:g.114683067G>A	ExAC,gnomAD
NCI-TCGA novel	p.Pro47LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114683039_114683061GAGCGCCGCCGCGCCGTTGGGAG>-	NCI-TCGA
rs769065791	p.Pro47Arg	missense variant	-	NC_000012.12:g.114683061G>C	ExAC,gnomAD
rs536946655	p.Pro48Ala	missense variant	-	NC_000012.12:g.114683059G>C	1000Genomes,ExAC,gnomAD
rs1168678629	p.Asn49Ser	missense variant	-	NC_000012.12:g.114683055T>C	TOPMed
RCV000703697	p.Ala51Thr	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114683050C>T	ClinVar
rs1327851574	p.Ala52Val	missense variant	-	NC_000012.12:g.114683046G>A	gnomAD
rs756033342	p.Leu60Met	missense variant	-	NC_000012.12:g.114683023G>T	ExAC,TOPMed,gnomAD
rs1369545046	p.Ala61Val	missense variant	-	NC_000012.12:g.114683019G>A	TOPMed
rs759407815	p.Ile64Thr	missense variant	-	NC_000012.12:g.114683010A>G	ExAC,gnomAD
rs766592107	p.Met65Lys	missense variant	-	NC_000012.12:g.114683007A>T	ExAC,gnomAD
rs766592107	p.Met65Thr	missense variant	-	NC_000012.12:g.114683007A>G	ExAC,gnomAD
rs1194543955	p.Met65Ile	missense variant	-	NC_000012.12:g.114683006C>T	gnomAD
rs1469975580	p.Asp66Asn	missense variant	-	NC_000012.12:g.114683005C>T	TOPMed,gnomAD
COSM5226333	p.Leu68PhePheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114682997_114682998insA	NCI-TCGA Cosmic
rs1006993913	p.Gly70Trp	missense variant	-	NC_000012.12:g.114682993C>A	TOPMed,gnomAD
rs1006993913	p.Gly70Arg	missense variant	-	NC_000012.12:g.114682993C>G	TOPMed,gnomAD
rs1012420316	p.Ala71Thr	missense variant	-	NC_000012.12:g.114682990C>T	TOPMed
rs1012420316	p.Ala71Ser	missense variant	-	NC_000012.12:g.114682990C>A	TOPMed
rs1266535166	p.Glu73Lys	missense variant	-	NC_000012.12:g.114682984C>T	TOPMed
rs895278286	p.Gly75Ser	missense variant	-	NC_000012.12:g.114682978C>T	TOPMed,gnomAD
rs866573295	p.Gly75Asp	missense variant	-	NC_000012.12:g.114682977C>T	gnomAD
rs895278286	p.Gly75Arg	missense variant	-	NC_000012.12:g.114682978C>G	TOPMed,gnomAD
rs770004469	p.Pro77Arg	missense variant	-	NC_000012.12:g.114682971G>C	ExAC,gnomAD
rs1372676946	p.Ser80Ala	missense variant	-	NC_000012.12:g.114682963A>C	gnomAD
NCI-TCGA novel	p.Gly82Arg	missense variant	-	NC_000012.12:g.114682957C>T	NCI-TCGA
NCI-TCGA novel	p.Pro83Ser	missense variant	-	NC_000012.12:g.114682954G>A	NCI-TCGA
rs548028432	p.Pro83Leu	missense variant	-	NC_000012.12:g.114682953G>A	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Gln84ArgPheSerTerUnk	frameshift	-	NC_000012.12:g.114682955C>-	NCI-TCGA
rs777208877	p.Ala85Glu	missense variant	-	NC_000012.12:g.114682947G>T	ExAC,TOPMed,gnomAD
rs777208877	p.Ala85Gly	missense variant	-	NC_000012.12:g.114682947G>C	ExAC,TOPMed,gnomAD
rs777208877	p.Ala85Val	missense variant	-	NC_000012.12:g.114682947G>A	ExAC,TOPMed,gnomAD
rs1174286681	p.His86Tyr	missense variant	-	NC_000012.12:g.114682945G>A	gnomAD
rs1460980304	p.Arg88Ser	missense variant	-	NC_000012.12:g.114682937C>G	TOPMed
rs886049011	p.Arg88Lys	missense variant	-	NC_000012.12:g.114682938C>T	gnomAD
RCV000301845	p.Arg88Lys	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114682938C>T	ClinVar
NCI-TCGA novel	p.Lys91Thr	missense variant	-	NC_000012.12:g.114682929T>G	NCI-TCGA
rs755627893	p.Lys91Glu	missense variant	-	NC_000012.12:g.114682930T>C	ExAC,TOPMed,gnomAD
rs374642197	p.Lys91Arg	missense variant	-	NC_000012.12:g.114682929T>C	ESP,ExAC,gnomAD
rs781212726	p.Glu94Gly	missense variant	-	NC_000012.12:g.114682920T>C	ExAC,gnomAD
rs143885412	p.Pro95Ser	missense variant	-	NC_000012.12:g.114682918G>A	ESP,ExAC,gnomAD
rs143885412	p.Pro95Ala	missense variant	-	NC_000012.12:g.114682918G>C	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Glu96Val	missense variant	-	NC_000012.12:g.114682914T>A	NCI-TCGA
NCI-TCGA novel	p.Glu97Ter	stop gained	-	NC_000012.12:g.114682912C>A	NCI-TCGA
NCI-TCGA novel	p.Glu97Asp	missense variant	-	NC_000012.12:g.114682910T>G	NCI-TCGA
NCI-TCGA novel	p.Glu98Ter	stop gained	-	NC_000012.12:g.114682909C>A	NCI-TCGA
rs1446884338	p.Val99Ala	missense variant	-	NC_000012.12:g.114682905A>G	gnomAD
rs1451400457	p.Glu100Gly	missense variant	-	NC_000012.12:g.114682902T>C	TOPMed
rs138271676	p.Asp101Glu	missense variant	-	NC_000012.12:g.114682898G>T	ESP,ExAC,TOPMed,gnomAD
rs750675578	p.Asp102Asn	missense variant	-	NC_000012.12:g.114682897C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro103His	missense variant	-	NC_000012.12:g.114682893G>T	NCI-TCGA
rs1042037489	p.Pro103Ser	missense variant	-	NC_000012.12:g.114682894G>A	TOPMed
COSM6071317	p.Pro103Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114682894G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys104ValPheSerTerUnk	frameshift	-	NC_000012.12:g.114682892_114682893insGACC	NCI-TCGA
rs150806908	p.Lys104Thr	missense variant	-	NC_000012.12:g.114682890T>G	ESP,TOPMed
rs150806908	p.Lys104Arg	missense variant	-	NC_000012.12:g.114682890T>C	ESP,TOPMed
NCI-TCGA novel	p.Val105Ala	missense variant	-	NC_000012.12:g.114682887A>G	NCI-TCGA
rs1314068240	p.His106Gln	missense variant	-	NC_000012.12:g.114682883G>T	TOPMed
rs776626691	p.His106Tyr	missense variant	-	NC_000012.12:g.114682885G>A	ExAC,gnomAD
NCI-TCGA novel	p.Leu107Met	missense variant	-	NC_000012.12:g.114682882G>T	NCI-TCGA
NCI-TCGA novel	p.Ala109Ser	missense variant	-	NC_000012.12:g.114682876C>A	NCI-TCGA
COSM1298959	p.Ala109Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114682875G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys110Ter	stop gained	-	NC_000012.12:g.114682873T>A	NCI-TCGA
COSM1359061	p.Glu111Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114682870C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu112Arg	missense variant	-	NC_000012.12:g.114682866A>C	NCI-TCGA
NCI-TCGA novel	p.Leu112Val	missense variant	-	NC_000012.12:g.114682867G>C	NCI-TCGA
NCI-TCGA novel	p.Trp113Gly	missense variant	-	NC_000012.12:g.114682864A>C	NCI-TCGA
COSM1476165	p.Trp113Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114682864A>G	NCI-TCGA Cosmic
COSM4039069	p.Trp113Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114682862C>T	NCI-TCGA Cosmic
rs772441761	p.Asp114His	missense variant	-	NC_000012.12:g.114682861C>G	ExAC,TOPMed,gnomAD
rs772441761	p.Asp114Asn	missense variant	-	NC_000012.12:g.114682861C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln115Ter	stop gained	-	NC_000012.12:g.114682858G>A	NCI-TCGA
COSM4039068	p.Gln115Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114682857T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys118Arg	missense variant	-	NC_000012.12:g.114682848T>C	NCI-TCGA
rs985381779	p.Gly120Cys	missense variant	-	NC_000012.12:g.114682843C>A	gnomAD
rs1373707233	p.Gly120Ala	missense variant	-	NC_000012.12:g.114682842C>G	gnomAD
COSM691937	p.Gly120Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114682842C>A	NCI-TCGA Cosmic
COSM3456535	p.Glu122Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114682837C>T	NCI-TCGA Cosmic
RCV000623643	p.Val124Phe	missense variant	Inborn genetic diseases	NC_000012.12:g.114682831C>A	ClinVar
rs927204453	p.Val124Ile	missense variant	-	NC_000012.12:g.114682831C>T	TOPMed
rs927204453	p.Val124Phe	missense variant	-	NC_000012.12:g.114682831C>A	TOPMed
NCI-TCGA novel	p.Arg131Gln	missense variant	-	NC_000012.12:g.114681144C>T	NCI-TCGA
rs1201988110	p.Arg131Gly	missense variant	-	NC_000012.12:g.114681145G>C	gnomAD
rs370785408	p.Met132Val	missense variant	-	NC_000012.12:g.114681142T>C	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro134LeuPheSerTerUnk	frameshift	-	NC_000012.12:g.114681137A>-	NCI-TCGA
COSM5196199	p.Pro134Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114681136G>A	NCI-TCGA Cosmic
rs267603321	p.Pro135Ser	missense variant	-	NC_000012.12:g.114681133G>A	gnomAD
rs774747599	p.Phe136Leu	missense variant	-	NC_000012.12:g.114681130A>G	ExAC
NCI-TCGA novel	p.Lys137Ter	frameshift	-	NC_000012.12:g.114681127_114681128insA	NCI-TCGA
rs1206189010	p.Leu143Met	missense variant	-	NC_000012.12:g.114681109G>T	TOPMed
VAR_009601	p.Leu143Pro	Missense	Ulnar-mammary syndrome (UMS) [MIM:181450]	-	UniProt
rs769431199	p.Asp144Glu	missense variant	-	NC_000012.12:g.114681104A>T	ExAC,gnomAD
rs1256655578	p.Lys145Arg	missense variant	-	NC_000012.12:g.114681102T>C	TOPMed
NCI-TCGA novel	p.Ala147ProPheSerTerUnk	frameshift	-	NC_000012.12:g.114681098T>-	NCI-TCGA
rs1312105333	p.Ala147Val	missense variant	-	NC_000012.12:g.114681096G>A	gnomAD
COSM1359060	p.Ala147SerPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114681097_114681098insT	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys148Asn	missense variant	-	NC_000012.12:g.114681092T>A	NCI-TCGA
NCI-TCGA novel	p.Tyr149Ter	stop gained	-	NC_000012.12:g.114681089_114681090insT	NCI-TCGA
VAR_009602	p.Tyr149Ser	Missense	Ulnar-mammary syndrome (UMS) [MIM:181450]	-	UniProt
NCI-TCGA novel	p.Ile150Ser	missense variant	-	NC_000012.12:g.114681087A>C	NCI-TCGA
NCI-TCGA novel	p.Leu151TyrPheSerTerUnk	frameshift	-	NC_000012.12:g.114681084A>-	NCI-TCGA
NCI-TCGA novel	p.Asp154Gly	missense variant	-	NC_000012.12:g.114681075T>C	NCI-TCGA
COSM6135711	p.Asp154Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114681076C>A	NCI-TCGA Cosmic
rs1296731331	p.Ile155Val	missense variant	-	NC_000012.12:g.114681073T>C	TOPMed,gnomAD
rs1285766986	p.Ile156Thr	missense variant	-	NC_000012.12:g.114681069A>G	gnomAD
rs761429570	p.Ile156Val	missense variant	-	NC_000012.12:g.114681070T>C	ExAC,gnomAD
NCI-TCGA novel	p.Asp159Glu	missense variant	-	NC_000012.12:g.114681059A>C	NCI-TCGA
COSM1298958	p.Asp159His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114681061C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp160GlyPheSerTerUnk	frameshift	-	NC_000012.12:g.114681057_114681058insC	NCI-TCGA
NCI-TCGA novel	p.Asp160ArgPheSerTerUnk	frameshift	-	NC_000012.12:g.114681058_114681059insT	NCI-TCGA
NCI-TCGA novel	p.Lys164SerPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114681042_114681046AATTT>-	NCI-TCGA
NCI-TCGA novel	p.Phe165Ile	missense variant	-	NC_000012.12:g.114681043A>T	NCI-TCGA
rs1430142395	p.Arg169Trp	missense variant	-	NC_000012.12:g.114681031G>A	TOPMed
rs772182165	p.Arg169Leu	missense variant	-	NC_000012.12:g.114681030C>A	ExAC,TOPMed,gnomAD
rs772182165	p.Arg169Gln	missense variant	-	NC_000012.12:g.114681030C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Trp170ValPheSerTerUnk	frameshift	-	NC_000012.12:g.114681028_114681029insC	NCI-TCGA
rs905399897	p.Met171Leu	missense variant	-	NC_000012.12:g.114681025T>G	TOPMed,gnomAD
NCI-TCGA novel	p.Val172Leu	missense variant	-	NC_000012.12:g.114681022C>A	NCI-TCGA
rs745631586	p.Val172Met	missense variant	-	NC_000012.12:g.114681022C>T	ExAC,gnomAD
rs1299722140	p.Ala173Thr	missense variant	-	NC_000012.12:g.114681019C>T	TOPMed
rs754023417	p.Glu179Lys	missense variant	-	NC_000012.12:g.114681001C>T	ExAC,gnomAD
NCI-TCGA novel	p.Pro181Ser	missense variant	-	NC_000012.12:g.114680995G>A	NCI-TCGA
rs945423833	p.Lys182Glu	missense variant	-	NC_000012.12:g.114680992T>C	gnomAD
rs1467097106	p.Met184Lys	missense variant	-	NC_000012.12:g.114680985A>T	gnomAD
COSM5831984	p.Met184GlyPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114680987_114680988insCT	NCI-TCGA Cosmic
rs753199262	p.Ile186Val	missense variant	-	NC_000012.12:g.114680980T>C	ExAC,TOPMed,gnomAD
rs760101710	p.His187Gln	missense variant	-	NC_000012.12:g.114680975G>C	ExAC,gnomAD
COSM430420	p.His187Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114680977G>A	NCI-TCGA Cosmic
rs767991404	p.His187Asn	missense variant	-	NC_000012.12:g.114680977G>T	ExAC,gnomAD
rs751907473	p.Pro188Leu	missense variant	-	NC_000012.12:g.114680973G>A	ExAC,TOPMed,gnomAD
rs751907473	p.Pro188Gln	missense variant	-	NC_000012.12:g.114680973G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp189Val	missense variant	-	NC_000012.12:g.114680970T>A	NCI-TCGA
rs768160499	p.Ala192Thr	missense variant	-	NC_000012.12:g.114680962C>T	ExAC,TOPMed,gnomAD
COSM2173055	p.Ala192Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114680962C>A	NCI-TCGA Cosmic
rs777588715	p.Thr193Pro	missense variant	-	NC_000012.12:g.114680959T>G	ExAC,TOPMed,gnomAD
rs777588715	p.Thr193Ala	missense variant	-	NC_000012.12:g.114680959T>C	ExAC,TOPMed,gnomAD
COSM5211609	p.Glu195GlyPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114680952_114680953insC	NCI-TCGA Cosmic
rs1346480124	p.Trp197Cys	missense variant	-	NC_000012.12:g.114680945C>A	gnomAD
COSM691939	p.Trp197Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114680946C>T	NCI-TCGA Cosmic
rs975627207	p.Met198Thr	missense variant	-	NC_000012.12:g.114680943A>G	gnomAD
rs1438542231	p.Ser199Ala	missense variant	-	NC_000012.12:g.114680941A>C	TOPMed,gnomAD
rs745862855	p.Val201Ile	missense variant	-	NC_000012.12:g.114680935C>T	ExAC,gnomAD
rs370362658	p.Val202Ile	missense variant	-	NC_000012.12:g.114680932C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe204Ser	missense variant	-	NC_000012.12:g.114680925A>G	NCI-TCGA
rs1452419195	p.Phe204Leu	missense variant	-	NC_000012.12:g.114680924G>C	gnomAD
rs749487839	p.His205Tyr	missense variant	-	NC_000012.12:g.114680923G>A	ExAC,TOPMed,gnomAD
COSM6135712	p.His205Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114680923G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu207GlnPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114680915_114680916CA>-	NCI-TCGA
NCI-TCGA novel	p.Thr210HisPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114680908_114680909insG	NCI-TCGA
rs756408358	p.Asn211Thr	missense variant	-	NC_000012.12:g.114680904T>G	ExAC
COSM430419	p.Asn211ThrPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114680906G>-	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser214Ala	missense variant	-	NC_000012.12:g.114680896A>C	NCI-TCGA
NCI-TCGA novel	p.Asp215AsnPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114680890_114680893TGTC>-	NCI-TCGA
rs1172445314	p.Asp215Asn	missense variant	-	NC_000012.12:g.114680893C>T	TOPMed
rs781306340	p.His217Arg	missense variant	-	NC_000012.12:g.114680886T>C	ExAC,gnomAD
NCI-TCGA novel	p.Phe219IlePheSerTerUnk	frameshift	-	NC_000012.12:g.114680882_114680883insC	NCI-TCGA
rs1415906300	p.Thr220Ile	missense variant	-	NC_000012.12:g.114679971G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Ala222Thr	missense variant	-	NC_000012.12:g.114679966C>T	NCI-TCGA
NCI-TCGA novel	p.Phe223Ser	missense variant	-	NC_000012.12:g.114679962A>G	NCI-TCGA
NCI-TCGA novel	p.Pro224GlnPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114679959G>-	NCI-TCGA
rs1400959825	p.Ser225Arg	missense variant	-	NC_000012.12:g.114679957T>G	gnomAD
rs780398425	p.Ser225Asn	missense variant	-	NC_000012.12:g.114679956C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala228Asp	missense variant	-	NC_000012.12:g.114679947G>T	NCI-TCGA
rs765693432	p.Ala228Thr	missense variant	-	NC_000012.12:g.114679948C>T	ExAC,gnomAD
rs765693432	p.Ala228Pro	missense variant	-	NC_000012.12:g.114679948C>G	ExAC,gnomAD
rs554364556	p.Thr229Met	missense variant	-	NC_000012.12:g.114679944G>A	TOPMed,gnomAD
COSM3456534	p.Gly232Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114679936C>T	NCI-TCGA Cosmic
rs368990405	p.Gln239Arg	missense variant	-	NC_000012.12:g.114679914T>C	ESP,ExAC,TOPMed,gnomAD
rs368990405	p.Gln239Leu	missense variant	-	NC_000012.12:g.114679914T>A	ESP,ExAC,TOPMed,gnomAD
rs1423508208	p.Thr240Ser	missense variant	-	NC_000012.12:g.114679651T>A	gnomAD
rs751111385	p.Ile241Val	missense variant	-	NC_000012.12:g.114679648T>C	ExAC,gnomAD
NCI-TCGA novel	p.Tyr248Ter	stop gained	-	NC_000012.12:g.114679625_114679626insT	NCI-TCGA
NCI-TCGA novel	p.Tyr248Asn	missense variant	-	NC_000012.12:g.114679627A>T	NCI-TCGA
rs528696682	p.Tyr248His	missense variant	-	NC_000012.12:g.114679627A>G	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Arg251Leu	missense variant	-	NC_000012.12:g.114679617C>A	NCI-TCGA
rs151047347	p.Arg251Gln	missense variant	-	NC_000012.12:g.114679617C>T	TOPMed,gnomAD
COSM3456532	p.His253Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114679612G>A	NCI-TCGA Cosmic
RCV000375533	p.Ile254Val	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114679609T>C	ClinVar
rs117465019	p.Ile254Val	missense variant	-	NC_000012.12:g.114679609T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1441443517	p.Ile254Thr	missense variant	-	NC_000012.12:g.114679608A>G	gnomAD
rs1372907987	p.Arg256Lys	missense variant	-	NC_000012.12:g.114679602C>T	gnomAD
rs1176249608	p.Ala257Asp	missense variant	-	NC_000012.12:g.114679599G>T	TOPMed
rs1321551828	p.Ala257Thr	missense variant	-	NC_000012.12:g.114679600C>T	gnomAD
rs1408088799	p.Asn258Lys	missense variant	-	NC_000012.12:g.114679595A>T	TOPMed
rs375420460	p.Asn258Ser	missense variant	-	NC_000012.12:g.114679596T>C	1000Genomes,ESP,ExAC,gnomAD
NCI-TCGA novel	p.Leu261Phe	missense variant	-	NC_000012.12:g.114679586C>G	NCI-TCGA
rs1160330259	p.Leu263Ile	missense variant	-	NC_000012.12:g.114679582G>T	gnomAD
rs1418098778	p.Pro264Leu	missense variant	-	NC_000012.12:g.114679578G>A	gnomAD
NCI-TCGA novel	p.Tyr265Cys	missense variant	-	NC_000012.12:g.114679575T>C	NCI-TCGA
NCI-TCGA novel	p.Tyr265Phe	missense variant	-	NC_000012.12:g.114679575T>A	NCI-TCGA
NCI-TCGA novel	p.Tyr265Ter	stop gained	-	NC_000012.12:g.114679573_114679574TA>-	NCI-TCGA
NCI-TCGA novel	p.Tyr265LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114679575T>-	NCI-TCGA
NCI-TCGA novel	p.Ser266ValPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114679573T>-	NCI-TCGA
rs1245312800	p.Phe268Leu	missense variant	-	NC_000012.12:g.114679565A>C	gnomAD
rs1198837775	p.Arg269Trp	missense variant	-	NC_000012.12:g.114679564G>A	gnomAD
rs775378442	p.Arg269Gln	missense variant	-	NC_000012.12:g.114679563C>T	ExAC,gnomAD
NCI-TCGA novel	p.Tyr271Ter	stop gained	-	NC_000012.12:g.114679556G>T	NCI-TCGA
rs746325292	p.Leu272Phe	missense variant	-	NC_000012.12:g.114679553C>A	ExAC,gnomAD
rs746325292	p.Leu272Phe	missense variant	-	NC_000012.12:g.114679553C>G	ExAC,gnomAD
rs779500081	p.Pro274Ser	missense variant	-	NC_000012.12:g.114679549G>A	ExAC,gnomAD
COSM1359059	p.Pro274Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114679548G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu275Gly	missense variant	-	NC_000012.12:g.114679545T>C	NCI-TCGA
rs1234535767	p.Glu275Lys	missense variant	-	NC_000012.12:g.114679546C>T	TOPMed,gnomAD
rs1372981319	p.Ile279Val	missense variant	-	NC_000012.12:g.114679534T>C	gnomAD
NCI-TCGA novel	p.Ala280Thr	missense variant	-	NC_000012.12:g.114679531C>T	NCI-TCGA
COSM691941	p.Ala280Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114679531C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr282Pro	missense variant	-	NC_000012.12:g.114679525T>G	NCI-TCGA
NCI-TCGA novel	p.Asp287His	missense variant	-	NC_000012.12:g.114679510C>G	NCI-TCGA
NCI-TCGA novel	p.Asp287Gly	missense variant	-	NC_000012.12:g.114679509T>C	NCI-TCGA
rs751228574	p.Asp287Glu	missense variant	-	NC_000012.12:g.114679508A>T	ExAC,gnomAD
rs370972949	p.Lys288Met	missense variant	-	NC_000012.12:g.114679506T>A	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Thr290AsnPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114677652_114677653insT	NCI-TCGA
RCV000008453	p.Lys293Ter	nonsense	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114677644T>A	ClinVar
rs104894376	p.Lys293Ter	stop gained	Ulnar-mammary syndrome (ums)	NC_000012.12:g.114677644T>A	-
COSM5228908	p.Ile294Ter	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114677641T>-	NCI-TCGA Cosmic
COSM416030	p.Asp295His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114677638C>G	NCI-TCGA Cosmic
COSM1476163	p.Asn296LysPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114677633_114677634insT	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro298Arg	missense variant	-	NC_000012.12:g.114677628G>C	NCI-TCGA
COSM1359058	p.Arg304Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114677610C>T	NCI-TCGA Cosmic
rs779733514	p.Arg310Ter	stop gained	-	NC_000012.12:g.114677593G>A	ExAC,gnomAD
COSM3456531	p.Arg311Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114677589C>T	NCI-TCGA Cosmic
rs1422059701	p.Arg314Ter	stop gained	-	NC_000012.12:g.114677581T>A	gnomAD
rs1169229764	p.Arg314Lys	missense variant	-	NC_000012.12:g.114677580C>T	gnomAD
COSM72929	p.Gln316Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114676466G>C	NCI-TCGA Cosmic
rs1223634909	p.Gln320Arg	missense variant	-	NC_000012.12:g.114676453T>C	gnomAD
NCI-TCGA novel	p.Ser321Phe	missense variant	-	NC_000012.12:g.114676450G>A	NCI-TCGA
rs374926979	p.Met322Leu	missense variant	-	NC_000012.12:g.114676448T>A	ESP,ExAC,TOPMed,gnomAD
rs374926979	p.Met322Val	missense variant	-	NC_000012.12:g.114676448T>C	ESP,ExAC,TOPMed,gnomAD
COSM691942	p.Met322Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114676446C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp326Ter	frameshift	-	NC_000012.12:g.114676436_114676437insA	NCI-TCGA
COSM5831982	p.Glu327AspPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114676428_114676431TCTT>-	NCI-TCGA Cosmic
rs752533066	p.Arg328Thr	missense variant	-	NC_000012.12:g.114676429C>G	ExAC,gnomAD
rs767275234	p.His329Gln	missense variant	-	NC_000012.12:g.114676425G>C	ExAC,gnomAD
rs1307544773	p.His329Leu	missense variant	-	NC_000012.12:g.114676426T>A	gnomAD
NCI-TCGA novel	p.Asn333LysPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114676413A>-	NCI-TCGA
rs755172309	p.Thr335Ala	missense variant	-	NC_000012.12:g.114676409T>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser336Tyr	missense variant	-	NC_000012.12:g.114676405G>T	NCI-TCGA
rs1295841754	p.Ser336Phe	missense variant	-	NC_000012.12:g.114676405G>A	TOPMed,gnomAD
COSM6135714	p.Asp337Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114676402T>C	NCI-TCGA Cosmic
rs1456819388	p.Glu338Lys	missense variant	-	NC_000012.12:g.114676400C>T	gnomAD
rs1163413752	p.Ser339Thr	missense variant	-	NC_000012.12:g.114676397A>T	gnomAD
rs1396893876	p.Ser340Phe	missense variant	-	NC_000012.12:g.114676393G>A	TOPMed
rs751859591	p.Ser341Asn	missense variant	-	NC_000012.12:g.114676390C>T	ExAC,TOPMed,gnomAD
rs150489416	p.Glu342Lys	missense variant	-	NC_000012.12:g.114676388C>T	ESP,TOPMed
NCI-TCGA novel	p.Ala345Asp	missense variant	-	NC_000012.12:g.114676378G>T	NCI-TCGA
NCI-TCGA novel	p.Phe346Leu	missense variant	-	NC_000012.12:g.114676374G>C	NCI-TCGA
rs567843458	p.Phe346Val	missense variant	-	NC_000012.12:g.114676376A>C	1000Genomes
rs1422491114	p.Phe346Tyr	missense variant	-	NC_000012.12:g.114676375A>T	gnomAD
rs369381057	p.Cys348Arg	missense variant	-	NC_000012.12:g.114676370A>G	ESP,ExAC,TOPMed,gnomAD
rs773465537	p.Ala350Thr	missense variant	-	NC_000012.12:g.114676364C>T	ExAC,TOPMed,gnomAD
RCV000024600	p.Gln351Ter	nonsense	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114676361G>A	ClinVar
rs397514484	p.Gln351Ter	stop gained	Ulnar-mammary syndrome (ums)	NC_000012.12:g.114676361G>A	-
COSM4844480	p.Ser354Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114676351G>A	NCI-TCGA Cosmic
rs765766538	p.Ala356Val	missense variant	-	NC_000012.12:g.114676345G>A	ExAC,TOPMed,gnomAD
rs140580685	p.Ala357Thr	missense variant	-	NC_000012.12:g.114676343C>T	ESP,ExAC,TOPMed,gnomAD
rs768904703	p.Ala357Asp	missense variant	-	NC_000012.12:g.114676342G>T	ExAC,gnomAD
COSM6071319	p.Ala357Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114676343C>A	NCI-TCGA Cosmic
rs370684735	p.Thr359Asn	missense variant	-	NC_000012.12:g.114676336G>T	ESP,ExAC,TOPMed,gnomAD
rs370684735	p.Thr359Ser	missense variant	-	NC_000012.12:g.114676336G>C	ESP,ExAC,TOPMed,gnomAD
rs748769415	p.Val360Ile	missense variant	-	NC_000012.12:g.114676334C>T	ExAC,gnomAD
rs10290	p.Gly361Arg	missense variant	-	NC_000012.12:g.114676331C>T	ExAC,gnomAD
NCI-TCGA novel	p.Thr362HisPheSerTerUnkUnkUnk	frameshift	-	NC_000012.12:g.114676329C>-	NCI-TCGA
rs377284522	p.Thr362Ile	missense variant	-	NC_000012.12:g.114676327G>A	ESP,TOPMed
rs374337915	p.Ser363Leu	missense variant	-	NC_000012.12:g.114676324G>A	ESP,TOPMed
COSM430415	p.Ser363Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114676324G>C	NCI-TCGA Cosmic
rs769757791	p.Leu365Val	missense variant	-	NC_000012.12:g.114676319G>C	ExAC,TOPMed,gnomAD
rs769757791	p.Leu365Phe	missense variant	-	NC_000012.12:g.114676319G>A	ExAC,TOPMed,gnomAD
rs1254986253	p.Lys366Asn	missense variant	-	NC_000012.12:g.114676314T>G	TOPMed
COSM6023947	p.Lys366ArgPheSerTerUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114676314_114676315TT>-	NCI-TCGA Cosmic
rs762652334	p.Cys369Arg	missense variant	-	NC_000012.12:g.114674830A>G	ExAC,gnomAD
rs890506392	p.Pro370Ala	missense variant	-	NC_000012.12:g.114674827G>C	TOPMed,gnomAD
rs890506392	p.Pro370Ser	missense variant	-	NC_000012.12:g.114674827G>A	TOPMed,gnomAD
rs772722825	p.Ser371Ile	missense variant	-	NC_000012.12:g.114674823C>A	ExAC,TOPMed,gnomAD
rs899268368	p.Ser371Arg	missense variant	-	NC_000012.12:g.114674822G>T	TOPMed,gnomAD
RCV000658669	p.Gly373Val	missense variant	-	NC_000012.12:g.114674817C>A	ClinVar
rs769194863	p.Gly373Asp	missense variant	-	NC_000012.12:g.114674817C>T	ExAC,gnomAD
rs769194863	p.Gly373Val	missense variant	-	NC_000012.12:g.114674817C>A	ExAC,gnomAD
COSM546569	p.Gly373Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114674818C>T	NCI-TCGA Cosmic
rs748067818	p.Glu374Lys	missense variant	-	NC_000012.12:g.114674815C>T	ExAC,gnomAD
NCI-TCGA novel	p.Ser375Asn	missense variant	-	NC_000012.12:g.114674811C>T	NCI-TCGA
rs1198914710	p.Ser375Arg	missense variant	-	NC_000012.12:g.114674810G>T	TOPMed,gnomAD
rs1483156589	p.Asp376Val	missense variant	-	NC_000012.12:g.114674808T>A	gnomAD
rs1312156913	p.Asp376Tyr	missense variant	-	NC_000012.12:g.114674809C>A	TOPMed
rs780968472	p.Ala377Thr	missense variant	-	NC_000012.12:g.114674806C>T	ExAC,TOPMed,gnomAD
rs780968472	p.Ala377Ser	missense variant	-	NC_000012.12:g.114674806C>A	ExAC,TOPMed,gnomAD
rs780968472	p.Ala377Pro	missense variant	-	NC_000012.12:g.114674806C>G	ExAC,TOPMed,gnomAD
rs1316526395	p.Ala379Thr	missense variant	-	NC_000012.12:g.114674800C>T	gnomAD
rs865915137	p.Glu380Lys	missense variant	-	NC_000012.12:g.114674797C>T	TOPMed,gnomAD
RCV000596277	p.Glu380Asp	missense variant	-	NC_000012.12:g.114674795C>G	ClinVar
rs865915137	p.Glu380Ter	stop gained	-	NC_000012.12:g.114674797C>A	TOPMed,gnomAD
rs376189812	p.Glu380Asp	missense variant	-	NC_000012.12:g.114674795C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs780049501	p.Ser381Ile	missense variant	-	NC_000012.12:g.114674793C>A	ExAC,gnomAD
rs758632611	p.Lys382Arg	missense variant	-	NC_000012.12:g.114674790T>C	ExAC,gnomAD
rs750675454	p.Glu384Lys	missense variant	-	NC_000012.12:g.114674785C>T	ExAC,gnomAD
rs1040058148	p.Glu384Gly	missense variant	-	NC_000012.12:g.114674784T>C	TOPMed,gnomAD
rs141004177	p.His385Arg	missense variant	-	NC_000012.12:g.114674781T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000333594	p.His385Arg	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114674781T>C	ClinVar
rs753046693	p.Glu388Asp	missense variant	-	NC_000012.12:g.114674771C>G	ExAC,gnomAD
rs1185716503	p.Glu388Gln	missense variant	-	NC_000012.12:g.114674773C>G	gnomAD
rs767883253	p.Cys390Arg	missense variant	-	NC_000012.12:g.114674767A>G	ExAC,gnomAD
NCI-TCGA novel	p.Asp391GluPheSerTerUnkUnkUnk	frameshift	-	NC_000012.12:g.114674762G>-	NCI-TCGA
rs1180836314	p.Asp391Asn	missense variant	-	NC_000012.12:g.114674764C>T	gnomAD
rs762528344	p.Asp391Glu	missense variant	-	NC_000012.12:g.114674762G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala392Thr	missense variant	-	NC_000012.12:g.114674761C>T	NCI-TCGA
rs1258048861	p.Ala392Ser	missense variant	-	NC_000012.12:g.114674761C>A	gnomAD
rs1214834962	p.Ala392Val	missense variant	-	NC_000012.12:g.114674760G>A	gnomAD
rs769533777	p.Lys394Thr	missense variant	-	NC_000012.12:g.114674754T>G	ExAC,gnomAD
rs1242201658	p.Lys394Asn	missense variant	-	NC_000012.12:g.114674753C>A	gnomAD
rs1323302982	p.Ile395Val	missense variant	-	NC_000012.12:g.114674752T>C	TOPMed
RCV000388077	p.Ser396Thr	missense variant	-	NC_000012.12:g.114674749A>T	ClinVar
rs78115331	p.Ser396Thr	missense variant	-	NC_000012.12:g.114674749A>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs768701023	p.Ser396Cys	missense variant	-	NC_000012.12:g.114674748G>C	ExAC,gnomAD
RCV000382366	p.Ser396Thr	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114674749A>T	ClinVar
NCI-TCGA novel	p.Thr398Ala	missense variant	-	NC_000012.12:g.114674743T>C	NCI-TCGA
rs746953122	p.Thr399Met	missense variant	-	NC_000012.12:g.114674739G>A	ExAC,gnomAD
rs1457604010	p.Glu401Lys	missense variant	-	NC_000012.12:g.114674734C>T	TOPMed,gnomAD
rs772020891	p.Glu402Asp	missense variant	-	NC_000012.12:g.114674729C>A	ExAC,gnomAD
rs746036481	p.Pro403Arg	missense variant	-	NC_000012.12:g.114674727G>C	ExAC
rs1438265315	p.Pro403Ser	missense variant	-	NC_000012.12:g.114674728G>A	TOPMed,gnomAD
rs1200233232	p.Cys404Ser	missense variant	-	NC_000012.12:g.114674725A>T	gnomAD
rs1453795458	p.Cys404Ser	missense variant	-	NC_000012.12:g.114674724C>G	TOPMed,gnomAD
rs370551433	p.Arg405Gly	missense variant	-	NC_000012.12:g.114674722G>C	ESP,ExAC,TOPMed,gnomAD
rs370551433	p.Arg405Cys	missense variant	-	NC_000012.12:g.114674722G>A	ESP,ExAC,TOPMed,gnomAD
rs1358091442	p.Arg405His	missense variant	-	NC_000012.12:g.114674721C>T	gnomAD
NCI-TCGA novel	p.Asp406Gly	missense variant	-	NC_000012.12:g.114674718T>C	NCI-TCGA
rs1286371143	p.Asp406Glu	missense variant	-	NC_000012.12:g.114674717G>C	gnomAD
NCI-TCGA novel	p.Lys407Asn	missense variant	-	NC_000012.12:g.114674714C>A	NCI-TCGA
rs1223450118	p.Gly408Arg	missense variant	-	NC_000012.12:g.114674713C>G	gnomAD
rs1351262620	p.Ser409Gly	missense variant	-	NC_000012.12:g.114674710T>C	gnomAD
COSM6071320	p.Pro410Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114674706G>A	NCI-TCGA Cosmic
rs755311630	p.Ala411Glu	missense variant	-	NC_000012.12:g.114674703G>T	ExAC,TOPMed,gnomAD
rs755311630	p.Ala411Gly	missense variant	-	NC_000012.12:g.114674703G>C	ExAC,TOPMed,gnomAD
rs755311630	p.Ala411Val	missense variant	-	NC_000012.12:g.114674703G>A	ExAC,TOPMed,gnomAD
rs1321490970	p.Val412Leu	missense variant	-	NC_000012.12:g.114674701C>G	gnomAD
COSM4039065	p.Val412Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114674701C>T	NCI-TCGA Cosmic
rs1336495393	p.Ala414Thr	missense variant	-	NC_000012.12:g.114674695C>T	gnomAD
rs562854136	p.His415Pro	missense variant	-	NC_000012.12:g.114674691T>G	gnomAD
rs1169673386	p.Leu416Pro	missense variant	-	NC_000012.12:g.114674688A>G	TOPMed
rs1160735321	p.Leu416Ile	missense variant	-	NC_000012.12:g.114674689G>T	gnomAD
rs761584262	p.Phe417Tyr	missense variant	-	NC_000012.12:g.114674685A>T	ExAC,gnomAD
NCI-TCGA novel	p.Ala418CysPheSerTerUnk	frameshift	-	NC_000012.12:g.114674682_114674683GC>-	NCI-TCGA
rs943648458	p.Ala418Thr	missense variant	-	NC_000012.12:g.114674683C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Ala419Val	missense variant	-	NC_000012.12:g.114674679G>A	NCI-TCGA
rs775941025	p.Ala419Thr	missense variant	-	NC_000012.12:g.114674680C>T	ExAC,gnomAD
rs763697862	p.Glu420Asp	missense variant	-	NC_000012.12:g.114674675C>G	ExAC,gnomAD
rs912240752	p.Arg421Trp	missense variant	-	NC_000012.12:g.114674674G>A	TOPMed
rs760646591	p.Arg421Pro	missense variant	-	NC_000012.12:g.114674673C>G	ExAC,gnomAD
rs376074487	p.Pro422Ser	missense variant	-	NC_000012.12:g.114674671G>A	ESP,ExAC,TOPMed,gnomAD
rs1218376949	p.Arg423Trp	missense variant	-	NC_000012.12:g.114674668G>A	gnomAD
rs145432134	p.Arg423Gln	missense variant	-	NC_000012.12:g.114674667C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000754972	p.Arg423Gln	missense variant	Obesity (EO Obesity)	NC_000012.12:g.114674667C>T	ClinVar
rs745622492	p.Asp424Asn	missense variant	-	NC_000012.12:g.114674665C>T	ExAC,gnomAD
rs774272475	p.Ser425Arg	missense variant	-	NC_000012.12:g.114674660G>C	ExAC,TOPMed,gnomAD
rs771049124	p.Gly426Arg	missense variant	-	NC_000012.12:g.114674659C>T	ExAC,gnomAD
rs777764537	p.Arg427Trp	missense variant	-	NC_000012.12:g.114674656G>A	ExAC,gnomAD
rs951396136	p.Arg427Gln	missense variant	-	NC_000012.12:g.114674655C>T	TOPMed,gnomAD
rs748607794	p.Asp429Glu	missense variant	-	NC_000012.12:g.114674648G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys430Thr	missense variant	-	NC_000012.12:g.114674646T>G	NCI-TCGA
rs1398394014	p.Ala431Val	missense variant	-	NC_000012.12:g.114674643G>A	gnomAD
rs1359476779	p.Ala431Ser	missense variant	-	NC_000012.12:g.114674644C>A	gnomAD
rs372774795	p.Ser432Trp	missense variant	-	NC_000012.12:g.114674640G>C	ESP,TOPMed,gnomAD
COSM3792221	p.Ser432Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114674640G>A	NCI-TCGA Cosmic
rs540908799	p.Pro433Ser	missense variant	-	NC_000012.12:g.114674638G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs540908799	p.Pro433Ala	missense variant	-	NC_000012.12:g.114674638G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1423724888	p.Asp434Glu	missense variant	-	NC_000012.12:g.114674633G>C	TOPMed,gnomAD
rs1033763029	p.Asp434Asn	missense variant	-	NC_000012.12:g.114674635C>T	TOPMed,gnomAD
rs1363892052	p.Ser435Thr	missense variant	-	NC_000012.12:g.114674632A>T	gnomAD
rs369654422	p.Ser435Leu	missense variant	-	NC_000012.12:g.114674631G>A	ESP,ExAC,TOPMed,gnomAD
rs375076522	p.His437Arg	missense variant	-	NC_000012.12:g.114674625T>C	ESP,ExAC,TOPMed,gnomAD
rs1179797029	p.His437Gln	missense variant	-	NC_000012.12:g.114674624A>T	TOPMed
RCV000303192	p.His437Arg	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114674625T>C	ClinVar
rs760237826	p.Pro439Leu	missense variant	-	NC_000012.12:g.114674619G>A	ExAC,gnomAD
rs1443972149	p.Pro439Ser	missense variant	-	NC_000012.12:g.114674620G>A	gnomAD
rs200038495	p.Ala440Gly	missense variant	-	NC_000012.12:g.114674616G>C	1000Genomes,gnomAD
rs200038495	p.Ala440Val	missense variant	-	NC_000012.12:g.114674616G>A	1000Genomes,gnomAD
rs775182377	p.Ala440Thr	missense variant	-	NC_000012.12:g.114674617C>T	ExAC,TOPMed,gnomAD
rs775182377	p.Ala440Pro	missense variant	-	NC_000012.12:g.114674617C>G	ExAC,TOPMed,gnomAD
rs775182377	p.Ala440Ser	missense variant	-	NC_000012.12:g.114674617C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser443AlaPheSerTerUnkUnkUnk	frameshift	-	NC_000012.12:g.114674609_114674610insATGGTGGCGGGGCT	NCI-TCGA
rs759577302	p.Ser443Ala	missense variant	-	NC_000012.12:g.114674608A>C	ExAC,gnomAD
rs1450439762	p.Ser444Phe	missense variant	-	NC_000012.12:g.114674604G>A	TOPMed,gnomAD
rs773448509	p.Ser445Gly	missense variant	-	NC_000012.12:g.114674602T>C	ExAC,TOPMed,gnomAD
rs773448509	p.Ser445Arg	missense variant	-	NC_000012.12:g.114674602T>G	ExAC,TOPMed,gnomAD
rs941278850	p.Thr446Ser	missense variant	-	NC_000012.12:g.114674598G>C	TOPMed,gnomAD
NCI-TCGA novel	p.Arg447Gly	missense variant	-	NC_000012.12:g.114674596G>C	NCI-TCGA
rs770040454	p.Arg447His	missense variant	-	NC_000012.12:g.114674595C>T	ExAC,gnomAD
rs888338239	p.Arg447Cys	missense variant	-	NC_000012.12:g.114674596G>A	TOPMed,gnomAD
rs1182105031	p.Gly448Asp	missense variant	-	NC_000012.12:g.114674592C>T	gnomAD
rs1418131493	p.Gly448Cys	missense variant	-	NC_000012.12:g.114674593C>A	gnomAD
rs781304111	p.Gly450Asp	missense variant	-	NC_000012.12:g.114674586C>T	ExAC,TOPMed,gnomAD
rs1182691296	p.Gly450Ser	missense variant	-	NC_000012.12:g.114674587C>T	TOPMed,gnomAD
rs781304111	p.Gly450Val	missense variant	-	NC_000012.12:g.114674586C>A	ExAC,TOPMed,gnomAD
rs565848855	p.Ala451Val	missense variant	-	NC_000012.12:g.114674583G>A	ExAC,TOPMed,gnomAD
rs1215745344	p.Glu452Lys	missense variant	-	NC_000012.12:g.114674581C>T	TOPMed
rs374981272	p.Arg454Ser	missense variant	-	NC_000012.12:g.114674575G>T	ESP,ExAC,gnomAD
rs758811184	p.Arg454His	missense variant	-	NC_000012.12:g.114674574C>T	ExAC,TOPMed,gnomAD
rs374981272	p.Arg454Cys	missense variant	-	NC_000012.12:g.114674575G>A	ESP,ExAC,gnomAD
rs371891930	p.Pro457Leu	missense variant	-	NC_000012.12:g.114674565G>A	ESP,ExAC,TOPMed,gnomAD
rs755898047	p.Pro457Thr	missense variant	-	NC_000012.12:g.114674566G>T	ExAC,TOPMed,gnomAD
rs751549922	p.Arg459Cys	missense variant	-	NC_000012.12:g.114674560G>A	ExAC,TOPMed,gnomAD
rs1411259653	p.Arg459His	missense variant	-	NC_000012.12:g.114674559C>T	gnomAD
rs751549922	p.Arg459Gly	missense variant	-	NC_000012.12:g.114674560G>C	ExAC,TOPMed,gnomAD
rs1440126149	p.Glu460Gln	missense variant	-	NC_000012.12:g.114674557C>G	gnomAD
rs1440126149	p.Glu460Lys	missense variant	-	NC_000012.12:g.114674557C>T	gnomAD
rs1176725361	p.Gly461Asp	missense variant	-	NC_000012.12:g.114674553C>T	gnomAD
rs1239750042	p.Gly461Ser	missense variant	-	NC_000012.12:g.114674554C>T	gnomAD
rs1480230095	p.Thr462Ser	missense variant	-	NC_000012.12:g.114674551T>A	gnomAD
rs1247378046	p.Ala463Val	missense variant	-	NC_000012.12:g.114674547G>A	gnomAD
rs1377897599	p.Pro464Arg	missense variant	-	NC_000012.12:g.114674544G>C	TOPMed
COSM691945	p.Pro464Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114674545G>T	NCI-TCGA Cosmic
rs1241117139	p.Ala465Asp	missense variant	-	NC_000012.12:g.114674541G>T	gnomAD
rs1291364957	p.Ala465Thr	missense variant	-	NC_000012.12:g.114674542C>T	TOPMed,gnomAD
rs1039440316	p.Val467Met	missense variant	-	NC_000012.12:g.114674536C>T	TOPMed,gnomAD
rs773055576	p.Glu468Lys	missense variant	-	NC_000012.12:g.114674533C>T	ExAC,TOPMed,gnomAD
rs958290156	p.Glu468Val	missense variant	-	NC_000012.12:g.114674532T>A	TOPMed
rs773055576	p.Glu468Ter	stop gained	-	NC_000012.12:g.114674533C>A	ExAC,TOPMed,gnomAD
rs924154861	p.Ala470Val	missense variant	-	NC_000012.12:g.114674526G>A	TOPMed,gnomAD
rs1438073122	p.Arg471His	missense variant	-	NC_000012.12:g.114674523C>T	TOPMed,gnomAD
rs1295791270	p.Arg471Cys	missense variant	-	NC_000012.12:g.114674524G>A	TOPMed,gnomAD
rs1438073122	p.Arg471Leu	missense variant	-	NC_000012.12:g.114674523C>A	TOPMed,gnomAD
rs1302202171	p.Ala472Thr	missense variant	-	NC_000012.12:g.114674521C>T	gnomAD
rs762031545	p.Pro474Arg	missense variant	-	NC_000012.12:g.114674514G>C	ExAC,TOPMed,gnomAD
rs762031545	p.Pro474Leu	missense variant	-	NC_000012.12:g.114674514G>A	ExAC,TOPMed,gnomAD
rs776621762	p.Gly475Ser	missense variant	-	NC_000012.12:g.114674512C>T	ExAC,gnomAD
rs1192814694	p.Gly475Asp	missense variant	-	NC_000012.12:g.114674511C>T	TOPMed,gnomAD
rs557929464	p.Ala478Gly	missense variant	-	NC_000012.12:g.114674502G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs557929464	p.Ala478Val	missense variant	-	NC_000012.12:g.114674502G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1217657389	p.Phe479Val	missense variant	-	NC_000012.12:g.114674500A>C	gnomAD
NCI-TCGA novel	p.Ala480Gly	missense variant	-	NC_000012.12:g.114674496G>C	NCI-TCGA
rs1284348347	p.Ala480Val	missense variant	-	NC_000012.12:g.114674496G>A	gnomAD
rs537957080	p.Pro481Ser	missense variant	-	NC_000012.12:g.114674494G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs772493303	p.Pro481Leu	missense variant	-	NC_000012.12:g.114674493G>A	ExAC,TOPMed,gnomAD
rs772493303	p.Pro481Arg	missense variant	-	NC_000012.12:g.114674493G>C	ExAC,TOPMed,gnomAD
rs772493303	p.Pro481Gln	missense variant	-	NC_000012.12:g.114674493G>T	ExAC,TOPMed,gnomAD
rs1282046318	p.Thr483Met	missense variant	-	NC_000012.12:g.114674487G>A	gnomAD
rs1400241499	p.Val484Met	missense variant	-	NC_000012.12:g.114674485C>T	gnomAD
rs1286749643	p.Gln485His	missense variant	-	NC_000012.12:g.114674480C>G	TOPMed,gnomAD
rs1018135320	p.Thr486Met	missense variant	-	NC_000012.12:g.114674478G>A	TOPMed,gnomAD
rs1178166072	p.Asp487Gly	missense variant	-	NC_000012.12:g.114674475T>C	gnomAD
rs1428684030	p.Ala488Ser	missense variant	-	NC_000012.12:g.114674473C>A	gnomAD
rs973929178	p.Ala488Val	missense variant	-	NC_000012.12:g.114674472G>A	gnomAD
rs746231917	p.Ala489Pro	missense variant	-	NC_000012.12:g.114674470C>G	ExAC,TOPMed,gnomAD
rs746231917	p.Ala489Ser	missense variant	-	NC_000012.12:g.114674470C>A	ExAC,TOPMed,gnomAD
rs544562535	p.Ala490Ser	missense variant	-	NC_000012.12:g.114674467C>A	TOPMed,gnomAD
rs544562535	p.Ala490Thr	missense variant	-	NC_000012.12:g.114674467C>T	TOPMed,gnomAD
rs575298892	p.Ala491Glu	missense variant	-	NC_000012.12:g.114674463G>T	1000Genomes,TOPMed,gnomAD
rs1446220330	p.Ala491Thr	missense variant	-	NC_000012.12:g.114674464C>T	TOPMed
rs1208681777	p.Ala494Val	missense variant	-	NC_000012.12:g.114674454G>A	gnomAD
rs1258087026	p.Ala494Thr	missense variant	-	NC_000012.12:g.114674455C>T	gnomAD
RCV000477734	p.Gln495Ter	nonsense	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114674452G>A	ClinVar
rs1060505020	p.Gln495Ter	stop gained	Ulnar-mammary syndrome (ums)	NC_000012.12:g.114674452G>A	-
rs1024919027	p.Gly496Val	missense variant	-	NC_000012.12:g.114674448C>A	TOPMed,gnomAD
rs1024919027	p.Gly496Asp	missense variant	-	NC_000012.12:g.114674448C>T	TOPMed,gnomAD
rs1218779893	p.Pro497Ser	missense variant	-	NC_000012.12:g.114674446G>A	gnomAD
rs1345506334	p.Pro497Leu	missense variant	-	NC_000012.12:g.114674445G>A	TOPMed
rs1381252826	p.Leu498Gln	missense variant	-	NC_000012.12:g.114674442A>T	gnomAD
rs1304301066	p.Pro499Ser	missense variant	-	NC_000012.12:g.114674440G>A	gnomAD
rs755770688	p.Gly500Asp	missense variant	-	NC_000012.12:g.114674436C>T	ExAC,TOPMed,gnomAD
rs755770688	p.Gly500Val	missense variant	-	NC_000012.12:g.114674436C>A	ExAC,TOPMed,gnomAD
rs1405341560	p.Leu501Phe	missense variant	-	NC_000012.12:g.114674434G>A	gnomAD
rs1198728710	p.Phe503Leu	missense variant	-	NC_000012.12:g.114674428A>G	TOPMed
rs780531262	p.Ala504Thr	missense variant	-	NC_000012.12:g.114674425C>T	ExAC,TOPMed,gnomAD
rs754541756	p.Ala504Asp	missense variant	-	NC_000012.12:g.114674424G>T	ExAC,TOPMed,gnomAD
rs780531262	p.Ala504Ser	missense variant	-	NC_000012.12:g.114674425C>A	ExAC,TOPMed,gnomAD
rs1258709646	p.Gly506Ser	missense variant	-	NC_000012.12:g.114674419C>T	gnomAD
rs994091095	p.Ala508Thr	missense variant	-	NC_000012.12:g.114674413C>T	TOPMed
rs766332681	p.Ala508Glu	missense variant	-	NC_000012.12:g.114674412G>T	ExAC,TOPMed,gnomAD
rs766332681	p.Ala508Val	missense variant	-	NC_000012.12:g.114674412G>A	ExAC,TOPMed,gnomAD
rs1259313182	p.Gly509Asp	missense variant	-	NC_000012.12:g.114674409C>T	gnomAD
rs1398681508	p.Phe513Cys	missense variant	-	NC_000012.12:g.114674397A>C	TOPMed
rs750157618	p.Asn514Ser	missense variant	-	NC_000012.12:g.114674394T>C	ExAC,TOPMed,gnomAD
rs1226242461	p.Gly515Arg	missense variant	-	NC_000012.12:g.114674392C>T	gnomAD
rs1321883287	p.Gly515Glu	missense variant	-	NC_000012.12:g.114674391C>T	TOPMed,gnomAD
rs1314420883	p.His516Leu	missense variant	-	NC_000012.12:g.114674388T>A	TOPMed,gnomAD
rs1275992297	p.Pro517Ser	missense variant	-	NC_000012.12:g.114674386G>A	TOPMed
rs1450269147	p.Pro517Leu	missense variant	-	NC_000012.12:g.114674385G>A	TOPMed,gnomAD
rs535507808	p.His521Asn	missense variant	-	NC_000012.12:g.114674374G>T	1000Genomes,ExAC,gnomAD
rs535507808	p.His521Tyr	missense variant	-	NC_000012.12:g.114674374G>A	1000Genomes,ExAC,gnomAD
rs899972922	p.Pro522Ala	missense variant	-	NC_000012.12:g.114674371G>C	TOPMed
rs1394460148	p.Ser523Arg	missense variant	-	NC_000012.12:g.114674366G>C	gnomAD
rs1394460148	p.Ser523Arg	missense variant	-	NC_000012.12:g.114674366G>T	gnomAD
rs1167341195	p.Gln524Arg	missense variant	-	NC_000012.12:g.114674364T>C	gnomAD
rs1458461555	p.Gln524His	missense variant	-	NC_000012.12:g.114674363C>G	TOPMed,gnomAD
rs936879280	p.Met527Val	missense variant	-	NC_000012.12:g.114674356T>C	TOPMed
NCI-TCGA novel	p.Gly528Ala	missense variant	-	NC_000012.12:g.114674352C>G	NCI-TCGA
rs1370487115	p.Gly529Asp	missense variant	-	NC_000012.12:g.114674349C>T	gnomAD
rs1370487115	p.Gly529Ala	missense variant	-	NC_000012.12:g.114674349C>G	gnomAD
rs1444457719	p.Ala530Thr	missense variant	-	NC_000012.12:g.114674347C>T	gnomAD
rs566842835	p.Ser533Asn	missense variant	-	NC_000012.12:g.114674337C>T	1000Genomes,ExAC,gnomAD
rs1447833815	p.Met534Lys	missense variant	-	NC_000012.12:g.114674334A>T	gnomAD
rs200948009	p.Met534Val	missense variant	-	NC_000012.12:g.114674335T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs772620679	p.Ala537Pro	missense variant	-	NC_000012.12:g.114674326C>G	ExAC,TOPMed,gnomAD
rs772620679	p.Ala537Thr	missense variant	-	NC_000012.12:g.114674326C>T	ExAC,TOPMed,gnomAD
rs1243297711	p.Met539Thr	missense variant	-	NC_000012.12:g.114674319A>G	gnomAD
rs774790019	p.Gly540Ala	missense variant	-	NC_000012.12:g.114674316C>G	ExAC,TOPMed,gnomAD
rs774790019	p.Gly540Asp	missense variant	-	NC_000012.12:g.114674316C>T	ExAC,TOPMed,gnomAD
rs746391253	p.Gly540Ser	missense variant	-	NC_000012.12:g.114674317C>T	ExAC,TOPMed,gnomAD
rs539716467	p.Pro541Thr	missense variant	-	NC_000012.12:g.114674314G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs539716467	p.Pro541Ser	missense variant	-	NC_000012.12:g.114674314G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs780879062	p.Leu542Phe	missense variant	-	NC_000012.12:g.114674311G>A	ExAC,gnomAD
rs1296134076	p.Gly548Val	missense variant	-	NC_000012.12:g.114674292C>A	TOPMed
rs1301548236	p.Ala549Val	missense variant	-	NC_000012.12:g.114674289G>A	gnomAD
NCI-TCGA novel	p.Gly552Ser	missense variant	-	NC_000012.12:g.114674281C>T	NCI-TCGA
rs1160762375	p.Gly552Cys	missense variant	-	NC_000012.12:g.114674281C>A	TOPMed,gnomAD
rs1160762375	p.Gly552Arg	missense variant	-	NC_000012.12:g.114674281C>G	TOPMed,gnomAD
rs764962945	p.Ser554Leu	missense variant	-	NC_000012.12:g.114674274G>A	ExAC,TOPMed,gnomAD
rs1200162263	p.Ser558Cys	missense variant	-	NC_000012.12:g.114674262G>C	gnomAD
rs757023811	p.Thr559Met	missense variant	-	NC_000012.12:g.114674259G>A	ExAC,TOPMed,gnomAD
rs1219837774	p.Ala560Thr	missense variant	-	NC_000012.12:g.114674257C>T	gnomAD
rs753614292	p.Met561Val	missense variant	-	NC_000012.12:g.114674254T>C	ExAC,gnomAD
rs201325654	p.Ala562Val	missense variant	-	NC_000012.12:g.114674250G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs374941856	p.Ala562Thr	missense variant	-	NC_000012.12:g.114674251C>T	ExAC,gnomAD
RCV000361036	p.Ala562Val	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114674250G>A	ClinVar
rs775584392	p.Ala564Thr	missense variant	-	NC_000012.12:g.114674245C>T	ExAC,gnomAD
rs767500073	p.Ala565Thr	missense variant	-	NC_000012.12:g.114674242C>T	ExAC,TOPMed,gnomAD
rs372029833	p.Ala566Val	missense variant	-	NC_000012.12:g.114674238G>A	ESP,TOPMed,gnomAD
rs1281379922	p.Ala567Ser	missense variant	-	NC_000012.12:g.114674236C>A	gnomAD
rs1281379922	p.Ala567Thr	missense variant	-	NC_000012.12:g.114674236C>T	gnomAD
rs1316375409	p.Ala567Val	missense variant	-	NC_000012.12:g.114674235G>A	gnomAD
rs1361474297	p.Gly569Glu	missense variant	-	NC_000012.12:g.114674229C>T	gnomAD
NCI-TCGA novel	p.Ser571Phe	missense variant	-	NC_000012.12:g.114674223G>A	NCI-TCGA
rs1300277161	p.Ser571Cys	missense variant	-	NC_000012.12:g.114674223G>C	gnomAD
rs1446406418	p.Gly572Glu	missense variant	-	NC_000012.12:g.114674220C>T	TOPMed
rs749641288	p.Gly572Arg	missense variant	-	NC_000012.12:g.114674221C>G	ExAC,gnomAD
rs1479267403	p.Ala573Thr	missense variant	-	NC_000012.12:g.114674218C>T	gnomAD
rs773504740	p.Ala573Val	missense variant	-	NC_000012.12:g.114674217G>A	ExAC,gnomAD
rs1156821376	p.Ala575Thr	missense variant	-	NC_000012.12:g.114674212C>T	TOPMed
rs1263505115	p.Ala575Val	missense variant	-	NC_000012.12:g.114674211G>A	TOPMed,gnomAD
rs1263505115	p.Ala575Gly	missense variant	-	NC_000012.12:g.114674211G>C	TOPMed,gnomAD
rs1445090095	p.Ala576Thr	missense variant	-	NC_000012.12:g.114674209C>T	gnomAD
rs1399626159	p.Ala576Val	missense variant	-	NC_000012.12:g.114674208G>A	TOPMed
rs1229095604	p.Thr577Ile	missense variant	-	NC_000012.12:g.114674205G>A	gnomAD
rs1200965652	p.Leu578Arg	missense variant	-	NC_000012.12:g.114674202A>C	gnomAD
rs375482722	p.Pro579Leu	missense variant	-	NC_000012.12:g.114674199G>A	ESP,ExAC,TOPMed,gnomAD
rs1384412351	p.His581Tyr	missense variant	-	NC_000012.12:g.114674194G>A	TOPMed
rs1223050643	p.Leu582Val	missense variant	-	NC_000012.12:g.114674191G>C	gnomAD
RCV000300557	p.His585Gln	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114674180G>T	ClinVar
rs528110988	p.His585Gln	missense variant	-	NC_000012.12:g.114674180G>T	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Val586Ile	missense variant	-	NC_000012.12:g.114674179C>T	NCI-TCGA
rs757250778	p.Leu587Pro	missense variant	-	NC_000012.12:g.114674175A>G	ExAC,gnomAD
rs1326245416	p.Ala588Ser	missense variant	-	NC_000012.12:g.114674173C>A	TOPMed,gnomAD
rs1326245416	p.Ala588Thr	missense variant	-	NC_000012.12:g.114674173C>T	TOPMed,gnomAD
COSM6071321	p.Ser589Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114674169G>A	NCI-TCGA Cosmic
rs753655242	p.Gln590Leu	missense variant	-	NC_000012.12:g.114674166T>A	ExAC,TOPMed,gnomAD
rs1262807912	p.Gln590His	missense variant	-	NC_000012.12:g.114674165C>G	TOPMed
rs753655242	p.Gln590Arg	missense variant	-	NC_000012.12:g.114674166T>C	ExAC,TOPMed,gnomAD
rs1182949304	p.Ala593Thr	missense variant	-	NC_000012.12:g.114672296C>T	gnomAD
rs1458110040	p.Ala593Val	missense variant	-	NC_000012.12:g.114672295G>A	TOPMed,gnomAD
rs1479824258	p.Met594Thr	missense variant	-	NC_000012.12:g.114672292A>G	TOPMed
rs930385721	p.Ser595Pro	missense variant	-	NC_000012.12:g.114672290A>G	TOPMed
rs867417931	p.Ser595Phe	missense variant	-	NC_000012.12:g.114672289G>A	TOPMed,gnomAD
rs867417931	p.Ser595Tyr	missense variant	-	NC_000012.12:g.114672289G>T	TOPMed,gnomAD
NCI-TCGA novel	p.Pro596Ala	missense variant	-	NC_000012.12:g.114672287G>C	NCI-TCGA
rs1437311804	p.Pro596Ser	missense variant	-	NC_000012.12:g.114672287G>A	gnomAD
rs753940578	p.Phe597Leu	missense variant	-	NC_000012.12:g.114672282G>C	ExAC,TOPMed,gnomAD
rs778450474	p.Phe597Ser	missense variant	-	NC_000012.12:g.114672283A>G	ExAC,gnomAD
rs1456840061	p.Gly598Glu	missense variant	-	NC_000012.12:g.114672280C>T	gnomAD
rs1314719430	p.Gly598Arg	missense variant	-	NC_000012.12:g.114672281C>T	gnomAD
rs749188927	p.Ser599Gly	missense variant	-	NC_000012.12:g.114672278T>C	ExAC,gnomAD
rs1376234157	p.Ser599Arg	missense variant	-	NC_000012.12:g.114672276G>C	gnomAD
rs1296950217	p.Leu600Met	missense variant	-	NC_000012.12:g.114672275G>T	gnomAD
rs777583851	p.Pro602Leu	missense variant	-	NC_000012.12:g.114672268G>A	ExAC,TOPMed,gnomAD
rs971835561	p.Pro604Ser	missense variant	-	NC_000012.12:g.114672263G>A	TOPMed,gnomAD
rs755884541	p.Thr606Met	missense variant	-	NC_000012.12:g.114672256G>A	ExAC,TOPMed,gnomAD
rs755321111	p.Met608Leu	missense variant	-	NC_000012.12:g.114672251T>A	ExAC,TOPMed,gnomAD
rs755321111	p.Met608Val	missense variant	-	NC_000012.12:g.114672251T>C	ExAC,TOPMed,gnomAD
rs755321111	p.Met608Leu	missense variant	-	NC_000012.12:g.114672251T>G	ExAC,TOPMed,gnomAD
rs751628989	p.Ala610Thr	missense variant	-	NC_000012.12:g.114672245C>T	ExAC,TOPMed,gnomAD
rs1313914234	p.Ala610Glu	missense variant	-	NC_000012.12:g.114672244G>T	TOPMed
rs766569858	p.Ala611Thr	missense variant	-	NC_000012.12:g.114672242C>T	ExAC,gnomAD
rs867049310	p.Ala611Val	missense variant	-	NC_000012.12:g.114672241G>A	gnomAD
rs867049310	p.Ala611Glu	missense variant	-	NC_000012.12:g.114672241G>T	gnomAD
rs1247323875	p.Ala612Thr	missense variant	-	NC_000012.12:g.114672239C>T	gnomAD
rs1225011740	p.Ala613Gly	missense variant	-	NC_000012.12:g.114672235G>C	gnomAD
rs1291296572	p.Ala614Ser	missense variant	-	NC_000012.12:g.114672233C>A	gnomAD
rs1291296572	p.Ala614Thr	missense variant	-	NC_000012.12:g.114672233C>T	gnomAD
rs763473739	p.Ser615Ala	missense variant	-	NC_000012.12:g.114672230A>C	ExAC,TOPMed,gnomAD
RCV000407537	p.Ser615Ala	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114672230A>C	ClinVar
rs200821102	p.Ala617Val	missense variant	-	NC_000012.12:g.114672223G>A	ExAC,TOPMed,gnomAD
RCV000349644	p.Ala617Val	missense variant	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114672223G>A	ClinVar
rs1223672232	p.Ala617Pro	missense variant	-	NC_000012.12:g.114672224C>G	gnomAD
rs200821102	p.Ala617Glu	missense variant	-	NC_000012.12:g.114672223G>T	ExAC,TOPMed,gnomAD
COSM691946	p.Ala617Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114672224C>T	NCI-TCGA Cosmic
rs765821877	p.Ala618Thr	missense variant	-	NC_000012.12:g.114672221C>T	ExAC,gnomAD
rs1191297422	p.Ala619Ser	missense variant	-	NC_000012.12:g.114672218C>A	TOPMed
rs1346724744	p.Ser621Arg	missense variant	-	NC_000012.12:g.114672210G>C	gnomAD
rs759202204	p.His624Arg	missense variant	-	NC_000012.12:g.114672202T>C	ExAC,TOPMed,gnomAD
rs771698419	p.His624Asn	missense variant	-	NC_000012.12:g.114672203G>T	ExAC,TOPMed,gnomAD
rs1201751425	p.Arg625His	missense variant	-	NC_000012.12:g.114672199C>T	NCI-TCGA Cosmic
rs773785943	p.Arg625Cys	missense variant	-	NC_000012.12:g.114672200G>A	ExAC,TOPMed,gnomAD
rs1201751425	p.Arg625His	missense variant	-	NC_000012.12:g.114672199C>T	TOPMed,gnomAD
rs773785943	p.Arg625Ser	missense variant	-	NC_000012.12:g.114672200G>T	ExAC,TOPMed,gnomAD
rs954634731	p.His626Gln	missense variant	-	NC_000012.12:g.114672195G>T	TOPMed,gnomAD
rs1259293033	p.Leu629Phe	missense variant	-	NC_000012.12:g.114672188G>A	gnomAD
rs1445898564	p.Asn630Ser	missense variant	-	NC_000012.12:g.114672184T>C	gnomAD
rs769814877	p.Leu631Val	missense variant	-	NC_000012.12:g.114672182G>C	ExAC,TOPMed,gnomAD
rs747894358	p.Leu631Pro	missense variant	-	NC_000012.12:g.114672181A>G	ExAC,gnomAD
rs769814877	p.Leu631Met	missense variant	-	NC_000012.12:g.114672182G>T	ExAC,TOPMed,gnomAD
rs1040183921	p.Asn632Lys	missense variant	-	NC_000012.12:g.114672177G>C	TOPMed,gnomAD
rs189469110	p.Thr633Ile	missense variant	-	NC_000012.12:g.114672175G>A	1000Genomes,gnomAD
rs1343061173	p.Thr633Ala	missense variant	-	NC_000012.12:g.114672176T>C	gnomAD
COSM4918852	p.Thr633Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114672176T>A	NCI-TCGA Cosmic
rs1382396799	p.Met634Val	missense variant	-	NC_000012.12:g.114672173T>C	TOPMed,gnomAD
rs781193551	p.Arg635Cys	missense variant	-	NC_000012.12:g.114672170G>A	NCI-TCGA Cosmic
rs1286841573	p.Arg635His	missense variant	-	NC_000012.12:g.114672169C>T	gnomAD
rs781193551	p.Arg635Cys	missense variant	-	NC_000012.12:g.114672170G>A	ExAC,TOPMed,gnomAD
rs781193551	p.Arg635Gly	missense variant	-	NC_000012.12:g.114672170G>C	ExAC,TOPMed,gnomAD
rs755181770	p.Pro636Gln	missense variant	-	NC_000012.12:g.114672166G>T	ExAC,gnomAD
NCI-TCGA novel	p.Arg637Trp	missense variant	-	NC_000012.12:g.114672164G>A	NCI-TCGA
rs1468341577	p.Leu638Val	missense variant	-	NC_000012.12:g.114672161G>C	gnomAD
rs1171437549	p.Pro642Ser	missense variant	-	NC_000012.12:g.114672149G>A	gnomAD
COSM3456528	p.Ser644Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114672142G>A	NCI-TCGA Cosmic
rs1260105802	p.Ile645Met	missense variant	-	NC_000012.12:g.114672138G>C	TOPMed,gnomAD
rs1186364207	p.Pro646Leu	missense variant	-	NC_000012.12:g.114672136G>A	gnomAD
rs780229109	p.Val647Ala	missense variant	-	NC_000012.12:g.114672133A>G	ExAC,TOPMed,gnomAD
rs1245554909	p.Val647Met	missense variant	-	NC_000012.12:g.114672134C>T	gnomAD
rs1320834041	p.Pro648Ser	missense variant	-	NC_000012.12:g.114672131G>A	TOPMed,gnomAD
rs1308949255	p.Pro650Leu	missense variant	-	NC_000012.12:g.114672124G>A	gnomAD
COSM935496	p.Pro650Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114672124G>T	NCI-TCGA Cosmic
rs1308949255	p.Pro650Leu	missense variant	-	NC_000012.12:g.114672124G>A	NCI-TCGA Cosmic
rs757838938	p.Asp651Glu	missense variant	-	NC_000012.12:g.114672120G>C	ExAC,TOPMed,gnomAD
rs754142951	p.Gly652Ser	missense variant	-	NC_000012.12:g.114672119C>T	ExAC,TOPMed
RCV000597929	p.Gly652Ser	missense variant	-	NC_000012.12:g.114672119C>T	ClinVar
rs754142951	p.Gly652Cys	missense variant	-	NC_000012.12:g.114672119C>A	ExAC,TOPMed
rs1383226635	p.Gly652Asp	missense variant	-	NC_000012.12:g.114672118C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Ser653Ile	missense variant	-	NC_000012.12:g.114672115C>A	NCI-TCGA
rs1338643169	p.Ser653Asn	missense variant	-	NC_000012.12:g.114672115C>T	gnomAD
rs1405449761	p.Ser654Arg	missense variant	-	NC_000012.12:g.114672113T>G	gnomAD
rs1298766115	p.Ser654Asn	missense variant	-	NC_000012.12:g.114672112C>T	gnomAD
rs563684608	p.Leu656Phe	missense variant	-	NC_000012.12:g.114672107G>A	1000Genomes
rs1445671634	p.Thr658Asn	missense variant	-	NC_000012.12:g.114672100G>T	gnomAD
rs199719014	p.Thr658Ala	missense variant	-	NC_000012.12:g.114672101T>C	ESP,ExAC,TOPMed,gnomAD
rs1182290035	p.Ala659Thr	missense variant	-	NC_000012.12:g.114672098C>T	gnomAD
RCV000722180	p.Pro661Ter	frameshift	Ulnar-mammary syndrome (UMS)	NC_000012.12:g.114672092_114672093dup	ClinVar
rs1239302522	p.Ser662Cys	missense variant	-	NC_000012.12:g.114672088G>C	gnomAD
rs1239302522	p.Ser662Phe	missense variant	-	NC_000012.12:g.114672088G>A	gnomAD
rs766105115	p.Met663Thr	missense variant	-	NC_000012.12:g.114672085A>G	ExAC,gnomAD
rs762342872	p.Ala664Val	missense variant	-	NC_000012.12:g.114672082G>A	ExAC,TOPMed,gnomAD
rs1235095687	p.Ala665Val	missense variant	-	NC_000012.12:g.114672079G>A	NCI-TCGA
rs1235095687	p.Ala665Val	missense variant	-	NC_000012.12:g.114672079G>A	gnomAD
rs940436570	p.Ala666Val	missense variant	-	NC_000012.12:g.114672076G>A	TOPMed,gnomAD
rs1268167495	p.Ala667Thr	missense variant	-	NC_000012.12:g.114672074C>T	TOPMed
rs748098418	p.Ala667Val	missense variant	-	NC_000012.12:g.114672073G>A	ExAC,gnomAD
rs748098418	p.Ala667Glu	missense variant	-	NC_000012.12:g.114672073G>T	ExAC,gnomAD
rs768590444	p.Gly668Arg	missense variant	-	NC_000012.12:g.114672071C>T	ExAC,gnomAD
rs917426315	p.Pro669His	missense variant	-	NC_000012.12:g.114672067G>T	TOPMed,gnomAD
rs1465838237	p.Pro669Ala	missense variant	-	NC_000012.12:g.114672068G>C	TOPMed
rs780391500	p.Asp671Asn	missense variant	-	NC_000012.12:g.114672062C>T	ExAC,gnomAD
rs1472675655	p.Asp671Gly	missense variant	-	NC_000012.12:g.114672061T>C	TOPMed
NCI-TCGA novel	p.Gly672Asp	missense variant	-	NC_000012.12:g.114672058C>T	NCI-TCGA
rs1367860375	p.Gly672Ser	missense variant	-	NC_000012.12:g.114672059C>T	TOPMed,gnomAD
rs1367860375	p.Gly672Arg	missense variant	-	NC_000012.12:g.114672059C>G	TOPMed,gnomAD
rs1416254745	p.Lys673Thr	missense variant	-	NC_000012.12:g.114672055T>G	TOPMed
COSM4392501	p.Lys673Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114672055T>C	NCI-TCGA Cosmic
rs1184573194	p.Ala675Gly	missense variant	-	NC_000012.12:g.114672049G>C	gnomAD
rs745920930	p.Ala675Thr	missense variant	-	NC_000012.12:g.114672050C>T	ExAC,gnomAD
rs1013102657	p.Ala676Ser	missense variant	-	NC_000012.12:g.114672047C>A	gnomAD
rs1013102657	p.Ala676Thr	missense variant	-	NC_000012.12:g.114672047C>T	gnomAD
rs1013102657	p.Ala676Thr	missense variant	-	NC_000012.12:g.114672047C>T	NCI-TCGA Cosmic
rs1490395317	p.Ala678Val	missense variant	-	NC_000012.12:g.114672040G>A	TOPMed,gnomAD
rs756448415	p.Pro681Leu	missense variant	-	NC_000012.12:g.114672031G>A	ExAC,gnomAD
rs753103762	p.Ala682Val	missense variant	-	NC_000012.12:g.114672028G>A	ExAC,gnomAD
NCI-TCGA novel	p.Ala685Thr	missense variant	-	NC_000012.12:g.114672020C>T	NCI-TCGA
rs762726425	p.Val686Met	missense variant	-	NC_000012.12:g.114672017C>T	ExAC,TOPMed,gnomAD
rs772542059	p.Asp687Gly	missense variant	-	NC_000012.12:g.114672013T>C	ExAC
NCI-TCGA novel	p.Gly689Cys	missense variant	-	NC_000012.12:g.114672008C>A	NCI-TCGA
rs761791510	p.Ser690Phe	missense variant	-	NC_000012.12:g.114672004G>A	ExAC,gnomAD
rs1424482515	p.Leu692Ile	missense variant	-	NC_000012.12:g.114671999G>T	gnomAD
rs768750171	p.Asn693Lys	missense variant	-	NC_000012.12:g.114671994G>T	ExAC,gnomAD
rs376267079	p.Asn693Ser	missense variant	-	NC_000012.12:g.114671995T>C	ESP,ExAC,gnomAD
COSM430413	p.Asn693ThrPheSerTerUnkUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.114671995T>-	NCI-TCGA Cosmic
rs373524965	p.Arg695Cys	missense variant	-	NC_000012.12:g.114671990G>A	ESP,ExAC,gnomAD
rs772126133	p.Arg695Leu	missense variant	-	NC_000012.12:g.114671989C>A	ExAC,gnomAD
rs772126133	p.Arg695His	missense variant	-	NC_000012.12:g.114671989C>T	ExAC,gnomAD
rs772126133	p.Arg695His	missense variant	-	NC_000012.12:g.114671989C>T	NCI-TCGA,NCI-TCGA Cosmic
rs1180900873	p.Ser696Phe	missense variant	-	NC_000012.12:g.114671986G>A	TOPMed,gnomAD
rs1270648980	p.Leu699Arg	missense variant	-	NC_000012.12:g.114671977A>C	gnomAD
rs947137864	p.Ser700Phe	missense variant	-	NC_000012.12:g.114671974G>A	gnomAD
rs910200581	p.Ser701Cys	missense variant	-	NC_000012.12:g.114671971G>C	gnomAD
rs910200581	p.Ser701Phe	missense variant	-	NC_000012.12:g.114671971G>A	gnomAD
rs1206831594	p.Ser701Thr	missense variant	-	NC_000012.12:g.114671972A>T	gnomAD
rs199572544	p.Ser702Asn	missense variant	-	NC_000012.12:g.114671968C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs199572544	p.Ser702Ile	missense variant	-	NC_000012.12:g.114671968C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs781632308	p.Met704Val	missense variant	-	NC_000012.12:g.114671963T>C	ExAC,gnomAD
rs781632308	p.Met704Leu	missense variant	-	NC_000012.12:g.114671963T>G	ExAC,gnomAD
rs972007244	p.Leu706Ser	missense variant	-	NC_000012.12:g.114671956A>G	gnomAD
rs1327392865	p.Ser707Leu	missense variant	-	NC_000012.12:g.114671953G>A	gnomAD
rs1380875741	p.Leu710Pro	missense variant	-	NC_000012.12:g.114671944A>G	gnomAD
rs750109853	p.Ala712Glu	missense variant	-	NC_000012.12:g.114671938G>T	ExAC,TOPMed,gnomAD
rs750109853	p.Ala712Val	missense variant	-	NC_000012.12:g.114671938G>A	ExAC,TOPMed,gnomAD
rs761372590	p.Glu713Asp	missense variant	-	NC_000012.12:g.114671934C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys714ArgPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.114671931_114671932TT>-	NCI-TCGA
rs1430734511	p.Lys714Thr	missense variant	-	NC_000012.12:g.114671932T>G	gnomAD
rs984149241	p.Glu715Val	missense variant	-	NC_000012.12:g.114671929T>A	TOPMed
rs369538205	p.Ala716Val	missense variant	-	NC_000012.12:g.114671926G>A	ESP,ExAC,TOPMed,gnomAD
rs369538205	p.Ala716Glu	missense variant	-	NC_000012.12:g.114671926G>T	ESP,ExAC,TOPMed,gnomAD
rs369538205	p.Ala716Gly	missense variant	-	NC_000012.12:g.114671926G>C	ESP,ExAC,TOPMed,gnomAD
rs775079618	p.Thr718Ser	missense variant	-	NC_000012.12:g.114671920G>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser719Gly	missense variant	-	NC_000012.12:g.114671918T>C	NCI-TCGA
rs1445032845	p.Ser719Asn	missense variant	-	NC_000012.12:g.114671917C>T	gnomAD
COSM3811131	p.Glu720Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.114671915C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gln722Leu	missense variant	-	NC_000012.12:g.114671908T>A	NCI-TCGA
NCI-TCGA novel	p.Ser723Ile	missense variant	-	NC_000012.12:g.114671905C>A	NCI-TCGA
rs771934403	p.Gln725Arg	missense variant	-	NC_000012.12:g.114671899T>C	ExAC,TOPMed,gnomAD
rs558420030	p.Arg726Gln	missense variant	-	NC_000012.12:g.114671896C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs558420030	p.Arg726Leu	missense variant	-	NC_000012.12:g.114671896C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1218875641	p.Arg726Trp	missense variant	-	NC_000012.12:g.114671897G>A	TOPMed,gnomAD
rs1326188945	p.Val728Ala	missense variant	-	NC_000012.12:g.114671890A>G	gnomAD
rs774611046	p.Ser729Arg	missense variant	-	NC_000012.12:g.114671886G>C	ExAC,TOPMed,gnomAD
rs1334054777	p.Gly730Asp	missense variant	-	NC_000012.12:g.114671884C>T	gnomAD
rs1407667924	p.Gly730Ser	missense variant	-	NC_000012.12:g.114671885C>T	gnomAD
rs1407667924	p.Gly730Ser	missense variant	-	NC_000012.12:g.114671885C>T	NCI-TCGA
rs771183388	p.Leu731Phe	missense variant	-	NC_000012.12:g.114671880C>A	ExAC,gnomAD
rs1351885173	p.Ala733Thr	missense variant	-	NC_000012.12:g.114671876C>T	TOPMed
rs1402577995	p.Lys734Thr	missense variant	-	NC_000012.12:g.114671872T>G	TOPMed
rs1419835703	p.Pro735Ser	missense variant	-	NC_000012.12:g.114671870G>A	gnomAD
rs1245300799	p.Pro735Arg	missense variant	-	NC_000012.12:g.114671869G>C	gnomAD
rs777891705	p.Ser738Ala	missense variant	-	NC_000012.12:g.114671861A>C	ExAC,gnomAD
rs1389276999	p.Ser738Phe	missense variant	-	NC_000012.12:g.114671860G>A	gnomAD
rs748697172	p.Arg739His	missense variant	-	NC_000012.12:g.114671857C>T	ExAC,TOPMed,gnomAD
rs770230836	p.Arg739Ser	missense variant	-	NC_000012.12:g.114671858G>T	ExAC,TOPMed,gnomAD
rs770230836	p.Arg739Cys	missense variant	-	NC_000012.12:g.114671858G>A	NCI-TCGA
rs770230836	p.Arg739Cys	missense variant	-	NC_000012.12:g.114671858G>A	ExAC,TOPMed,gnomAD
rs15033	p.Ala741Gly	missense variant	-	NC_000012.12:g.114671851G>C	TOPMed
rs15033	p.Ala741Val	missense variant	-	NC_000012.12:g.114671851G>A	TOPMed
rs138010059	p.Ala741Pro	missense variant	-	NC_000012.12:g.114671852C>G	ESP,ExAC,TOPMed,gnomAD
rs751905018	p.Pro743Leu	missense variant	-	NC_000012.12:g.114671845G>A	ExAC,TOPMed,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0000768	Congenital Abnormality	group	BEFREE
C0002893	Refractory anemias	disease	BEFREE
C0003466	Anus, Imperforate	disease	HPO
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0004245	Atrioventricular Block	disease	BEFREE
C0005684	Malignant neoplasm of urinary bladder	disease	BEFREE
C0005695	Bladder Neoplasm	group	BEFREE
C0005904	Body Temperature Changes	phenotype	HPO
C0006142	Malignant neoplasm of breast	disease	BEFREE;CGI;CTD_human
C0008073	Developmental Disabilities	group	BEFREE
C0009404	Colorectal Neoplasms	group	BEFREE
C0010068	Coronary heart disease	disease	BEFREE
C0010417	Cryptorchidism	disease	HPO
C0018818	Ventricular Septal Defects	group	BEFREE;HPO
C0019294	Hernia, Inguinal	phenotype	HPO
C0020538	Hypertensive disease	group	BEFREE
C0020608	Hypodontia	disease	HPO
C0020636	Congenital hypoplasia	disease	BEFREE
C0022658	Kidney Diseases	group	BEFREE
C0022660	Kidney Failure, Acute	disease	BEFREE
C0023903	Liver neoplasms	group	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE;CTD_human
C0025202	melanoma	disease	BEFREE;LHGDN
C0025362	Mental Retardation	disease	BEFREE
C0027051	Myocardial Infarction	disease	RGD
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0028754	Obesity	disease	HPO
C0033578	Prostatic Neoplasms	group	CTD_human
C0034012	Delayed Puberty	phenotype	HPO
C0034194	Pyloric Stenosis	phenotype	HPO
C0035436	Rheumatic Fever	disease	BEFREE
C0038356	Stomach Neoplasms	group	CTD_human
C0038454	Cerebrovascular accident	group	CTD_human
C0040128	Thyroid Diseases	group	CTD_human
C0040427	Tooth Abnormalities	group	CTD_human
C0041207	Truncus Arteriosus, Persistent	disease	BEFREE
C0149925	Small cell carcinoma of lung	disease	BEFREE
C0152427	Polydactyly	disease	GENOMICS_ENGLAND
C0152436	Hymen, Imperforate	phenotype	HPO
C0178664	Glomerulosclerosis (disorder)	disease	BEFREE
C0206624	Hepatoblastoma	disease	BEFREE
C0206762	Limb Deformities, Congenital	group	BEFREE;CTD_human
C0235480	Paroxysmal atrial fibrillation	disease	BEFREE
C0238441	Subglottic stenosis	phenotype	HPO
C0262374	Stricture of anus	phenotype	HPO
C0264490	Acute respiratory failure	disease	BEFREE
C0266013	Congenital hypoplasia of breast	disease	HPO
C0266383	Uterine Anomalies	group	HPO
C0266435	Congenital hypoplasia of penis	disease	HPO
C0269269	Inversion of nipple (disorder)	phenotype	HPO
C0279000	Liver and Intrahepatic Biliary Tract Carcinoma	disease	BEFREE
C0345904	Malignant neoplasm of liver	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0376358	Malignant neoplasm of prostate	disease	CTD_human
C0426799	Congenital hypoplasia of clavicle	disease	HPO
C0428908	Sinus Node Dysfunction (disorder)	disease	BEFREE
C0431904	Ulnar polydactyly of fingers	disease	HPO
C0432355	Hypoplasia of nipple	disease	HPO
C0496956	Neoplasm of uncertain or unknown behavior of breast	disease	CGI
C0520927	Decreased fertility	phenotype	HPO
C0524730	Odontome	disease	CTD_human
C0559106	Ventricular preexcitation	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE;CGI;CTD_human
C0685381	Congenital hypoplasia of radius	disease	HPO
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0699885	Carcinoma of bladder	disease	BEFREE
C0751956	Acute Cerebrovascular Accidents	disease	CTD_human
C0858252	Breast adenocarcinoma	disease	CGI
C0919267	ovarian neoplasm	disease	LHGDN
C0948740	Hypoplasia of the pituitary gland	disease	HPO
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE
C1257931	Mammary Neoplasms, Human	group	CTD_human
C1319315	Adenocarcinoma of large intestine	disease	GWASDB
C1405984	Absent radius	disease	HPO
C1458155	Mammary Neoplasms	group	BEFREE;CTD_human;LHGDN
C1527249	Colorectal Cancer	disease	BEFREE;GWASCAT
C1708349	Hereditary Diffuse Gastric Cancer	disease	CTD_human
C1832117	Short humerus	phenotype	HPO
C1832160	Abnormality of temperature regulation	phenotype	HPO
C1838608	Radial aplasia	disease	HPO
C1840087	Radial ray hypoplasia	phenotype	HPO
C1846434	Hypoplastic scapulae	phenotype	HPO
C1849314	absence of radius and ulna	phenotype	HPO
C1857206	Sparse lateral eyebrow	phenotype	HPO
C1858539	Shawl scrotum	phenotype	HPO
C1858574	Sparse axillary hair	phenotype	HPO
C1859392	Absent axillary hair	phenotype	HPO
C1859775	Anterior pituitary hypoplasia	phenotype	HPO
C1860614	ULNAR HYPOPLASIA	phenotype	HPO
C1862083	Short 4th toe	phenotype	HPO
C1862132	Short ulnae	phenotype	HPO
C1865571	Aplasia/Hypoplasia of the ulna	phenotype	HPO
C1866994	Ulnar-mammary syndrome	disease	BEFREE;CLINVAR;CTD_human;MGD;ORPHANET;UNIPROT
C1867003	Axillary apocrine gland hypoplasia	phenotype	HPO
C2239176	Liver carcinoma	disease	BEFREE
C2678397	Aplasia of the ulna	phenotype	HPO
C3279571	Ectopic posterior pituitary	phenotype	HPO
C3714756	Intellectual Disability	group	BEFREE;GENOMICS_ENGLAND
C4021111	Short 5th toe	phenotype	HPO
C4021744	Abnormality of the wrist	phenotype	HPO
C4021782	Abnormality of the fingernails	phenotype	HPO
C4025414	Radial club hand	disease	GENOMICS_ENGLAND
C4025467	Deformed radius	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000977	RNA polymerase II regulatory region sequence-specific DNA binding	IBA
GO:0000978	RNA polymerase II cis-regulatory region sequence-specific DNA binding	IDA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM
GO:0001085	RNA polymerase II transcription factor binding	ISS
GO:0001102	RNA polymerase II activating transcription factor binding	ISS
GO:0001102	RNA polymerase II activating transcription factor binding	IBA
GO:0001227	DNA-binding transcription repressor activity, RNA polymerase II-specific	IDA
GO:0001228	DNA-binding transcription activator activity, RNA polymerase II-specific	IBA
GO:0005515	protein binding	IPI
GO:0043565	sequence-specific DNA binding	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0000122	negative regulation of transcription by RNA polymerase II	IDA
GO:0000122	negative regulation of transcription by RNA polymerase II	IBA
GO:0001501	skeletal system development	IMP
GO:0001568	blood vessel development	IEA
GO:0001701	in utero embryonic development	IEA
GO:0001708	cell fate specification	IBA
GO:0001947	heart looping	IBA
GO:0003151	outflow tract morphogenesis	IEA
GO:0003167	atrioventricular bundle cell differentiation	IEA
GO:0003205	cardiac chamber development	IBA
GO:0006357	regulation of transcription by RNA polymerase II	TAS
GO:0007417	central nervous system development	IBA
GO:0007569	cell aging	IDA
GO:0008284	positive regulation of cell population proliferation	IDA
GO:0008284	positive regulation of cell population proliferation	IBA
GO:0008595	anterior/posterior axis specification, embryo	IMP
GO:0009887	animal organ morphogenesis	IDA
GO:0010159	specification of animal organ position	IEA
GO:0019827	stem cell population maintenance	IEA
GO:0021761	limbic system development	IEA
GO:0030539	male genitalia development	IMP
GO:0030540	female genitalia development	IMP
GO:0030857	negative regulation of epithelial cell differentiation	IEA
GO:0030879	mammary gland development	IMP
GO:0032275	luteinizing hormone secretion	IMP
GO:0035115	embryonic forelimb morphogenesis	IMP
GO:0035116	embryonic hindlimb morphogenesis	IEA
GO:0035136	forelimb morphogenesis	IDA
GO:0042733	embryonic digit morphogenesis	IMP
GO:0043066	negative regulation of apoptotic process	IDA
GO:0045662	negative regulation of myoblast differentiation	IDA
GO:0045787	positive regulation of cell cycle	IDA
GO:0045892	negative regulation of transcription, DNA-templated	IDA
GO:0045944	positive regulation of transcription by RNA polymerase II	IBA
GO:0046884	follicle-stimulating hormone secretion	IMP
GO:0048332	mesoderm morphogenesis	IMP
GO:0060021	roof of mouth development	IEA
GO:0060412	ventricular septum morphogenesis	IEA
GO:0060444	branching involved in mammary gland duct morphogenesis	IEA
GO:0060596	mammary placode formation	IEA
GO:0060923	cardiac muscle cell fate commitment	IEA
GO:0060931	sinoatrial node cell development	IEA
GO:0090398	cellular senescence	IDA
GO:2000648	positive regulation of stem cell proliferation	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000790	nuclear chromatin	ISA
GO:0005634	nucleus	IDA
GO:0005634	nucleus	IBA

Reactome Pathway

Reactome ID	Reactome Term	Evidence

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in decreased expression of TBX3 mRNA	28628672
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of TBX3 mRNA	28628672
C016403	2,4-dinitrotoluene	2,4-dinitrotoluene affects the expression of TBX3 mRNA	21346803
C023035	3,4,5,3',4'-pentachlorobiphenyl	3,4,5,3',4'-pentachlorobiphenyl results in increased expression of TBX3 mRNA	19692669
C009505	4,4'-diaminodiphenylmethane	4,4'-diaminodiphenylmethane results in decreased expression of TBX3 mRNA	18648102
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TBX3 mRNA	27188386
C496492	abrine	abrine results in increased expression of TBX3 mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in decreased expression of TBX3 mRNA	26690555
D000082	Acetaminophen	Acetaminophen results in increased expression of TBX3 mRNA	29067470
C016601	afimoxifene	PD 173074 inhibits the reaction [afimoxifene results in increased expression of TBX3 protein]	21098263
D000447	Aldehydes	Aldehydes results in increased expression of TBX3 mRNA	25014914
D000638	Amiodarone	Amiodarone results in increased expression of TBX3 mRNA	23397585
D000640	Amitrole	Amitrole results in decreased expression of TBX3 mRNA	23397585
D018501	Antirheumatic Agents	Antirheumatic Agents results in increased expression of TBX3 mRNA	24449571
C015001	arsenite	arsenite results in increased methylation of TBX3 promoter	23974009
C030935	benz(a)anthracene	benz(a)anthracene results in increased expression of TBX3 mRNA	26377693
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of TBX3 mRNA	21802500; 22316170;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of TBX3 mRNA	22228805; 23735875; 27195522;
C543008	bis(4-hydroxyphenyl)sulfone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in decreased expression of TBX3 mRNA	28628672
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of TBX3 mRNA	30951980
C006780	bisphenol A	bisphenol A results in increased expression of TBX3 mRNA	20678512; 24424067; 29275510;
C006780	bisphenol A	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of TBX3 mRNA	28628672
C006780	bisphenol A	bisphenol A affects the expression of TBX3 mRNA	21786754
C006780	bisphenol A	bisphenol A results in decreased expression of TBX3 mRNA	25181051; 30816183;
C000611646	bisphenol F	bisphenol F results in increased expression of TBX3 mRNA	30951980
C018475	butyraldehyde	butyraldehyde results in increased expression of TBX3 mRNA	26079696
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of TBX3 mRNA	23397585
D002185	Cannabidiol	Cannabidiol affects the methylation of TBX3 gene	30521419
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of TBX3 mRNA	31150632
D002251	Carbon Tetrachloride	schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of TBX3 mRNA]	31150632
D002330	Carmustine	TBX3 mRNA affects the susceptibility to Carmustine	16365179
D002509	Cephaloridine	Cephaloridine results in decreased expression of TBX3 mRNA	18500788
D002922	Ciguatoxins	Ciguatoxins affects the expression of TBX3 mRNA	18353800
D002994	Clofibrate	Clofibrate results in increased expression of TBX3 mRNA	25270620
D019327	Copper Sulfate	Copper Sulfate results in decreased expression of TBX3 mRNA	19549813
D003471	Cuprizone	Cuprizone affects the expression of TBX3 mRNA	27523638
D003471	Cuprizone	Cuprizone results in decreased expression of TBX3 mRNA	26577399
C089595	cylindrospermopsin	cylindrospermopsin results in increased expression of TBX3 mRNA	24921660
C093628	cyproconazole	cyproconazole results in decreased expression of TBX3 mRNA	22045034
D000077209	Decitabine	Decitabine results in increased expression of TBX3 mRNA	16367923
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in decreased expression of TBX3 mRNA	28628672
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of TBX3 mRNA	28628672
D003907	Dexamethasone	Dexamethasone results in decreased expression of TBX3 mRNA	20032058
D003907	Dexamethasone	Testosterone inhibits the reaction [Dexamethasone results in decreased expression of TBX3 mRNA]	20032058
D004008	Diclofenac	Diclofenac results in increased expression of TBX3 mRNA	26934552
C000944	dicrotophos	dicrotophos results in increased expression of TBX3 mRNA	28302478
D004041	Dietary Fats	Dietary Fats affects the expression of TBX3 mRNA	19680557
D004041	Dietary Fats	Dietary Fats results in increased expression of TBX3 mRNA	22010203
D004041	Dietary Fats	Testosterone inhibits the reaction [Dietary Fats results in increased expression of TBX3 mRNA]	22010203
D004117	Dimethoate	Dimethoate results in increased expression of TBX3 mRNA	23397585
D004221	Disulfiram	Disulfiram results in decreased expression of TBX3 mRNA	20530235
D004237	Diuron	Diuron results in increased expression of TBX3 mRNA	21551480
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TBX3 mRNA	27188386
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in decreased expression of TBX3 protein	28548306
D004365	Drugs, Chinese Herbal	PPP2CA protein affects the reaction [Drugs, Chinese Herbal results in decreased expression of TBX3 protein]	28548306
D004726	Endosulfan	Endosulfan results in increased expression of TBX3 mRNA	29391264
C038939	enzacamene	enzacamene results in increased expression of TBX3 mRNA	23397585
C045651	epigallocatechin gallate	[potassium chromate(VI) co-treated with epigallocatechin gallate] results in increased expression of TBX3 mRNA	22079256
D004958	Estradiol	Estradiol affects the expression of TBX3 mRNA	22574217
D004958	Estradiol	[Estradiol co-treated with TGFB1 protein] results in increased expression of TBX3 mRNA	30165855
D004958	Estradiol	Estradiol results in increased expression of TBX3 mRNA	24424067
D004967	Estrogens	Estrogens affects the localization of TBX3 protein	21098263
D004967	Estrogens	Estrogens results in increased expression of TBX3 protein	21098263
D004967	Estrogens	FGF9 protein promotes the reaction [Estrogens results in increased expression of TBX3 protein]	21098263
D004967	Estrogens	PD 173074 inhibits the reaction [Estrogens results in increased expression of TBX3 protein]	21098263
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of TBX3 mRNA	17557909
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of TBX3 mRNA	23129252
D017313	Fenretinide	Fenretinide results in increased expression of TBX3 mRNA	28973697
C017690	fenvalerate	fenvalerate results in increased expression of TBX3 mRNA	23397585
D004397	Fonofos	Fonofos results in increased methylation of TBX3 promoter	22847954
C039281	furan	furan results in decreased expression of TBX3 mRNA	25539665; 27387713;
D006861	Hydrogen Peroxide	Hydrogen Peroxide affects the expression of TBX3 mRNA	20044591
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in decreased expression of TBX3 mRNA	28628672
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of TBX3 mRNA	28628672
D007480	Iopanoic Acid	Iopanoic Acid results in increased expression of TBX3 mRNA	23397585
C561695	(+)-JQ1 compound	(+)-JQ1 compound affects the expression of TBX3 mRNA	26733615
C561695	(+)-JQ1 compound	(+)-JQ1 compound promotes the reaction [Panobinostat affects the expression of TBX3 mRNA]	26733615
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in increased expression of TBX3 mRNA	27432991
C561695	(+)-JQ1 compound	Panobinostat promotes the reaction [(+)-JQ1 compound affects the expression of TBX3 mRNA]	26733615
C561695	(+)-JQ1 compound	[PD 0325901 co-treated with (+)-JQ1 compound] results in decreased expression of TBX3 mRNA	25119042
D019344	Lactic Acid	Lactic Acid results in increased expression of TBX3 mRNA	30851411
D000077339	Leflunomide	Leflunomide results in increased expression of TBX3 mRNA	28988120
D008687	Metformin	Metformin results in increased expression of TBX3 mRNA	31324951
D008694	Methamphetamine	Methamphetamine results in decreased expression of TBX3 mRNA	29802913
D008713	Methimazole	Methimazole results in increased expression of TBX3 mRNA	23397585
D008731	Methoxychlor	Methoxychlor results in increased expression of TBX3 mRNA	23397585
D008748	Methylcholanthrene	Methylcholanthrene results in increased expression of TBX3 mRNA	23397585
C004925	methylmercuric chloride	methylmercuric chloride results in decreased expression of TBX3 mRNA	28001369
C004925	methylmercuric chloride	methylmercuric chloride affects the expression of TBX3 mRNA	21613230
D008767	Methylmercury Compounds	Methylmercury Compounds results in decreased expression of TBX3 mRNA	23397585
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased expression of TBX3 mRNA	23397585
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased expression of TBX3 mRNA	21664453
C500085	muraglitazar	muraglitazar results in increased expression of TBX3 mRNA	21515302
C058815	N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide	N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide results in decreased expression of TBX3 mRNA	15255957
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in decreased expression of TBX3 mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in decreased expression of TBX3 mRNA	25554681
D009532	Nickel	Nickel results in decreased expression of TBX3 mRNA	25583101
C118580	octylmethoxycinnamate	octylmethoxycinnamate results in decreased expression of TBX3 mRNA	23397585
D000073878	Palm Oil	Palm Oil affects the expression of TBX3 mRNA	19680557
D000077767	Panobinostat	(+)-JQ1 compound promotes the reaction [Panobinostat affects the expression of TBX3 mRNA]	26733615
D000077767	Panobinostat	Panobinostat affects the expression of TBX3 mRNA	26733615
D000077767	Panobinostat	Panobinostat promotes the reaction [(+)-JQ1 compound affects the expression of TBX3 mRNA]	26733615
C016030	pantogab	pantogab results in decreased expression of TBX3 mRNA	17379144
D010278	Parathion	Parathion results in increased methylation of TBX3 promoter	22847954
C568608	PCI 5002	[PCI 5002 co-treated with Zinc] results in increased expression of TBX3 mRNA	18593933
C506614	PD 0325901	[PD 0325901 co-treated with (+)-JQ1 compound] results in decreased expression of TBX3 mRNA	25119042
C506614	PD 0325901	PD 0325901 results in decreased expression of TBX3 mRNA	25119042
C115711	PD 173074	PD 173074 inhibits the reaction [afimoxifene results in increased expression of TBX3 protein]	21098263
C115711	PD 173074	PD 173074 inhibits the reaction [Estrogens results in increased expression of TBX3 protein]	21098263
C046012	pentanal	pentanal results in increased expression of TBX3 mRNA	26079696
D010426	Pentosan Sulfuric Polyester	Pentosan Sulfuric Polyester results in decreased expression of TBX3 mRNA	28973697
D010629	Phenformin	Phenformin results in increased expression of TBX3 mRNA	31324951
D010634	Phenobarbital	NR1I3 protein affects the reaction [Phenobarbital results in increased expression of TBX3 mRNA]	19482888
D010634	Phenobarbital	Phenobarbital affects the expression of TBX3 mRNA	23091169
D010634	Phenobarbital	Phenobarbital results in decreased expression of TBX3 mRNA	19482888
D010795	Phthalic Acids	Phthalic Acids results in decreased expression of TBX3 mRNA	21061450
D010938	Plant Oils	Plant Oils results in increased expression of TBX3 mRNA	23370395
C054694	polyoxyethyleneamine	polyoxyethyleneamine results in increased expression of TBX3 mRNA	28711546
C027373	potassium chromate(VI)	[potassium chromate(VI) co-treated with epigallocatechin gallate] results in increased expression of TBX3 mRNA	22079256
C027373	potassium chromate(VI)	potassium chromate(VI) results in increased expression of TBX3 mRNA	22079256
D011285	Pregnenolone Carbonitrile	Pregnenolone Carbonitrile results in decreased expression of TBX3 mRNA	28903501
C045950	propiconazole	propiconazole results in decreased expression of TBX3 mRNA	21278054
C005556	propionaldehyde	propionaldehyde results in increased expression of TBX3 mRNA	26079696
D011441	Propylthiouracil	Propylthiouracil results in increased expression of TBX3 mRNA	23397585
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of TBX3 mRNA	24780913
C043680	ptaquiloside	ptaquiloside results in decreased expression of TBX3 mRNA	23274088
D011794	Quercetin	Quercetin results in increased expression of TBX3 mRNA	21632981
D012312	Ritodrine	Ritodrine results in decreased expression of TBX3 mRNA	23370008
D000077154	Rosiglitazone	Rosiglitazone results in increased expression of TBX3 mRNA	21515302
D012402	Rotenone	Rotenone results in increased expression of TBX3 mRNA	28374803
C015499	schizandrin B	schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of TBX3 mRNA]	31150632
D012822	Silicon Dioxide	Silicon Dioxide results in increased expression of TBX3 mRNA	25351596
D012834	Silver	Silver results in decreased expression of TBX3 mRNA	26014281
D012906	Smoke	Smoke affects the expression of TBX3 mRNA	23693141
C009277	sodium arsenate	sodium arsenate affects the methylation of TBX3 promoter	20667999
C009277	sodium arsenate	sodium arsenate results in increased expression of TBX3 mRNA	20667999; 21795629;
D018038	Sodium Selenite	Sodium Selenite results in decreased expression of TBX3 mRNA	23274088
C105686	SU 5402	SU 5402 results in decreased expression of TBX3 mRNA	15255957
D013467	Sulindac	Sulindac results in increased expression of TBX3 mRNA	11906190
D000077210	Sunitinib	Sunitinib results in increased expression of TBX3 mRNA	31533062
C013698	tallow	tallow affects the expression of TBX3 mRNA	19680557
D000077204	Temozolomide	TBX3 mRNA affects the susceptibility to Temozolomide	16365179
C012568	terbufos	terbufos results in increased methylation of TBX3 promoter	22847954
C501413	tesaglitazar	tesaglitazar results in increased expression of TBX3 mRNA	21515302
D013739	Testosterone	Testosterone inhibits the reaction [Dietary Fats results in increased expression of TBX3 mRNA]	22010203
D013739	Testosterone	Testosterone inhibits the reaction [Dexamethasone results in decreased expression of TBX3 mRNA]	20032058
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of TBX3 mRNA	22298810
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of TBX3 mRNA	16697128; 19692669; 20106945; 21632981; 21802500; 26238291;
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of TBX3 mRNA	21570461
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of TBX3 mRNA	24058054
D013893	Thiram	Thiram results in decreased expression of TBX3 mRNA	20530235
C009495	titanium dioxide	titanium dioxide results in decreased expression of TBX3 mRNA	23131501
C009495	titanium dioxide	titanium dioxide results in increased expression of TBX3 mRNA	23557971
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased expression of TBX3 mRNA	28065790
D014212	Tretinoin	Tretinoin results in decreased expression of TBX3 mRNA	20530235
D014212	Tretinoin	Tretinoin results in increased expression of TBX3 mRNA	21934132; 23724009;
D014212	Tretinoin	Tretinoin results in increased expression of TBX3 mRNA	16604517
C016805	tris(1,3-dichloro-2-propyl)phosphate	tris(1,3-dichloro-2-propyl)phosphate results in decreased expression of TBX3 mRNA	26179874
D000077288	Troglitazone	Troglitazone results in increased expression of TBX3 mRNA	17569031
D014520	Urethane	Urethane results in increased expression of TBX3 mRNA	28818685
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TBX3 mRNA	27188386
D014635	Valproic Acid	Valproic Acid results in increased expression of TBX3 mRNA	24383497; 26272509; 28001369;
D014635	Valproic Acid	Valproic Acid results in decreased expression of TBX3 mRNA	22045034
D014638	Vanadates	Vanadates results in increased expression of TBX3 mRNA	22714537
D001335	Vehicle Emissions	Vehicle Emissions results in decreased methylation of TBX3 gene	25560391
C029297	vinylidene chloride	vinylidene chloride results in decreased expression of TBX3 mRNA	26682919
D015032	Zinc	[PCI 5002 co-treated with Zinc] results in increased expression of TBX3 mRNA	18593933
D019287	Zinc Sulfate	Zinc Sulfate results in decreased expression of TBX3 mRNA	16330358

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0025	Alternative splicing
KW-0217	Developmental protein
KW-0225	Disease mutation
KW-0238	DNA-binding
KW-0539	Nucleus
KW-0597	Phosphoprotein
KW-1185	Reference proteome
KW-0678	Repressor
KW-0804	Transcription
KW-0805	Transcription regulation

Interpro

InterPro ID	InterPro Term
IPR008967	p53-like_TF_DNA-bd
IPR036960	T-box_sf
IPR022582	TBX
IPR001699	TF_T-box
IPR018186	TF_T-box_CS

PROSITE

PROSITE ID	PROSITE Term
PS01283	TBOX_1
PS01264	TBOX_2
PS50252	TBOX_3

Pfam

Pfam ID	Pfam Term
PF00907	T-box
PF12598	TBX

Gene: TBX3

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction