CleftGeneDB-Search

Gene: TULP3

Basic information

Tag	Content
Uniprot ID	O75386; B3KNB7; B7Z6A2; D3DUQ4; F8WBZ9; Q8N5B0;
Entrez ID	7289
Genbank protein ID	BAH13188.1; EAW88878.1; EAW88876.1; AAH32587.1; BAG51279.1; AAC95431.1; EAW88877.1;
Genbank nucleotide ID	NM_003324.4; NM_001160408.1;
Ensembl protein ID	ENSP00000380321; ENSP00000410051; ENSP00000444110;
Ensembl nucleotide ID	ENSG00000078246
Gene name	Tubby-related protein 3
Gene symbol	TULP3
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Negative regulator of the Shh signaling transduction pathway: recruited to primary cilia via association with the IFT complex A (IFT-A) and is required for recruitment of G protein-coupled receptor GPR161 to cilia, a promoter of PKA-dependent basal repression machinery in Shh signaling. Binds to phosphorylated inositide (phosphoinositide) lipids. Both IFT-A- and phosphoinositide-binding properties are required to regulate ciliary G protein-coupled receptor trafficking. Not involved in ciliogenesis. During adipogenesis, regulates ciliary trafficking of FFAR4 in preadipocytes.
Sequence	MEASRCRLSP SGDSVFHEEM MKMRQAKLDY QRLLLEKRQR KKRLEPFMVQ PNPEARLRRA 60 KPRASDEQTP LVNCHTPHSN VILHGIDGPA AVLKPDEVHA PSVSSSVVEE DAENTVDTAS 120 KPGLQERLQK HDISESVNFD EETDGISQSA CLERPNSASS QNSTDTGTSG SATAAQPADN 180 LLGDIDDLED FVYSPAPQGV TVRCRIIRDK RGMDRGLFPT YYMYLEKEEN QKIFLLAARK 240 RKKSKTANYL ISIDPVDLSR EGESYVGKLR SNLMGTKFTV YDRGICPMKG RGLVGAAHTR 300 QELAAISYET NVLGFKGPRK MSVIIPGMTL NHKQIPYQPQ NNHDSLLSRW QNRTMENLVE 360 LHNKAPVWNS DTQSYVLNFR GRVTQASVKN FQIVHKNDPD YIVMQFGRVA DDVFTLDYNY 420 PLCAVQAFGI GLSSFDSKLA CE 442

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	TULP3		F1N7S0		Bos taurus	Prediction	More>>
1:1 ortholog	TULP3	611832	F1PNR7		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	TULP3	102170303	A0A452G8R3		Capra hircus	Prediction	More>>
1:1 ortholog	TULP3	7289	O75386		Homo sapiens	Prediction	More>>
1:1 ortholog	Tulp3	22158	O88413	CPO	Mus musculus	Publication	More>>
1:1 ortholog	TULP3		H2R7L6		Pan troglodytes	Prediction	More>>
1:1 ortholog		100511196	A0A480JWW4		Sus scrofa	Prediction	More>>
1:1 ortholog	TULP3	100341264	G1SUQ3		Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Tulp3		F1M656		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs755991024	p.Glu2Ala	missense variant	-	NC_000012.12:g.2890952A>C	ExAC,TOPMed,gnomAD
rs777546129	p.Ser4Leu	missense variant	-	NC_000012.12:g.2890958C>T	ExAC,gnomAD
rs749267317	p.Arg5His	missense variant	-	NC_000012.12:g.2890961G>A	ExAC,gnomAD
rs1479491653	p.Arg7Pro	missense variant	-	NC_000012.12:g.2890967G>C	TOPMed
rs772084901	p.Arg7Gly	missense variant	-	NC_000012.12:g.2890966C>G	TOPMed
rs772084901	p.Arg7Trp	missense variant	-	NC_000012.12:g.2890966C>T	TOPMed
rs770889122	p.Leu8Val	missense variant	-	NC_000012.12:g.2890969C>G	ExAC,gnomAD
rs770889122	p.Leu8Phe	missense variant	-	NC_000012.12:g.2890969C>T	ExAC,gnomAD
rs1285748443	p.Leu8Pro	missense variant	-	NC_000012.12:g.2890970T>C	gnomAD
NCI-TCGA novel	p.Ser9Arg	missense variant	-	NC_000012.12:g.2890974T>G	NCI-TCGA
rs1260709383	p.Ser9Ile	missense variant	-	NC_000012.12:g.2890973G>T	gnomAD
rs1012583057	p.Pro10Ser	missense variant	-	NC_000012.12:g.2890975C>T	gnomAD
NCI-TCGA novel	p.Ser11Asn	missense variant	-	NC_000012.12:g.2890979G>A	NCI-TCGA
rs528212334	p.Gly12Ser	missense variant	-	NC_000012.12:g.2890981G>A	1000Genomes,ExAC,gnomAD
rs771559772	p.Gly12Asp	missense variant	-	NC_000012.12:g.2890982G>A	ExAC,gnomAD
COSM3792512	p.Asp13His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2890984G>C	NCI-TCGA Cosmic
rs1164359285	p.Asp13Tyr	missense variant	-	NC_000012.12:g.2890984G>T	gnomAD
rs1160808693	p.Phe16Leu	missense variant	-	NC_000012.12:g.2909535C>G	gnomAD
COSM3460061	p.His17Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2909536C>T	NCI-TCGA Cosmic
rs1373964188	p.His17Asn	missense variant	-	NC_000012.12:g.2909536C>A	gnomAD
rs773058868	p.Glu18Gln	missense variant	-	NC_000012.12:g.2909539G>C	TOPMed,gnomAD
rs138991083	p.Glu19Lys	missense variant	-	NC_000012.12:g.2909542G>A	ESP,ExAC,TOPMed,gnomAD
rs757112195	p.Met21Leu	missense variant	-	NC_000012.12:g.2909548A>T	ExAC,gnomAD
COSM3739597	p.Met23Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2909555T>C	NCI-TCGA Cosmic
rs1242162221	p.Arg24Gln	missense variant	-	NC_000012.12:g.2909558G>A	gnomAD
rs201665307	p.Arg24Ter	stop gained	-	NC_000012.12:g.2909557C>T	NCI-TCGA,NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg24Leu	missense variant	-	NC_000012.12:g.2909558G>T	NCI-TCGA
rs201665307	p.Arg24Ter	stop gained	-	NC_000012.12:g.2909557C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln25Ter	stop gained	-	NC_000012.12:g.2909560C>T	NCI-TCGA
COSM3871462	p.Gln31Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.2909578C>T	NCI-TCGA Cosmic
rs769598549	p.Arg32Lys	missense variant	-	NC_000012.12:g.2920764G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg32Met	missense variant	-	NC_000012.12:g.2920764G>T	NCI-TCGA
rs992579948	p.Arg32Trp	missense variant	-	NC_000012.12:g.2920763A>T	TOPMed
rs779375609	p.Leu34Val	missense variant	-	NC_000012.12:g.2920769C>G	ExAC,TOPMed,gnomAD
rs779375609	p.Leu34Ile	missense variant	-	NC_000012.12:g.2920769C>A	ExAC,TOPMed,gnomAD
rs746235539	p.Glu36Gln	missense variant	-	NC_000012.12:g.2920775G>C	ExAC,gnomAD
rs775930305	p.Arg38Lys	missense variant	-	NC_000012.12:g.2920782G>A	ExAC,gnomAD
COSM3460062	p.Arg40Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2920788G>T	NCI-TCGA Cosmic
rs1399073180	p.Lys41Arg	missense variant	-	NC_000012.12:g.2920791A>G	TOPMed
COSM5224652	p.Lys42SerPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.2920790A>-	NCI-TCGA Cosmic
rs529548720	p.Arg43His	missense variant	-	NC_000012.12:g.2920797G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs529548720	p.Arg43Leu	missense variant	-	NC_000012.12:g.2920797G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1185410476	p.Arg43Cys	missense variant	-	NC_000012.12:g.2920796C>T	TOPMed
NCI-TCGA novel	p.Leu44Arg	missense variant	-	NC_000012.12:g.2920800T>G	NCI-TCGA
rs776803884	p.Leu44Ile	missense variant	-	NC_000012.12:g.2920799C>A	ExAC,gnomAD
rs761973948	p.Glu45Asp	missense variant	-	NC_000012.12:g.2920804G>T	ExAC,TOPMed,gnomAD
rs1242241953	p.Glu45Lys	missense variant	-	NC_000012.12:g.2920802G>A	TOPMed
COSM2205015	p.Phe47Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2920809T>G	NCI-TCGA Cosmic
rs1269807743	p.Val49Ala	missense variant	-	NC_000012.12:g.2920815T>C	gnomAD
rs765458545	p.Gln50His	missense variant	-	NC_000012.12:g.2920819G>T	ExAC,gnomAD
rs1220540022	p.Pro51Ala	missense variant	-	NC_000012.12:g.2920820C>G	gnomAD
rs146376218	p.Asn52Tyr	missense variant	-	NC_000012.12:g.2920823A>T	1000Genomes,ESP,ExAC,gnomAD
rs762722512	p.Glu54Ala	missense variant	-	NC_000012.12:g.2920830A>C	ExAC,TOPMed,gnomAD
rs369808122	p.Arg56Ser	missense variant	-	NC_000012.12:g.2920837G>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg56Met	missense variant	-	NC_000012.12:g.2920836G>T	NCI-TCGA
rs550241450	p.Arg58His	missense variant	-	NC_000012.12:g.2920842G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs200463632	p.Arg58Cys	missense variant	-	NC_000012.12:g.2920841C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs373458913	p.Arg59Trp	missense variant	-	NC_000012.12:g.2920844C>T	ESP,ExAC,TOPMed,gnomAD
rs139350068	p.Arg59Gln	missense variant	-	NC_000012.12:g.2920845G>A	ESP,ExAC,TOPMed,gnomAD
rs373458913	p.Arg59Gly	missense variant	-	NC_000012.12:g.2920844C>G	ESP,ExAC,TOPMed,gnomAD
rs777297562	p.Pro62Ser	missense variant	-	NC_000012.12:g.2920853C>T	ExAC,gnomAD
rs746242429	p.Arg63Gly	missense variant	-	NC_000012.12:g.2920856A>G	ExAC,TOPMed,gnomAD
rs1313326449	p.Ser65Gly	missense variant	-	NC_000012.12:g.2920862A>G	TOPMed
rs1457972410	p.Asp66His	missense variant	-	NC_000012.12:g.2920865G>C	gnomAD
rs747555221	p.Pro70Ala	missense variant	-	NC_000012.12:g.2920877C>G	ExAC,gnomAD
COSM3460064	p.Pro70Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2920878C>T	NCI-TCGA Cosmic
rs376106577	p.Val72Met	missense variant	-	NC_000012.12:g.2920883G>A	ESP,ExAC,TOPMed,gnomAD
rs1341349792	p.Asn73Ser	missense variant	-	NC_000012.12:g.2920887A>G	gnomAD
rs1291676947	p.Pro77Leu	missense variant	-	NC_000012.12:g.2920899C>T	gnomAD
rs202025723	p.Asn80Ser	missense variant	-	NC_000012.12:g.2920908A>G	ExAC,gnomAD
rs773363701	p.His84Asp	missense variant	-	NC_000012.12:g.2920919C>G	ExAC,gnomAD
rs570541745	p.His84Arg	missense variant	-	NC_000012.12:g.2920920A>G	1000Genomes,ExAC,gnomAD
rs773363701	p.His84Tyr	missense variant	-	NC_000012.12:g.2920919C>T	ExAC,gnomAD
rs149595629	p.Gly85Asp	missense variant	-	NC_000012.12:g.2922262G>A	ESP,ExAC,TOPMed,gnomAD
rs149595629	p.Gly85Val	missense variant	-	NC_000012.12:g.2922262G>T	ESP,ExAC,TOPMed,gnomAD
rs908922013	p.Ile86Val	missense variant	-	NC_000012.12:g.2922264A>G	TOPMed,gnomAD
rs753421907	p.Asp87Gly	missense variant	-	NC_000012.12:g.2922268A>G	ExAC,gnomAD
NCI-TCGA novel	p.Gly88Cys	missense variant	-	NC_000012.12:g.2922270G>T	NCI-TCGA
rs1379816918	p.Gly88Val	missense variant	-	NC_000012.12:g.2922271G>T	TOPMed,gnomAD
rs1256023837	p.Pro89Ser	missense variant	-	NC_000012.12:g.2922273C>T	gnomAD
rs1439155274	p.Ala90Pro	missense variant	-	NC_000012.12:g.2922276G>C	gnomAD
rs761325000	p.Ala90Asp	missense variant	-	NC_000012.12:g.2922277C>A	ExAC,gnomAD
rs367724509	p.Val92Ile	missense variant	-	NC_000012.12:g.2922282G>A	ESP,ExAC,TOPMed,gnomAD
rs148720872	p.Asp96His	missense variant	-	NC_000012.12:g.2922294G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs567441567	p.Glu97Lys	missense variant	-	NC_000012.12:g.2922297G>A	1000Genomes,ExAC,gnomAD
rs1239898516	p.Glu97Gly	missense variant	-	NC_000012.12:g.2922298A>G	TOPMed,gnomAD
rs756670655	p.Val98Asp	missense variant	-	NC_000012.12:g.2922301T>A	ExAC,gnomAD
rs1482160114	p.His99Asp	missense variant	-	NC_000012.12:g.2922303C>G	gnomAD
rs1338370409	p.His99Arg	missense variant	-	NC_000012.12:g.2922304A>G	TOPMed
rs777662918	p.Ala100Thr	missense variant	-	NC_000012.12:g.2922306G>A	ExAC,TOPMed,gnomAD
rs777662918	p.Ala100Pro	missense variant	-	NC_000012.12:g.2922306G>C	ExAC,TOPMed,gnomAD
rs371125928	p.Ser102Ter	stop gained	-	NC_000012.12:g.2922313C>G	ESP,TOPMed
rs1360443877	p.Val103Leu	missense variant	-	NC_000012.12:g.2922315G>C	TOPMed
NCI-TCGA novel	p.Ser105Phe	missense variant	-	NC_000012.12:g.2922322C>T	NCI-TCGA
rs770995642	p.Ser106Ala	missense variant	-	NC_000012.12:g.2922324T>G	ExAC,gnomAD
rs142250486	p.Val107Ile	missense variant	-	NC_000012.12:g.2922327G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs376218431	p.Val108Leu	missense variant	-	NC_000012.12:g.2922330G>T	ESP,ExAC,TOPMed,gnomAD
rs376218431	p.Val108Met	missense variant	-	NC_000012.12:g.2922330G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp111His	missense variant	-	NC_000012.12:g.2922339G>C	NCI-TCGA
rs1456534504	p.Asp111Gly	missense variant	-	NC_000012.12:g.2922340A>G	TOPMed
rs1375047324	p.Ala112Thr	missense variant	-	NC_000012.12:g.2922342G>A	TOPMed
rs1193959506	p.Ala112Gly	missense variant	-	NC_000012.12:g.2922343C>G	TOPMed
rs772045352	p.Glu113Gln	missense variant	-	NC_000012.12:g.2922345G>C	ExAC,gnomAD
rs1171560504	p.Asn114Thr	missense variant	-	NC_000012.12:g.2922349A>C	gnomAD
rs1403068475	p.Asn114Lys	missense variant	-	NC_000012.12:g.2922350C>G	gnomAD
rs1460286243	p.Thr115Pro	missense variant	-	NC_000012.12:g.2922351A>C	gnomAD
rs768663010	p.Val116Leu	missense variant	-	NC_000012.12:g.2922354G>T	ExAC,gnomAD
rs768663010	p.Val116Met	missense variant	-	NC_000012.12:g.2922354G>A	ExAC,gnomAD
rs1292976314	p.Asp117Val	missense variant	-	NC_000012.12:g.2922358A>T	gnomAD
rs775936484	p.Asp117Asn	missense variant	-	NC_000012.12:g.2922357G>A	ExAC,gnomAD
rs1325526741	p.Thr118Ala	missense variant	-	NC_000012.12:g.2922360A>G	gnomAD
NCI-TCGA novel	p.Ala119LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.2922362T>-	NCI-TCGA
COSM938618	p.Ser120Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2922366T>A	NCI-TCGA Cosmic
rs1191347843	p.Pro122Ala	missense variant	-	NC_000012.12:g.2922372C>G	TOPMed
rs761451396	p.Pro122Arg	missense variant	-	NC_000012.12:g.2922373C>G	ExAC,gnomAD
rs1259493178	p.Leu124Pro	missense variant	-	NC_000012.12:g.2922379T>C	gnomAD
rs764784084	p.Glu126Lys	missense variant	-	NC_000012.12:g.2922384G>A	ExAC,TOPMed
NCI-TCGA novel	p.Arg127Ser	missense variant	-	NC_000012.12:g.2922387C>A	NCI-TCGA
NCI-TCGA novel	p.Arg127Cys	missense variant	-	NC_000012.12:g.2922387C>T	NCI-TCGA
rs368203383	p.Arg127His	missense variant	-	NC_000012.12:g.2922388G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln129Leu	missense variant	-	NC_000012.12:g.2922394A>T	NCI-TCGA
rs767825622	p.Gln129Pro	missense variant	-	NC_000012.12:g.2922394A>C	ExAC,gnomAD
rs753081065	p.Lys130Asn	missense variant	-	NC_000012.12:g.2922398G>T	ExAC,TOPMed
rs200658695	p.His131Arg	missense variant	-	NC_000012.12:g.2922400A>G	1000Genomes,ExAC,gnomAD
rs556148165	p.His131Tyr	missense variant	-	NC_000012.12:g.2922399C>T	1000Genomes,gnomAD
rs1302981132	p.Asp132Gly	missense variant	-	NC_000012.12:g.2930248A>G	TOPMed,gnomAD
rs1380728122	p.Ile133Thr	missense variant	-	NC_000012.12:g.2930251T>C	gnomAD
rs750552969	p.Ser136Asn	missense variant	-	NC_000012.12:g.2930260G>A	ExAC,TOPMed,gnomAD
rs750552969	p.Ser136Thr	missense variant	-	NC_000012.12:g.2930260G>C	ExAC,TOPMed,gnomAD
rs1246604206	p.Asn138Ser	missense variant	-	NC_000012.12:g.2930266A>G	TOPMed
rs192385949	p.Asp140Asn	missense variant	-	NC_000012.12:g.2930271G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1446291865	p.Asp140Gly	missense variant	-	NC_000012.12:g.2930272A>G	TOPMed,gnomAD
rs192385949	p.Asp140His	missense variant	-	NC_000012.12:g.2930271G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1281026489	p.Glu142Lys	missense variant	-	NC_000012.12:g.2930277G>A	TOPMed
rs780960168	p.Glu142Ala	missense variant	-	NC_000012.12:g.2930278A>C	ExAC,gnomAD
rs748075740	p.Thr143Asn	missense variant	-	NC_000012.12:g.2930281C>A	ExAC,TOPMed,gnomAD
rs994581521	p.Asp144Glu	missense variant	-	NC_000012.12:g.2930285T>G	TOPMed
rs772648143	p.Gly145Arg	missense variant	-	NC_000012.12:g.2930286G>A	ExAC,TOPMed,gnomAD
rs748798022	p.Ile146Leu	missense variant	-	NC_000012.12:g.2930289A>T	ExAC,gnomAD
rs770568354	p.Ile146Met	missense variant	-	NC_000012.12:g.2930291A>G	ExAC,TOPMed,gnomAD
rs774113409	p.Gln148Arg	missense variant	-	NC_000012.12:g.2930296A>G	ExAC,gnomAD
rs1445802514	p.Ser149Leu	missense variant	-	NC_000012.12:g.2930299C>T	TOPMed
rs764563348	p.Cys151Arg	missense variant	-	NC_000012.12:g.2930304T>C	ExAC,TOPMed,gnomAD
rs1423921730	p.Arg154Gly	missense variant	-	NC_000012.12:g.2930313A>G	TOPMed
rs1439423521	p.Pro155Leu	missense variant	-	NC_000012.12:g.2930317C>T	gnomAD
rs776892524	p.Pro155Ser	missense variant	-	NC_000012.12:g.2930316C>T	ExAC,gnomAD
rs1442011229	p.Asn156His	missense variant	-	NC_000012.12:g.2930319A>C	TOPMed
rs765854333	p.Ala158Val	missense variant	-	NC_000012.12:g.2930326C>T	ExAC,gnomAD
NCI-TCGA novel	p.Ser159Ter	stop gained	-	NC_000012.12:g.2930329C>G	NCI-TCGA
rs1448716909	p.Gln161Glu	missense variant	-	NC_000012.12:g.2930334C>G	gnomAD
rs139812745	p.Ser163Ter	stop gained	-	NC_000012.12:g.2930341C>G	ESP,TOPMed
rs1008339211	p.Thr164Ser	missense variant	-	NC_000012.12:g.2930343A>T	TOPMed
rs1459276941	p.Asp165Tyr	missense variant	-	NC_000012.12:g.2931037G>T	TOPMed
rs1225428222	p.Gly167Asp	missense variant	-	NC_000012.12:g.2931044G>A	TOPMed,gnomAD
rs200507827	p.Ser169Cys	missense variant	-	NC_000012.12:g.2931050C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs200507827	p.Ser169Tyr	missense variant	-	NC_000012.12:g.2931050C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1284685964	p.Gly170Ala	missense variant	-	NC_000012.12:g.2931053G>C	gnomAD
rs774419359	p.Gly170Ser	missense variant	-	NC_000012.12:g.2931052G>A	ExAC,TOPMed,gnomAD
rs759598411	p.Thr173Ile	missense variant	-	NC_000012.12:g.2931062C>T	ExAC,gnomAD
rs201040349	p.Ala175Thr	missense variant	-	NC_000012.12:g.2931067G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs760434859	p.Ala175Gly	missense variant	-	NC_000012.12:g.2931068C>G	ExAC,gnomAD
rs1351898877	p.Gln176Pro	missense variant	-	NC_000012.12:g.2931071A>C	gnomAD
COSM4041345	p.Gln176His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2931072A>T	NCI-TCGA Cosmic
rs763840266	p.Gln176Ter	stop gained	-	NC_000012.12:g.2931070C>T	ExAC,TOPMed,gnomAD
rs757160211	p.Pro177Leu	missense variant	-	NC_000012.12:g.2931074C>T	ExAC,gnomAD
rs753659657	p.Pro177Ser	missense variant	-	NC_000012.12:g.2931073C>T	ExAC,gnomAD
COSM3792513	p.Asp179His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2931079G>C	NCI-TCGA Cosmic
COSM431004	p.Asn180Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2931083A>G	NCI-TCGA Cosmic
rs372237123	p.Asn180Asp	missense variant	-	NC_000012.12:g.2931082A>G	ESP,ExAC,TOPMed,gnomAD
rs200191197	p.Leu181Phe	missense variant	-	NC_000012.12:g.2931085C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs200191197	p.Leu181Val	missense variant	-	NC_000012.12:g.2931085C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs757906008	p.Gly183Arg	missense variant	-	NC_000012.12:g.2931091G>A	ExAC,gnomAD
rs779725068	p.Asp184Val	missense variant	-	NC_000012.12:g.2931095A>T	ExAC,gnomAD
rs1320272012	p.Ile185Thr	missense variant	-	NC_000012.12:g.2931098T>C	TOPMed
rs768445744	p.Ile185Val	missense variant	-	NC_000012.12:g.2931097A>G	ExAC,TOPMed,gnomAD
rs1455491662	p.Asp186Glu	missense variant	-	NC_000012.12:g.2931102C>G	TOPMed,gnomAD
rs17853063	p.Asp187Asn	missense variant	-	NC_000012.12:g.2931103G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs17853063	p.Asp187Tyr	missense variant	-	NC_000012.12:g.2931103G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1316181056	p.Asp190Asn	missense variant	-	NC_000012.12:g.2931112G>A	TOPMed
rs1057360909	p.Asp190Glu	missense variant	-	NC_000012.12:g.2931114C>A	TOPMed
rs1401530750	p.Phe191Tyr	missense variant	-	NC_000012.12:g.2931116T>A	gnomAD
rs772236632	p.Val192Leu	missense variant	-	NC_000012.12:g.2931118G>C	ExAC,TOPMed,gnomAD
rs745941807	p.Ser194Arg	missense variant	-	NC_000012.12:g.2931126T>A	ExAC,TOPMed,gnomAD
rs372314358	p.Ser194Cys	missense variant	-	NC_000012.12:g.2931124A>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln198Glu	missense variant	-	NC_000012.12:g.2931136C>G	NCI-TCGA
rs772087384	p.Gln198His	missense variant	-	NC_000012.12:g.2931138A>C	ExAC,gnomAD
rs775582102	p.Gly199Val	missense variant	-	NC_000012.12:g.2931140G>T	ExAC,TOPMed,gnomAD
rs775582102	p.Gly199Asp	missense variant	-	NC_000012.12:g.2931140G>A	ExAC,TOPMed,gnomAD
rs764314917	p.Val202Gly	missense variant	-	NC_000012.12:g.2931149T>G	ExAC,gnomAD
rs776341624	p.Arg203Thr	missense variant	-	NC_000012.12:g.2931152G>C	ExAC,gnomAD
NCI-TCGA novel	p.Arg203Ser	missense variant	-	NC_000012.12:g.2931153A>C	NCI-TCGA
rs547315819	p.Cys204Trp	missense variant	-	NC_000012.12:g.2931156T>G	ExAC,TOPMed,gnomAD
rs1256076642	p.Cys204Phe	missense variant	-	NC_000012.12:g.2931155G>T	gnomAD
rs142402471	p.Arg205Trp	missense variant	-	NC_000012.12:g.2931157C>T	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg205Leu	missense variant	-	NC_000012.12:g.2931158G>T	NCI-TCGA
rs750365836	p.Arg205Gln	missense variant	-	NC_000012.12:g.2931158G>A	ExAC,TOPMed,gnomAD
rs1431264214	p.Ile206Met	missense variant	-	NC_000012.12:g.2931162A>G	gnomAD
rs770945850	p.Arg208Gln	missense variant	-	NC_000012.12:g.2931167G>A	TOPMed,gnomAD
rs377154908	p.Arg208Trp	missense variant	-	NC_000012.12:g.2931166C>T	ESP,ExAC,gnomAD
rs140815564	p.Arg211Gly	missense variant	-	NC_000012.12:g.2931175A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM6072000	p.Arg211Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2931177G>T	NCI-TCGA Cosmic
rs754606546	p.Met213Arg	missense variant	-	NC_000012.12:g.2931182T>G	ExAC,gnomAD
rs751127621	p.Met213Val	missense variant	-	NC_000012.12:g.2931181A>G	ExAC,TOPMed,gnomAD
rs376478642	p.Asp214His	missense variant	-	NC_000012.12:g.2931184G>C	ESP,ExAC,TOPMed,gnomAD
rs376478642	p.Asp214Tyr	missense variant	-	NC_000012.12:g.2931184G>T	ESP,ExAC,TOPMed,gnomAD
rs376478642	p.Asp214Asn	missense variant	-	NC_000012.12:g.2931184G>A	ESP,ExAC,TOPMed,gnomAD
rs150118931	p.Arg215Trp	missense variant	-	NC_000012.12:g.2931187C>T	ESP,ExAC,TOPMed,gnomAD
rs150118931	p.Arg215Gly	missense variant	-	NC_000012.12:g.2931187C>G	ESP,ExAC,TOPMed,gnomAD
rs151311529	p.Arg215Gln	missense variant	-	NC_000012.12:g.2931188G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1268330772	p.Gly216Arg	missense variant	-	NC_000012.12:g.2931190G>C	TOPMed
rs746323357	p.Gly216Val	missense variant	-	NC_000012.12:g.2931191G>T	ExAC,TOPMed,gnomAD
rs746323357	p.Gly216Asp	missense variant	-	NC_000012.12:g.2931191G>A	ExAC,TOPMed,gnomAD
rs772659716	p.Leu217Val	missense variant	-	NC_000012.12:g.2931193C>G	ExAC,TOPMed,gnomAD
rs775494294	p.Phe218Leu	missense variant	-	NC_000012.12:g.2931196T>C	ExAC,gnomAD
rs768862836	p.Pro219Ser	missense variant	-	NC_000012.12:g.2931199C>T	ExAC,gnomAD
rs1259937009	p.Thr220Ile	missense variant	-	NC_000012.12:g.2931203C>T	gnomAD
NCI-TCGA novel	p.Thr220HisPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.2931197_2931198insC	NCI-TCGA
rs1209060945	p.Tyr222Ter	stop gained	-	NC_000012.12:g.2931210T>G	gnomAD
rs369164770	p.Tyr222Cys	missense variant	-	NC_000012.12:g.2931209A>G	ESP,ExAC,gnomAD
rs1266933486	p.Tyr224Cys	missense variant	-	NC_000012.12:g.2931215A>G	TOPMed,gnomAD
rs1421490663	p.Glu228Val	missense variant	-	NC_000012.12:g.2931227A>T	TOPMed,gnomAD
NCI-TCGA novel	p.Glu229Ter	stop gained	-	NC_000012.12:g.2931229G>T	NCI-TCGA
rs1173822375	p.Asn230Lys	missense variant	-	NC_000012.12:g.2931234T>A	TOPMed
NCI-TCGA novel	p.Asn230Ile	missense variant	-	NC_000012.12:g.2931233A>T	NCI-TCGA
rs761649417	p.Asn230Asp	missense variant	-	NC_000012.12:g.2931232A>G	ExAC,TOPMed,gnomAD
COSM3460066	p.Gln231Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.2931235C>T	NCI-TCGA Cosmic
rs921240025	p.Gln231Glu	missense variant	-	NC_000012.12:g.2931235C>G	TOPMed,gnomAD
rs764898707	p.Lys232Glu	missense variant	-	NC_000012.12:g.2931238A>G	ExAC,TOPMed,gnomAD
rs1164693731	p.Ile233Val	missense variant	-	NC_000012.12:g.2933418A>G	gnomAD
COSM1361143	p.Leu235Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2933424C>A	NCI-TCGA Cosmic
rs200808802	p.Leu235Phe	missense variant	-	NC_000012.12:g.2933424C>T	ESP,ExAC,TOPMed,gnomAD
rs1320069996	p.Leu236Val	missense variant	-	NC_000012.12:g.2933427C>G	TOPMed
rs762869650	p.Ala237Ser	missense variant	-	NC_000012.12:g.2933430G>T	ExAC,gnomAD
rs1455714011	p.Ala237Val	missense variant	-	NC_000012.12:g.2933431C>T	TOPMed
NCI-TCGA novel	p.Arg239Ile	missense variant	-	NC_000012.12:g.2933437G>T	NCI-TCGA
rs61760187	p.Arg241Trp	missense variant	-	NC_000012.12:g.2933442C>T	gnomAD
rs770976166	p.Arg241Gln	missense variant	-	NC_000012.12:g.2933443G>A	ExAC,TOPMed,gnomAD
rs770976166	p.Arg241Leu	missense variant	-	NC_000012.12:g.2933443G>T	ExAC,TOPMed,gnomAD
rs1239349750	p.Lys242Arg	missense variant	-	NC_000012.12:g.2933446A>G	gnomAD
NCI-TCGA novel	p.Lys243Asn	missense variant	-	NC_000012.12:g.2933450G>T	NCI-TCGA
rs1395318633	p.Ser244Thr	missense variant	-	NC_000012.12:g.2933452G>C	gnomAD
rs1361272763	p.Thr246Ile	missense variant	-	NC_000012.12:g.2933458C>T	gnomAD
rs759083451	p.Ala247Val	missense variant	-	NC_000012.12:g.2933461C>T	ExAC,gnomAD
rs1412934880	p.Tyr249Cys	missense variant	-	NC_000012.12:g.2933467A>G	TOPMed
rs1217637202	p.Asp254Asn	missense variant	-	NC_000012.12:g.2933481G>A	TOPMed,gnomAD
rs1217637202	p.Asp254His	missense variant	-	NC_000012.12:g.2933481G>C	TOPMed,gnomAD
rs1482333928	p.Asp257Asn	missense variant	-	NC_000012.12:g.2933490G>A	gnomAD
rs193281338	p.Arg260His	missense variant	-	NC_000012.12:g.2933500G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs193281338	p.Arg260Pro	missense variant	-	NC_000012.12:g.2933500G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs532633521	p.Arg260Cys	missense variant	-	NC_000012.12:g.2933499C>T	ExAC,TOPMed,gnomAD
rs532633521	p.Arg260Gly	missense variant	-	NC_000012.12:g.2933499C>G	ExAC,TOPMed,gnomAD
rs376020604	p.Glu261Lys	missense variant	-	NC_000012.12:g.2933502G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu263Lys	missense variant	-	NC_000012.12:g.2933508G>A	NCI-TCGA
rs1419870676	p.Ser264Arg	missense variant	-	NC_000012.12:g.2933513T>A	gnomAD
rs369214279	p.Tyr265Ter	stop gained	-	NC_000012.12:g.2933516T>G	ESP,ExAC,TOPMed,gnomAD
rs769899222	p.Val266Asp	missense variant	-	NC_000012.12:g.2933518T>A	ExAC,TOPMed,gnomAD
rs774321767	p.Gly267Ala	missense variant	-	NC_000012.12:g.2933521G>C	ExAC,gnomAD
rs137879043	p.Gly267Ser	missense variant	-	NC_000012.12:g.2933520G>A	ESP,ExAC,TOPMed,gnomAD
rs137879043	p.Gly267Cys	missense variant	-	NC_000012.12:g.2933520G>T	ESP,ExAC,TOPMed,gnomAD
rs1308182743	p.Lys268Arg	missense variant	-	NC_000012.12:g.2933524A>G	gnomAD
rs1010511428	p.Leu269Phe	missense variant	-	NC_000012.12:g.2933526C>T	TOPMed
rs746482584	p.Asn272Ser	missense variant	-	NC_000012.12:g.2934452A>G	ExAC,TOPMed,gnomAD
rs746482584	p.Asn272Ile	missense variant	-	NC_000012.12:g.2934452A>T	ExAC,TOPMed,gnomAD
rs768256239	p.Lys277Asn	missense variant	-	NC_000012.12:g.2934468G>C	ExAC,TOPMed,gnomAD
rs1191415245	p.Thr279Ala	missense variant	-	NC_000012.12:g.2934472A>G	gnomAD
rs761395470	p.Thr279Ile	missense variant	-	NC_000012.12:g.2934473C>T	ExAC,gnomAD
rs764871037	p.Tyr281Asp	missense variant	-	NC_000012.12:g.2934478T>G	ExAC,gnomAD
rs753286936	p.Arg283His	missense variant	-	NC_000012.12:g.2934485G>A	ExAC,gnomAD
rs767887151	p.Arg283Cys	missense variant	-	NC_000012.12:g.2934484C>T	ExAC,TOPMed,gnomAD
rs764187183	p.Ile285Met	missense variant	-	NC_000012.12:g.2934492C>G	ExAC,TOPMed,gnomAD
rs756609003	p.Ile285Val	missense variant	-	NC_000012.12:g.2934490A>G	ExAC,gnomAD
rs1347420524	p.Pro287Ala	missense variant	-	NC_000012.12:g.2934496C>G	gnomAD
rs1465964800	p.Met288Thr	missense variant	-	NC_000012.12:g.2934500T>C	TOPMed
rs753982357	p.Met288Val	missense variant	-	NC_000012.12:g.2934499A>G	ExAC,gnomAD
rs757488213	p.Arg291Trp	missense variant	-	NC_000012.12:g.2934508C>T	ExAC,TOPMed,gnomAD
rs536446600	p.Arg291Gln	missense variant	-	NC_000012.12:g.2934509G>A	ExAC,TOPMed,gnomAD
rs546880875	p.Gly292Val	missense variant	-	NC_000012.12:g.2934512G>T	1000Genomes,ExAC,gnomAD
rs746927336	p.Leu293Trp	missense variant	-	NC_000012.12:g.2934515T>G	ExAC,TOPMed,gnomAD
rs1222704398	p.Val294Ile	missense variant	-	NC_000012.12:g.2934517G>A	gnomAD
rs768489704	p.Val294Ala	missense variant	-	NC_000012.12:g.2934518T>C	ExAC,gnomAD
rs145878391	p.Gly295Arg	missense variant	-	NC_000012.12:g.2934520G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs116014892	p.Ala296Val	missense variant	-	NC_000012.12:g.2934524C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs116014892	p.Ala296Glu	missense variant	-	NC_000012.12:g.2934524C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1476320811	p.Ala297Val	missense variant	-	NC_000012.12:g.2934527C>T	gnomAD
COSM693403	p.Ala297Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2934526G>A	NCI-TCGA Cosmic
rs761187853	p.Arg300Gln	missense variant	-	NC_000012.12:g.2934536G>A	ExAC,TOPMed,gnomAD
rs763523593	p.Arg300Trp	missense variant	-	NC_000012.12:g.2934535C>T	ExAC,TOPMed,gnomAD
rs764514802	p.Gln301Leu	missense variant	-	NC_000012.12:g.2934539A>T	ExAC,TOPMed,gnomAD
rs991493166	p.Gln301His	missense variant	-	NC_000012.12:g.2934540G>C	TOPMed
rs1398214362	p.Glu302Asp	missense variant	-	NC_000012.12:g.2934543G>C	gnomAD
rs1405876245	p.Ala305Val	missense variant	-	NC_000012.12:g.2934551C>T	TOPMed
rs762042997	p.Ile306Val	missense variant	-	NC_000012.12:g.2934553A>G	ExAC,TOPMed,gnomAD
rs1282963770	p.Ser307Pro	missense variant	-	NC_000012.12:g.2934556T>C	gnomAD
rs150642906	p.Glu309Lys	missense variant	-	NC_000012.12:g.2937631G>A	ESP,ExAC,TOPMed,gnomAD
rs150642906	p.Glu309Gln	missense variant	-	NC_000012.12:g.2937631G>C	ESP,ExAC,TOPMed,gnomAD
rs777330773	p.Thr310Ala	missense variant	-	NC_000012.12:g.2937634A>G	ExAC,gnomAD
rs1185351704	p.Thr310Ile	missense variant	-	NC_000012.12:g.2937635C>T	TOPMed,gnomAD
rs368526026	p.Val312Ile	missense variant	-	NC_000012.12:g.2937640G>A	ESP,ExAC,gnomAD
rs769148627	p.Leu313Phe	missense variant	-	NC_000012.12:g.2937643C>T	TOPMed
rs763165864	p.Gly314Glu	missense variant	-	NC_000012.12:g.2937647G>A	ExAC,gnomAD
NCI-TCGA novel	p.Gly317Val	inframe deletion	-	NC_000012.12:g.2937656_2937676GTCCTAGGAAAATGTCTGTGA>-	NCI-TCGA
rs751351701	p.Gly317Ala	missense variant	-	NC_000012.12:g.2937656G>C	ExAC,gnomAD
rs1280507194	p.Arg319Lys	missense variant	-	NC_000012.12:g.2937662G>A	TOPMed
COSM938620	p.Lys320Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2937665A>G	NCI-TCGA Cosmic
rs754773818	p.Met321Thr	missense variant	-	NC_000012.12:g.2937668T>C	ExAC,gnomAD
rs781075943	p.Met321Ile	missense variant	-	NC_000012.12:g.2937669G>A	ExAC,gnomAD
rs752590569	p.Ile325Val	missense variant	-	NC_000012.12:g.2937679A>G	ExAC,gnomAD
rs752590569	p.Ile325Leu	missense variant	-	NC_000012.12:g.2937679A>C	ExAC,gnomAD
NCI-TCGA novel	p.Gly327Ala	missense variant	-	NC_000012.12:g.2937686G>C	NCI-TCGA
rs756066173	p.Thr329Arg	missense variant	-	NC_000012.12:g.2937692C>G	ExAC,gnomAD
rs1446576749	p.Thr329Ala	missense variant	-	NC_000012.12:g.2937691A>G	gnomAD
rs748755336	p.Ile335Thr	missense variant	-	NC_000012.12:g.2937710T>C	ExAC,gnomAD
rs770614137	p.Pro336Leu	missense variant	-	NC_000012.12:g.2937713C>T	ExAC,gnomAD
rs1205428775	p.Pro336Ala	missense variant	-	NC_000012.12:g.2937712C>G	gnomAD
rs200713391	p.Tyr337Cys	missense variant	-	NC_000012.12:g.2937716A>G	ExAC,TOPMed,gnomAD
rs1457127149	p.Tyr337His	missense variant	-	NC_000012.12:g.2937715T>C	gnomAD
rs769187441	p.Gln338Pro	missense variant	-	NC_000012.12:g.2937719A>C	ExAC,gnomAD
rs1421042858	p.Gln338Ter	stop gained	-	NC_000012.12:g.2937718C>T	gnomAD
rs769187441	p.Gln338Arg	missense variant	-	NC_000012.12:g.2937719A>G	ExAC,gnomAD
rs762364081	p.Gln340Glu	missense variant	-	NC_000012.12:g.2937724C>G	ExAC,gnomAD
rs762364081	p.Gln340Ter	stop gained	-	NC_000012.12:g.2937724C>T	ExAC,gnomAD
rs143103362	p.Asn342Asp	missense variant	-	NC_000012.12:g.2938114A>G	ESP,ExAC,TOPMed,gnomAD
rs767249282	p.Asp344Asn	missense variant	-	NC_000012.12:g.2938120G>A	ExAC,TOPMed,gnomAD
rs776940652	p.Ser345Asn	missense variant	-	NC_000012.12:g.2938124G>A	ExAC,gnomAD
rs1375090106	p.Leu346Ser	missense variant	-	NC_000012.12:g.2938127T>C	gnomAD
rs1456756568	p.Leu347Val	missense variant	-	NC_000012.12:g.2938129C>G	gnomAD
COSM4917040	p.Gln351Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2938142A>T	NCI-TCGA Cosmic
rs756767944	p.Thr354Ile	missense variant	-	NC_000012.12:g.2938151C>T	ExAC,gnomAD
rs1248541438	p.Thr354Pro	missense variant	-	NC_000012.12:g.2938150A>C	TOPMed
rs201262022	p.Met355Val	missense variant	-	NC_000012.12:g.2938153A>G	ESP,ExAC,TOPMed,gnomAD
rs147467278	p.Asn357Asp	missense variant	-	NC_000012.12:g.2938159A>G	ESP,ExAC,TOPMed,gnomAD
rs1243849784	p.His362Arg	missense variant	-	NC_000012.12:g.2938175A>G	gnomAD
rs781644204	p.Asn363Lys	missense variant	-	NC_000012.12:g.2938179C>A	ExAC,gnomAD
NCI-TCGA novel	p.Ala365Thr	missense variant	-	NC_000012.12:g.2938183G>A	NCI-TCGA
rs1485596722	p.Val367Ala	missense variant	-	NC_000012.12:g.2938190T>C	gnomAD
rs770408342	p.Val367Ile	missense variant	-	NC_000012.12:g.2938189G>A	ExAC,TOPMed,gnomAD
rs1276111458	p.Asn369Lys	missense variant	-	NC_000012.12:g.2938197C>A	TOPMed
rs34246393	p.Ser370Thr	missense variant	-	NC_000012.12:g.2938199G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1422426084	p.Thr372Ser	missense variant	-	NC_000012.12:g.2938205C>G	gnomAD
rs770875252	p.Gln373Glu	missense variant	-	NC_000012.12:g.2938207C>G	ExAC,gnomAD
rs1386260183	p.Ser374Ala	missense variant	-	NC_000012.12:g.2938210T>G	gnomAD
rs1156494021	p.Tyr375Cys	missense variant	-	NC_000012.12:g.2938214A>G	gnomAD
NCI-TCGA novel	p.Tyr375Phe	missense variant	-	NC_000012.12:g.2938214A>T	NCI-TCGA
rs1344047379	p.Val376Ile	missense variant	-	NC_000012.12:g.2938216G>A	gnomAD
rs1369598087	p.Leu377Val	missense variant	-	NC_000012.12:g.2938219C>G	TOPMed
rs759694975	p.Asn378Ser	missense variant	-	NC_000012.12:g.2938223A>G	ExAC,gnomAD
rs767729549	p.Arg380Gly	missense variant	-	NC_000012.12:g.2938228C>G	ExAC,TOPMed,gnomAD
rs113831847	p.Arg380His	missense variant	-	NC_000012.12:g.2938229G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs760523025	p.Arg382Trp	missense variant	-	NC_000012.12:g.2938234C>T	ExAC,TOPMed,gnomAD
rs764071522	p.Arg382Gln	missense variant	-	NC_000012.12:g.2938235G>A	ExAC,gnomAD
rs753760251	p.Val383Asp	missense variant	-	NC_000012.12:g.2938238T>A	ExAC,gnomAD
rs757253951	p.Gln385Arg	missense variant	-	NC_000012.12:g.2938244A>G	ExAC,gnomAD
rs371955902	p.Ala386Glu	missense variant	-	NC_000012.12:g.2938247C>A	ESP,ExAC,gnomAD
rs371955902	p.Ala386Val	missense variant	-	NC_000012.12:g.2938247C>T	ESP,ExAC,gnomAD
rs1482527285	p.Val388Leu	missense variant	-	NC_000012.12:g.2938252G>C	gnomAD
rs756583357	p.Phe391Ser	missense variant	-	NC_000012.12:g.2938262T>C	ExAC,TOPMed,gnomAD
rs1408433123	p.Phe391Leu	missense variant	-	NC_000012.12:g.2938263C>G	TOPMed
rs1446848744	p.Gln392Ter	stop gained	-	NC_000012.12:g.2938264C>T	gnomAD
rs985314972	p.Ile393Thr	missense variant	-	NC_000012.12:g.2938268T>C	TOPMed,gnomAD
rs544419371	p.Val394Ala	missense variant	-	NC_000012.12:g.2938271T>C	1000Genomes,ExAC,gnomAD
rs1173360238	p.His395Arg	missense variant	-	NC_000012.12:g.2938274A>G	TOPMed
NCI-TCGA novel	p.Asn397MetPheSerTerUnk	frameshift	-	NC_000012.12:g.2938276A>-	NCI-TCGA
NCI-TCGA novel	p.Asp398Val	missense variant	-	NC_000012.12:g.2938283A>T	NCI-TCGA
rs115288066	p.Pro399Ala	missense variant	-	NC_000012.12:g.2938285C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs777941550	p.Pro399Arg	missense variant	-	NC_000012.12:g.2939311C>G	ExAC,TOPMed,gnomAD
rs115288066	p.Pro399Ser	missense variant	-	NC_000012.12:g.2938285C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs754233335	p.Asp400Asn	missense variant	-	NC_000012.12:g.2939313G>A	ExAC,gnomAD
rs570648183	p.Tyr401Asp	missense variant	-	NC_000012.12:g.2939316T>G	1000Genomes,ExAC
rs570648183	p.Tyr401His	missense variant	-	NC_000012.12:g.2939316T>C	1000Genomes,ExAC
rs745928595	p.Ile402Met	missense variant	-	NC_000012.12:g.2939321A>G	ExAC,TOPMed,gnomAD
rs772180667	p.Val403Gly	missense variant	-	NC_000012.12:g.2939323T>G	ExAC,gnomAD
rs151194786	p.Met404Val	missense variant	-	NC_000012.12:g.2939325A>G	ESP,ExAC,TOPMed,gnomAD
rs747187923	p.Met404Ile	missense variant	-	NC_000012.12:g.2939327G>A	ExAC,gnomAD
COSM4911013	p.Gln405Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2939329A>T	NCI-TCGA Cosmic
rs768940984	p.Gln405Lys	missense variant	-	NC_000012.12:g.2939328C>A	ExAC,gnomAD
rs140237163	p.Arg408Cys	missense variant	-	NC_000012.12:g.2939337C>T	ESP,ExAC,TOPMed,gnomAD
rs761172007	p.Arg408Leu	missense variant	-	NC_000012.12:g.2939338G>T	ExAC,TOPMed,gnomAD
rs761172007	p.Arg408His	missense variant	-	NC_000012.12:g.2939338G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp412Asn	missense variant	-	NC_000012.12:g.2939349G>A	NCI-TCGA
rs773320390	p.Val413Leu	missense variant	-	NC_000012.12:g.2939352G>T	ExAC,TOPMed,gnomAD
rs773320390	p.Val413Met	missense variant	-	NC_000012.12:g.2939352G>A	ExAC,TOPMed,gnomAD
COSM693400	p.Phe414Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2939356T>A	NCI-TCGA Cosmic
rs765935318	p.Thr415Ile	missense variant	-	NC_000012.12:g.2939359C>T	ExAC,TOPMed,gnomAD
rs1233204132	p.Leu416Arg	missense variant	-	NC_000012.12:g.2939362T>G	TOPMed
COSM1361145	p.Asp417Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2939364G>T	NCI-TCGA Cosmic
rs751127572	p.Asp417Asn	missense variant	-	NC_000012.12:g.2939364G>A	ExAC,gnomAD
rs759044001	p.Asn419Ser	missense variant	-	NC_000012.12:g.2939371A>G	ExAC,TOPMed,gnomAD
COSM3986865	p.Asn419Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.2939371A>C	NCI-TCGA Cosmic
rs754141781	p.Pro421Ser	missense variant	-	NC_000012.12:g.2939376C>T	ExAC,gnomAD
rs144033598	p.Cys423Arg	missense variant	-	NC_000012.12:g.2939382T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs779362288	p.Gln426His	missense variant	-	NC_000012.12:g.2939393G>C	ExAC,TOPMed,gnomAD
rs1347475152	p.Ala427Asp	missense variant	-	NC_000012.12:g.2939395C>A	TOPMed,gnomAD
rs758930432	p.Gly431Ser	missense variant	-	NC_000012.12:g.2939406G>A	ExAC,TOPMed,gnomAD
rs747119742	p.Ser433Cys	missense variant	-	NC_000012.12:g.2939413C>G	ExAC,gnomAD
rs1216758183	p.Ser433Ala	missense variant	-	NC_000012.12:g.2939412T>G	gnomAD
rs1222770419	p.Asp436Asn	missense variant	-	NC_000012.12:g.2939421G>A	gnomAD
rs140769882	p.Ser437Thr	missense variant	-	NC_000012.12:g.2939425G>C	ESP,ExAC,TOPMed,gnomAD
rs750019336	p.Ala440Val	missense variant	-	NC_000012.12:g.2939434C>T	ExAC,gnomAD
rs1054107031	p.Ala440Thr	missense variant	-	NC_000012.12:g.2939433G>A	TOPMed
rs769668205	p.Ter443Ser	stop lost	-	NC_000012.12:g.2939443G>C	ExAC,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0027794	Neural Tube Defects	group	BEFREE
C0152427	Polydactyly	disease	BEFREE
C0235974	Pancreatic carcinoma	disease	BEFREE
C0238198	Gastrointestinal Stromal Tumors	group	CTD_human
C0281361	Adenocarcinoma of pancreas	disease	BEFREE
C0345354	Radial polydactyly	disease	BEFREE
C0346647	Malignant neoplasm of pancreas	disease	BEFREE
C1335302	Pancreatic Ductal Adenocarcinoma	disease	BEFREE
C3179349	Gastrointestinal Stromal Sarcoma	disease	CTD_human

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0001664	G protein-coupled receptor binding	IDA
GO:0005515	protein binding	IPI
GO:0005546	phosphatidylinositol-4,5-bisphosphate binding	NAS
GO:0019899	enzyme binding	IPI
GO:0035091	phosphatidylinositol binding	IDA
GO:0044877	protein-containing complex binding	IDA
GO:0120160	intraciliary transport particle A binding	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001843	neural tube closure	IEA
GO:0006355	regulation of transcription, DNA-templated	NAS
GO:0007186	G protein-coupled receptor signaling pathway	NAS
GO:0007420	brain development	IEA
GO:0008277	regulation of G protein-coupled receptor signaling pathway	IDA
GO:0008277	regulation of G protein-coupled receptor signaling pathway	IMP
GO:0009952	anterior/posterior pattern specification	IEA
GO:0021914	negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning	IEA
GO:0021953	central nervous system neuron differentiation	IEA
GO:0031076	embryonic camera-type eye development	IEA
GO:0042733	embryonic digit morphogenesis	IEA
GO:0045879	negative regulation of smoothened signaling pathway	IDA
GO:0048702	embryonic neurocranium morphogenesis	IEA
GO:0060348	bone development	IEA
GO:0060434	bronchus morphogenesis	IEA
GO:0060831	smoothened signaling pathway involved in dorsal/ventral neural tube patterning	IEA
GO:0061512	protein localization to cilium	IBA
GO:0061512	protein localization to cilium	IDA
GO:0061512	protein localization to cilium	IMP
GO:0061548	ganglion development	IEA
GO:1901621	negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005576	extracellular region	IEA
GO:0005634	nucleus	NAS
GO:0005634	nucleus	IDA
GO:0005654	nucleoplasm	IDA
GO:0005730	nucleolus	IDA
GO:0005886	plasma membrane	IDA
GO:0005886	plasma membrane	NAS
GO:0005929	cilium	IDA
GO:0005929	cilium	IBA
GO:0005929	cilium	TAS
GO:0005930	axoneme	IEA
GO:0097546	ciliary base	IDA
GO:0097731	9+0 non-motile cilium	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-162582	Signal Transduction	TAS
R-HSA-5358351	Signaling by Hedgehog	TAS
R-HSA-5610787	Hedgehog 'off' state	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D000082	Acetaminophen	Acetaminophen results in increased expression of TULP3 mRNA	21420995
D000082	Acetaminophen	Acetaminophen affects the expression of TULP3 mRNA	17562736
D018501	Antirheumatic Agents	Antirheumatic Agents results in increased expression of TULP3 mRNA	24449571
D001104	Arbutin	Arbutin results in decreased expression of TULP3 mRNA	17103032
C006780	bisphenol A	bisphenol A results in decreased expression of TULP3 mRNA	25181051; 30816183;
D002220	Carbamazepine	Carbamazepine affects the expression of TULP3 mRNA	22634333
D002330	Carmustine	TULP3 mRNA affects the susceptibility to Carmustine	16365179
D019327	Copper Sulfate	Copper Sulfate results in increased expression of TULP3 mRNA	19549813
D016572	Cyclosporine	Cyclosporine results in increased expression of TULP3 mRNA	20106945; 25562108; 27989131;
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in decreased expression of TULP3 mRNA	21266533
C000944	dicrotophos	dicrotophos results in increased expression of TULP3 mRNA	28302478
D004726	Endosulfan	Endosulfan results in decreased expression of TULP3 mRNA	29391264
D005020	Ethyl Methanesulfonate	Ethyl Methanesulfonate results in increased expression of TULP3 mRNA	23649840
C061365	flusilazole	flusilazole affects the expression of TULP3 mRNA	22634333
D005557	Formaldehyde	Formaldehyde results in increased expression of TULP3 mRNA	23649840
D019833	Genistein	Genistein results in decreased expression of TULP3 mRNA	16705744
C007836	geraniol	geraniol results in increased expression of TULP3 mRNA	27683099
C410337	K 7174	K 7174 results in increased expression of TULP3 mRNA	24086573
C011890	kojic acid	kojic acid results in decreased expression of TULP3 mRNA	16595896
D008741	Methyl Methanesulfonate	Methyl Methanesulfonate results in increased expression of TULP3 mRNA	23649840
D000077150	Oxaliplatin	[Oxaliplatin co-treated with Topotecan] results in increased expression of TULP3 mRNA	25729387
C568608	PCI 5002	[PCI 5002 co-treated with Zinc] results in increased expression of TULP3 mRNA	18593933
C513635	S-2-pentyl-4-pentynoic hydroxamic acid	S-2-pentyl-4-pentynoic hydroxamic acid results in increased expression of TULP3 mRNA	21427059
D012643	Selenium	[Selenium co-treated with Vitamin E] results in decreased expression of TULP3 mRNA	19244175
D012643	Selenium	Selenium results in decreased expression of TULP3 mRNA	19244175
D012834	Silver	Silver results in decreased expression of TULP3 mRNA	27131904
D012999	Soman	Soman results in decreased expression of TULP3 mRNA	19281266
D000077210	Sunitinib	Sunitinib results in increased expression of TULP3 mRNA	31533062
C061133	tamibarotene	tamibarotene affects the expression of TULP3 mRNA	15498508
D000077204	Temozolomide	TULP3 mRNA affects the susceptibility to Temozolomide	16365179
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in decreased expression of TULP3 mRNA	15336504
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of TULP3 mRNA	21570461
D019772	Topotecan	[Oxaliplatin co-treated with Topotecan] results in increased expression of TULP3 mRNA	25729387
D014212	Tretinoin	Tretinoin results in decreased expression of TULP3 mRNA	15498508
C012589	trichostatin A	trichostatin A results in increased expression of TULP3 mRNA	15901671
D014635	Valproic Acid	Valproic Acid results in increased expression of TULP3 mRNA	29154799
D014635	Valproic Acid	Valproic Acid results in increased expression of TULP3 mRNA	20546886
D014635	Valproic Acid	Valproic Acid results in increased expression of TULP3 mRNA	15901671
D014810	Vitamin E	[Selenium co-treated with Vitamin E] results in decreased expression of TULP3 mRNA	19244175
D014810	Vitamin E	Vitamin E results in decreased expression of TULP3 mRNA	19244175
D024483	Vitamin K 3	Vitamin K 3 affects the expression of TULP3 mRNA	20044591
D015032	Zinc	[PCI 5002 co-treated with Zinc] results in increased expression of TULP3 mRNA	18593933

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0025	Alternative splicing
KW-1003	Cell membrane
KW-0966	Cell projection
KW-0969	Cilium
KW-0963	Cytoplasm
KW-0217	Developmental protein
KW-0472	Membrane
KW-0539	Nucleus
KW-1185	Reference proteome
KW-0964	Secreted

Interpro

InterPro ID	InterPro Term
IPR025659	Tubby-like_C
IPR000007	Tubby_C
IPR018066	Tubby_C_CS
IPR005398	Tubby_N

PROSITE

PROSITE ID	PROSITE Term
PS01200	TUB_1
PS01201	TUB_2

Pfam

Pfam ID	Pfam Term
PF01167	Tub
PF16322	Tub_N

Gene: TULP3

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction