CleftGeneDB-Search

Gene: TM7SF2

Basic information

Tag	Content
Uniprot ID	O76062; A8K4H0; O95982; Q8IY06; Q96E64; Q96GZ1;
Entrez ID	7108
Genbank protein ID	AAH38353.1; AAC21450.1; BAF83624.1; AAC21457.1; AAH12857.1; AAD09769.1; AAH09052.1; AAD09765.1;
Genbank nucleotide ID	NM_001277233.1; NM_003273.3;
Ensembl protein ID	ENSP00000279263; ENSP00000329520;
Ensembl nucleotide ID	ENSG00000149809
Gene name	Delta(14)-sterol reductase TM7SF2
Gene symbol	TM7SF2
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Catalyzes the reduction of the C14-unsaturated bond of lanosterol, as part of the metabolic pathway leading to cholesterol biosynthesis.
Sequence	MAPTQGPRAP LEFGGPLGAA ALLLLLPATM FHLLLAARSG PARLLGPPAS LPGLEVLWSP 60 RALLLWLAWL GLQAALYLLP ARKVAEGQEL KDKSRLRYPI NGFQALVLTA LLVGLGMSAG 120 LPLGALPEML LPLAFVATLT AFIFSLFLYM KAQVAPVSAL APGGNSGNPI YDFFLGRELN 180 PRICFFDFKY FCELRPGLIG WVLINLALLM KEAELRGSPS LAMWLVNGFQ LLYVGDALWH 240 EEAVLTTMDI THDGFGFMLA FGDMAWVPFT YSLQAQFLLH HPQPLGLPMA SVICLINATG 300 YYIFRGANSQ KNTFRKNPSD PRVAGLETIS TATGRKLLVS GWWGMVRHPN YLGDLIMALA 360 WSLPCGVSHL LPYFYLLYFT ALLVHREARD ERQCLQKYGL AWQEYCRRVP YRIMPYIY 418

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	TM7SF2	282384	Q17QS8		Bos taurus	Prediction	More>>
1:1 ortholog	TM7SF2	476027	A0A5F4DIJ7		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	TM7SF2	100861120	A0A452DYK9		Capra hircus	Prediction	More>>
1:1 ortholog	TM7SF2	7108	O76062		Homo sapiens	Prediction	More>>
1:1 ortholog	Tm7sf2	73166	Q71KT5	CPO	Mus musculus	Publication	More>>
1:1 ortholog	TM7SF2	451314	K6ZIY4		Pan troglodytes	Prediction	More>>
1:1 ortholog		100514510	A0A480QTI0		Sus scrofa	Prediction	More>>
1:1 ortholog	Tm7sf2	293688	Q5BK21		Rattus norvegicus	Prediction	More>>
1:1 ortholog	tm7sf2		F1Q8Y4		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs746410125	p.Ala2Val	missense variant	-	NC_000011.10:g.65112020C>T	ExAC,gnomAD
rs1484023001	p.Pro3Ser	missense variant	-	NC_000011.10:g.65112022C>T	TOPMed,gnomAD
rs1198423120	p.Pro3Leu	missense variant	-	NC_000011.10:g.65112023C>T	gnomAD
rs769826284	p.Thr4Ser	missense variant	-	NC_000011.10:g.65112026C>G	ExAC,gnomAD
rs769826284	p.Thr4Ile	missense variant	-	NC_000011.10:g.65112026C>T	ExAC,gnomAD
rs775514606	p.Gly6Asp	missense variant	-	NC_000011.10:g.65112032G>A	ExAC
NCI-TCGA novel	p.Gly6Cys	missense variant	-	NC_000011.10:g.65112031G>T	NCI-TCGA
rs768848767	p.Pro7Leu	missense variant	-	NC_000011.10:g.65112035C>T	ExAC,gnomAD
rs763067450	p.Pro7Ser	missense variant	-	NC_000011.10:g.65112034C>T	ExAC,gnomAD
rs1472555529	p.Arg8Leu	missense variant	-	NC_000011.10:g.65112038G>T	gnomAD
rs1179865601	p.Arg8Trp	missense variant	-	NC_000011.10:g.65112037C>T	TOPMed
NCI-TCGA novel	p.Arg8GlyPheSerTerUnkUnk	frameshift	-	NC_000011.10:g.65112033_65112034CC>-	NCI-TCGA
rs774697135	p.Pro10Ser	missense variant	-	NC_000011.10:g.65112043C>T	ExAC,TOPMed,gnomAD
rs532572337	p.Gly14Arg	missense variant	-	NC_000011.10:g.65112055G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs532572337	p.Gly14Arg	missense variant	-	NC_000011.10:g.65112055G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs765316965	p.Pro16Ala	missense variant	-	NC_000011.10:g.65112061C>G	ExAC,TOPMed,gnomAD
rs752243591	p.Leu17Gln	missense variant	-	NC_000011.10:g.65112065T>A	ExAC,gnomAD
rs1032053988	p.Ala19Thr	missense variant	-	NC_000011.10:g.65112517G>A	gnomAD
rs1032053988	p.Ala19Ser	missense variant	-	NC_000011.10:g.65112517G>T	gnomAD
rs1032053988	p.Ala19Pro	missense variant	-	NC_000011.10:g.65112517G>C	gnomAD
rs1047282998	p.Ala20Val	missense variant	-	NC_000011.10:g.65112521C>T	TOPMed,gnomAD
rs1324620567	p.Ala21Val	missense variant	-	NC_000011.10:g.65112524C>T	gnomAD
rs891400616	p.Leu23Pro	missense variant	-	NC_000011.10:g.65112530T>C	TOPMed,gnomAD
rs1436680054	p.Pro27Leu	missense variant	-	NC_000011.10:g.65112542C>T	gnomAD
rs552926486	p.Ala28Ser	missense variant	-	NC_000011.10:g.65112544G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs573100022	p.Ala28Val	missense variant	-	NC_000011.10:g.65112545C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs367955365	p.Thr29Ala	missense variant	-	NC_000011.10:g.65112547A>G	gnomAD
rs1353982024	p.Met30Val	missense variant	-	NC_000011.10:g.65112550A>G	TOPMed
rs1320429480	p.Met30Ile	missense variant	-	NC_000011.10:g.65112552G>A	TOPMed,gnomAD
rs765262117	p.Met30Thr	missense variant	-	NC_000011.10:g.65112551T>C	ExAC,gnomAD
rs1233531752	p.His32Pro	missense variant	-	NC_000011.10:g.65112557A>C	TOPMed
rs762494844	p.Ala36Gly	missense variant	-	NC_000011.10:g.65112569C>G	ExAC,TOPMed,gnomAD
rs762494844	p.Ala36Val	missense variant	-	NC_000011.10:g.65112569C>T	ExAC,TOPMed,gnomAD
rs781766885	p.Arg38Leu	missense variant	-	NC_000011.10:g.65112575G>T	ExAC,TOPMed,gnomAD
rs982011193	p.Arg38Cys	missense variant	-	NC_000011.10:g.65112574C>T	TOPMed,gnomAD
rs781766885	p.Arg38Pro	missense variant	-	NC_000011.10:g.65112575G>C	ExAC,TOPMed,gnomAD
rs781766885	p.Arg38His	missense variant	-	NC_000011.10:g.65112575G>A	ExAC,TOPMed,gnomAD
rs767122038	p.Ser39Trp	missense variant	-	NC_000011.10:g.65112578C>G	ExAC,TOPMed,gnomAD
rs750770040	p.Gly40Ser	missense variant	-	NC_000011.10:g.65112580G>A	ExAC,TOPMed,gnomAD
rs750770040	p.Gly40Arg	missense variant	-	NC_000011.10:g.65112580G>C	ExAC,TOPMed,gnomAD
rs1164077624	p.Gly40Val	missense variant	-	NC_000011.10:g.65112581G>T	gnomAD
rs750770040	p.Gly40Cys	missense variant	-	NC_000011.10:g.65112580G>T	ExAC,TOPMed,gnomAD
rs756534085	p.Pro41Ser	missense variant	-	NC_000011.10:g.65112583C>T	ExAC,gnomAD
rs1317958921	p.Ala42Glu	missense variant	-	NC_000011.10:g.65112587C>A	TOPMed,gnomAD
rs1286298401	p.Arg43His	missense variant	-	NC_000011.10:g.65112590G>A	gnomAD
rs371186990	p.Arg43Cys	missense variant	-	NC_000011.10:g.65112589C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1377483659	p.Leu44Pro	missense variant	-	NC_000011.10:g.65112593T>C	gnomAD
rs1331857216	p.Leu45Pro	missense variant	-	NC_000011.10:g.65112596T>C	gnomAD
rs1289472111	p.Leu45Met	missense variant	-	NC_000011.10:g.65112595C>A	gnomAD
rs1267664876	p.Gly46Ser	missense variant	-	NC_000011.10:g.65112598G>A	gnomAD
rs1443204531	p.Gly46Val	missense variant	-	NC_000011.10:g.65112599G>T	gnomAD
rs1235973414	p.Pro47Gln	missense variant	-	NC_000011.10:g.65112602C>A	gnomAD
rs1212576392	p.Pro47Ser	missense variant	-	NC_000011.10:g.65112601C>T	TOPMed,gnomAD
rs1212576392	p.Pro47Thr	missense variant	-	NC_000011.10:g.65112601C>A	TOPMed,gnomAD
rs1471658328	p.Pro48Ser	missense variant	-	NC_000011.10:g.65112604C>T	gnomAD
rs1412529879	p.Ala49Ser	missense variant	-	NC_000011.10:g.65112607G>T	TOPMed,gnomAD
rs1412529879	p.Ala49Thr	missense variant	-	NC_000011.10:g.65112607G>A	TOPMed,gnomAD
rs773375844	p.Ser50Phe	missense variant	-	NC_000011.10:g.65112611C>T	ExAC,gnomAD
rs1414650276	p.Leu51Met	missense variant	-	NC_000011.10:g.65112613C>A	gnomAD
rs1357094628	p.Pro52Ser	missense variant	-	NC_000011.10:g.65112616C>T	gnomAD
rs1352866861	p.Gly53Ala	missense variant	-	NC_000011.10:g.65112620G>C	TOPMed,gnomAD
rs1309023964	p.Gly53Arg	missense variant	-	NC_000011.10:g.65112619G>A	gnomAD
rs1352866861	p.Gly53Val	missense variant	-	NC_000011.10:g.65112620G>T	TOPMed,gnomAD
rs1309023964	p.Gly53Trp	missense variant	-	NC_000011.10:g.65112619G>T	gnomAD
rs901336141	p.Leu54Met	missense variant	-	NC_000011.10:g.65112622C>A	gnomAD
NCI-TCGA novel	p.Leu54Gln	missense variant	-	NC_000011.10:g.65112623T>A	NCI-TCGA
rs1345858699	p.Glu55Lys	missense variant	-	NC_000011.10:g.65112625G>A	TOPMed,gnomAD
rs775524238	p.Val56Met	missense variant	-	NC_000011.10:g.65112628G>A	ExAC
rs1209878998	p.Trp58Ter	stop gained	-	NC_000011.10:g.65112635G>A	gnomAD
rs1252342331	p.Ser59Gly	missense variant	-	NC_000011.10:g.65112637A>G	TOPMed,gnomAD
rs1483982385	p.Ser59Arg	missense variant	-	NC_000011.10:g.65112639C>G	TOPMed,gnomAD
rs1179972352	p.Arg61Trp	missense variant	-	NC_000011.10:g.65112643C>T	TOPMed,gnomAD
rs1363187058	p.Arg61Gln	missense variant	-	NC_000011.10:g.65112644G>A	TOPMed,gnomAD
rs1179972352	p.Arg61Gly	missense variant	-	NC_000011.10:g.65112643C>G	TOPMed,gnomAD
rs1173836529	p.Ala62Val	missense variant	-	NC_000011.10:g.65112647C>T	gnomAD
rs1157207889	p.Leu65Gln	missense variant	-	NC_000011.10:g.65112656T>A	TOPMed
rs1309009174	p.Leu67Val	missense variant	-	NC_000011.10:g.65112661C>G	gnomAD
rs1421050244	p.Leu70Phe	missense variant	-	NC_000011.10:g.65112670C>T	TOPMed
rs1421050244	p.Leu70Ile	missense variant	-	NC_000011.10:g.65112670C>A	TOPMed
rs1408509054	p.Leu72Val	missense variant	-	NC_000011.10:g.65112676C>G	TOPMed,gnomAD
rs1328711241	p.Ala74Val	missense variant	-	NC_000011.10:g.65112683C>T	gnomAD
rs1254793702	p.Leu78Ile	missense variant	-	NC_000011.10:g.65112694C>A	TOPMed
rs1273220359	p.Pro80Ala	missense variant	-	NC_000011.10:g.65112700C>G	gnomAD
rs1347410878	p.Pro80Arg	missense variant	-	NC_000011.10:g.65112701C>G	TOPMed,gnomAD
rs1347410878	p.Pro80Leu	missense variant	-	NC_000011.10:g.65112701C>T	TOPMed,gnomAD
rs544392611	p.Ala81Gly	missense variant	-	NC_000011.10:g.65112704C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs544392611	p.Ala81Val	missense variant	-	NC_000011.10:g.65112704C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs563774622	p.Arg82His	missense variant	-	NC_000011.10:g.65112707G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs563774622	p.Arg82Leu	missense variant	-	NC_000011.10:g.65112707G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1384255212	p.Val84Met	missense variant	-	NC_000011.10:g.65112811G>A	TOPMed
rs1386721492	p.Glu86Gly	missense variant	-	NC_000011.10:g.65112818A>G	gnomAD
rs1053859882	p.Glu86Lys	missense variant	-	NC_000011.10:g.65112817G>A	TOPMed,gnomAD
rs1381923795	p.Gln88Arg	missense variant	-	NC_000011.10:g.65112824A>G	gnomAD
rs1294561804	p.Leu90Ser	missense variant	-	NC_000011.10:g.65112830T>C	gnomAD
rs1294561804	p.Leu90Trp	missense variant	-	NC_000011.10:g.65112830T>G	gnomAD
rs1340890806	p.Asp92Glu	missense variant	-	NC_000011.10:g.65112837C>G	gnomAD
rs984178225	p.Lys93Met	missense variant	-	NC_000011.10:g.65112839A>T	TOPMed,gnomAD
rs573822376	p.Lys93Glu	missense variant	-	NC_000011.10:g.65112838A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs984178225	p.Lys93Arg	missense variant	-	NC_000011.10:g.65112839A>G	TOPMed,gnomAD
rs1208803014	p.Arg95Leu	missense variant	-	NC_000011.10:g.65112845G>T	TOPMed,gnomAD
rs1208803014	p.Arg95His	missense variant	-	NC_000011.10:g.65112845G>A	TOPMed,gnomAD
rs1429064818	p.Arg97Cys	missense variant	-	NC_000011.10:g.65112850C>T	TOPMed
rs1269532861	p.Tyr98His	missense variant	-	NC_000011.10:g.65112853T>C	TOPMed,gnomAD
rs1277537371	p.Gly102Cys	missense variant	-	NC_000011.10:g.65112865G>T	gnomAD
rs1280023643	p.Gln104His	missense variant	-	NC_000011.10:g.65113227G>T	gnomAD
rs1055088924	p.Gln104Ter	stop gained	-	NC_000011.10:g.65113225C>T	TOPMed,gnomAD
rs753158046	p.Gln104Pro	missense variant	-	NC_000011.10:g.65113226A>C	ExAC,gnomAD
NCI-TCGA novel	p.Gln104Glu	missense variant	-	NC_000011.10:g.65113225C>G	NCI-TCGA
rs1055088924	p.Gln104Lys	missense variant	-	NC_000011.10:g.65113225C>A	TOPMed,gnomAD
rs758455043	p.Val107Leu	missense variant	-	NC_000011.10:g.65113234G>T	ExAC,TOPMed,gnomAD
rs751733076	p.Ala110Thr	missense variant	-	NC_000011.10:g.65113243G>A	ExAC,gnomAD
rs757533597	p.Leu112Phe	missense variant	-	NC_000011.10:g.65113251G>T	ExAC,TOPMed,gnomAD
rs368811097	p.Val113Gly	missense variant	-	NC_000011.10:g.65113253T>G	ExAC,gnomAD
rs368811097	p.Val113Glu	missense variant	-	NC_000011.10:g.65113253T>A	ExAC,gnomAD
rs749102887	p.Gly114Ala	missense variant	-	NC_000011.10:g.65113256G>C	ExAC,gnomAD
NCI-TCGA novel	p.Gly114Val	missense variant	-	NC_000011.10:g.65113256G>T	NCI-TCGA
rs906315729	p.Gly116Arg	missense variant	-	NC_000011.10:g.65113261G>A	TOPMed,gnomAD
rs377641143	p.Gly116Glu	missense variant	-	NC_000011.10:g.65113262G>A	ESP,ExAC,TOPMed,gnomAD
rs371004792	p.Met117Ile	missense variant	-	NC_000011.10:g.65113266G>A	ESP,ExAC,TOPMed,gnomAD
rs11539360	p.Ala119Val	missense variant	-	NC_000011.10:g.65113271C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1293584325	p.Leu121Pro	missense variant	-	NC_000011.10:g.65113277T>C	gnomAD
rs1027102131	p.Pro122Leu	missense variant	-	NC_000011.10:g.65113280C>T	TOPMed
rs1413508745	p.Leu123Pro	missense variant	-	NC_000011.10:g.65113283T>C	gnomAD
rs1194185346	p.Gly124Arg	missense variant	-	NC_000011.10:g.65113285G>C	TOPMed
NCI-TCGA novel	p.Gly124Val	missense variant	-	NC_000011.10:g.65113286G>T	NCI-TCGA
rs368139158	p.Gly124Glu	missense variant	-	NC_000011.10:g.65113286G>A	ESP,ExAC,TOPMed,gnomAD
rs770555777	p.Ala125Thr	missense variant	-	NC_000011.10:g.65113288G>A	ExAC,gnomAD
rs776272038	p.Ala125Val	missense variant	-	NC_000011.10:g.65113289C>T	ExAC,gnomAD
rs199945827	p.Pro127Gln	missense variant	-	NC_000011.10:g.65113295C>A	ExAC,TOPMed,gnomAD
rs199945827	p.Pro127Leu	missense variant	-	NC_000011.10:g.65113295C>T	ExAC,TOPMed,gnomAD
rs1271392101	p.Met129Ile	missense variant	-	NC_000011.10:g.65113302G>A	gnomAD
rs558383899	p.Leu130Phe	missense variant	-	NC_000011.10:g.65113303C>T	TOPMed
rs1341193576	p.Leu131Gln	missense variant	-	NC_000011.10:g.65113307T>A	TOPMed
rs751678155	p.Ala134Val	missense variant	-	NC_000011.10:g.65113316C>T	ExAC,gnomAD
rs373651115	p.Ala137Thr	missense variant	-	NC_000011.10:g.65113324G>A	ESP,ExAC,TOPMed,gnomAD
rs1451636203	p.Thr138Ile	missense variant	-	NC_000011.10:g.65113328C>T	gnomAD
COSM4035333	p.Ala141Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65113336G>A	NCI-TCGA Cosmic
rs1427821990	p.Ala141Val	missense variant	-	NC_000011.10:g.65113337C>T	TOPMed,gnomAD
rs1314197376	p.Ile143Val	missense variant	-	NC_000011.10:g.65113342A>G	TOPMed
rs758307738	p.Phe144Ser	missense variant	-	NC_000011.10:g.65113346T>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser145Gly	missense variant	-	NC_000011.10:g.65113348A>G	NCI-TCGA
rs1459365131	p.Ser145Arg	missense variant	-	NC_000011.10:g.65113350C>A	gnomAD
rs555112713	p.Met150Val	missense variant	-	NC_000011.10:g.65113363A>G	ExAC,TOPMed,gnomAD
rs746451414	p.Met150Arg	missense variant	-	NC_000011.10:g.65113364T>G	ExAC,TOPMed,gnomAD
rs770443444	p.Ala152Val	missense variant	-	NC_000011.10:g.65113370C>T	ExAC,TOPMed,gnomAD
rs770443444	p.Ala152Gly	missense variant	-	NC_000011.10:g.65113370C>G	ExAC,TOPMed,gnomAD
rs112462138	p.Gln153Lys	missense variant	-	NC_000011.10:g.65113372C>A	ExAC,TOPMed,gnomAD
rs769529852	p.Ala155Thr	missense variant	-	NC_000011.10:g.65113378G>A	ExAC,TOPMed,gnomAD
rs367791949	p.Val157Leu	missense variant	-	NC_000011.10:g.65113384G>C	ESP,TOPMed,gnomAD
rs775699671	p.Val157Gly	missense variant	-	NC_000011.10:g.65113385T>G	ExAC,gnomAD
rs763435259	p.Ser158Ala	missense variant	-	NC_000011.10:g.65113387T>G	ExAC,gnomAD
rs1283986292	p.Ala159Thr	missense variant	-	NC_000011.10:g.65113390G>A	TOPMed,gnomAD
COSM690055	p.Ala161Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65113396G>C	NCI-TCGA Cosmic
rs775000437	p.Pro162Leu	missense variant	-	NC_000011.10:g.65113400C>T	ExAC,gnomAD
COSM1127688	p.Pro162Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65113399C>T	NCI-TCGA Cosmic
COSM3451700	p.Gly164Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65113406G>A	NCI-TCGA Cosmic
rs548244298	p.Asn165Ile	missense variant	-	NC_000011.10:g.65113409A>T	1000Genomes
COSM1355885	p.Asn165ThrPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000011.10:g.65113402G>-	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser166Ala	missense variant	-	NC_000011.10:g.65113411T>G	NCI-TCGA
rs749601174	p.Gly167Asp	missense variant	-	NC_000011.10:g.65113491G>A	ExAC,TOPMed,gnomAD
rs1406784876	p.Pro169Ser	missense variant	-	NC_000011.10:g.65113496C>T	gnomAD
COSM3451701	p.Pro169Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65113497C>T	NCI-TCGA Cosmic
rs1414739563	p.Pro169Arg	missense variant	-	NC_000011.10:g.65113497C>G	gnomAD
rs1358110223	p.Ile170Phe	missense variant	-	NC_000011.10:g.65113499A>T	gnomAD
rs773142728	p.Tyr171Asp	missense variant	-	NC_000011.10:g.65113502T>G	ExAC,gnomAD
NCI-TCGA novel	p.Tyr171Ter	stop gained	-	NC_000011.10:g.65113504C>G	NCI-TCGA
NCI-TCGA novel	p.Asp172Asn	missense variant	-	NC_000011.10:g.65113505G>A	NCI-TCGA
rs1309118164	p.Leu175Pro	missense variant	-	NC_000011.10:g.65113515T>C	gnomAD
rs1338066263	p.Gly176Arg	missense variant	-	NC_000011.10:g.65113517G>C	gnomAD
rs760865565	p.Arg177Gln	missense variant	-	NC_000011.10:g.65113521G>A	ExAC,gnomAD
rs1274757492	p.Glu178Val	missense variant	-	NC_000011.10:g.65113524A>T	TOPMed
NCI-TCGA novel	p.Leu179His	missense variant	-	NC_000011.10:g.65113527T>A	NCI-TCGA
NCI-TCGA novel	p.Pro181His	missense variant	-	NC_000011.10:g.65113533C>A	NCI-TCGA
rs368193705	p.Arg182His	missense variant	-	NC_000011.10:g.65113536G>A	ESP,ExAC,TOPMed,gnomAD
rs1345966475	p.Arg182Gly	missense variant	-	NC_000011.10:g.65113535C>G	gnomAD
rs762689150	p.Ile183Val	missense variant	-	NC_000011.10:g.65113538A>G	ExAC,gnomAD
rs1315919303	p.Cys184Tyr	missense variant	-	NC_000011.10:g.65113542G>A	TOPMed
rs1345406377	p.Phe185Leu	missense variant	-	NC_000011.10:g.65113546C>A	gnomAD
NCI-TCGA novel	p.Phe185GlyValCysArgHisProHisArg	insertion	-	NC_000011.10:g.65113545_65113546insTGGCGTTTGTCGCCACCCTCACCG	NCI-TCGA
rs763907881	p.Phe186Leu	missense variant	-	NC_000011.10:g.65113549C>G	ExAC,TOPMed,gnomAD
rs371986771	p.Phe188Leu	missense variant	-	NC_000011.10:g.65113555C>G	ESP,TOPMed
rs751397747	p.Lys189Glu	missense variant	-	NC_000011.10:g.65113556A>G	ExAC,gnomAD
rs757168980	p.Lys189Thr	missense variant	-	NC_000011.10:g.65113557A>C	ExAC,gnomAD
rs1179028204	p.Phe191Leu	missense variant	-	NC_000011.10:g.65113562T>C	gnomAD
rs1353524397	p.Phe191Leu	missense variant	-	NC_000011.10:g.65113564C>A	TOPMed
rs781253513	p.Cys192Ser	missense variant	-	NC_000011.10:g.65113565T>A	ExAC,TOPMed,gnomAD
rs781253513	p.Cys192Arg	missense variant	-	NC_000011.10:g.65113565T>C	ExAC,TOPMed,gnomAD
rs1026908692	p.Arg195Ter	stop gained	-	NC_000011.10:g.65113574C>T	TOPMed
rs749899970	p.Gly197Ser	missense variant	-	NC_000011.10:g.65113580G>A	ExAC,gnomAD
rs755657150	p.Leu198Ile	missense variant	-	NC_000011.10:g.65113583C>A	ExAC,gnomAD
rs755657150	p.Leu198Phe	missense variant	-	NC_000011.10:g.65113583C>T	ExAC,gnomAD
rs1392904159	p.Leu198Pro	missense variant	-	NC_000011.10:g.65113584T>C	gnomAD
rs779512414	p.Ile199Phe	missense variant	-	NC_000011.10:g.65113586A>T	ExAC,gnomAD
rs1408778642	p.Gly200Asp	missense variant	-	NC_000011.10:g.65113590G>A	gnomAD
rs377167308	p.Gly200Ser	missense variant	-	NC_000011.10:g.65113589G>A	ExAC,gnomAD
NCI-TCGA novel	p.Gly200Val	missense variant	-	NC_000011.10:g.65113590G>T	NCI-TCGA
COSM76743	p.Gly200Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65113589G>C	NCI-TCGA Cosmic
rs1191421411	p.Leu206Gln	missense variant	-	NC_000011.10:g.65114726T>A	TOPMed
rs778766450	p.Leu209Ser	missense variant	-	NC_000011.10:g.65114735T>C	ExAC,TOPMed,gnomAD
rs748516890	p.Met210Leu	missense variant	-	NC_000011.10:g.65114737A>C	ExAC,gnomAD
rs1192923440	p.Met210Thr	missense variant	-	NC_000011.10:g.65114738T>C	gnomAD
NCI-TCGA novel	p.Met210Ile	missense variant	-	NC_000011.10:g.65114739G>A	NCI-TCGA
COSM4817748	p.Met210Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65114739G>C	NCI-TCGA Cosmic
rs71468691	p.Glu212Lys	missense variant	-	NC_000011.10:g.65114743G>A	gnomAD
rs1476505341	p.Ala213Thr	missense variant	-	NC_000011.10:g.65114746G>A	gnomAD
rs1239886182	p.Glu214Lys	missense variant	-	NC_000011.10:g.65114749G>A	TOPMed
rs772488065	p.Arg216Ter	stop gained	-	NC_000011.10:g.65114755C>T	ExAC,TOPMed,gnomAD
rs183249527	p.Arg216Gln	missense variant	-	NC_000011.10:g.65114756G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly217Asp	missense variant	-	NC_000011.10:g.65114759G>A	NCI-TCGA
rs1287359290	p.Pro219Leu	missense variant	-	NC_000011.10:g.65114765C>T	TOPMed
rs201108253	p.Ser220Leu	missense variant	-	NC_000011.10:g.65114768C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs776671000	p.Met223Thr	missense variant	-	NC_000011.10:g.65114777T>C	ExAC,TOPMed,gnomAD
rs1383094677	p.Met223Leu	missense variant	-	NC_000011.10:g.65114776A>T	gnomAD
rs374920822	p.Trp224Ter	stop gained	-	NC_000011.10:g.65114781G>A	ESP,ExAC,TOPMed,gnomAD
rs759674435	p.Trp224Ser	missense variant	-	NC_000011.10:g.65114780G>C	ExAC,gnomAD
rs775696515	p.Val226Gly	missense variant	-	NC_000011.10:g.65114786T>G	ExAC,gnomAD
rs775696515	p.Val226Ala	missense variant	-	NC_000011.10:g.65114786T>C	ExAC,gnomAD
rs761460155	p.Asn227Ser	missense variant	-	NC_000011.10:g.65114789A>G	ExAC,gnomAD
rs1333456934	p.Leu231Ser	missense variant	-	NC_000011.10:g.65114801T>C	gnomAD
COSM1355886	p.Leu232Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65114803C>T	NCI-TCGA Cosmic
rs867555087	p.Tyr233His	missense variant	-	NC_000011.10:g.65114806T>C	gnomAD
NCI-TCGA novel	p.Tyr233Asn	missense variant	-	NC_000011.10:g.65114806T>A	NCI-TCGA
rs1262050128	p.Asp236Val	missense variant	-	NC_000011.10:g.65114816A>T	gnomAD
rs1204902286	p.Ala237Asp	missense variant	-	NC_000011.10:g.65114819C>A	gnomAD
rs1348179563	p.Ala237Thr	missense variant	-	NC_000011.10:g.65114818G>A	TOPMed,gnomAD
rs1258714589	p.Leu238Phe	missense variant	-	NC_000011.10:g.65114821C>T	gnomAD
rs1258714589	p.Leu238Val	missense variant	-	NC_000011.10:g.65114821C>G	gnomAD
rs772980923	p.His240Tyr	missense variant	-	NC_000011.10:g.65114827C>T	ExAC,gnomAD
rs148878643	p.Val244Ile	missense variant	-	NC_000011.10:g.65114919G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs766413625	p.Thr247Ile	missense variant	-	NC_000011.10:g.65114929C>T	ExAC,gnomAD
rs1292710984	p.Thr247Ala	missense variant	-	NC_000011.10:g.65114928A>G	TOPMed
rs776714853	p.Met248Thr	missense variant	-	NC_000011.10:g.65114932T>C	ExAC,TOPMed,gnomAD
rs200355387	p.Asp249Tyr	missense variant	-	NC_000011.10:g.65114934G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs758049533	p.His252Tyr	missense variant	-	NC_000011.10:g.65114943C>T	ExAC
NCI-TCGA novel	p.Asp253GlyPheSerTerUnkUnk	frameshift	-	NC_000011.10:g.65114945_65114964TGACGGGTTTGGCTTCATGC>-	NCI-TCGA
rs763712793	p.Asp253Glu	missense variant	-	NC_000011.10:g.65114948C>A	ExAC,gnomAD
rs143577587	p.Gly254Trp	missense variant	-	NC_000011.10:g.65114949G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs143577587	p.Gly254Arg	missense variant	-	NC_000011.10:g.65114949G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs902293592	p.Phe255Leu	missense variant	-	NC_000011.10:g.65114952T>C	TOPMed,gnomAD
rs551357064	p.Ala260Val	missense variant	-	NC_000011.10:g.65114968C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs895322845	p.Met264Ile	missense variant	-	NC_000011.10:g.65114981G>A	TOPMed,gnomAD
rs749373964	p.Trp266Gly	missense variant	-	NC_000011.10:g.65114985T>G	ExAC,TOPMed
rs768906444	p.Trp266Ter	stop gained	-	NC_000011.10:g.65114987G>A	ExAC,gnomAD
rs774501532	p.Val267Met	missense variant	-	NC_000011.10:g.65114988G>A	ExAC,gnomAD
rs375674215	p.Tyr271Cys	missense variant	-	NC_000011.10:g.65115001A>G	ESP,ExAC,TOPMed,gnomAD
rs1452881698	p.Tyr271Ter	stop gained	-	NC_000011.10:g.65115002C>G	gnomAD
rs1013053449	p.Ser272Thr	missense variant	-	NC_000011.10:g.65115004G>C	TOPMed,gnomAD
rs770862173	p.Leu273Val	missense variant	-	NC_000011.10:g.65115006C>G	ExAC,gnomAD
NCI-TCGA novel	p.Ala275Val	missense variant	-	NC_000011.10:g.65115013C>T	NCI-TCGA
rs776660302	p.Gln276His	missense variant	-	NC_000011.10:g.65115017G>T	ExAC,gnomAD
rs1428922520	p.Gln276Pro	missense variant	-	NC_000011.10:g.65115016A>C	gnomAD
rs187240326	p.Pro282Leu	missense variant	-	NC_000011.10:g.65115034C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs762439033	p.Pro284His	missense variant	-	NC_000011.10:g.65115040C>A	ExAC
rs775054516	p.Pro284Thr	missense variant	-	NC_000011.10:g.65115039C>A	ExAC,TOPMed,gnomAD
rs763739423	p.Gly286Arg	missense variant	-	NC_000011.10:g.65115045G>A	ExAC,TOPMed,gnomAD
rs751188189	p.Gly286Glu	missense variant	-	NC_000011.10:g.65115046G>A	ExAC,gnomAD
rs762121544	p.Met289Thr	missense variant	-	NC_000011.10:g.65115055T>C	ExAC,gnomAD
rs1233977520	p.Met289Val	missense variant	-	NC_000011.10:g.65115054A>G	TOPMed,gnomAD
COSM6069890	p.Ser291Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65115061C>T	NCI-TCGA Cosmic
rs1213249801	p.Ile293Thr	missense variant	-	NC_000011.10:g.65115067T>C	gnomAD
NCI-TCGA novel	p.Leu295His	missense variant	-	NC_000011.10:g.65115073T>A	NCI-TCGA
NCI-TCGA novel	p.Ile296Val	missense variant	-	NC_000011.10:g.65115075A>G	NCI-TCGA
rs368684139	p.Asn297Ser	missense variant	-	NC_000011.10:g.65115079A>G	ESP,ExAC,TOPMed,gnomAD
rs768077110	p.Ala298Asp	missense variant	-	NC_000011.10:g.65115314C>A	ExAC,TOPMed,gnomAD
rs768077110	p.Ala298Gly	missense variant	-	NC_000011.10:g.65115314C>G	ExAC,TOPMed,gnomAD
rs1129195	p.Thr299Ile	missense variant	-	NC_000011.10:g.65115317C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1129195	p.Thr299Ile	missense variant	-	NC_000011.10:g.65115317C>T	UniProt,dbSNP
VAR_012716	p.Thr299Ile	missense variant	-	NC_000011.10:g.65115317C>T	UniProt
rs761419824	p.Tyr301Ter	stop gained	-	NC_000011.10:g.65115324C>A	ExAC,gnomAD
rs767202148	p.Tyr302Cys	missense variant	-	NC_000011.10:g.65115326A>G	ExAC,TOPMed,gnomAD
rs767202148	p.Tyr302Ser	missense variant	-	NC_000011.10:g.65115326A>C	ExAC,TOPMed,gnomAD
rs1354129124	p.Ile303Val	missense variant	-	NC_000011.10:g.65115328A>G	gnomAD
rs948814150	p.Phe304Leu	missense variant	-	NC_000011.10:g.65115333C>A	gnomAD
rs377189788	p.Arg305Cys	missense variant	-	NC_000011.10:g.65115334C>T	ESP,TOPMed,gnomAD
rs369865834	p.Arg305His	missense variant	-	NC_000011.10:g.65115335G>A	ESP,ExAC,TOPMed,gnomAD
COSM6134061	p.Arg305Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65115335G>T	NCI-TCGA Cosmic
rs377189788	p.Arg305Gly	missense variant	-	NC_000011.10:g.65115334C>G	ESP,TOPMed,gnomAD
rs190564223	p.Gly306Glu	missense variant	-	NC_000011.10:g.65115338G>A	1000Genomes,ExAC,gnomAD
rs1014972652	p.Ala307Val	missense variant	-	NC_000011.10:g.65115341C>T	TOPMed,gnomAD
rs573857198	p.Ala307Ser	missense variant	-	NC_000011.10:g.65115340G>T	TOPMed,gnomAD
rs752875093	p.Asn308Lys	missense variant	-	NC_000011.10:g.65115345T>A	ExAC,gnomAD
rs758681533	p.Lys311Glu	missense variant	-	NC_000011.10:g.65115352A>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn312His	missense variant	-	NC_000011.10:g.65115355A>C	NCI-TCGA
rs376738474	p.Thr313Ile	missense variant	-	NC_000011.10:g.65115359C>T	ESP,ExAC,TOPMed,gnomAD
rs778210498	p.Thr313Ser	missense variant	-	NC_000011.10:g.65115358A>T	ExAC,gnomAD
NCI-TCGA novel	p.Phe314SerPheSerTerUnkUnkUnk	frameshift	-	NC_000011.10:g.65115360T>-	NCI-TCGA
rs201258810	p.Arg315Pro	missense variant	-	NC_000011.10:g.65115365G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs769493365	p.Arg315Ter	stop gained	-	NC_000011.10:g.65115364C>T	ExAC,TOPMed,gnomAD
rs201258810	p.Arg315Gln	missense variant	-	NC_000011.10:g.65115365G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs773709021	p.Asn317Lys	missense variant	-	NC_000011.10:g.65115372T>A	ExAC,TOPMed,gnomAD
rs546134704	p.Pro318Leu	missense variant	-	NC_000011.10:g.65115374C>T	gnomAD
rs1263894495	p.Pro318Ser	missense variant	-	NC_000011.10:g.65115373C>T	TOPMed,gnomAD
rs747710223	p.Pro321Ser	missense variant	-	NC_000011.10:g.65115382C>T	ExAC,TOPMed,gnomAD
rs771706431	p.Arg322Ile	missense variant	-	NC_000011.10:g.65115386G>T	ExAC,gnomAD
rs772852483	p.Val323Leu	missense variant	-	NC_000011.10:g.65115388G>C	ExAC,gnomAD
rs372729147	p.Val323Gly	missense variant	-	NC_000011.10:g.65115389T>G	ESP
rs760970320	p.Ala324Thr	missense variant	-	NC_000011.10:g.65115391G>A	ExAC,gnomAD
rs760970320	p.Ala324Ser	missense variant	-	NC_000011.10:g.65115391G>T	ExAC,gnomAD
rs1282929940	p.Glu327Ala	missense variant	-	NC_000011.10:g.65115482A>C	TOPMed
rs371080784	p.Glu327Lys	missense variant	-	NC_000011.10:g.65115481G>A	ESP,TOPMed,gnomAD
rs371080784	p.Glu327Gln	missense variant	-	NC_000011.10:g.65115481G>C	ESP,TOPMed,gnomAD
rs1468623549	p.Ile329Leu	missense variant	-	NC_000011.10:g.65115487A>C	gnomAD
rs770656879	p.Thr331Lys	missense variant	-	NC_000011.10:g.65115494C>A	ExAC,TOPMed,gnomAD
rs770656879	p.Thr331Ile	missense variant	-	NC_000011.10:g.65115494C>T	ExAC,TOPMed,gnomAD
rs375652399	p.Thr331Ala	missense variant	-	NC_000011.10:g.65115493A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM930328	p.Ala332Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65115497C>T	NCI-TCGA Cosmic
rs368243602	p.Thr333Ala	missense variant	-	NC_000011.10:g.65115499A>G	ESP,ExAC,TOPMed,gnomAD
rs760012550	p.Thr333Lys	missense variant	-	NC_000011.10:g.65115500C>A	ExAC,gnomAD
rs1332211373	p.Gly334Arg	missense variant	-	NC_000011.10:g.65115502G>C	TOPMed
rs1332211373	p.Gly334Arg	missense variant	-	NC_000011.10:g.65115502G>A	TOPMed
rs551444950	p.Arg335Gln	missense variant	-	NC_000011.10:g.65115506G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs553025048	p.Arg335Trp	missense variant	-	NC_000011.10:g.65115505C>T	ExAC,gnomAD
rs1463110740	p.Leu338Met	missense variant	-	NC_000011.10:g.65115514C>A	gnomAD
rs1162973077	p.Val339Met	missense variant	-	NC_000011.10:g.65115517G>A	gnomAD
rs751733062	p.Val339Ala	missense variant	-	NC_000011.10:g.65115518T>C	ExAC
rs1162973077	p.Val339Leu	missense variant	-	NC_000011.10:g.65115517G>C	gnomAD
rs201690600	p.Trp342Cys	missense variant	-	NC_000011.10:g.65115528G>C	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Trp343Ter	stop gained	-	NC_000011.10:g.65115530G>A	NCI-TCGA
rs1433597004	p.Gly344Ala	missense variant	-	NC_000011.10:g.65115533G>C	gnomAD
NCI-TCGA novel	p.Gly344Ser	missense variant	-	NC_000011.10:g.65115532G>A	NCI-TCGA
rs753567126	p.Gly344Arg	missense variant	-	NC_000011.10:g.65115532G>C	ExAC,TOPMed,gnomAD
rs778761215	p.Met345Thr	missense variant	-	NC_000011.10:g.65115536T>C	ExAC,gnomAD
rs748104845	p.Arg347Cys	missense variant	-	NC_000011.10:g.65115541C>T	ExAC,TOPMed,gnomAD
rs375149084	p.Arg347His	missense variant	-	NC_000011.10:g.65115542G>A	ESP,ExAC,TOPMed,gnomAD
rs1212177148	p.Tyr351His	missense variant	-	NC_000011.10:g.65115553T>C	TOPMed
rs547388685	p.Leu352Pro	missense variant	-	NC_000011.10:g.65115557T>C	1000Genomes,ExAC,gnomAD
rs547388685	p.Leu352Arg	missense variant	-	NC_000011.10:g.65115557T>G	1000Genomes,ExAC,gnomAD
rs780903663	p.Ile356Met	missense variant	-	NC_000011.10:g.65115570C>G	ExAC
rs1309042768	p.Ile356Leu	missense variant	-	NC_000011.10:g.65115568A>C	TOPMed
COSM4035334	p.Met357Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65115571A>G	NCI-TCGA Cosmic
rs1487527822	p.Ala358Val	missense variant	-	NC_000011.10:g.65115575C>T	gnomAD
rs1193528015	p.Leu359Pro	missense variant	-	NC_000011.10:g.65115578T>C	gnomAD
rs1258837917	p.Ala360Thr	missense variant	-	NC_000011.10:g.65115580G>A	gnomAD
rs1050479929	p.Ser362Phe	missense variant	-	NC_000011.10:g.65115587C>T	TOPMed
rs1476195842	p.Leu363Phe	missense variant	-	NC_000011.10:g.65115591G>C	gnomAD
rs1238427509	p.Pro364Ser	missense variant	-	NC_000011.10:g.65115592C>T	TOPMed
rs1185975858	p.Pro364Leu	missense variant	-	NC_000011.10:g.65115593C>T	gnomAD
rs1012043850	p.Gly366Glu	missense variant	-	NC_000011.10:g.65115893G>A	TOPMed
rs376487559	p.Gly366Arg	missense variant	-	NC_000011.10:g.65115598G>A	ESP,ExAC,TOPMed,gnomAD
rs375239318	p.Val367Met	missense variant	-	NC_000011.10:g.65115895G>A	ESP,ExAC,TOPMed,gnomAD
rs1332867882	p.Val367Ala	missense variant	-	NC_000011.10:g.65115896T>C	TOPMed
rs1348733481	p.His369Tyr	missense variant	-	NC_000011.10:g.65115901C>T	TOPMed
rs544507657	p.His369Gln	missense variant	-	NC_000011.10:g.65115903C>G	ExAC,TOPMed,gnomAD
rs755351709	p.Pro372Ser	missense variant	-	NC_000011.10:g.65115910C>T	ExAC,TOPMed,gnomAD
rs1195700444	p.Tyr373Cys	missense variant	-	NC_000011.10:g.65115914A>G	gnomAD
rs369161377	p.Leu376Phe	missense variant	-	NC_000011.10:g.65115922C>T	ESP,ExAC,TOPMed,gnomAD
rs1477176662	p.Leu377Phe	missense variant	-	NC_000011.10:g.65115925C>T	TOPMed,gnomAD
rs1403283215	p.Phe379Leu	missense variant	-	NC_000011.10:g.65115931T>C	TOPMed,gnomAD
rs1164487879	p.Thr380Ala	missense variant	-	NC_000011.10:g.65115934A>G	gnomAD
COSM5510517	p.Ala381Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65115937G>A	NCI-TCGA Cosmic
rs778148061	p.Ala381Val	missense variant	-	NC_000011.10:g.65115938C>T	ExAC,TOPMed,gnomAD
rs747033645	p.Leu383Pro	missense variant	-	NC_000011.10:g.65115944T>C	ExAC,gnomAD
rs771022046	p.Val384Met	missense variant	-	NC_000011.10:g.65115946G>A	ExAC,TOPMed,gnomAD
rs776795728	p.His385Tyr	missense variant	-	NC_000011.10:g.65115949C>T	ExAC,TOPMed,gnomAD
rs1375513345	p.His385Gln	missense variant	-	NC_000011.10:g.65115951C>A	gnomAD
rs769961279	p.Arg386His	missense variant	-	NC_000011.10:g.65115953G>A	ExAC,TOPMed,gnomAD
rs746060735	p.Arg386Cys	missense variant	-	NC_000011.10:g.65115952C>T	ExAC
rs769961279	p.Arg386Pro	missense variant	-	NC_000011.10:g.65115953G>C	ExAC,TOPMed,gnomAD
rs574235274	p.Arg389Gln	missense variant	-	NC_000011.10:g.65115962G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs200277720	p.Asp390Gly	missense variant	-	NC_000011.10:g.65115965A>G	ESP,ExAC,TOPMed,gnomAD
COSM415453	p.Glu391Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65115967G>C	NCI-TCGA Cosmic
rs760211079	p.Arg392Trp	missense variant	-	NC_000011.10:g.65115970C>T	ExAC,gnomAD
rs1244010289	p.Gln393Glu	missense variant	-	NC_000011.10:g.65115973C>G	gnomAD
rs753436919	p.Cys394Ser	missense variant	-	NC_000011.10:g.65115977G>C	ExAC,TOPMed,gnomAD
rs764855560	p.Lys397Arg	missense variant	-	NC_000011.10:g.65115986A>G	ExAC,gnomAD
rs1263401967	p.Lys397Ter	stop gained	-	NC_000011.10:g.65115985A>T	gnomAD
rs183160005	p.Tyr398Ter	stop gained	-	NC_000011.10:g.65115990C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs778294179	p.Gly399Ser	missense variant	-	NC_000011.10:g.65115991G>A	ExAC,gnomAD
rs1360415182	p.Gly399Ala	missense variant	-	NC_000011.10:g.65115992G>C	gnomAD
rs1357462189	p.Ala401Val	missense variant	-	NC_000011.10:g.65115998C>T	gnomAD
NCI-TCGA novel	p.Ala401Thr	missense variant	-	NC_000011.10:g.65115997G>A	NCI-TCGA
rs757798946	p.Trp402Ter	stop gained	-	NC_000011.10:g.65116001G>A	ExAC,gnomAD
rs781223700	p.Gln403Ter	stop gained	-	NC_000011.10:g.65116003C>T	ExAC
COSM3986347	p.Gln403Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65116004A>G	NCI-TCGA Cosmic
rs373299244	p.Tyr405His	missense variant	-	NC_000011.10:g.65116009T>C	ESP,ExAC,TOPMed,gnomAD
rs1242045787	p.Cys406Ter	stop gained	-	NC_000011.10:g.65116014C>A	TOPMed,gnomAD
rs780139717	p.Arg407Gln	missense variant	-	NC_000011.10:g.65116016G>A	ExAC,gnomAD
rs770048261	p.Arg407Trp	missense variant	-	NC_000011.10:g.65116015C>T	ExAC,gnomAD
rs1280686488	p.Arg408Cys	missense variant	-	NC_000011.10:g.65116018C>T	gnomAD
rs377534768	p.Arg408His	missense variant	-	NC_000011.10:g.65116019G>A	ESP,TOPMed,gnomAD
COSM544564	p.Arg408Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000011.10:g.65116019G>C	NCI-TCGA Cosmic
rs771788944	p.Pro410Ser	missense variant	-	NC_000011.10:g.65116024C>T	ExAC,gnomAD
rs370698238	p.Arg412His	missense variant	-	NC_000011.10:g.65116031G>A	ESP,TOPMed,gnomAD
rs1458848167	p.Arg412Cys	missense variant	-	NC_000011.10:g.65116030C>T	gnomAD
rs1023683629	p.Met414Val	missense variant	-	NC_000011.10:g.65116036A>G	TOPMed,gnomAD
rs746855481	p.Met414Thr	missense variant	-	NC_000011.10:g.65116037T>C	ExAC,TOPMed,gnomAD
rs1174760585	p.Pro415Ser	missense variant	-	NC_000011.10:g.65116039C>T	gnomAD
rs975032673	p.Pro415Leu	missense variant	-	NC_000011.10:g.65116040C>T	gnomAD
rs1171305566	p.Tyr416Cys	missense variant	-	NC_000011.10:g.65116043A>G	TOPMed,gnomAD
rs1444901035	p.Ile417Thr	missense variant	-	NC_000011.10:g.65116046T>C	gnomAD
rs1330956370	p.Tyr418His	missense variant	-	NC_000011.10:g.65116048T>C	gnomAD
rs375604515	p.Ter419Ser	stop lost	-	NC_000011.10:g.65116052G>C	ESP,ExAC,TOPMed,gnomAD
rs368355832	p.Ter419Cys	stop lost	-	NC_000011.10:g.65116053A>C	ESP,ExAC,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0002940	Aneurysm	phenotype	BEFREE
C0003850	Arteriosclerosis	disease	BEFREE
C0003864	Arthritis	disease	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0004114	Astrocytoma	disease	BEFREE
C0004135	Ataxia Telangiectasia	disease	BEFREE
C0004153	Atherosclerosis	disease	BEFREE
C0006118	Brain Neoplasms	group	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0007102	Malignant tumor of colon	disease	BEFREE
C0007131	Non-Small Cell Lung Carcinoma	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE
C0007222	Cardiovascular Diseases	group	BEFREE
C0007766	Intracranial Aneurysm	disease	BEFREE
C0007785	Cerebral Infarction	disease	BEFREE
C0008354	Cholera	disease	BEFREE
C0008479	Chondrosarcoma	disease	BEFREE
C0011847	Diabetes	disease	BEFREE
C0011849	Diabetes Mellitus	group	BEFREE
C0011854	Diabetes Mellitus, Insulin-Dependent	disease	BEFREE
C0011884	Diabetic Retinopathy	disease	BEFREE
C0013264	Muscular Dystrophy, Duchenne	disease	BEFREE
C0015695	Fatty Liver	disease	BEFREE
C0017636	Glioblastoma	disease	BEFREE
C0018801	Heart failure	disease	BEFREE
C0018802	Congestive heart failure	disease	BEFREE
C0019196	Hepatitis C	disease	BEFREE
C0020538	Hypertensive disease	group	BEFREE
C0021294	Infant, Premature	phenotype	BEFREE
C0022658	Kidney Diseases	group	BEFREE
C0023890	Liver Cirrhosis	disease	BEFREE
C0023895	Liver diseases	group	BEFREE
C0023903	Liver neoplasms	group	BEFREE
C0024121	Lung Neoplasms	group	BEFREE
C0024232	Lymphatic Metastasis	disease	BEFREE
C0024530	Malaria	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025048	Meconium Aspiration Syndrome	phenotype	BEFREE
C0025517	Metabolic Diseases	group	BEFREE
C0027051	Myocardial Infarction	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027697	Nephritis	disease	BEFREE
C0027707	Nephritis, Interstitial	disease	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0030354	Papilloma	disease	BEFREE
C0035309	Retinal Diseases	group	BEFREE
C0036690	Septicemia	disease	BEFREE
C0038525	Subarachnoid Hemorrhage	disease	BEFREE
C0041349	Nephritis, Tubulointerstitial	disease	BEFREE
C0042164	Uveitis	disease	BEFREE
C0042373	Vascular Diseases	group	BEFREE
C0079774	Peripheral T-Cell Lymphoma	disease	BEFREE
C0153690	Secondary malignant neoplasm of bone	disease	BEFREE
C0155626	Acute myocardial infarction	disease	BEFREE
C0235833	Congenital diaphragmatic hernia	disease	BEFREE
C0235974	Pancreatic carcinoma	disease	BEFREE
C0239946	Fibrosis, Liver	disease	BEFREE
C0242292	McCune-Albright Syndrome	disease	BEFREE
C0242350	Erectile dysfunction	disease	BEFREE
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0242723	Parasitemia	disease	BEFREE
C0243026	Sepsis	disease	BEFREE
C0264694	Chronic myocardial ischemia	disease	BEFREE
C0339543	Epiretinal Membrane	phenotype	BEFREE
C0346153	Breast Cancer, Familial	disease	BEFREE
C0346647	Malignant neoplasm of pancreas	disease	BEFREE
C0349782	Ischemic cardiomyopathy	disease	BEFREE
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0524620	Metabolic Syndrome X	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0684249	Carcinoma of lung	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0700636	Focal nodular hyperplasia of liver	disease	BEFREE
C0740391	Middle Cerebral Artery Occlusion	phenotype	BEFREE
C0812413	Malignant Pleural Mesothelioma	disease	BEFREE
C0850803	Anaphylaxis (non medication)	disease	BEFREE
C0917798	Cerebral Ischemia	disease	BEFREE
C0948380	Colorectal cancer metastatic	disease	BEFREE
C1096155	Macrophage Activation Syndrome	disease	BEFREE
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1145628	Autonomic nervous system disorders	group	BEFREE
C1261473	Sarcoma	group	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1314694	Astrocytoma, low grade	disease	BEFREE
C1449563	Cardiomyopathy, Familial Idiopathic	disease	BEFREE
C1458155	Mammary Neoplasms	group	BEFREE
C1519346	Skin Carcinogenesis	disease	BEFREE
C1519670	Tumor Angiogenesis	phenotype	BEFREE
C1621958	Glioblastoma Multiforme	disease	BEFREE
C1623038	Cirrhosis	disease	BEFREE
C1658953	tumor vasculature	phenotype	BEFREE
C1861821	CATARACT, MARNER TYPE	disease	BEFREE
C2239176	Liver carcinoma	disease	BEFREE
C2711227	Steatohepatitis	disease	BEFREE
C2919945	Cavernous Hemangioma of Brain	phenotype	BEFREE
C3203102	Idiopathic pulmonary arterial hypertension	disease	BEFREE
C3714948	PACHYONYCHIA CONGENITA 3	disease	BEFREE
C3887486	Interstitial lung fibrosis	phenotype	BEFREE
C3888198	BESTROPHINOPATHY, AUTOSOMAL RECESSIVE	disease	BEFREE
C4020969	Inflammatory abnormality of the eye	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0016627	oxidoreductase activity, acting on the CH-CH group of donors	IBA
GO:0050613	delta14-sterol reductase activity	IDA
GO:0050613	delta14-sterol reductase activity	TAS
GO:0050661	NADP binding	ISS

GO:Biological Process

GO ID	GO Term	Evidence
GO:0006695	cholesterol biosynthetic process	IEA
GO:0006695	cholesterol biosynthetic process	IDA
GO:0006695	cholesterol biosynthetic process	TAS
GO:0016126	sterol biosynthetic process	IBA
GO:0045540	regulation of cholesterol biosynthetic process	TAS
GO:0055114	oxidation-reduction process	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005637	nuclear inner membrane	IBA
GO:0005783	endoplasmic reticulum	IDA
GO:0005789	endoplasmic reticulum membrane	TAS
GO:0005887	integral component of plasma membrane	TAS
GO:0030176	integral component of endoplasmic reticulum membrane	IBA
GO:0043231	intracellular membrane-bounded organelle	IDA
GO:0043235	receptor complex	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1430728	Metabolism	TAS
R-HSA-1655829	Regulation of cholesterol biosynthesis by SREBP (SREBF)	TAS
R-HSA-191273	Cholesterol biosynthesis	TAS
R-HSA-2426168	Activation of gene expression by SREBF (SREBP)	TAS
R-HSA-556833	Metabolism of lipids	TAS
R-HSA-8957322	Metabolism of steroids	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
C028474	1,4-bis(2-(3,5-dichloropyridyloxy))benzene	1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of TM7SF2 mRNA	21354444
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in increased expression of TM7SF2 mRNA	28628672
D015058	1-Naphthylisothiocyanate	1-Naphthylisothiocyanate results in increased expression of TM7SF2 mRNA	30723492
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in decreased expression of TM7SF2 mRNA	25614096
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased expression of TM7SF2 mRNA	20056577
C016403	2,4-dinitrotoluene	2,4-dinitrotoluene affects the expression of TM7SF2 mRNA	21346803
C023514	2,6-dinitrotoluene	2,6-dinitrotoluene affects the expression of TM7SF2 mRNA	21346803
C585004	2-monochloropropanediol	2-monochloropropanediol results in decreased expression of TM7SF2 mRNA	28522335
C023035	3,4,5,3',4'-pentachlorobiphenyl	3,4,5,3',4'-pentachlorobiphenyl results in increased expression of TM7SF2 mRNA	23196670
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of TM7SF2 mRNA	27188386
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in increased expression of TM7SF2 mRNA	19150397
D000082	Acetaminophen	Acetaminophen results in decreased expression of TM7SF2 mRNA	29067470
D000082	Acetaminophen	Acetaminophen affects the expression of TM7SF2 mRNA	17562736
D000082	Acetaminophen	Acetaminophen results in decreased expression of TM7SF2 mRNA	30723492
D020106	Acrylamide	Acrylamide results in decreased expression of TM7SF2 mRNA	28959563
D016604	Aflatoxin B1	Aflatoxin B1 affects the expression of TM7SF2 protein	20106945
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased expression of TM7SF2 mRNA	27153756
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased expression of TM7SF2 mRNA	19770486
C000593263	afuresertib	afuresertib results in increased expression of TM7SF2 mRNA	28960945
D001507	Beclomethasone	Beclomethasone results in increased expression of TM7SF2 mRNA	23656298
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of TM7SF2 mRNA	21964900
C022921	benzo(k)fluoranthene	benzo(k)fluoranthene results in decreased expression of TM7SF2 mRNA	26377693
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of TM7SF2 mRNA	27685785
C543008	bis(4-hydroxyphenyl)sulfone	[bis(4-hydroxyphenyl)sulfone co-treated with Tretinoin] results in decreased expression of TM7SF2 mRNA	30951980
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in decreased expression of TM7SF2 mRNA	30951980
C006780	bisphenol A	bisphenol A affects the expression of TM7SF2 mRNA	21786754
C006780	bisphenol A	bisphenol A results in increased expression of TM7SF2 mRNA	30248606
C006780	bisphenol A	bisphenol A affects the expression of TM7SF2 mRNA	30903817
C006780	bisphenol A	bisphenol A results in increased expression of TM7SF2 mRNA	29275510
C006780	bisphenol A	bisphenol A results in decreased expression of TM7SF2 mRNA	25181051; 30816183;
C018475	butyraldehyde	butyraldehyde results in increased expression of TM7SF2 mRNA	26079696
D002211	Capsaicin	Capsaicin results in decreased expression of TM7SF2 mRNA	18533110
D002251	Carbon Tetrachloride	Carbon Tetrachloride affects the expression of TM7SF2 mRNA	17484886
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of TM7SF2 mRNA	27339419
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of TM7SF2 mRNA	31150632
D002738	Chloroquine	Chloroquine results in decreased expression of TM7SF2 mRNA	19393257
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in increased expression of TM7SF2 mRNA	27392435
D002945	Cisplatin	Cisplatin results in increased expression of TM7SF2 mRNA	27392435
C018021	cobaltous chloride	cobaltous chloride results in decreased expression of TM7SF2 mRNA	24386269
D019327	Copper Sulfate	Copper Sulfate results in decreased expression of TM7SF2 mRNA	19549813
D003471	Cuprizone	Cuprizone results in decreased expression of TM7SF2 mRNA	27523638
D016572	Cyclosporine	Cyclosporine results in decreased expression of TM7SF2 mRNA	20106945; 21632981; 25562108;
C093628	cyproconazole	cyproconazole affects the expression of TM7SF2 mRNA	22045034
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in increased expression of TM7SF2 mRNA	28628672
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in decreased expression of TM7SF2 mRNA	21266533
D004041	Dietary Fats	Dietary Fats affects the expression of TM7SF2 mRNA	19680557
D004041	Dietary Fats	Dietary Fats results in decreased expression of TM7SF2 mRNA	22609946; 30120929;
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of TM7SF2 mRNA	28943392
D004052	Diethylnitrosamine	Diethylnitrosamine results in decreased expression of TM7SF2 mRNA	19638242
D013196	Dihydrotestosterone	Dihydrotestosterone results in increased expression of TM7SF2 mRNA	29458080
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of TM7SF2 mRNA	27188386
D013759	Dronabinol	Dronabinol results in increased expression of TM7SF2 mRNA	16616335
D004726	Endosulfan	Endosulfan affects the expression of TM7SF2 mRNA	29391264
D004958	Estradiol	[Estradiol co-treated with TGFB1 protein] results in decreased expression of TM7SF2 mRNA	30165855
D000431	Ethanol	Ethanol results in increased expression of TM7SF2 mRNA	29361514
C024565	ethylene dichloride	ethylene dichloride results in decreased expression of TM7SF2 mRNA	28189721
C545733	fatostatin	fatostatin results in decreased expression of TM7SF2 mRNA	19716478
D005228	Fatty Acids, Essential	Fatty Acids, Essential deficiency results in increased expression of TM7SF2 mRNA	23333450
C061365	flusilazole	flusilazole results in decreased expression of TM7SF2 mRNA	22382673
C061365	flusilazole	flusilazole results in increased expression of TM7SF2 mRNA	22382673
C061365	flusilazole	flusilazole affects the expression of TM7SF2 mRNA	22634333
C056933	fumonisin B1	[NR1H2 protein affects the susceptibility to fumonisin B1] which affects the expression of TM7SF2 mRNA	30448865
C056933	fumonisin B1	[NR1H3 protein affects the susceptibility to fumonisin B1] which affects the expression of TM7SF2 mRNA	30448865
C000593030	GSK-J4	GSK-J4 results in decreased expression of TM7SF2 mRNA	29301935
C409722	hexaconazole	hexaconazole affects the expression of TM7SF2 mRNA	22045034
D006861	Hydrogen Peroxide	Hydrogen Peroxide affects the expression of TM7SF2 mRNA	20044591
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in increased expression of TM7SF2 mRNA	28628672
D007529	Isoflavones	Isoflavones affects the expression of TM7SF2 mRNA	16365062
D015474	Isotretinoin	Isotretinoin results in decreased expression of TM7SF2 mRNA	20436886
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in increased expression of TM7SF2 mRNA	27392435
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in increased expression of TM7SF2 mRNA	22904298; 23430699; 24796395; 26752646; 26911376;
C410337	K 7174	K 7174 results in decreased expression of TM7SF2 mRNA	24086573
D008701	Methapyrilene	Methapyrilene results in increased expression of TM7SF2 mRNA	30467583
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of TM7SF2 mRNA	23103053
D008741	Methyl Methanesulfonate	Methyl Methanesulfonate results in decreased expression of TM7SF2 mRNA	26011545
C016599	mono-(2-ethylhexyl)phthalate	mono-(2-ethylhexyl)phthalate results in decreased expression of TM7SF2 mRNA	22401849
D009151	Mustard Gas	Mustard Gas results in increased expression of TM7SF2 mRNA	25102026
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of TM7SF2 mRNA	24389112
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in decreased expression of TM7SF2 mRNA	25620056
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in increased expression of TM7SF2 mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in decreased expression of TM7SF2 mRNA	25620056
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of TM7SF2 mRNA	25554681
D009532	Nickel	Nickel results in decreased expression of TM7SF2 mRNA	24768652; 25583101;
C012655	nimesulide	nimesulide results in decreased expression of TM7SF2 mRNA	24136188
D015125	Oxyquinoline	Oxyquinoline results in decreased expression of TM7SF2 mRNA	21632981
D000073878	Palm Oil	Palm Oil affects the expression of TM7SF2 mRNA	19680557
D052638	Particulate Matter	Particulate Matter results in decreased expression of TM7SF2 mRNA	24769257
D010629	Phenformin	Phenformin results in increased expression of TM7SF2 mRNA	31324951
D017035	Pravastatin	Pravastatin results in increased expression of TM7SF2 mRNA	27225895
D011374	Progesterone	Progesterone results in increased expression of TM7SF2 mRNA	23012394
C005556	propionaldehyde	propionaldehyde results in increased expression of TM7SF2 mRNA	26079696
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of TM7SF2 mRNA	24780913
D012402	Rotenone	Rotenone affects the expression of TM7SF2 mRNA	28374803
C513635	S-2-pentyl-4-pentynoic hydroxamic acid	S-2-pentyl-4-pentynoic hydroxamic acid results in increased expression of TM7SF2 mRNA	21427059
D012822	Silicon Dioxide	Silicon Dioxide analog results in decreased expression of TM7SF2 mRNA	25895662
D012834	Silver	Silver results in decreased expression of TM7SF2 mRNA	27131904
D019821	Simvastatin	Simvastatin results in increased expression of TM7SF2 mRNA	25055962
C017947	sodium arsenite	sodium arsenite results in decreased expression of TM7SF2 mRNA	29361514
C016104	sodium bichromate	sodium bichromate results in decreased expression of TM7SF2 mRNA	24612858
C016104	sodium bichromate	sodium bichromate affects the expression of TM7SF2 mRNA	22110744
D012969	Sodium Fluoride	Sodium Fluoride results in decreased expression of TM7SF2 protein	28918527
D012999	Soman	Soman results in decreased expression of TM7SF2 mRNA	19281266
C075117	squalestatin 1	squalestatin 1 results in increased expression of TM7SF2 mRNA	27225895
C013698	tallow	tallow affects the expression of TM7SF2 mRNA	19680557
D013629	Tamoxifen	Tamoxifen results in decreased expression of TM7SF2 mRNA	25123088
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in decreased expression of TM7SF2 mRNA	15336504
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of TM7SF2 mRNA	21570461
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to TM7SF2 gene]	28213091
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of TM7SF2 mRNA	28213091
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of TM7SF2 mRNA	21215274
D013853	Thioacetamide	[Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of TM7SF2 mRNA	28943392
C009495	titanium dioxide	titanium dioxide results in increased expression of TM7SF2 mRNA	23557971
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased expression of TM7SF2 mRNA	28065790
D014212	Tretinoin	Tretinoin results in decreased expression of TM7SF2 mRNA	20530235
D014212	Tretinoin	[bis(4-hydroxyphenyl)sulfone co-treated with Tretinoin] results in decreased expression of TM7SF2 mRNA	30951980
D014241	Trichloroethylene	Trichloroethylene affects the expression of TM7SF2 mRNA	21135412
C012589	trichostatin A	trichostatin A results in decreased expression of TM7SF2 mRNA	24935251
C016805	tris(1,3-dichloro-2-propyl)phosphate	tris(1,3-dichloro-2-propyl)phosphate results in decreased expression of TM7SF2 mRNA	26179874
D014520	Urethane	Urethane results in decreased expression of TM7SF2 mRNA	28818685
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of TM7SF2 mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of TM7SF2 mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in decreased expression of TM7SF2 mRNA	26272509
D014635	Valproic Acid	Valproic Acid results in increased expression of TM7SF2 mRNA	23179753; 27188386;
D014635	Valproic Acid	Valproic Acid results in decreased expression of TM7SF2 mRNA	22045034
D014635	Valproic Acid	Valproic Acid results in increased expression of TM7SF2 mRNA	21427059
C025643	vinclozolin	vinclozolin results in increased expression of TM7SF2 mRNA	22570695
D024483	Vitamin K 3	Vitamin K 3 affects the expression of TM7SF2 mRNA	20044591
C066632	yessotoxin	yessotoxin analog results in increased expression of TM7SF2 mRNA	30679557
D000077211	Zoledronic Acid	Zoledronic Acid results in increased expression of TM7SF2 mRNA	24714768

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0025	Alternative splicing
KW-0152	Cholesterol biosynthesis
KW-0153	Cholesterol metabolism
KW-0256	Endoplasmic reticulum
KW-0444	Lipid biosynthesis
KW-0443	Lipid metabolism
KW-0472	Membrane
KW-0492	Microsome
KW-0521	NADP
KW-0560	Oxidoreductase
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0752	Steroid biosynthesis
KW-0753	Steroid metabolism
KW-0756	Sterol biosynthesis
KW-1207	Sterol metabolism
KW-0812	Transmembrane
KW-1133	Transmembrane helix

Interpro

InterPro ID	InterPro Term
IPR001171	Ergosterol_biosynth_ERG4_ERG24
IPR018083	Sterol_reductase_CS

PROSITE

PROSITE ID	PROSITE Term
PS01017	STEROL_REDUCT_1
PS01018	STEROL_REDUCT_2

Pfam

Pfam ID	Pfam Term
PF01222	ERG4_ERG24

Gene: TM7SF2

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction