CleftGeneDB-Search

Gene: NTN1

Basic information

Tag	Content
Uniprot ID	O95631; E9KL51;
Entrez ID	9423
Genbank protein ID	AAD09221.1; ADU87650.1;
Genbank nucleotide ID	XM_006721595.3; NM_004822.2;
Ensembl protein ID	ENSP00000173229
Ensembl nucleotide ID	ENSG00000065320
Gene name	Netrin-1
Gene symbol	NTN1
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Manually collected
Reference	27033726; 25704602;
Functional description	Netrins control guidance of CNS commissural axons and peripheral motor axons. Its association with either DCC or some UNC5 receptors will lead to axon attraction or repulsion, respectively. Binding to UNC5C might cause dissociation of UNC5C from polymerized TUBB3 in microtubules and thereby lead to increased microtubule dynamics and axon repulsion (PubMed:28483977). Involved in dorsal root ganglion axon projection towards the spinal cord (PubMed:28483977). It also serves as a survival factor via its association with its receptors which prevent the initiation of apoptosis. Involved in tumorigenesis by regulating apoptosis (PubMed:15343335).
Sequence	MMRAVWEALA ALAAVACLVG AVRGGPGLSM FAGQAAQPDP CSDENGHPRR CIPDFVNAAF 60 GKDVRVSSTC GRPPARYCVV SERGEERLRS CHLCNASDPK KAHPPAFLTD LNNPHNLTCW 120 QSENYLQFPH NVTLTLSLGK KFEVTYVSLQ FCSPRPESMA IYKSMDYGRT WVPFQFYSTQ 180 CRKMYNRPHR APITKQNEQE AVCTDSHTDM RPLSGGLIAF STLDGRPSAH DFDNSPVLQD 240 WVTATDIRVA FSRLHTFGDE NEDDSELARD SYFYAVSDLQ VGGRCKCNGH AARCVRDRDD 300 SLVCDCRHNT AGPECDRCKP FHYDRPWQRA TAREANECVA CNCNLHARRC RFNMELYKLS 360 GRKSGGVCLN CRHNTAGRHC HYCKEGYYRD MGKPITHRKA CKACDCHPVG AAGKTCNQTT 420 GQCPCKDGVT GITCNRCAKG YQQSRSPIAP CIKIPVAPPT TAASSVEEPE DCDSYCKASK 480 GKLKINMKKY CKKDYAVQIH ILKADKAGDW WKFTVNIISV YKQGTSRIRR GDQSLWIRSR 540 DIACKCPKIK PLKKYLLLGN AEDSPDQSGI VADKSSLVIQ WRDTWARRLR KFQQREKKGK 600 CKKA 604

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
4URT
6FKQ
4URT

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Species	Evidence	Details
1:1 ortholog	NTN1	522767	F1N0C7	Bos taurus	Prediction	More>>
1:1 ortholog	NTN1		A0A452FGQ4	Capra hircus	Prediction	More>>
1:1 ortholog	NTN1	9423	O95631	Homo sapiens	Publication	More>>
1:1 ortholog	Ntn1	18208	O09118	Mus musculus	Prediction	More>>
1:1 ortholog	NTN1	455083	H2QC90	Pan troglodytes	Prediction	More>>
1:1 ortholog			A0A4X1V6Z8	Sus scrofa	Prediction	More>>
1:1 ortholog	Ntn1		F1LPC8	Rattus norvegicus	Prediction	More>>
1:1 ortholog	ntn1a	30227	O42140	Danio rerio	Prediction	More>>

Identified variants/mutations related to cleft phenotype

Gene symbol	Significant Variants/SNPS	Methods	PubMed ID
NTN1	rs4791774C>T (increase risk)	GWAS	31780810
NTN1	rs11273201	Genotyping and GWAS	27033726
NTN1	rs7406226	Genotyping and GWAS	27033726
NTN1	rs1880646	Genotyping and GWAS	27033726
NTN1	rs1880646G>A	GWAS	28232668
NTN1	rs2872615A>G	GWAS	28232668
NTN1	haplotype combination rs9788972-rs9915089	GWAS	3221112
NTN1	haplotype combination rs4791774-rs9788972	GWAS	3221112
NTN1	rs11273201A>AACCCAAAACCCAC	GWAS; EMMAX; and TWAS	33137956
NTN1	rs4791774 A>G	GWAS and TDT	30506619
NTN1	rs9904526	GWAS and Sanger sequencing	25704602

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1487156376	p.Met2Ile	missense variant	-	NC_000017.11:g.9022379G>T	TOPMed
rs951076846	p.Arg3Leu	missense variant	-	NC_000017.11:g.9022381G>T	TOPMed
rs1204652345	p.Ala4Thr	missense variant	-	NC_000017.11:g.9022383G>A	TOPMed,gnomAD
rs1204652345	p.Ala4Ser	missense variant	-	NC_000017.11:g.9022383G>T	TOPMed,gnomAD
rs1345968008	p.Ala4Val	missense variant	-	NC_000017.11:g.9022384C>T	TOPMed
rs895460822	p.Glu7Ala	missense variant	-	NC_000017.11:g.9022393A>C	TOPMed
rs1402269691	p.Ala8Thr	missense variant	-	NC_000017.11:g.9022395G>A	TOPMed
rs1044181487	p.Ala8Val	missense variant	-	NC_000017.11:g.9022396C>T	TOPMed
rs1414739346	p.Ala14Val	missense variant	-	NC_000017.11:g.9022414C>T	TOPMed
rs770519483	p.Ala16Gly	missense variant	-	NC_000017.11:g.9022420C>G	ExAC,gnomAD
rs904264101	p.Ala21Ser	missense variant	-	NC_000017.11:g.9022434G>T	TOPMed,gnomAD
rs904264101	p.Ala21Thr	missense variant	-	NC_000017.11:g.9022434G>A	TOPMed,gnomAD
rs774092955	p.Gly25Trp	missense variant	-	NC_000017.11:g.9022446G>T	ExAC,gnomAD
rs1474365383	p.Pro26Thr	missense variant	-	NC_000017.11:g.9022449C>A	TOPMed
rs928391967	p.Gly27Arg	missense variant	-	NC_000017.11:g.9022452G>A	gnomAD
rs928391967	p.Gly27Arg	missense variant	-	NC_000017.11:g.9022452G>C	gnomAD
rs1354353462	p.Ser29Asn	missense variant	-	NC_000017.11:g.9022459G>A	TOPMed,gnomAD
rs1354353462	p.Ser29Ile	missense variant	-	NC_000017.11:g.9022459G>T	TOPMed,gnomAD
rs1201889936	p.Met30Leu	missense variant	-	NC_000017.11:g.9022461A>C	TOPMed
rs767190473	p.Met30Ile	missense variant	-	NC_000017.11:g.9022463G>A	ExAC,gnomAD
rs775131409	p.Phe31Leu	missense variant	-	NC_000017.11:g.9022464T>C	ExAC,TOPMed,gnomAD
rs775131409	p.Phe31Ile	missense variant	-	NC_000017.11:g.9022464T>A	ExAC,TOPMed,gnomAD
rs1238290758	p.Ala32Val	missense variant	-	NC_000017.11:g.9022468C>T	gnomAD
rs1286646502	p.Ala35Val	missense variant	-	NC_000017.11:g.9022477C>T	gnomAD
rs764031075	p.Asp39Gly	missense variant	-	NC_000017.11:g.9022489A>G	ExAC,TOPMed,gnomAD
rs1208736060	p.Asp39Tyr	missense variant	-	NC_000017.11:g.9022488G>T	gnomAD
rs764914777	p.Ser42Leu	missense variant	-	NC_000017.11:g.9022498C>T	ExAC,gnomAD
rs947255384	p.Asp43Glu	missense variant	-	NC_000017.11:g.9022502C>G	TOPMed
rs1179876418	p.Asp43Val	missense variant	-	NC_000017.11:g.9022501A>T	gnomAD
rs1382637441	p.Glu44Ter	stop gained	-	NC_000017.11:g.9022503G>T	TOPMed,gnomAD
rs1382637441	p.Glu44Gln	missense variant	-	NC_000017.11:g.9022503G>C	TOPMed,gnomAD
rs1420988349	p.Gly46Arg	missense variant	-	NC_000017.11:g.9022509G>C	gnomAD
rs141044792	p.Gly46Asp	missense variant	-	NC_000017.11:g.9022510G>A	1000Genomes,ExAC,gnomAD
rs766580870	p.His47Leu	missense variant	-	NC_000017.11:g.9022513A>T	TOPMed,gnomAD
rs564296441	p.His47Gln	missense variant	-	NC_000017.11:g.9022514C>A	ExAC,TOPMed,gnomAD
rs866779945	p.Pro48Gln	missense variant	-	NC_000017.11:g.9022516C>A	TOPMed
rs866779945	p.Pro48Arg	missense variant	-	NC_000017.11:g.9022516C>G	TOPMed
rs868865853	p.Arg49Ser	missense variant	-	NC_000017.11:g.9022518C>A	TOPMed,gnomAD
rs867783307	p.Pro53Gln	missense variant	-	NC_000017.11:g.9022531C>A	gnomAD
rs1378973992	p.Asp54Glu	missense variant	-	NC_000017.11:g.9022535C>G	TOPMed,gnomAD
rs1347980959	p.Phe55Leu	missense variant	-	NC_000017.11:g.9022538T>G	TOPMed,gnomAD
rs1232212784	p.Val56Phe	missense variant	-	NC_000017.11:g.9022539G>T	gnomAD
rs530015851	p.Ala58Val	missense variant	-	NC_000017.11:g.9022546C>T	1000Genomes
rs530015851	p.Ala58Glu	missense variant	-	NC_000017.11:g.9022546C>A	1000Genomes
rs868538817	p.Phe60Leu	missense variant	-	NC_000017.11:g.9022553C>A	TOPMed,gnomAD
rs1212597776	p.Gly61Val	missense variant	-	NC_000017.11:g.9022555G>T	gnomAD
rs1212597776	p.Gly61Asp	missense variant	-	NC_000017.11:g.9022555G>A	gnomAD
rs1204002615	p.Gly61Arg	missense variant	-	NC_000017.11:g.9022554G>C	gnomAD
rs756628226	p.Lys62Asn	missense variant	-	NC_000017.11:g.9022559G>C	ExAC,TOPMed,gnomAD
rs1480516380	p.Arg65Ser	missense variant	-	NC_000017.11:g.9022566C>A	gnomAD
rs867005711	p.Arg65Leu	missense variant	-	NC_000017.11:g.9022567G>T	TOPMed,gnomAD
rs1480516380	p.Arg65Cys	missense variant	-	NC_000017.11:g.9022566C>T	gnomAD
rs867005711	p.Arg65His	missense variant	-	NC_000017.11:g.9022567G>A	TOPMed,gnomAD
rs1240603076	p.Ser68Thr	missense variant	-	NC_000017.11:g.9022576G>C	TOPMed,gnomAD
rs1240603076	p.Ser68Asn	missense variant	-	NC_000017.11:g.9022576G>A	TOPMed,gnomAD
rs778302037	p.Thr69Ile	missense variant	-	NC_000017.11:g.9022579C>T	ExAC,gnomAD
rs1453062498	p.Thr69Ala	missense variant	-	NC_000017.11:g.9022578A>G	gnomAD
rs1453062498	p.Thr69Ser	missense variant	-	NC_000017.11:g.9022578A>T	gnomAD
rs1229272962	p.Cys70Arg	missense variant	-	NC_000017.11:g.9022581T>C	TOPMed
rs1370917223	p.Pro73Leu	missense variant	-	NC_000017.11:g.9022591C>T	gnomAD
rs1177864027	p.Pro73Ser	missense variant	-	NC_000017.11:g.9022590C>T	gnomAD
rs1402168181	p.Pro74Leu	missense variant	-	NC_000017.11:g.9022594C>T	gnomAD
rs1051643472	p.Pro74Ala	missense variant	-	NC_000017.11:g.9022593C>G	TOPMed,gnomAD
rs1402168181	p.Pro74Leu	missense variant	-	NC_000017.11:g.9022594C>T	NCI-TCGA Cosmic
rs1292862173	p.Arg76His	missense variant	-	NC_000017.11:g.9022600G>A	TOPMed,gnomAD
rs1220965829	p.Cys78Ter	stop gained	-	NC_000017.11:g.9022607C>A	gnomAD
rs745578628	p.Val79Met	missense variant	-	NC_000017.11:g.9022608G>A	ExAC,TOPMed,gnomAD
rs1057094252	p.Val80Leu	missense variant	-	NC_000017.11:g.9022611G>T	TOPMed
rs1353894647	p.Ser81Thr	missense variant	-	NC_000017.11:g.9022615G>C	TOPMed
rs1307099241	p.Ser81Arg	missense variant	-	NC_000017.11:g.9022616C>A	gnomAD
rs775149906	p.Glu85Asp	missense variant	-	NC_000017.11:g.9022628G>T	ExAC,TOPMed,gnomAD
rs548182167	p.Glu86Gln	missense variant	-	NC_000017.11:g.9022629G>C	1000Genomes,TOPMed
rs1213695522	p.Arg87Trp	missense variant	-	NC_000017.11:g.9022632C>T	gnomAD
rs1247787617	p.Arg87Gln	missense variant	-	NC_000017.11:g.9022633G>A	TOPMed,gnomAD
rs1247787617	p.Arg87Leu	missense variant	-	NC_000017.11:g.9022633G>T	TOPMed,gnomAD
rs1381078110	p.Leu88Arg	missense variant	-	NC_000017.11:g.9022636T>G	TOPMed
rs1044451064	p.Arg89Leu	missense variant	-	NC_000017.11:g.9022639G>T	TOPMed
rs768509009	p.Ser90Trp	missense variant	-	NC_000017.11:g.9022642C>G	ExAC,TOPMed,gnomAD
rs768509009	p.Ser90Leu	missense variant	-	NC_000017.11:g.9022642C>T	ExAC,TOPMed,gnomAD
rs375380782	p.His92Asn	missense variant	-	NC_000017.11:g.9022647C>A	ESP,ExAC,TOPMed,gnomAD
rs1376620666	p.Cys94Tyr	missense variant	-	NC_000017.11:g.9022654G>A	gnomAD
rs1417105052	p.Cys94Ter	stop gained	-	NC_000017.11:g.9022655C>A	gnomAD
rs1164005622	p.Ala96Val	missense variant	-	NC_000017.11:g.9022660C>T	gnomAD
rs1287144736	p.Pro99Arg	missense variant	-	NC_000017.11:g.9022669C>G	gnomAD
rs1438744633	p.Pro99Ser	missense variant	-	NC_000017.11:g.9022668C>T	gnomAD
rs1053227918	p.Lys100Thr	missense variant	-	NC_000017.11:g.9022672A>C	TOPMed
rs765138634	p.Lys100Glu	missense variant	-	NC_000017.11:g.9022671A>G	ExAC,gnomAD
NCI-TCGA novel	p.Lys100Asn	missense variant	-	NC_000017.11:g.9022673G>T	NCI-TCGA
rs1333223709	p.His103Tyr	missense variant	-	NC_000017.11:g.9022680C>T	gnomAD
rs1232995274	p.Pro104Arg	missense variant	-	NC_000017.11:g.9022684C>G	gnomAD
rs1323977457	p.Pro105Ser	missense variant	-	NC_000017.11:g.9022686C>T	gnomAD
rs867295954	p.Ala106Thr	missense variant	-	NC_000017.11:g.9022689G>A	gnomAD
rs767670390	p.Ala106Val	missense variant	-	NC_000017.11:g.9022690C>T	ExAC,TOPMed,gnomAD
rs752803239	p.Phe107Leu	missense variant	-	NC_000017.11:g.9022694C>G	ExAC,gnomAD
rs1474108111	p.Thr109Ile	missense variant	-	NC_000017.11:g.9022699C>T	TOPMed,gnomAD
rs1474108111	p.Thr109Ser	missense variant	-	NC_000017.11:g.9022699C>G	TOPMed,gnomAD
COSM4071131	p.Asp110Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9022701G>A	NCI-TCGA Cosmic
rs1410799994	p.Asn112Ser	missense variant	-	NC_000017.11:g.9022708A>G	TOPMed,gnomAD
rs777691583	p.Pro114Leu	missense variant	-	NC_000017.11:g.9022714C>T	NCI-TCGA
rs777691583	p.Pro114Leu	missense variant	-	NC_000017.11:g.9022714C>T	ExAC,gnomAD
rs1420370454	p.Asn116Lys	missense variant	-	NC_000017.11:g.9022721C>G	gnomAD
rs1161617405	p.Leu117Val	missense variant	-	NC_000017.11:g.9022722C>G	TOPMed
rs1417519830	p.Leu117Pro	missense variant	-	NC_000017.11:g.9022723T>C	TOPMed
rs1353752805	p.Cys119Tyr	missense variant	-	NC_000017.11:g.9022729G>A	gnomAD
rs1008999734	p.Gln121Lys	missense variant	-	NC_000017.11:g.9022734C>A	TOPMed,gnomAD
NCI-TCGA novel	p.Glu123CysPheSerTerUnkUnk	frameshift	-	NC_000017.11:g.9022738_9022747CCGAGAACTA>-	NCI-TCGA
rs200187924	p.Asn124Thr	missense variant	-	NC_000017.11:g.9022744A>C	ExAC,TOPMed,gnomAD
rs200187924	p.Asn124Ser	missense variant	-	NC_000017.11:g.9022744A>G	ExAC,TOPMed,gnomAD
rs779337164	p.Tyr125Asn	missense variant	-	NC_000017.11:g.9022746T>A	ExAC,gnomAD
rs571334142	p.Phe128Leu	missense variant	-	NC_000017.11:g.9022757C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs571334142	p.Phe128Leu	missense variant	-	NC_000017.11:g.9022757C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1262845727	p.His130Arg	missense variant	-	NC_000017.11:g.9022762A>G	TOPMed
rs779814893	p.Thr135Ile	missense variant	-	NC_000017.11:g.9022777C>T	ExAC,gnomAD
rs1484460161	p.Leu136Val	missense variant	-	NC_000017.11:g.9022779C>G	gnomAD
rs1186379178	p.Ser137Ala	missense variant	-	NC_000017.11:g.9022782T>G	TOPMed,gnomAD
rs746632315	p.Gly139Val	missense variant	-	NC_000017.11:g.9022789G>T	ExAC,gnomAD
rs1473654500	p.Gly139Cys	missense variant	-	NC_000017.11:g.9022788G>T	gnomAD
COSM4071132	p.Lys141Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9022795A>C	NCI-TCGA Cosmic
COSM3796278	p.Glu143Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9022800G>A	NCI-TCGA Cosmic
rs1440404039	p.Val144Ala	missense variant	-	NC_000017.11:g.9022804T>C	gnomAD
NCI-TCGA novel	p.Val144Leu	missense variant	-	NC_000017.11:g.9022803G>C	NCI-TCGA
rs1278786572	p.Val147Met	missense variant	-	NC_000017.11:g.9022812G>A	TOPMed
rs1279508055	p.Gln150His	missense variant	-	NC_000017.11:g.9022823G>C	TOPMed,gnomAD
rs775995825	p.Gln150Leu	missense variant	-	NC_000017.11:g.9022822A>T	ExAC
rs1414159385	p.Phe151Leu	missense variant	-	NC_000017.11:g.9022826C>A	gnomAD
COSM5055931	p.Arg155Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9022837G>A	NCI-TCGA Cosmic
rs1335097221	p.Arg155Trp	missense variant	-	NC_000017.11:g.9022836C>T	gnomAD
rs1440394143	p.Met159Thr	missense variant	-	NC_000017.11:g.9022849T>C	gnomAD
rs1028036395	p.Met159Ile	missense variant	-	NC_000017.11:g.9022850G>A	TOPMed,gnomAD
rs1400510763	p.Ala160Thr	missense variant	-	NC_000017.11:g.9022851G>A	TOPMed
rs1378242475	p.Ala160Val	missense variant	-	NC_000017.11:g.9022852C>T	gnomAD
rs1240273489	p.Ile161Leu	missense variant	-	NC_000017.11:g.9022854A>C	gnomAD
rs769551467	p.Tyr162Cys	missense variant	-	NC_000017.11:g.9022858A>G	ExAC,TOPMed,gnomAD
rs762689038	p.Met165Val	missense variant	-	NC_000017.11:g.9022866A>G	ExAC,TOPMed,gnomAD
COSM708494	p.Asp166Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9022869G>T	NCI-TCGA Cosmic
rs1470975750	p.Asp166His	missense variant	-	NC_000017.11:g.9022869G>C	TOPMed
rs766128293	p.Arg169His	missense variant	-	NC_000017.11:g.9022879G>A	NCI-TCGA Cosmic
rs766128293	p.Arg169Leu	missense variant	-	NC_000017.11:g.9022879G>T	ExAC,gnomAD
rs766128293	p.Arg169His	missense variant	-	NC_000017.11:g.9022879G>A	ExAC,gnomAD
rs752964582	p.Thr170Met	missense variant	-	NC_000017.11:g.9022882C>T	ExAC,gnomAD
rs1427846302	p.Thr170Ala	missense variant	-	NC_000017.11:g.9022881A>G	TOPMed
rs752964582	p.Thr170Lys	missense variant	-	NC_000017.11:g.9022882C>A	ExAC,gnomAD
rs1252968756	p.Val172Met	missense variant	-	NC_000017.11:g.9022887G>A	gnomAD
rs764297553	p.Pro173Ser	missense variant	-	NC_000017.11:g.9022890C>T	ExAC,gnomAD
rs757792325	p.Phe174Leu	missense variant	-	NC_000017.11:g.9022893T>C	ExAC,TOPMed,gnomAD
COSM4071134	p.Phe176Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9022899T>C	NCI-TCGA Cosmic
rs779511545	p.Phe176Cys	missense variant	-	NC_000017.11:g.9022900T>G	ExAC,gnomAD
rs1395836571	p.Phe176Leu	missense variant	-	NC_000017.11:g.9022901C>G	gnomAD
rs1331045767	p.Ser178Thr	missense variant	-	NC_000017.11:g.9022905T>A	gnomAD
rs1401458871	p.Cys181Tyr	missense variant	-	NC_000017.11:g.9022915G>A	TOPMed,gnomAD
rs1449707617	p.Arg182Pro	missense variant	-	NC_000017.11:g.9022918G>C	gnomAD
rs758877817	p.Met184Val	missense variant	-	NC_000017.11:g.9022923A>G	ExAC,gnomAD
rs746720404	p.Asn186Lys	missense variant	-	NC_000017.11:g.9022931C>G	ExAC,TOPMed,gnomAD
rs751410364	p.Asn186Ser	missense variant	-	NC_000017.11:g.9022930A>G	ExAC,TOPMed,gnomAD
rs768189573	p.Arg187Leu	missense variant	-	NC_000017.11:g.9022933G>T	ExAC,gnomAD
rs768189573	p.Arg187Gln	missense variant	-	NC_000017.11:g.9022933G>A	ExAC,gnomAD
rs780758662	p.Arg190His	missense variant	-	NC_000017.11:g.9022942G>A	ExAC,TOPMed,gnomAD
rs769794608	p.Ala191Thr	missense variant	-	NC_000017.11:g.9022944G>A	ExAC,gnomAD
rs1248692227	p.Lys195Arg	missense variant	-	NC_000017.11:g.9022957A>G	gnomAD
rs773172213	p.Lys195Glu	missense variant	-	NC_000017.11:g.9022956A>G	ExAC,gnomAD
rs773172213	p.Lys195Gln	missense variant	-	NC_000017.11:g.9022956A>C	ExAC,gnomAD
rs1474579784	p.Gln196His	missense variant	-	NC_000017.11:g.9022961G>C	gnomAD
rs770770428	p.Asn197Lys	missense variant	-	NC_000017.11:g.9022964C>A	ExAC,gnomAD
rs749199790	p.Asn197Ser	missense variant	-	NC_000017.11:g.9022963A>G	ExAC,gnomAD
rs760951671	p.Glu200Asp	missense variant	-	NC_000017.11:g.9022973G>T	ExAC,TOPMed,gnomAD
rs992652140	p.Val202Leu	missense variant	-	NC_000017.11:g.9022977G>T	TOPMed
rs201736911	p.Thr204Ser	missense variant	-	NC_000017.11:g.9022984C>G	ESP,ExAC,TOPMed,gnomAD
rs1454765199	p.Asp205Asn	missense variant	-	NC_000017.11:g.9022986G>A	TOPMed
rs200854554	p.His207Arg	missense variant	-	NC_000017.11:g.9022993A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1332287834	p.His207Tyr	missense variant	-	NC_000017.11:g.9022992C>T	gnomAD
rs1277164731	p.Thr208Asn	missense variant	-	NC_000017.11:g.9022996C>A	TOPMed,gnomAD
rs1277164731	p.Thr208Ile	missense variant	-	NC_000017.11:g.9022996C>T	TOPMed,gnomAD
rs199674301	p.Met210Val	missense variant	-	NC_000017.11:g.9023001A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs766922436	p.Arg211Leu	missense variant	-	NC_000017.11:g.9023005G>T	ExAC,gnomAD
rs34079256	p.Arg211Ser	missense variant	-	NC_000017.11:g.9023004C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs34079256	p.Arg211Cys	missense variant	-	NC_000017.11:g.9023004C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs34079256	p.Arg211Cys	missense variant	-	NC_000017.11:g.9023004C>T	NCI-TCGA
rs1428238477	p.Pro212Ser	missense variant	-	NC_000017.11:g.9023007C>T	TOPMed
rs1428238477	p.Pro212Ser	missense variant	-	NC_000017.11:g.9023007C>T	NCI-TCGA Cosmic
rs1292174649	p.Leu213Phe	missense variant	-	NC_000017.11:g.9023010C>T	gnomAD
rs372642681	p.Ser214Leu	missense variant	-	NC_000017.11:g.9023014C>T	ESP,ExAC,TOPMed,gnomAD
rs1264100470	p.Gly216Val	missense variant	-	NC_000017.11:g.9023020G>T	gnomAD
COSM1303569	p.Ala219Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9023028G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr222Met	missense variant	-	NC_000017.11:g.9023038C>T	NCI-TCGA
rs1165503909	p.Asp224Tyr	missense variant	-	NC_000017.11:g.9023043G>T	gnomAD
rs1417255509	p.Gly225Arg	missense variant	-	NC_000017.11:g.9023046G>C	gnomAD
COSM460170	p.Ser228Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9023056C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.His230Asn	missense variant	-	NC_000017.11:g.9023061C>A	NCI-TCGA
rs1401636588	p.Phe232Leu	missense variant	-	NC_000017.11:g.9023069C>G	gnomAD
rs749289575	p.Asp233His	missense variant	-	NC_000017.11:g.9023070G>C	ExAC,TOPMed,gnomAD
rs1339624679	p.Asn234Ser	missense variant	-	NC_000017.11:g.9023074A>G	TOPMed,gnomAD
rs770788634	p.Pro236Thr	missense variant	-	NC_000017.11:g.9023079C>A	ExAC,TOPMed,gnomAD
rs770788634	p.Pro236Ser	missense variant	-	NC_000017.11:g.9023079C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln239Ter	stop gained	-	NC_000017.11:g.9023088C>T	NCI-TCGA
rs1287048531	p.Asp240Asn	missense variant	-	NC_000017.11:g.9023091G>A	gnomAD
rs868503729	p.Ala244Thr	missense variant	-	NC_000017.11:g.9023103G>A	TOPMed,gnomAD
rs1190236557	p.Ile247Val	missense variant	-	NC_000017.11:g.9023112A>G	gnomAD
rs1437308979	p.Arg248His	missense variant	-	NC_000017.11:g.9023116G>A	gnomAD
NCI-TCGA novel	p.Arg248Cys	missense variant	-	NC_000017.11:g.9023115C>T	NCI-TCGA
rs1437308979	p.Arg248Leu	missense variant	-	NC_000017.11:g.9023116G>T	gnomAD
rs762076661	p.Val249Leu	missense variant	-	NC_000017.11:g.9023118G>T	ExAC,TOPMed,gnomAD
rs762076661	p.Val249Met	missense variant	-	NC_000017.11:g.9023118G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala250Thr	missense variant	-	NC_000017.11:g.9023121G>A	NCI-TCGA
rs1248532211	p.Arg253Cys	missense variant	-	NC_000017.11:g.9023130C>T	TOPMed
rs148441765	p.Arg253Leu	missense variant	-	NC_000017.11:g.9023131G>T	ESP,ExAC,TOPMed,gnomAD
rs148441765	p.Arg253His	missense variant	-	NC_000017.11:g.9023131G>A	ESP,ExAC,TOPMed,gnomAD
rs1391973690	p.His255Arg	missense variant	-	NC_000017.11:g.9023137A>G	TOPMed
rs745820812	p.Phe257Leu	missense variant	-	NC_000017.11:g.9023144C>G	ExAC,TOPMed,gnomAD
rs766935068	p.Asp259Glu	missense variant	-	NC_000017.11:g.9023150C>G	ExAC,gnomAD
rs1297009010	p.Glu262Gln	missense variant	-	NC_000017.11:g.9023157G>C	TOPMed
rs751977350	p.Glu262Ala	missense variant	-	NC_000017.11:g.9023158A>C	ExAC,gnomAD
rs1310142074	p.Asp263Glu	missense variant	-	NC_000017.11:g.9023162C>G	gnomAD
rs142558586	p.Ser265Leu	missense variant	-	NC_000017.11:g.9023167C>T	ESP,TOPMed,gnomAD
rs755259287	p.Ser271Trp	missense variant	-	NC_000017.11:g.9023185C>G	ExAC,TOPMed,gnomAD
rs755259287	p.Ser271Leu	missense variant	-	NC_000017.11:g.9023185C>T	ExAC,TOPMed,gnomAD
rs1236907234	p.Ala275Val	missense variant	-	NC_000017.11:g.9023197C>T	gnomAD
rs767898852	p.Ala275Thr	missense variant	-	NC_000017.11:g.9023196G>A	ExAC,gnomAD
rs1457746235	p.Ser277Phe	missense variant	-	NC_000017.11:g.9023203C>T	gnomAD
rs1380455130	p.Asp278Asn	missense variant	-	NC_000017.11:g.9023205G>A	gnomAD
rs1173539091	p.Gly282Asp	missense variant	-	NC_000017.11:g.9023218G>A	gnomAD
rs755758763	p.Gly283Ser	missense variant	-	NC_000017.11:g.9023220G>A	ExAC,gnomAD
rs1420306201	p.Arg284Leu	missense variant	-	NC_000017.11:g.9023224G>T	TOPMed
NCI-TCGA novel	p.Cys287SerPheSerTerUnkUnkUnk	frameshift	-	NC_000017.11:g.9023233_9023254GCAACGGCCACGCGGCCCGCTG>-	NCI-TCGA
rs1195204919	p.Asn288Ser	missense variant	-	NC_000017.11:g.9023236A>G	TOPMed
rs865836663	p.Gly289Arg	missense variant	-	NC_000017.11:g.9023238G>C	gnomAD
rs865836663	p.Gly289Cys	missense variant	-	NC_000017.11:g.9023238G>T	gnomAD
rs1379224707	p.Ala291Glu	missense variant	-	NC_000017.11:g.9023245C>A	gnomAD
rs1385083318	p.Ala292Thr	missense variant	-	NC_000017.11:g.9023247G>A	gnomAD
rs1300880577	p.Arg293His	missense variant	-	NC_000017.11:g.9023251G>A	TOPMed,gnomAD
rs577333476	p.Val295Leu	missense variant	-	NC_000017.11:g.9023256G>T	1000Genomes,TOPMed,gnomAD
rs577333476	p.Val295Met	missense variant	-	NC_000017.11:g.9023256G>A	1000Genomes,TOPMed,gnomAD
rs577333476	p.Val295Met	missense variant	-	NC_000017.11:g.9023256G>A	NCI-TCGA
rs748734505	p.Arg296Pro	missense variant	-	NC_000017.11:g.9023260G>C	ExAC,TOPMed,gnomAD
rs748734505	p.Arg296His	missense variant	-	NC_000017.11:g.9023260G>A	ExAC,TOPMed,gnomAD
rs1314584634	p.Arg296Ser	missense variant	-	NC_000017.11:g.9023259C>A	TOPMed
rs1256601152	p.Asp297Tyr	missense variant	-	NC_000017.11:g.9023262G>T	gnomAD
NCI-TCGA novel	p.Asp299Asn	missense variant	-	NC_000017.11:g.9023268G>A	NCI-TCGA
rs1240512658	p.Leu302Pro	missense variant	-	NC_000017.11:g.9023278T>C	gnomAD
rs778673423	p.Val303Met	missense variant	-	NC_000017.11:g.9023280G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Val303Leu	missense variant	-	NC_000017.11:g.9023280G>C	NCI-TCGA
rs868254012	p.Asp305Asn	missense variant	-	NC_000017.11:g.9023286G>A	gnomAD
rs745784631	p.Asp305Gly	missense variant	-	NC_000017.11:g.9023287A>G	ExAC,TOPMed,gnomAD
rs745784631	p.Asp305Val	missense variant	-	NC_000017.11:g.9023287A>T	ExAC,TOPMed,gnomAD
rs868254012	p.Asp305Tyr	missense variant	-	NC_000017.11:g.9023286G>T	gnomAD
rs771813609	p.Asp305Glu	missense variant	-	NC_000017.11:g.9023288C>G	ExAC,TOPMed,gnomAD
rs779888759	p.Cys306Trp	missense variant	-	NC_000017.11:g.9023291C>G	ExAC,gnomAD
NCI-TCGA novel	p.Thr310Met	missense variant	-	NC_000017.11:g.9023302C>T	NCI-TCGA
rs1171304335	p.Ala311Asp	missense variant	-	NC_000017.11:g.9023305C>A	gnomAD
rs1171304335	p.Ala311Val	missense variant	-	NC_000017.11:g.9023305C>T	gnomAD
rs1249348058	p.Gly312Ser	missense variant	-	NC_000017.11:g.9023307G>A	TOPMed,gnomAD
rs1293061746	p.Pro313Arg	missense variant	-	NC_000017.11:g.9023311C>G	TOPMed,gnomAD
rs1293061746	p.Pro313Leu	missense variant	-	NC_000017.11:g.9023311C>T	TOPMed,gnomAD
rs1361634726	p.Arg317Leu	missense variant	-	NC_000017.11:g.9023323G>T	TOPMed
rs987215469	p.Arg329His	missense variant	-	NC_000017.11:g.9023359G>A	TOPMed
rs773439086	p.Ala332Val	missense variant	-	NC_000017.11:g.9023368C>T	ExAC
rs1320393559	p.Asn336Ser	missense variant	-	NC_000017.11:g.9023380A>G	gnomAD
rs1221446939	p.Val339Met	missense variant	-	NC_000017.11:g.9023388G>A	TOPMed,gnomAD
rs1221446939	p.Val339Leu	missense variant	-	NC_000017.11:g.9023388G>T	TOPMed,gnomAD
rs759962176	p.Asn342Tyr	missense variant	-	NC_000017.11:g.9162818A>T	ExAC,gnomAD
rs1471678606	p.Leu345Pro	missense variant	-	NC_000017.11:g.9162828T>C	gnomAD
rs375204917	p.Arg348Trp	missense variant	-	NC_000017.11:g.9162836C>T	1000Genomes,ESP,ExAC,gnomAD
rs368127099	p.Arg348Gln	missense variant	-	NC_000017.11:g.9162837G>A	ESP,ExAC,TOPMed,gnomAD
rs374707235	p.Arg349Leu	missense variant	-	NC_000017.11:g.9162840G>T	ExAC,TOPMed,gnomAD
rs374707235	p.Arg349His	missense variant	-	NC_000017.11:g.9162840G>A	ExAC,TOPMed,gnomAD
rs1420588142	p.Arg349Cys	missense variant	-	NC_000017.11:g.9162839C>T	gnomAD
rs531668666	p.Arg351His	missense variant	-	NC_000017.11:g.9162846G>A	UniProt,dbSNP
VAR_014279	p.Arg351His	missense variant	-	NC_000017.11:g.9162846G>A	UniProt
rs531668666	p.Arg351His	missense variant	-	NC_000017.11:g.9162846G>A	ExAC,gnomAD
rs140248343	p.Arg351Ser	missense variant	-	NC_000017.11:g.9162845C>A	ESP,ExAC,TOPMed,gnomAD
rs140248343	p.Arg351Cys	missense variant	-	NC_000017.11:g.9162845C>T	ESP,ExAC,TOPMed,gnomAD
rs1238578306	p.Asn353Lys	missense variant	-	NC_000017.11:g.9162853C>A	TOPMed,gnomAD
rs1306500773	p.Met354Val	missense variant	-	NC_000017.11:g.9162854A>G	gnomAD
rs758282081	p.Leu356Ile	missense variant	-	NC_000017.11:g.9162860C>A	ExAC,gnomAD
rs751434453	p.Tyr357Cys	missense variant	-	NC_000017.11:g.9162864A>G	ExAC,gnomAD
rs779997082	p.Tyr357His	missense variant	-	NC_000017.11:g.9162863T>C	ExAC,TOPMed,gnomAD
rs754863907	p.Leu359Phe	missense variant	-	NC_000017.11:g.9162869C>T	ExAC,gnomAD
COSM276408	p.Ser360Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9162873C>T	NCI-TCGA Cosmic
rs558564980	p.Arg362His	missense variant	-	NC_000017.11:g.9162879G>A	1000Genomes,ExAC,gnomAD
rs749586755	p.Arg362Cys	missense variant	-	NC_000017.11:g.9162878C>T	ExAC,gnomAD
rs778868022	p.Lys363Asn	missense variant	-	NC_000017.11:g.9162883G>C	ExAC,gnomAD
rs772486953	p.Ser364Arg	missense variant	-	NC_000017.11:g.9162886C>A	ExAC,TOPMed,gnomAD
rs772486953	p.Ser364Arg	missense variant	-	NC_000017.11:g.9162886C>G	ExAC,TOPMed,gnomAD
COSM3403417	p.Gly365Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9162887G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly365Val	missense variant	-	NC_000017.11:g.9162888G>T	NCI-TCGA
rs1160517048	p.Val367Ile	missense variant	-	NC_000017.11:g.9162893G>A	gnomAD
NCI-TCGA novel	p.Cys368Tyr	missense variant	-	NC_000017.11:g.9162897G>A	NCI-TCGA
rs1216191751	p.Leu369Ile	missense variant	-	NC_000017.11:g.9162899C>A	gnomAD
rs1414280704	p.Asn370Tyr	missense variant	-	NC_000017.11:g.9162902A>T	TOPMed,gnomAD
rs776977895	p.Asn370Ser	missense variant	-	NC_000017.11:g.9162903A>G	ExAC,gnomAD
rs144950762	p.Asn370Lys	missense variant	-	NC_000017.11:g.9162904C>G	ESP,ExAC,TOPMed,gnomAD
rs1414280704	p.Asn370Asp	missense variant	-	NC_000017.11:g.9162902A>G	TOPMed,gnomAD
rs1331242639	p.Arg372His	missense variant	-	NC_000017.11:g.9162909G>A	gnomAD
rs1331242639	p.Arg372Leu	missense variant	-	NC_000017.11:g.9162909G>T	gnomAD
rs772623927	p.Arg372Cys	missense variant	-	NC_000017.11:g.9162908C>T	ExAC,gnomAD
rs762489133	p.Asn374Ser	missense variant	-	NC_000017.11:g.9162915A>G	ExAC,TOPMed,gnomAD
rs765779295	p.Thr375Pro	missense variant	-	NC_000017.11:g.9162917A>C	ExAC,gnomAD
rs754959235	p.Ala376Thr	missense variant	-	NC_000017.11:g.9162920G>A	ExAC,TOPMed,gnomAD
rs767421459	p.Ala376Val	missense variant	-	NC_000017.11:g.9162921C>T	ExAC,gnomAD
rs754959235	p.Ala376Pro	missense variant	-	NC_000017.11:g.9162920G>C	ExAC,TOPMed,gnomAD
rs1196735610	p.Gly377Ala	missense variant	-	NC_000017.11:g.9162924G>C	gnomAD
rs1325419572	p.Gly377Ser	missense variant	-	NC_000017.11:g.9162923G>A	TOPMed,gnomAD
rs757439358	p.Arg378Cys	missense variant	-	NC_000017.11:g.9162926C>T	ExAC
rs1458294875	p.His379Leu	missense variant	-	NC_000017.11:g.9162930A>T	gnomAD
rs1037160564	p.His381Arg	missense variant	-	NC_000017.11:g.9162936A>G	TOPMed
rs758553071	p.Arg389His	missense variant	-	NC_000017.11:g.9162960G>A	NCI-TCGA
rs1477843526	p.Arg389Cys	missense variant	-	NC_000017.11:g.9162959C>T	TOPMed,gnomAD
rs758553071	p.Arg389His	missense variant	-	NC_000017.11:g.9162960G>A	ExAC,gnomAD
NCI-TCGA novel	p.Arg389Leu	missense variant	-	NC_000017.11:g.9162960G>T	NCI-TCGA
rs747583915	p.Asp390Asn	missense variant	-	NC_000017.11:g.9162962G>A	ExAC,gnomAD
rs1463713159	p.Met391Ile	missense variant	-	NC_000017.11:g.9162967G>T	TOPMed
rs1170602853	p.Met391Thr	missense variant	-	NC_000017.11:g.9162966T>C	TOPMed,gnomAD
rs1401613787	p.Gly392Asp	missense variant	-	NC_000017.11:g.9162969G>A	gnomAD
rs1247253192	p.Lys393Arg	missense variant	-	NC_000017.11:g.9162972A>G	TOPMed
rs769085897	p.Ile395Leu	missense variant	-	NC_000017.11:g.9162977A>C	ExAC,gnomAD
rs772961270	p.Arg398Gln	missense variant	-	NC_000017.11:g.9162987G>A	ExAC,gnomAD
rs1283511561	p.Arg398Trp	missense variant	-	NC_000017.11:g.9162986C>T	gnomAD
NCI-TCGA novel	p.Arg398Leu	missense variant	-	NC_000017.11:g.9162987G>T	NCI-TCGA
COSM3403418	p.Lys399Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000017.11:g.9162989A>T	NCI-TCGA Cosmic
rs1257370869	p.Ala400Thr	missense variant	-	NC_000017.11:g.9162992G>A	NCI-TCGA
rs1257370869	p.Ala400Thr	missense variant	-	NC_000017.11:g.9162992G>A	gnomAD
rs1251422099	p.Val409Met	missense variant	-	NC_000017.11:g.9179824G>A	TOPMed
rs1337230198	p.Lys414Glu	missense variant	-	NC_000017.11:g.9179839A>G	gnomAD
rs760664453	p.Lys414Arg	missense variant	-	NC_000017.11:g.9179840A>G	ExAC,gnomAD
rs768422332	p.Thr415Ile	missense variant	-	NC_000017.11:g.9179843C>T	ExAC,gnomAD
rs776507980	p.Asn417Ser	missense variant	-	NC_000017.11:g.9179849A>G	ExAC,gnomAD
rs761557142	p.Gln418His	missense variant	-	NC_000017.11:g.9179853A>T	ExAC,gnomAD
rs764990370	p.Thr420Asn	missense variant	-	NC_000017.11:g.9179858C>A	ExAC,gnomAD
rs1286087443	p.Gln422Arg	missense variant	-	NC_000017.11:g.9179864A>G	TOPMed
rs1352940456	p.Cys425Ser	missense variant	-	NC_000017.11:g.9179872T>A	TOPMed
rs1289412509	p.Lys426Asn	missense variant	-	NC_000017.11:g.9179877G>T	gnomAD
rs767706132	p.Gly428Ser	missense variant	-	NC_000017.11:g.9179881G>A	ExAC,gnomAD
rs1368135380	p.Val429Met	missense variant	-	NC_000017.11:g.9179884G>A	TOPMed
rs199736561	p.Thr430Met	missense variant	-	NC_000017.11:g.9179888C>T	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly431Arg	missense variant	-	NC_000017.11:g.9179890G>C	NCI-TCGA
rs764463891	p.Ile432Val	missense variant	-	NC_000017.11:g.9179893A>G	ExAC,TOPMed,gnomAD
rs367908355	p.Ile432Thr	missense variant	-	NC_000017.11:g.9179894T>C	ESP,ExAC,gnomAD
rs1034816738	p.Arg436Cys	missense variant	-	NC_000017.11:g.9179905C>T	TOPMed,gnomAD
rs779408192	p.Ala438Ser	missense variant	-	NC_000017.11:g.9179911G>T	ExAC,TOPMed,gnomAD
rs779408192	p.Ala438Thr	missense variant	-	NC_000017.11:g.9179911G>A	ExAC,TOPMed,gnomAD
rs1174788779	p.Gly440Ser	missense variant	-	NC_000017.11:g.9179917G>A	TOPMed
rs745580830	p.Gln443His	missense variant	-	NC_000017.11:g.9179928G>C	ExAC,gnomAD
NCI-TCGA novel	p.Arg445ProPheSerTerUnk	frameshift	-	NC_000017.11:g.9179933G>-	NCI-TCGA
rs758056714	p.Ser446Phe	missense variant	-	NC_000017.11:g.9179936C>T	ExAC,gnomAD
rs758056714	p.Ser446Cys	missense variant	-	NC_000017.11:g.9179936C>G	ExAC,gnomAD
rs1022072462	p.Pro447Ala	missense variant	-	NC_000017.11:g.9179938C>G	TOPMed,gnomAD
rs1022072462	p.Pro447Ser	missense variant	-	NC_000017.11:g.9179938C>T	TOPMed,gnomAD
rs1420549242	p.Ala449Thr	missense variant	-	NC_000017.11:g.9179944G>A	gnomAD
rs1190617393	p.Pro450Leu	missense variant	-	NC_000017.11:g.9179948C>T	TOPMed
rs1196305630	p.Pro450Ala	missense variant	-	NC_000017.11:g.9179947C>G	gnomAD
rs925672779	p.Ile452Val	missense variant	-	NC_000017.11:g.9179953A>G	TOPMed,gnomAD
rs776784254	p.Val456Ile	missense variant	-	NC_000017.11:g.9182924G>A	ExAC,TOPMed,gnomAD
rs762421437	p.Ala457Val	missense variant	-	NC_000017.11:g.9182928C>T	ExAC,gnomAD
rs149166851	p.Pro458Leu	missense variant	-	NC_000017.11:g.9182931C>T	ESP,ExAC,TOPMed,gnomAD
rs376278603	p.Pro459Thr	missense variant	-	NC_000017.11:g.9182933C>A	ESP,ExAC,TOPMed,gnomAD
rs370320158	p.Pro459Leu	missense variant	-	NC_000017.11:g.9182934C>T	ESP,ExAC,TOPMed,gnomAD
rs201647422	p.Thr460Met	missense variant	-	NC_000017.11:g.9182937C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs541757843	p.Thr460Pro	missense variant	-	NC_000017.11:g.9182936A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs777725695	p.Thr461Ile	missense variant	-	NC_000017.11:g.9182940C>T	ExAC,gnomAD
rs1426866580	p.Ala462Val	missense variant	-	NC_000017.11:g.9182943C>T	gnomAD
rs1296568733	p.Ala463Pro	missense variant	-	NC_000017.11:g.9182945G>C	gnomAD
rs1175810246	p.Ala463Val	missense variant	-	NC_000017.11:g.9182946C>T	TOPMed
rs1344989253	p.Ser464Gly	missense variant	-	NC_000017.11:g.9182948A>G	gnomAD
NCI-TCGA novel	p.Ser464Asn	missense variant	-	NC_000017.11:g.9182949G>A	NCI-TCGA
rs749223121	p.Ser465Arg	missense variant	-	NC_000017.11:g.9182953C>G	ExAC,TOPMed,gnomAD
COSM6082460	p.Val466Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9182954G>T	NCI-TCGA Cosmic
rs770685391	p.Val466Met	missense variant	-	NC_000017.11:g.9182954G>A	ExAC,TOPMed,gnomAD
rs1224906376	p.Glu467Lys	missense variant	-	NC_000017.11:g.9182957G>A	TOPMed
NCI-TCGA novel	p.Glu467Asp	missense variant	-	NC_000017.11:g.9182959G>T	NCI-TCGA
NCI-TCGA novel	p.Glu468Ter	stop gained	-	NC_000017.11:g.9182960G>T	NCI-TCGA
NCI-TCGA novel	p.Asp471Gly	missense variant	-	NC_000017.11:g.9221168A>G	NCI-TCGA
rs376071535	p.Cys472Trp	missense variant	-	NC_000017.11:g.9221172C>G	ESP,ExAC,TOPMed,gnomAD
rs761359652	p.Asp473Asn	missense variant	-	NC_000017.11:g.9221173G>A	ExAC,TOPMed,gnomAD
rs1263017163	p.Asp473Gly	missense variant	-	NC_000017.11:g.9221174A>G	gnomAD
rs1460500841	p.Tyr475His	missense variant	-	NC_000017.11:g.9221179T>C	gnomAD
rs192776775	p.Lys477Arg	missense variant	-	NC_000017.11:g.9221186A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs769415167	p.Lys477Glu	missense variant	-	NC_000017.11:g.9221185A>G	ExAC,gnomAD
rs763000977	p.Gly481Arg	missense variant	-	NC_000017.11:g.9221197G>A	ExAC,gnomAD
NCI-TCGA novel	p.Lys484Thr	missense variant	-	NC_000017.11:g.9221207A>C	NCI-TCGA
rs759450158	p.Asn486Asp	missense variant	-	NC_000017.11:g.9221212A>G	ExAC,gnomAD
rs1328658979	p.Met487Ile	missense variant	-	NC_000017.11:g.9221217G>T	TOPMed,gnomAD
rs527854751	p.Lys489Arg	missense variant	-	NC_000017.11:g.9221222A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs367820405	p.Lys489Asn	missense variant	-	NC_000017.11:g.9221223G>C	ESP,ExAC,TOPMed,gnomAD
VAR_014280	p.Lys489Glu	Missense	-	-	UniProt
rs1338831191	p.Tyr490Ser	missense variant	-	NC_000017.11:g.9221225A>C	gnomAD
COSM283405	p.Lys492Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9221232G>T	NCI-TCGA Cosmic
rs143263899	p.Lys493Asn	missense variant	-	NC_000017.11:g.9221235G>C	ESP,ExAC,TOPMed,gnomAD
rs781630973	p.Ala496Gly	missense variant	-	NC_000017.11:g.9239640C>G	ExAC,gnomAD
rs1199633261	p.Val497Ile	missense variant	-	NC_000017.11:g.9239642G>A	TOPMed
rs748416143	p.Gln498His	missense variant	-	NC_000017.11:g.9239647G>T	ExAC,gnomAD
rs146793027	p.His500Tyr	missense variant	-	NC_000017.11:g.9239651C>T	ESP,ExAC,gnomAD
rs1265173784	p.Ala504Val	missense variant	-	NC_000017.11:g.9239664C>T	TOPMed
rs777612620	p.Asp505Glu	missense variant	-	NC_000017.11:g.9239668C>G	ExAC
rs748931841	p.Ala507Val	missense variant	-	NC_000017.11:g.9239673C>T	ExAC,TOPMed,gnomAD
rs773929383	p.Gly508Glu	missense variant	-	NC_000017.11:g.9239676G>A	ExAC,TOPMed,gnomAD
COSM986407	p.Asp509Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9239678G>T	NCI-TCGA Cosmic
rs1439004109	p.Trp510Ser	missense variant	-	NC_000017.11:g.9239682G>C	gnomAD
rs1476064147	p.Phe513Leu	missense variant	-	NC_000017.11:g.9239690T>C	gnomAD
rs1349460578	p.Thr514Met	missense variant	-	NC_000017.11:g.9239694C>T	TOPMed
rs1234766339	p.Val515Ala	missense variant	-	NC_000017.11:g.9239697T>C	TOPMed
rs372941055	p.Ile517Val	missense variant	-	NC_000017.11:g.9239702A>G	ESP,ExAC,TOPMed,gnomAD
rs574346024	p.Ile518Val	missense variant	-	NC_000017.11:g.9239705A>G	1000Genomes,ExAC,gnomAD
VAR_082026	p.Ile518del	inframe_deletion	Mirror movements 4 (MRMV4) [MIM:618264]	-	UniProt
rs760426490	p.Ser519Phe	missense variant	-	NC_000017.11:g.9239709C>T	ExAC,gnomAD
rs201393437	p.Val520Leu	missense variant	-	NC_000017.11:g.9239711G>C	ExAC,TOPMed,gnomAD
rs766453556	p.Val520Ala	missense variant	-	NC_000017.11:g.9239712T>C	ExAC,TOPMed,gnomAD
rs201393437	p.Val520Met	missense variant	-	NC_000017.11:g.9239711G>A	ExAC,TOPMed,gnomAD
rs751537816	p.Gln523Arg	missense variant	-	NC_000017.11:g.9239721A>G	ExAC,gnomAD
rs755534824	p.Gly524Arg	missense variant	-	NC_000017.11:g.9239723G>C	ExAC
NCI-TCGA novel	p.Gly524Asp	missense variant	-	NC_000017.11:g.9239724G>A	NCI-TCGA
rs767874469	p.Thr525Arg	missense variant	-	NC_000017.11:g.9239727C>G	ExAC,gnomAD
rs767874469	p.Thr525Met	missense variant	-	NC_000017.11:g.9239727C>T	ExAC,gnomAD
rs753221564	p.Ser526Asn	missense variant	-	NC_000017.11:g.9239730G>A	ExAC,TOPMed,gnomAD
rs756488485	p.Arg527His	missense variant	-	NC_000017.11:g.9239733G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg527Pro	missense variant	-	NC_000017.11:g.9239733G>C	NCI-TCGA
NCI-TCGA novel	p.Arg530His	missense variant	-	NC_000017.11:g.9239742G>A	NCI-TCGA
rs756910433	p.Gly531Arg	missense variant	-	NC_000017.11:g.9239744G>C	ExAC,TOPMed,gnomAD
rs778586513	p.Asp532Asn	missense variant	-	NC_000017.11:g.9239747G>A	ExAC,TOPMed,gnomAD
rs1323074317	p.Gln533His	missense variant	-	NC_000017.11:g.9239752G>C	gnomAD
rs1027810331	p.Gln533Glu	missense variant	-	NC_000017.11:g.9239750C>G	TOPMed
rs1265292089	p.Arg538Cys	missense variant	-	NC_000017.11:g.9239765C>T	TOPMed
rs771578807	p.Arg538His	missense variant	-	NC_000017.11:g.9239766G>A	ExAC,TOPMed,gnomAD
rs771578807	p.Arg538Pro	missense variant	-	NC_000017.11:g.9239766G>C	ExAC,TOPMed,gnomAD
COSM986408	p.Asp541Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9239775A>G	NCI-TCGA Cosmic
rs940885304	p.Ala543Thr	missense variant	-	NC_000017.11:g.9239780G>A	gnomAD
rs751928074	p.Pro547Ser	missense variant	-	NC_000017.11:g.9239792C>T	gnomAD
rs1281955856	p.Lys548Glu	missense variant	-	NC_000017.11:g.9239795A>G	gnomAD
rs1316054908	p.Lys548Thr	missense variant	-	NC_000017.11:g.9239796A>C	gnomAD
rs372411993	p.Ile549Met	missense variant	-	NC_000017.11:g.9239800C>G	ESP,TOPMed,gnomAD
rs746951758	p.Pro551Ser	missense variant	-	NC_000017.11:g.9239804C>T	ExAC,TOPMed,gnomAD
rs746951758	p.Pro551Thr	missense variant	-	NC_000017.11:g.9239804C>A	ExAC,TOPMed,gnomAD
rs1243790900	p.Lys553Met	missense variant	-	NC_000017.11:g.9239811A>T	TOPMed,gnomAD
rs768506222	p.Lys553Gln	missense variant	-	NC_000017.11:g.9239810A>C	ExAC,gnomAD
rs776341534	p.Leu556Val	missense variant	-	NC_000017.11:g.9239819C>G	ExAC,gnomAD
rs1419981732	p.Gly559Ser	missense variant	-	NC_000017.11:g.9239828G>A	gnomAD
rs1162045663	p.Asn560Ser	missense variant	-	NC_000017.11:g.9239832A>G	gnomAD
rs1404484921	p.Asn560Lys	missense variant	-	NC_000017.11:g.9239833C>A	gnomAD
rs774523281	p.Ala561Gly	missense variant	-	NC_000017.11:g.9239835C>G	ExAC,TOPMed,gnomAD
rs766541731	p.Ala561Thr	missense variant	-	NC_000017.11:g.9239834G>A	ExAC,gnomAD
rs774523281	p.Ala561Val	missense variant	-	NC_000017.11:g.9239835C>T	ExAC,TOPMed,gnomAD
rs1359220268	p.Asp563His	missense variant	-	NC_000017.11:g.9239840G>C	TOPMed,gnomAD
rs1359220268	p.Asp563Asn	missense variant	-	NC_000017.11:g.9239840G>A	TOPMed,gnomAD
COSM1303570	p.Ser564Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.9239844C>T	NCI-TCGA Cosmic
rs1449790598	p.Ser564Thr	missense variant	-	NC_000017.11:g.9239843T>A	gnomAD
rs1326281968	p.Ser564Cys	missense variant	-	NC_000017.11:g.9239844C>G	TOPMed
rs1372383609	p.Pro565Gln	missense variant	-	NC_000017.11:g.9239847C>A	gnomAD
rs1228728087	p.Gln567Ter	stop gained	-	NC_000017.11:g.9239852C>T	gnomAD
rs1289958693	p.Ser568Gly	missense variant	-	NC_000017.11:g.9239855A>G	gnomAD
rs767616324	p.Gly569Arg	missense variant	-	NC_000017.11:g.9239858G>C	ExAC,gnomAD
rs767616324	p.Gly569Ser	missense variant	-	NC_000017.11:g.9239858G>A	ExAC,gnomAD
rs199592596	p.Val571Met	missense variant	-	NC_000017.11:g.9239864G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs756618575	p.Ala572Val	missense variant	-	NC_000017.11:g.9239868C>T	ExAC,gnomAD
rs756618575	p.Ala572Gly	missense variant	-	NC_000017.11:g.9239868C>G	ExAC,gnomAD
rs1202701393	p.Asp573Asn	missense variant	-	NC_000017.11:g.9239870G>A	TOPMed,gnomAD
rs764564681	p.Asp573Gly	missense variant	-	NC_000017.11:g.9239871A>G	ExAC,gnomAD
rs1202701393	p.Asp573His	missense variant	-	NC_000017.11:g.9239870G>C	TOPMed,gnomAD
rs1184833926	p.Val578Ala	missense variant	-	NC_000017.11:g.9239886T>C	gnomAD
rs77968125	p.Val578Met	missense variant	-	NC_000017.11:g.9239885G>A	gnomAD
rs77968125	p.Val578Leu	missense variant	-	NC_000017.11:g.9239885G>C	gnomAD
rs754203987	p.Arg582Gln	missense variant	-	NC_000017.11:g.9239898G>A	ExAC,TOPMed,gnomAD
rs754203987	p.Arg582Leu	missense variant	-	NC_000017.11:g.9239898G>T	ExAC,TOPMed,gnomAD
rs1177707494	p.Asp583Ala	missense variant	-	NC_000017.11:g.9239901A>C	gnomAD
rs1425264637	p.Thr584Arg	missense variant	-	NC_000017.11:g.9239904C>G	gnomAD
rs1415643317	p.Ala586Thr	missense variant	-	NC_000017.11:g.9239909G>A	gnomAD
rs1326470780	p.Arg587Trp	missense variant	-	NC_000017.11:g.9239912C>T	gnomAD
rs1353610676	p.Arg587Gln	missense variant	-	NC_000017.11:g.9239913G>A	gnomAD
rs1410023585	p.Arg588Trp	missense variant	-	NC_000017.11:g.9239915C>T	TOPMed,gnomAD
rs1309693313	p.Arg590Pro	missense variant	-	NC_000017.11:g.9239922G>C	TOPMed,gnomAD
rs1309693313	p.Arg590His	missense variant	-	NC_000017.11:g.9239922G>A	TOPMed,gnomAD
rs778747963	p.Gln593Arg	missense variant	-	NC_000017.11:g.9239931A>G	ExAC,gnomAD
rs1275306683	p.Gln594Ter	stop gained	-	NC_000017.11:g.9239933C>T	gnomAD
rs1427193309	p.Lys598Arg	missense variant	-	NC_000017.11:g.9239946A>G	TOPMed
rs1458758706	p.Gly599Ser	missense variant	-	NC_000017.11:g.9239948G>A	TOPMed
NCI-TCGA novel	p.Gly599Asp	missense variant	-	NC_000017.11:g.9239949G>A	NCI-TCGA
rs757903979	p.Lys600Thr	missense variant	-	NC_000017.11:g.9239952A>C	ExAC,gnomAD
RCV000735956	p.Cys601Ser	missense variant	MIRROR MOVEMENTS 4 (MRMV4)	NC_000017.11:g.9239955G>C	ClinVar
RCV000735954	p.Cys601Arg	missense variant	MIRROR MOVEMENTS 4 (MRMV4)	NC_000017.11:g.9239954T>C	ClinVar
VAR_082027	p.Cys601Arg	Missense	Mirror movements 4 (MRMV4) [MIM:618264]	-	UniProt
VAR_082028	p.Cys601Ser	Missense	Mirror movements 4 (MRMV4) [MIM:618264]	-	UniProt
rs1207540547	p.Lys602Gln	missense variant	-	NC_000017.11:g.9239957A>C	TOPMed,gnomAD
rs1200817962	p.Ala604Val	missense variant	-	NC_000017.11:g.9239964C>T	gnomAD
rs746926114	p.Ala604Thr	missense variant	-	NC_000017.11:g.9239963G>A	ExAC,TOPMed,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0000768	Congenital Abnormality	group	BEFREE
C0002395	Alzheimer's Disease	disease	BEFREE
C0002726	Amyloidosis	disease	BEFREE
C0003850	Arteriosclerosis	disease	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE;GWASDB
C0004153	Atherosclerosis	disease	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0006826	Malignant Neoplasms	group	BEFREE
C0007102	Malignant tumor of colon	disease	BEFREE
C0007103	Malignant neoplasm of endometrium	disease	BEFREE
C0007131	Non-Small Cell Lung Carcinoma	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE
C0007222	Cardiovascular Diseases	group	BEFREE
C0008924	Cleft upper lip	disease	GWASCAT;GWASDB
C0009319	Colitis	disease	BEFREE
C0009324	Ulcerative Colitis	disease	BEFREE
C0009375	Colonic Neoplasms	group	BEFREE
C0009402	Colorectal Carcinoma	disease	BEFREE
C0009404	Colorectal Neoplasms	group	BEFREE;LHGDN
C0010054	Coronary Arteriosclerosis	disease	BEFREE
C0010068	Coronary heart disease	disease	BEFREE
C0011847	Diabetes	disease	BEFREE
C0011849	Diabetes Mellitus	group	BEFREE
C0014070	Encephalomyelitis	disease	BEFREE
C0015544	Failure to Thrive	disease	BEFREE
C0017636	Glioblastoma	disease	BEFREE
C0019196	Hepatitis C	disease	BEFREE
C0021368	Inflammation	phenotype	LHGDN
C0021390	Inflammatory Bowel Diseases	group	BEFREE
C0021841	Intestinal Neoplasms	group	BEFREE
C0022660	Kidney Failure, Acute	disease	BEFREE
C0024121	Lung Neoplasms	group	BEFREE;LHGDN
C0025149	Medulloblastoma	disease	BEFREE
C0026769	Multiple Sclerosis	disease	BEFREE
C0026896	Myasthenia Gravis	disease	BEFREE
C0027051	Myocardial Infarction	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027819	Neuroblastoma	group	BEFREE
C0029408	Degenerative polyarthritis	disease	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0031154	Peritonitis	disease	BEFREE
C0038525	Subarachnoid Hemorrhage	disease	BEFREE
C0040100	Thymoma	disease	BEFREE
C0085109	Corneal Neovascularization	disease	BEFREE
C0178874	Tumor Progression	phenotype	BEFREE
C0220650	Metastatic malignant neoplasm to brain	disease	BEFREE
C0220810	Congenital defects	group	BEFREE
C0242287	Isaacs syndrome	disease	BEFREE
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0243026	Sepsis	disease	LHGDN
C0278488	Carcinoma breast stage IV	disease	BEFREE
C0278510	Childhood Medulloblastoma	disease	BEFREE
C0346629	Malignant neoplasm of large intestine	disease	BEFREE
C0454455	Mirror movements disorder	disease	BEFREE
C0476089	Endometrial Carcinoma	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0677886	Epithelial ovarian cancer	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0684249	Carcinoma of lung	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0700095	Central neuroblastoma	disease	BEFREE
C0878787	Growth failure	phenotype	BEFREE
C0920646	Ischemia of kidney	disease	BEFREE
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1306459	Primary malignant neoplasm	group	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1378703	Renal carcinoma	disease	BEFREE
C1458155	Mammary Neoplasms	group	BEFREE;LHGDN
C1519383	Smoking Behaviors	phenotype	GWASCAT
C1527249	Colorectal Cancer	disease	BEFREE
C1561643	Chronic Kidney Diseases	group	BEFREE
C1563716	Thyroid Dysgenesis	disease	BEFREE
C1883486	Uterine Corpus Cancer	disease	BEFREE
C1956346	Coronary Artery Disease	disease	BEFREE
C2118460	Acute colitis	disease	BEFREE
C2239176	Liver carcinoma	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0005515	protein binding	IPI

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001764	neuron migration	IEA
GO:0006915	apoptotic process	IEA
GO:0006930	substrate-dependent cell migration, cell extension	ISS
GO:0007097	nuclear migration	IEA
GO:0007265	Ras protein signal transduction	ISS
GO:0008045	motor neuron axon guidance	IBA
GO:0008284	positive regulation of cell population proliferation	IEA
GO:0009887	animal organ morphogenesis	IBA
GO:0009888	tissue development	IBA
GO:0016358	dendrite development	IBA
GO:0030334	regulation of cell migration	IEA
GO:0030517	negative regulation of axon extension	IEA
GO:0032488	Cdc42 protein signal transduction	ISS
GO:0033564	anterior/posterior axon guidance	IEA
GO:0042472	inner ear morphogenesis	IEA
GO:0045773	positive regulation of axon extension	ISS
GO:0051963	regulation of synapse assembly	IEA
GO:0060603	mammary gland duct morphogenesis	IEA
GO:0061643	chemorepulsion of axon	ISS
GO:0098609	cell-cell adhesion	IEA
GO:1902842	negative regulation of netrin-activated signaling pathway	TAS
GO:2000147	positive regulation of cell motility	ISS

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005576	extracellular region	IDA
GO:0005576	extracellular region	TAS
GO:0005604	basement membrane	IBA
GO:0005737	cytoplasm	IEA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1266738	Developmental Biology	TAS
R-HSA-1266738	Developmental Biology	IEA
R-HSA-373752	Netrin-1 signaling	TAS
R-HSA-373752	Netrin-1 signaling	IEA
R-HSA-376172	DSCAM interactions	IEA
R-HSA-376176	Signaling by ROBO receptors	IEA
R-HSA-418885	DCC mediated attractive signaling	TAS
R-HSA-418885	DCC mediated attractive signaling	IEA
R-HSA-418886	Netrin mediated repulsion signals	IEA
R-HSA-418890	Role of second messengers in netrin-1 signaling	IEA
R-HSA-422475	Axon guidance	TAS
R-HSA-422475	Axon guidance	IEA
R-HSA-428542	Regulation of commissural axon pathfinding by SLIT and ROBO	IEA

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of NTN1 mRNA	28628672
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of NTN1 mRNA	28628672
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in decreased expression of NTN1 mRNA	24810058
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [NTN1 protein results in decreased expression of ICAM1 protein]	29162556
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [NTN1 protein results in decreased expression of IL6 protein]	29162556
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [NTN1 protein results in decreased expression of MPO protein]	29162556
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [NTN1 protein results in decreased expression of RELA protein]	29162556
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [NTN1 protein results in decreased expression of TNF protein]	29162556
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane results in decreased susceptibility to NTN1 protein	29162556
C583074	4,4'-hexafluorisopropylidene diphenol	4,4'-hexafluorisopropylidene diphenol results in increased expression of NTN1 mRNA	27567155
C496492	abrine	abrine results in increased expression of NTN1 mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in increased expression of NTN1 mRNA	26690555; 29067470;
D016604	Aflatoxin B1	Aflatoxin B1 affects the methylation of NTN1 intron	30157460
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased expression of NTN1 mRNA	22100608
D000447	Aldehydes	Aldehydes results in increased expression of NTN1 mRNA	25014914
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of NTN1 mRNA	16483693
D001151	Arsenic	Arsenic results in increased expression of NTN1 mRNA	24019935
D001280	Atrazine	Atrazine results in decreased expression of NTN1 mRNA	25929836
C030935	benz(a)anthracene	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of NTN1 mRNA	27858113
D001564	Benzo(a)pyrene	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of NTN1 mRNA	27858113
D001564	Benzo(a)pyrene	Benzo(a)pyrene promotes the reaction [AHR protein binds to NTN1 promoter]	19654925
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of NTN1 mRNA	21569818
C006703	benzo(b)fluoranthene	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of NTN1 mRNA	27858113
C026487	benzo(e)pyrene	benzo(e)pyrene results in decreased methylation of NTN1 intron	30157460
C022921	benzo(k)fluoranthene	benzo(k)fluoranthene results in increased expression of NTN1 mRNA	26377693
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of NTN1 mRNA	30951980
C006780	bisphenol A	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of NTN1 mRNA	28628672
C006780	bisphenol A	bisphenol A results in increased expression of NTN1 mRNA	30951980
C006780	bisphenol A	bisphenol A affects the expression of NTN1 mRNA	30816183
C006780	bisphenol A	bisphenol A results in decreased expression of NTN1 mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased methylation of NTN1 gene	28505145
C000611646	bisphenol F	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of NTN1 mRNA	28628672
C000611646	bisphenol F	bisphenol F results in increased expression of NTN1 mRNA	30951980
C018475	butyraldehyde	butyraldehyde results in increased expression of NTN1 mRNA	26079696
D002104	Cadmium	Cadmium results in increased expression of NTN1 mRNA	24376830
D019256	Cadmium Chloride	Cadmium Chloride results in increased export of NTN1 protein	29421648
D019256	Cadmium Chloride	Curcumin inhibits the reaction [Cadmium Chloride results in increased export of NTN1 protein]	29421648
D002251	Carbon Tetrachloride	Carbon Tetrachloride affects the expression of NTN1 mRNA	17484886
C031180	chrysene	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of NTN1 mRNA	27858113
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in increased expression of NTN1 mRNA	27392435
D002945	Cisplatin	Cisplatin results in increased expression of NTN1 mRNA	27392435
D002990	Clobetasol	Clobetasol results in decreased expression of NTN1 mRNA	27462272
D003042	Cocaine	Cocaine results in decreased expression of NTN1 mRNA	17898221
D003474	Curcumin	Curcumin inhibits the reaction [Cadmium Chloride results in increased export of NTN1 protein]	29421648
D003634	DDT	DDT results in increased methylation of NTN1 gene	30207508
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of NTN1 mRNA	28628672
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of NTN1 mRNA	28628672
D003976	Diazinon	Diazinon affects the expression of NTN1 mRNA	22546817
D004026	Dieldrin	Dieldrin affects the expression of NTN1 mRNA	22546817
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of NTN1 mRNA	31163220
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with Phenobarbital] results in decreased expression of NTN1 mRNA	24535843
D004052	Diethylnitrosamine	Diethylnitrosamine results in decreased expression of NTN1 mRNA	24535843
D004317	Doxorubicin	Doxorubicin results in decreased expression of NTN1 mRNA	29803840
D004317	Doxorubicin	Doxorubicin results in increased expression of NTN1 mRNA	30031762
D004317	Doxorubicin	Doxorubicin results in increased expression of NTN1 mRNA	25896364
D004958	Estradiol	[Estradiol co-treated with Plant Preparations] results in decreased expression of NTN1 mRNA	26945725
D000431	Ethanol	Ethanol results in increased expression of NTN1 mRNA	30319688
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of NTN1 mRNA	23129252
C063007	exoenzyme C3, Clostridium botulinum	exoenzyme C3, Clostridium botulinum inhibits the reaction [lead titanate zirconate results in decreased expression of NTN1 protein]	24203571
D017313	Fenretinide	Fenretinide results in increased expression of NTN1 mRNA	28973697
D005947	Glucose	NTN1 protein inhibits the reaction [Glucose results in decreased phosphorylation of MAPK1 protein]	29059224
D005947	Glucose	NTN1 protein inhibits the reaction [Glucose results in decreased phosphorylation of MAPK3 protein]	29059224
D005947	Glucose	NTN1 protein inhibits the reaction [Glucose results in decreased phosphorylation of NOS3 protein]	29059224
D005947	Glucose	NTN1 protein inhibits the reaction [Glucose results in increased activity of CASP3 protein]	29059224
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of NTN1 mRNA	28628672
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of NTN1 mRNA	28628672
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in increased expression of NTN1 mRNA	27392435
D007608	Kainic Acid	Kainic Acid results in increased expression of NTN1 mRNA	19700661
C065536	lead titanate zirconate	exoenzyme C3, Clostridium botulinum inhibits the reaction [lead titanate zirconate results in decreased expression of NTN1 protein]	24203571
C065536	lead titanate zirconate	lead titanate zirconate results in decreased expression of NTN1 protein	24203571
D018021	Lithium Chloride	Lithium Chloride results in decreased expression of NTN1 mRNA	23527032
D008344	Maneb	[LRRK2 protein mutant form co-treated with Maneb co-treated with Paraquat] results in decreased expression of NTN1 mRNA	23017109
D008344	Maneb	[Maneb co-treated with Paraquat] results in decreased expression of NTN1 mRNA	23017109
D008701	Methapyrilene	Methapyrilene results in decreased methylation of NTN1 intron	30157460
D008777	Methyltestosterone	Methyltestosterone results in decreased expression of NTN1 mRNA	29191790
D008999	Monocrotophos	Monocrotophos affects the expression of NTN1 mRNA	28645554
C022838	nickel chloride	nickel chloride affects the expression of NTN1 mRNA	22546817
D010269	Paraquat	[LRRK2 protein mutant form co-treated with Maneb co-treated with Paraquat] results in decreased expression of NTN1 mRNA	23017109
D010269	Paraquat	[Maneb co-treated with Paraquat] results in decreased expression of NTN1 mRNA	23017109
C046012	pentanal	pentanal results in increased expression of NTN1 mRNA	26079696
D010634	Phenobarbital	[Diethylnitrosamine co-treated with Phenobarbital] results in decreased expression of NTN1 mRNA	24535843
C006253	pirinixic acid	pirinixic acid results in decreased expression of NTN1 mRNA	20813756
D028321	Plant Preparations	[Estradiol co-treated with Plant Preparations] results in decreased expression of NTN1 mRNA	26945725
C005556	propionaldehyde	propionaldehyde results in increased expression of NTN1 mRNA	26079696
D012402	Rotenone	Rotenone results in decreased expression of NTN1 mRNA	29955902
D012822	Silicon Dioxide	Silicon Dioxide analog results in decreased expression of NTN1 mRNA	25895662
D012822	Silicon Dioxide	Silicon Dioxide analog results in increased expression of NTN1 mRNA	23806026
D012834	Silver	Silver results in decreased expression of NTN1 mRNA	27131904
C017947	sodium arsenite	sodium arsenite affects the methylation of NTN1 gene	28589171
C017947	sodium arsenite	sodium arsenite results in increased expression of NTN1 mRNA	29301061
D013311	Streptozocin	[NTN1 protein co-treated with Streptozocin] results in increased expression of ARG1 protein	29059224
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	29059224
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased expression of CDKN2A mRNA]	29059224
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased expression of CDKN2A protein]	29059224
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased expression of PTGS2 protein]	29059224
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased expression of RELA protein]	29059224
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased expression of TRP53 mRNA]	29059224
D013311	Streptozocin	NTN1 protein promotes the reaction [Streptozocin results in increased expression of DCC mRNA]	29059224
D013311	Streptozocin	NTN1 protein promotes the reaction [Streptozocin results in increased expression of DCC protein]	29059224
D013311	Streptozocin	Streptozocin promotes the reaction [NTN1 protein results in increased phosphorylation of MAPK1 protein]	29059224
D013311	Streptozocin	Streptozocin promotes the reaction [NTN1 protein results in increased phosphorylation of MAPK3 protein]	29059224
D013311	Streptozocin	Streptozocin results in decreased expression of NTN1 protein	29059224
D000077210	Sunitinib	Sunitinib results in decreased expression of NTN1 mRNA	31533062
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to NTN1 promoter]	19654925
C009495	titanium dioxide	titanium dioxide results in decreased expression of NTN1 mRNA	29264374
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of NTN1 protein	30291989
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased expression of NTN1 mRNA	28065790
C012589	trichostatin A	trichostatin A results in increased expression of NTN1 mRNA	24935251
D014260	Triclosan	Triclosan results in increased expression of NTN1 mRNA	30510588
D000077288	Troglitazone	Troglitazone results in decreased expression of NTN1 mRNA	28973697
D014635	Valproic Acid	Valproic Acid results in increased expression of NTN1 mRNA	28001369
D014635	Valproic Acid	Valproic Acid results in increased methylation of NTN1 gene	29154799
D014635	Valproic Acid	Valproic Acid results in decreased expression of NTN1 mRNA	29261810
D014635	Valproic Acid	Valproic Acid results in increased expression of NTN1 mRNA	24896083
C070417	Win 55212-2	Win 55212-2 results in increased expression of NTN1 mRNA	12237329
D000077211	Zoledronic Acid	Zoledronic Acid results in increased expression of NTN1 mRNA	24714768

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0053	Apoptosis
KW-0963	Cytoplasm
KW-0225	Disease mutation
KW-1015	Disulfide bond
KW-0325	Glycoprotein
KW-0424	Laminin EGF-like domain
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0677	Repeat
KW-0964	Secreted
KW-0732	Signal

Interpro

InterPro ID	InterPro Term
IPR008979	Galactose-bd-like_sf
IPR002049	Laminin_EGF
IPR008211	Laminin_N
IPR038684	Laminin_N_sf
IPR001134	Netrin_domain
IPR018933	Netrin_module_non-TIMP
IPR008993	TIMP-like_OB-fold

PROSITE

PROSITE ID	PROSITE Term
PS00022	EGF_1
PS01248	EGF_LAM_1
PS50027	EGF_LAM_2
PS51117	LAMININ_NTER
PS50189	NTR

Pfam

Pfam ID	Pfam Term
PF00053	Laminin_EGF
PF00055	Laminin_N
PF01759	NTR

Gene: NTN1

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Identified variants/mutations related to cleft phenotype

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction