CleftGeneDB-Search

Gene: TFAP2A

Basic information

Tag	Content
Uniprot ID	P05549; Q13777; Q5TAV5; Q8N1C6;
Entrez ID	7020
Genbank protein ID	AAH17754.1; CAB59735.1; AAA35539.1; CAA36842.1; EAW55249.1; AAA02487.1;
Genbank nucleotide ID	NM_001042425.1; NM_003220.2; NM_001032280.2;
Ensembl protein ID	ENSP00000501092; ENSP00000316516; ENSP00000368928;
Ensembl nucleotide ID	ENSG00000137203
Gene name	Transcription factor AP-2-alpha
Gene symbol	TFAP2A
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Manually collected
Reference	21781438; 26602496;
Functional description	Sequence-specific DNA-binding protein that interacts with inducible viral and cellular enhancer elements to regulate transcription of selected genes. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. AP-2-alpha is the only AP-2 protein required for early morphogenesis of the lens vesicle. Together with the CITED2 coactivator, stimulates the PITX2 P1 promoter transcription activation. Associates with chromatin to the PITX2 P1 promoter region.
Sequence	MLWKLTDNIK YEDCEDRHDG TSNGTARLPQ LGTVGQSPYT SAPPLSHTPN ADFQPPYFPP 60 PYQPIYPQSQ DPYSHVNDPY SLNPLHAQPQ PQHPGWPGQR QSQESGLLHT HRGLPHQLSG 120 LDPRRDYRRH EDLLHGPHAL SSGLGDLSIH SLPHAIEEVP HVEDPGINIP DQTVIKKGPV 180 SLSKSNSNAV SAIPINKDNL FGGVVNPNEV FCSVPGRLSL LSSTSKYKVT VAEVQRRLSP 240 PECLNASLLG GVLRRAKSKN GGRSLREKLD KIGLNLPAGR RKAANVTLLT SLVEGEAVHL 300 ARDFGYVCET EFPAKAVAEF LNRQHSDPNE QVTRKNMLLA TKQICKEFTD LLAQDRSPLG 360 NSRPNPILEP GIQSCLTHFN LISHGFGSPA VCAAVTALQN YLTEALKAMD KMYLSNNPNS 420 HTDNNAKSSD KEEKHRK 437

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

There is no orthologous record for this gene !

Identified variants/mutations related to cleft phenotype

Gene symbol	Significant Variants/SNPS	Methods	PubMed ID
TFAP2A	rs303050A>G	PCR	21781438
TFAP2A	rs3798693C>T	PCR	21781438
TFAP2A	rs533558*G	Genotyping	21781438
TFAP2A	rs9381107G>A	GWAS	28232668

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1472670698	p.Thr6Met	missense variant	-	NC_000006.12:g.10414969G>A	gnomAD
rs897507137	p.Asn8Thr	missense variant	-	NC_000006.12:g.10414963T>G	TOPMed,gnomAD
rs897507137	p.Asn8Ser	missense variant	-	NC_000006.12:g.10414963T>C	TOPMed,gnomAD
rs745818259	p.Tyr11Cys	missense variant	-	NC_000006.12:g.10414954T>C	ExAC,TOPMed,gnomAD
rs972628376	p.Glu12Asp	missense variant	-	NC_000006.12:g.10414950C>G	TOPMed,gnomAD
rs757277133	p.Asp13Gly	missense variant	-	NC_000006.12:g.10414948T>C	ExAC,gnomAD
rs1390260109	p.Asp16Asn	missense variant	-	NC_000006.12:g.10410335C>T	gnomAD
rs143258135	p.Gly20Asp	missense variant	-	NC_000006.12:g.10410322C>T	ESP,ExAC,TOPMed,gnomAD
rs143258135	p.Gly20Val	missense variant	-	NC_000006.12:g.10410322C>A	ESP,ExAC,TOPMed,gnomAD
rs1031902856	p.Gly20Ser	missense variant	-	NC_000006.12:g.10410323C>T	TOPMed
rs1158262777	p.Gly24Arg	missense variant	-	NC_000006.12:g.10410311C>T	gnomAD
rs1480723872	p.Thr25Arg	missense variant	-	NC_000006.12:g.10410307G>C	TOPMed,gnomAD
rs1480723872	p.Thr25Lys	missense variant	-	NC_000006.12:g.10410307G>T	TOPMed,gnomAD
rs1247903803	p.Ala26Thr	missense variant	-	NC_000006.12:g.10410305C>T	gnomAD
rs1417791100	p.Gln30Arg	missense variant	-	NC_000006.12:g.10410292T>C	TOPMed
rs9368354	p.Thr33Ala	missense variant	-	NC_000006.12:g.10410284T>C	ExAC,TOPMed,gnomAD
rs780216169	p.Val34Gly	missense variant	-	NC_000006.12:g.10410280A>C	ExAC,TOPMed,gnomAD
rs772479857	p.Gly35Val	missense variant	-	NC_000006.12:g.10410277C>A	ExAC,TOPMed,gnomAD
rs1468852747	p.Ser37Thr	missense variant	-	NC_000006.12:g.10410272A>T	TOPMed
rs779448987	p.Ser37Phe	missense variant	-	NC_000006.12:g.10410271G>A	ExAC,TOPMed,gnomAD
rs1277168345	p.Pro38His	missense variant	-	NC_000006.12:g.10410268G>T	gnomAD
rs1324911573	p.Pro38Ser	missense variant	-	NC_000006.12:g.10410269G>A	TOPMed,gnomAD
rs1231120267	p.Thr40Met	missense variant	-	NC_000006.12:g.10410262G>A	gnomAD
rs373246714	p.Ala42Ser	missense variant	-	NC_000006.12:g.10410257C>A	ESP,ExAC,gnomAD
rs751224702	p.Leu45Pro	missense variant	-	NC_000006.12:g.10410247A>G	ExAC,gnomAD
rs762787739	p.His47Pro	missense variant	-	NC_000006.12:g.10410241T>G	ExAC,gnomAD
rs765183722	p.Thr48Ser	missense variant	-	NC_000006.12:g.10410238G>C	ExAC,gnomAD
rs750226796	p.Thr48Pro	missense variant	-	NC_000006.12:g.10410239T>G	ExAC,TOPMed,gnomAD
rs765183722	p.Thr48Ile	missense variant	-	NC_000006.12:g.10410238G>A	ExAC,gnomAD
rs761863117	p.Pro49Leu	missense variant	-	NC_000006.12:g.10410235G>A	ExAC,gnomAD
rs1373206188	p.Pro49Ser	missense variant	-	NC_000006.12:g.10410236G>A	gnomAD
rs527785340	p.Asn50Ser	missense variant	-	NC_000006.12:g.10410232T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs776792762	p.Asn50His	missense variant	-	NC_000006.12:g.10410233T>G	ExAC,gnomAD
rs760904143	p.Ala51Pro	missense variant	-	NC_000006.12:g.10410230C>G	ExAC
rs1443395951	p.Asp52Asn	missense variant	-	NC_000006.12:g.10410227C>T	TOPMed,gnomAD
rs775764363	p.Asp52Ala	missense variant	-	NC_000006.12:g.10410226T>G	ExAC
rs772228476	p.Phe53Leu	missense variant	-	NC_000006.12:g.10410224A>G	ExAC,gnomAD
rs1199306870	p.Pro55Thr	missense variant	-	NC_000006.12:g.10410218G>T	gnomAD
rs749803917	p.Phe58Ser	missense variant	-	NC_000006.12:g.10410208A>G	ExAC,gnomAD
rs1297198582	p.Phe58Leu	missense variant	-	NC_000006.12:g.10410207G>C	TOPMed,gnomAD
rs778321721	p.Pro60Gln	missense variant	-	NC_000006.12:g.10410202G>T	ExAC
rs746550070	p.Tyr62Ser	missense variant	-	NC_000006.12:g.10410196T>G	ExAC,gnomAD
rs758018662	p.Tyr66Cys	missense variant	-	NC_000006.12:g.10410184T>C	ExAC,gnomAD
rs750185451	p.Gln68Glu	missense variant	-	NC_000006.12:g.10410179G>C	ExAC,TOPMed,gnomAD
rs560684169	p.Asp71Glu	missense variant	-	NC_000006.12:g.10410168A>T	1000Genomes,ExAC,TOPMed
rs753822419	p.Pro72Ala	missense variant	-	NC_000006.12:g.10410167G>C	ExAC,TOPMed,gnomAD
rs753822419	p.Pro72Thr	missense variant	-	NC_000006.12:g.10410167G>T	ExAC,TOPMed,gnomAD
rs764184708	p.Ser74Thr	missense variant	-	NC_000006.12:g.10410161A>T	ExAC,gnomAD
rs1442384775	p.His75Tyr	missense variant	-	NC_000006.12:g.10410158G>A	gnomAD
rs1193218173	p.Val76Ile	missense variant	-	NC_000006.12:g.10410155C>T	gnomAD
rs775468691	p.Asn77Lys	missense variant	-	NC_000006.12:g.10410150G>C	ExAC,gnomAD
rs1207350614	p.Pro79Ala	missense variant	-	NC_000006.12:g.10410146G>C	TOPMed,gnomAD
rs1064797321	p.Pro79Arg	missense variant	-	NC_000006.12:g.10410145G>C	TOPMed,gnomAD
rs1340179779	p.Tyr80Cys	missense variant	-	NC_000006.12:g.10410142T>C	gnomAD
rs1229159576	p.Pro84Ala	missense variant	-	NC_000006.12:g.10410131G>C	gnomAD
rs200131527	p.Pro84Leu	missense variant	-	NC_000006.12:g.10410130G>A	ESP,ExAC,TOPMed,gnomAD
rs376101872	p.Leu85Val	missense variant	-	NC_000006.12:g.10410128G>C	ESP,gnomAD
rs545067807	p.His86Gln	missense variant	-	NC_000006.12:g.10410123G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1309820486	p.Ala87Thr	missense variant	-	NC_000006.12:g.10410122C>T	gnomAD
rs1369464081	p.Pro89Arg	missense variant	-	NC_000006.12:g.10410115G>C	gnomAD
rs746489683	p.Pro97Ser	missense variant	-	NC_000006.12:g.10410092G>A	ExAC,TOPMed,gnomAD
rs779455245	p.Pro97Leu	missense variant	-	NC_000006.12:g.10410091G>A	ExAC,TOPMed,gnomAD
rs920462082	p.Gly98Arg	missense variant	-	NC_000006.12:g.10410089C>G	TOPMed
rs372468982	p.Gln99His	missense variant	-	NC_000006.12:g.10410084C>G	ESP,ExAC,TOPMed,gnomAD
rs778774564	p.Arg100Thr	missense variant	-	NC_000006.12:g.10410082C>G	ExAC,gnomAD
rs757104358	p.Ser102Arg	missense variant	-	NC_000006.12:g.10410075G>T	ExAC,TOPMed,gnomAD
rs757104358	p.Ser102Arg	missense variant	-	NC_000006.12:g.10410075G>C	ExAC,TOPMed,gnomAD
rs1227500007	p.Gly106Glu	missense variant	-	NC_000006.12:g.10410064C>T	gnomAD
rs753730365	p.Gly106Arg	missense variant	-	NC_000006.12:g.10410065C>G	ExAC,gnomAD
rs756034130	p.Leu108Gln	missense variant	-	NC_000006.12:g.10410058A>T	ExAC,TOPMed,gnomAD
rs1407939076	p.Thr110Ala	missense variant	-	NC_000006.12:g.10410053T>C	TOPMed,gnomAD
rs767502053	p.Gly113Arg	missense variant	-	NC_000006.12:g.10410044C>T	ExAC,gnomAD
rs1405134828	p.Gln117Arg	missense variant	-	NC_000006.12:g.10410031T>C	gnomAD
rs1490019573	p.Leu118Pro	missense variant	-	NC_000006.12:g.10410028A>G	TOPMed
rs1161927231	p.Ser119Leu	missense variant	-	NC_000006.12:g.10410025G>A	gnomAD
rs1234156913	p.Asp122Gly	missense variant	-	NC_000006.12:g.10410016T>C	TOPMed
rs763273543	p.Arg124His	missense variant	-	NC_000006.12:g.10410010C>T	ExAC,TOPMed,gnomAD
rs763273543	p.Arg124Leu	missense variant	-	NC_000006.12:g.10410010C>A	ExAC,TOPMed,gnomAD
rs1405346146	p.Arg125Lys	missense variant	-	NC_000006.12:g.10410007C>T	TOPMed
rs200574824	p.Asp126Glu	missense variant	-	NC_000006.12:g.10410003G>C	1000Genomes,ExAC,gnomAD
rs748618587	p.Tyr127His	missense variant	-	NC_000006.12:g.10410002A>G	ExAC,TOPMed,gnomAD
rs774997299	p.Tyr127Cys	missense variant	-	NC_000006.12:g.10410001T>C	ExAC,gnomAD
rs771478009	p.His130Gln	missense variant	-	NC_000006.12:g.10409991G>T	ExAC,gnomAD
rs968299826	p.Leu134Pro	missense variant	-	NC_000006.12:g.10409980A>G	gnomAD
rs778686750	p.His138Gln	missense variant	-	NC_000006.12:g.10409967G>T	ExAC,gnomAD
rs770743434	p.Ala139Glu	missense variant	-	NC_000006.12:g.10409965G>T	ExAC,gnomAD
rs1009464114	p.Ser142Pro	missense variant	-	NC_000006.12:g.10409957A>G	TOPMed,gnomAD
rs1190763496	p.Leu144Phe	missense variant	-	NC_000006.12:g.10409951G>A	gnomAD
rs1336225760	p.Leu147Pro	missense variant	-	NC_000006.12:g.10409941A>G	TOPMed
rs1453679490	p.Ser148Trp	missense variant	-	NC_000006.12:g.10409938G>C	TOPMed,gnomAD
rs1206569048	p.Ile149Asn	missense variant	-	NC_000006.12:g.10409935A>T	gnomAD
rs1464302120	p.His150Tyr	missense variant	-	NC_000006.12:g.10409933G>A	TOPMed,gnomAD
rs555997980	p.Ser151Cys	missense variant	-	NC_000006.12:g.10409929G>C	1000Genomes,ExAC,gnomAD
rs754995203	p.His154Leu	missense variant	-	NC_000006.12:g.10409920T>A	ExAC
rs375321728	p.His154Gln	missense variant	-	NC_000006.12:g.10409919G>T	ESP,TOPMed,gnomAD
rs1034685390	p.Ala155Thr	missense variant	-	NC_000006.12:g.10409918C>T	TOPMed,gnomAD
rs1366944925	p.Ile156Thr	missense variant	-	NC_000006.12:g.10409914A>G	gnomAD
rs1295010353	p.Ile156Met	missense variant	-	NC_000006.12:g.10409913G>C	TOPMed,gnomAD
rs751678511	p.Ile156Val	missense variant	-	NC_000006.12:g.10409915T>C	ExAC,TOPMed,gnomAD
rs1001826033	p.Glu157Gln	missense variant	-	NC_000006.12:g.10409912C>G	TOPMed
rs1001826033	p.Glu157Lys	missense variant	-	NC_000006.12:g.10409912C>T	TOPMed
rs766548263	p.Glu158Asp	missense variant	-	NC_000006.12:g.10409907C>A	ExAC,gnomAD
rs1437702443	p.Glu158Val	missense variant	-	NC_000006.12:g.10409908T>A	TOPMed
rs1384770887	p.Val159Ile	missense variant	-	NC_000006.12:g.10409906C>T	gnomAD
rs1303880752	p.Pro160Leu	missense variant	-	NC_000006.12:g.10409902G>A	gnomAD
rs1303880752	p.Pro160Gln	missense variant	-	NC_000006.12:g.10409902G>T	gnomAD
rs540208578	p.Val162Ile	missense variant	-	NC_000006.12:g.10406841C>T	1000Genomes,ExAC,gnomAD
rs890498550	p.Pro165Thr	missense variant	-	NC_000006.12:g.10406832G>T	TOPMed
rs765549775	p.Pro165Leu	missense variant	-	NC_000006.12:g.10406831G>A	ExAC,TOPMed,gnomAD
rs765549775	p.Pro165Gln	missense variant	-	NC_000006.12:g.10406831G>T	ExAC,TOPMed,gnomAD
rs1449365849	p.Gly166Ser	missense variant	-	NC_000006.12:g.10406829C>T	TOPMed
rs754264393	p.Gly166Asp	missense variant	-	NC_000006.12:g.10406828C>T	ExAC,gnomAD
rs528101301	p.Ile167Met	missense variant	-	NC_000006.12:g.10406824A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1354299682	p.Asp171Gly	missense variant	-	NC_000006.12:g.10406813T>C	TOPMed
rs1321006396	p.Lys176Met	missense variant	-	NC_000006.12:g.10406798T>A	gnomAD
rs1443522039	p.Pro179Ser	missense variant	-	NC_000006.12:g.10404737G>A	gnomAD
rs1208782432	p.Val180Met	missense variant	-	NC_000006.12:g.10404734C>T	gnomAD
rs764532449	p.Leu182Pro	missense variant	-	NC_000006.12:g.10404727A>G	ExAC,TOPMed,gnomAD
rs764532449	p.Leu182Arg	missense variant	-	NC_000006.12:g.10404727A>C	ExAC,TOPMed,gnomAD
rs146735451	p.Ser183Tyr	missense variant	-	NC_000006.12:g.10404724G>T	ESP,ExAC,TOPMed
rs201296512	p.Asn186Asp	missense variant	-	NC_000006.12:g.10404716T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs201296512	p.Asn186His	missense variant	-	NC_000006.12:g.10404716T>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1167211530	p.Ser187Asn	missense variant	-	NC_000006.12:g.10404712C>T	TOPMed
rs565071190	p.Asn188Ser	missense variant	-	NC_000006.12:g.10404709T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1435982863	p.Ala189Gly	missense variant	-	NC_000006.12:g.10404706G>C	TOPMed
rs1332158151	p.Val190Ile	missense variant	-	NC_000006.12:g.10404704C>T	gnomAD
rs1339506384	p.Val190Ala	missense variant	-	NC_000006.12:g.10404703A>G	TOPMed
rs772810778	p.Ile193Val	missense variant	-	NC_000006.12:g.10404695T>C	ExAC,gnomAD
rs764751482	p.Pro194Ser	missense variant	-	NC_000006.12:g.10404692G>A	ExAC,gnomAD
rs761543465	p.Ile195Met	missense variant	-	NC_000006.12:g.10404687A>C	ExAC,gnomAD
rs925135582	p.Asn196Lys	missense variant	-	NC_000006.12:g.10404684G>T	TOPMed
rs768437372	p.Asn199Asp	missense variant	-	NC_000006.12:g.10404677T>C	ExAC,gnomAD
rs772033707	p.Phe201Leu	missense variant	-	NC_000006.12:g.10404669G>T	ExAC,gnomAD
rs763437712	p.Gly203Asp	missense variant	-	NC_000006.12:g.10404664C>T	ExAC,TOPMed,gnomAD
rs1207517084	p.Val204Met	missense variant	-	NC_000006.12:g.10404662C>T	gnomAD
rs1306008241	p.Val205Leu	missense variant	-	NC_000006.12:g.10404659C>G	gnomAD
rs202002859	p.Asn208Ser	missense variant	-	NC_000006.12:g.10404649T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs202002859	p.Asn208Thr	missense variant	-	NC_000006.12:g.10404649T>G	1000Genomes,ExAC,TOPMed,gnomAD
rs749528750	p.Val210Ile	missense variant	-	NC_000006.12:g.10404644C>T	ExAC,TOPMed,gnomAD
rs749528750	p.Val210Leu	missense variant	-	NC_000006.12:g.10404644C>G	ExAC,TOPMed,gnomAD
rs979214687	p.Ser213Leu	missense variant	-	NC_000006.12:g.10404634G>A	TOPMed
rs793888541	p.Val214Asp	missense variant	-	NC_000006.12:g.10404631A>T	-
rs793888540	p.Arg217Ser	missense variant	-	NC_000006.12:g.10404623G>T	-
rs1554111768	p.Arg217Leu	missense variant	-	NC_000006.12:g.10404622C>A	-
rs1341138385	p.Thr224Ile	missense variant	-	NC_000006.12:g.10404601G>A	TOPMed,gnomAD
rs768098328	p.Ser225Pro	missense variant	-	NC_000006.12:g.10404599A>G	ExAC,gnomAD
rs749849069	p.Val229Ile	missense variant	-	NC_000006.12:g.10404587C>T	ExAC,gnomAD
rs1554111751	p.Glu233Lys	missense variant	-	NC_000006.12:g.10404575C>T	-
rs1554111749	p.Arg236Trp	missense variant	-	NC_000006.12:g.10404566G>A	-
rs151344525	p.Arg237Pro	missense variant	Branchiooculofacial syndrome (bofs)	NC_000006.12:g.10404562C>G	-
rs151344525	p.Arg237Gln	missense variant	Branchiooculofacial syndrome (bofs)	NC_000006.12:g.10404562C>T	-
rs1479723294	p.Leu238Ile	missense variant	-	NC_000006.12:g.10404560G>T	TOPMed,gnomAD
rs1479723294	p.Leu238Val	missense variant	-	NC_000006.12:g.10404560G>C	TOPMed,gnomAD
rs1554111734	p.Leu238Pro	missense variant	-	NC_000006.12:g.10404559A>G	-
rs1274356477	p.Ser239Leu	missense variant	-	NC_000006.12:g.10404556G>A	TOPMed
rs1453058626	p.Pro240Gln	missense variant	-	NC_000006.12:g.10404553G>T	gnomAD
rs1222662376	p.Pro240Ala	missense variant	-	NC_000006.12:g.10404554G>C	gnomAD
rs151344526	p.Glu242Lys	missense variant	-	NC_000006.12:g.10404548C>T	-
rs1232550960	p.Cys243Arg	missense variant	-	NC_000006.12:g.10404545A>G	gnomAD
rs929697206	p.Leu244Ile	missense variant	-	NC_000006.12:g.10404542G>T	gnomAD
rs929697206	p.Leu244Phe	missense variant	-	NC_000006.12:g.10404542G>A	gnomAD
VAR_045838	p.Leu249Pro	Missense	Branchiooculofacial syndrome (BOFS) [MIM:113620]	-	UniProt
rs1554111717	p.Gly250Asp	missense variant	-	NC_000006.12:g.10404523C>T	-
rs151344530	p.Arg254Gln	missense variant	-	NC_000006.12:g.10404511C>T	-
rs151344528	p.Arg254Trp	missense variant	-	NC_000006.12:g.10404512G>A	gnomAD
rs151344528	p.Arg254Gly	missense variant	Branchiooculofacial syndrome (BOFS)	NC_000006.12:g.10404512G>C	UniProt,dbSNP
VAR_045839	p.Arg254Gly	missense variant	Branchiooculofacial syndrome (BOFS)	NC_000006.12:g.10404512G>C	UniProt
rs151344528	p.Arg254Gly	missense variant	-	NC_000006.12:g.10404512G>C	gnomAD
rs121909574	p.Arg255Trp	missense variant	Branchiooculofacial syndrome (bofs)	NC_000006.12:g.10404509T>A	ExAC,TOPMed,gnomAD
rs121909574	p.Arg255Gly	missense variant	Branchiooculofacial syndrome (bofs)	NC_000006.12:g.10404509T>C	ExAC,TOPMed,gnomAD
rs121909574	p.Arg255Gly	missense variant	Branchiooculofacial syndrome (BOFS)	NC_000006.12:g.10404509T>C	UniProt,dbSNP
VAR_045840	p.Arg255Gly	missense variant	Branchiooculofacial syndrome (BOFS)	NC_000006.12:g.10404509T>C	UniProt
rs151344531	p.Ala256Val	missense variant	-	NC_000006.12:g.10402608G>A	-
rs121909575	p.Gly262Glu	missense variant	Branchiooculofacial syndrome (bofs)	NC_000006.12:g.10402590C>T	-
rs121909575	p.Gly262Glu	missense variant	Branchiooculofacial syndrome (BOFS)	NC_000006.12:g.10402590C>T	UniProt,dbSNP
VAR_045841	p.Gly262Glu	missense variant	Branchiooculofacial syndrome (BOFS)	NC_000006.12:g.10402590C>T	UniProt
rs781630462	p.Ser264Phe	missense variant	-	NC_000006.12:g.10402584G>A	ExAC
rs747379877	p.Glu267Gln	missense variant	-	NC_000006.12:g.10402576C>G	ExAC,gnomAD
rs1380933178	p.Ile272Thr	missense variant	-	NC_000006.12:g.10402560A>G	gnomAD
rs1304000210	p.Asn275Ser	missense variant	-	NC_000006.12:g.10402551T>C	gnomAD
rs1248995629	p.Gly279Arg	missense variant	-	NC_000006.12:g.10402540C>T	TOPMed
rs1334796537	p.Lys282Thr	missense variant	-	NC_000006.12:g.10402530T>G	gnomAD
rs1021266565	p.Asn285Ser	missense variant	-	NC_000006.12:g.10402521T>C	TOPMed,gnomAD
rs1021266565	p.Asn285Thr	missense variant	-	NC_000006.12:g.10402521T>G	TOPMed,gnomAD
rs755697313	p.Val286Ile	missense variant	-	NC_000006.12:g.10402519C>T	ExAC,TOPMed,gnomAD
rs1230671196	p.Val293Leu	missense variant	-	NC_000006.12:g.10402498C>G	TOPMed,gnomAD
rs1230671196	p.Val293Ile	missense variant	-	NC_000006.12:g.10402498C>T	TOPMed,gnomAD
rs267607108	p.Glu296Lys	missense variant	Branchiooculofacial syndrome (bofs)	NC_000006.12:g.10400587C>T	-
rs1554110994	p.Ala297Pro	missense variant	-	NC_000006.12:g.10400584C>G	-
rs1291410371	p.His299Gln	missense variant	-	NC_000006.12:g.10400576G>C	TOPMed,gnomAD
rs377114324	p.Val307Met	missense variant	-	NC_000006.12:g.10400554C>T	ESP,ExAC,TOPMed,gnomAD
rs756122879	p.Glu309Lys	missense variant	-	NC_000006.12:g.10400548C>T	ExAC,gnomAD
rs752860081	p.Thr310Ile	missense variant	-	NC_000006.12:g.10400544G>A	ExAC,gnomAD
rs144275164	p.Glu311Ala	missense variant	-	NC_000006.12:g.10400541T>G	ESP
rs1347573125	p.Phe320Cys	missense variant	-	NC_000006.12:g.10400514A>C	gnomAD
rs1232638969	p.Leu321Val	missense variant	-	NC_000006.12:g.10400512G>C	TOPMed
rs759768857	p.Asn322Ser	missense variant	-	NC_000006.12:g.10400508T>C	ExAC,gnomAD
rs751854479	p.Gln324Arg	missense variant	-	NC_000006.12:g.10400502T>C	ExAC,gnomAD
rs763437006	p.His325Gln	missense variant	-	NC_000006.12:g.10400498A>C	ExAC
rs1277818334	p.Ser326Cys	missense variant	-	NC_000006.12:g.10400496G>C	TOPMed,gnomAD
rs575186761	p.Asp327Asn	missense variant	-	NC_000006.12:g.10400494C>T	ExAC,TOPMed,gnomAD
rs1233128354	p.Pro328Ser	missense variant	-	NC_000006.12:g.10400491G>A	gnomAD
rs902671328	p.Asn329Ser	missense variant	-	NC_000006.12:g.10400487T>C	gnomAD
rs1271181704	p.Leu338Phe	missense variant	-	NC_000006.12:g.10400461G>A	gnomAD
rs750693033	p.Gln343Glu	missense variant	-	NC_000006.12:g.10398704G>C	ExAC,gnomAD
rs765634102	p.Ile344Met	missense variant	-	NC_000006.12:g.10398699T>C	ExAC,TOPMed,gnomAD
rs757626207	p.Phe348Tyr	missense variant	-	NC_000006.12:g.10398688A>T	ExAC,gnomAD
rs1298300281	p.Asp350Tyr	missense variant	-	NC_000006.12:g.10398683C>A	gnomAD
rs759083592	p.Ala353Thr	missense variant	-	NC_000006.12:g.10398674C>T	ExAC,gnomAD
rs765898042	p.Arg356Leu	missense variant	-	NC_000006.12:g.10398664C>A	ExAC,gnomAD
rs772807658	p.Pro358Ser	missense variant	-	NC_000006.12:g.10398659G>A	ExAC,TOPMed,gnomAD
rs747986718	p.Asn361Ser	missense variant	-	NC_000006.12:g.10398649T>C	ExAC,TOPMed,gnomAD
rs776521790	p.Asn365Ser	missense variant	-	NC_000006.12:g.10398637T>C	ExAC,gnomAD
rs1479064980	p.Asn365His	missense variant	-	NC_000006.12:g.10398638T>G	TOPMed
rs1418554694	p.Ile367Val	missense variant	-	NC_000006.12:g.10398632T>C	gnomAD
rs1188838299	p.Glu369Gln	missense variant	-	NC_000006.12:g.10398626C>G	gnomAD
rs768613709	p.Cys375Tyr	missense variant	-	NC_000006.12:g.10398607C>T	ExAC,gnomAD
rs747045958	p.Thr377Ile	missense variant	-	NC_000006.12:g.10398601G>A	ExAC,gnomAD
rs1274422034	p.Ser383Thr	missense variant	-	NC_000006.12:g.10398584A>T	TOPMed,gnomAD
rs1165787572	p.Ser388Arg	missense variant	-	NC_000006.12:g.10398567G>C	TOPMed
rs1353656280	p.Pro389Ser	missense variant	-	NC_000006.12:g.10398566G>A	gnomAD
rs754293607	p.Cys392Ser	missense variant	-	NC_000006.12:g.10398556C>G	ExAC,gnomAD
rs754293607	p.Cys392Tyr	missense variant	-	NC_000006.12:g.10398556C>T	ExAC,gnomAD
rs778384375	p.Ala393Ser	missense variant	-	NC_000006.12:g.10398554C>A	ExAC,gnomAD
rs905854185	p.Ala394Val	missense variant	-	NC_000006.12:g.10398550G>A	TOPMed
rs1395122023	p.Val395Phe	missense variant	-	NC_000006.12:g.10398548C>A	gnomAD
rs1367388357	p.Thr396Met	missense variant	-	NC_000006.12:g.10398544G>A	gnomAD
rs750068981	p.Thr396Ser	missense variant	-	NC_000006.12:g.10398545T>A	ExAC,gnomAD
rs1325930703	p.Asn400Lys	missense variant	-	NC_000006.12:g.10398531G>T	TOPMed
rs1248028062	p.Tyr401Cys	missense variant	-	NC_000006.12:g.10398529T>C	gnomAD
rs1274286799	p.Glu404Lys	missense variant	-	NC_000006.12:g.10398521C>T	gnomAD
rs1052198371	p.Lys407Thr	missense variant	-	NC_000006.12:g.10398511T>G	TOPMed
rs1216098518	p.Met409Ile	missense variant	-	NC_000006.12:g.10398504C>T	TOPMed,gnomAD
rs1332712198	p.Met412Arg	missense variant	-	NC_000006.12:g.10398496A>C	TOPMed,gnomAD
rs1487162743	p.Tyr413Phe	missense variant	-	NC_000006.12:g.10398493T>A	TOPMed
rs1239924038	p.Asn417Thr	missense variant	-	NC_000006.12:g.10398481T>G	gnomAD
rs867726953	p.Pro418Arg	missense variant	-	NC_000006.12:g.10398478G>C	gnomAD
rs867726953	p.Pro418Leu	missense variant	-	NC_000006.12:g.10398478G>A	gnomAD
rs3734391	p.Asn419Lys	missense variant	-	NC_000006.12:g.10398474G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs201591227	p.Asn419Thr	missense variant	-	NC_000006.12:g.10398475T>G	ExAC,TOPMed,gnomAD
rs201591227	p.Asn419Ser	missense variant	-	NC_000006.12:g.10398475T>C	ExAC,TOPMed,gnomAD
rs772175937	p.Ser420Asn	missense variant	-	NC_000006.12:g.10398472C>T	ExAC,gnomAD
rs771307700	p.Asp423His	missense variant	-	NC_000006.12:g.10398464C>G	ExAC,gnomAD
rs771307700	p.Asp423Asn	missense variant	-	NC_000006.12:g.10398464C>T	ExAC,gnomAD
rs749620758	p.Asn425Lys	missense variant	-	NC_000006.12:g.10398456G>T	ExAC,gnomAD
rs778294642	p.Ser428Asn	missense variant	-	NC_000006.12:g.10398448C>T	ExAC,TOPMed,gnomAD
rs756614321	p.Ser429Gly	missense variant	-	NC_000006.12:g.10398446T>C	ExAC,gnomAD
rs781601001	p.Glu433Lys	missense variant	-	NC_000006.12:g.10398434C>T	ExAC,gnomAD
rs1554110673	p.Ter438Trp	stop lost	-	NC_000006.12:g.10398417T>C	-
COSM1071681	p.Met1Unk	missense variant	Variant assessed as Somatic; HIGH impact.	NC_000006.12:g.10414985T>G	NCI-TCGA Cosmic
COSM1071680	p.Lys4Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10414975T>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu12Ala	missense variant	-	NC_000006.12:g.10414951T>G	NCI-TCGA
NCI-TCGA novel	p.Asp13Tyr	missense variant	-	NC_000006.12:g.10414949C>A	NCI-TCGA
NCI-TCGA novel	p.Gln30ProPheSerTerUnkUnkUnk	frameshift	-	NC_000006.12:g.10410292_10410293insG	NCI-TCGA
COSM3697425	p.Ser41Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10410259C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro55Ser	missense variant	-	NC_000006.12:g.10410218G>A	NCI-TCGA
NCI-TCGA novel	p.Pro59Ser	missense variant	-	NC_000006.12:g.10410206G>A	NCI-TCGA
COSM1311424	p.Gln63Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000006.12:g.10410194G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser69Trp	missense variant	-	NC_000006.12:g.10410175G>C	NCI-TCGA
NCI-TCGA novel	p.Asp71Tyr	missense variant	-	NC_000006.12:g.10410170C>A	NCI-TCGA
COSM3776968	p.Pro72Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10410166G>A	NCI-TCGA Cosmic
COSM3410513	p.Ser74Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10410160G>A	NCI-TCGA Cosmic
COSM1071676	p.Asn77Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10410151T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp78Asn	missense variant	-	NC_000006.12:g.10410149C>T	NCI-TCGA
NCI-TCGA novel	p.Gln88Glu	missense variant	-	NC_000006.12:g.10410119G>C	NCI-TCGA
NCI-TCGA novel	p.Glu104AlaPheSerTerUnkUnk	frameshift	-	NC_000006.12:g.10410012_10410070AGGATCCAGGCCCGACAGCTGGTGAGGCAGCCCCCGGTGCGTGTGCAGGAGCCCAGACT>-	NCI-TCGA
NCI-TCGA novel	p.Thr110Met	missense variant	-	NC_000006.12:g.10410052G>A	NCI-TCGA
NCI-TCGA novel	p.Gln117Leu	missense variant	-	NC_000006.12:g.10410031T>A	NCI-TCGA
COSM1071672	p.Arg124Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10410011G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg129Gln	missense variant	-	NC_000006.12:g.10409995C>T	NCI-TCGA
COSM1487083	p.Val159Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10409905A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu163Lys	missense variant	-	NC_000006.12:g.10406838C>T	NCI-TCGA
NCI-TCGA novel	p.Val174AsnPheSerTerUnk	frameshift	-	NC_000006.12:g.10406804_10406805AC>-	NCI-TCGA
NCI-TCGA novel	p.Ser181Phe	missense variant	-	NC_000006.12:g.10404730G>A	NCI-TCGA
COSM3776965	p.Ser191Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10404700G>A	NCI-TCGA Cosmic
COSM6105002	p.Ser191Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10404700G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly202Ser	missense variant	-	NC_000006.12:g.10404668C>T	NCI-TCGA
COSM1134245	p.Glu209Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10404647C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr224Asn	missense variant	-	NC_000006.12:g.10404601G>T	NCI-TCGA
NCI-TCGA novel	p.Leu238ArgPheSerTerUnkUnk	frameshift	-	NC_000006.12:g.10404559_10404560insGC	NCI-TCGA
NCI-TCGA novel	p.Ser247Leu	missense variant	-	NC_000006.12:g.10404532G>A	NCI-TCGA
NCI-TCGA novel	p.Arg255Lys	missense variant	-	NC_000006.12:g.10404508C>T	NCI-TCGA
NCI-TCGA novel	p.Asn260MetPheSerTerUnk	frameshift	-	NC_000006.12:g.10402596T>-	NCI-TCGA
NCI-TCGA novel	p.Lys268AsnPheSerTerUnk	frameshift	-	NC_000006.12:g.10402571T>-	NCI-TCGA
NCI-TCGA novel	p.Pro277Ser	missense variant	-	NC_000006.12:g.10402546G>A	NCI-TCGA
NCI-TCGA novel	p.Arg281His	missense variant	-	NC_000006.12:g.10402533C>T	NCI-TCGA
NCI-TCGA novel	p.Lys282Ter	stop gained	-	NC_000006.12:g.10402531T>A	NCI-TCGA
NCI-TCGA novel	p.Ala283Val	missense variant	-	NC_000006.12:g.10402527G>A	NCI-TCGA
NCI-TCGA novel	p.Val293Ala	missense variant	-	NC_000006.12:g.10402497A>G	NCI-TCGA
COSM4831592	p.Val293Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10402497A>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu294Gln	missense variant	-	NC_000006.12:g.10402495C>G	NCI-TCGA
NCI-TCGA novel	p.Glu294Ter	stop gained	-	NC_000006.12:g.10402495C>A	NCI-TCGA
COSM6172283	p.Gly295Ter	missense variant	Variant assessed as Somatic; HIGH impact.	NC_000006.12:g.10402492C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Cys308Phe	missense variant	-	NC_000006.12:g.10400550C>A	NCI-TCGA
COSM1071666	p.Glu311Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10400542C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu321Phe	missense variant	-	NC_000006.12:g.10400512G>A	NCI-TCGA
NCI-TCGA novel	p.Leu321CysPheSerTerUnkUnk	frameshift	-	NC_000006.12:g.10400512_10400513insAAAGAGAAACA	NCI-TCGA
COSM3776962	p.Arg323Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10400505C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp327Glu	missense variant	-	NC_000006.12:g.10400492A>T	NCI-TCGA
NCI-TCGA novel	p.Glu330Val	missense variant	-	NC_000006.12:g.10400484T>A	NCI-TCGA
NCI-TCGA novel	p.Asn336LysPheSerTerUnkUnk	frameshift	-	NC_000006.12:g.10400465_10400466insT	NCI-TCGA
NCI-TCGA novel	p.Gln343His	missense variant	-	NC_000006.12:g.10398702C>G	NCI-TCGA
COSM1487082	p.Cys345Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398698A>G	NCI-TCGA Cosmic
COSM1487081	p.Phe348Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398688A>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gln354Glu	missense variant	-	NC_000006.12:g.10398671G>C	NCI-TCGA
NCI-TCGA novel	p.Gln373Glu	missense variant	-	NC_000006.12:g.10398614G>C	NCI-TCGA
NCI-TCGA novel	p.His384Asn	missense variant	-	NC_000006.12:g.10398581G>T	NCI-TCGA
COSM1071662	p.Gly387Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398572C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala397Thr	missense variant	-	NC_000006.12:g.10398542C>T	NCI-TCGA
COSM3857206	p.Leu398Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398538A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Tyr401His	missense variant	-	NC_000006.12:g.10398530A>G	NCI-TCGA
COSM4929209	p.Ala405Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398517G>T	NCI-TCGA Cosmic
COSM3994534	p.Asn425Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398456G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu433Asp	missense variant	-	NC_000006.12:g.10398432C>A	NCI-TCGA
NCI-TCGA novel	p.Lys434Asn	missense variant	-	NC_000006.12:g.10398429C>G	NCI-TCGA
COSM3828692	p.Arg436Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000006.12:g.10398424C>T	NCI-TCGA Cosmic

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001418	Adenocarcinoma	group	BEFREE
C0002871	Anemia	disease	BEFREE
C0003119	Anophthalmos	disease	BEFREE;HPO
C0004114	Astrocytoma	disease	BEFREE
C0005699	Blast Phase	disease	BEFREE
C0005745	Blepharoptosis	disease	HPO
C0006142	Malignant neoplasm of breast	disease	BEFREE;CTD_human
C0007102	Malignant tumor of colon	disease	BEFREE
C0007112	Adenocarcinoma of prostate	disease	BEFREE
C0007124	Noninfiltrating Intraductal Carcinoma	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE;LHGDN
C0007137	Squamous cell carcinoma	disease	BEFREE;LHGDN
C0007847	Malignant tumor of cervix	disease	BEFREE
C0008497	Choriocarcinoma	disease	BEFREE
C0008924	Cleft upper lip	disease	BEFREE;HPO
C0008925	Cleft Palate	disease	BEFREE
C0009363	Congenital ocular coloboma (disorder)	disease	BEFREE;GENOMICS_ENGLAND
C0009375	Colonic Neoplasms	group	LHGDN
C0009402	Colorectal Carcinoma	disease	BEFREE
C0009404	Colorectal Neoplasms	group	LHGDN
C0010417	Cryptorchidism	disease	HPO
C0011603	Dermatitis	disease	BEFREE
C0011860	Diabetes Mellitus, Non-Insulin-Dependent	disease	BEFREE
C0014544	Epilepsy	disease	HPO
C0015393	Eye Abnormalities	group	CTD_human
C0015934	Fetal Growth Retardation	phenotype	HPO
C0017168	Gastroesophageal reflux disease	disease	HPO
C0017205	Gaucher Disease	disease	BEFREE
C0017636	Glioblastoma	disease	BEFREE
C0017638	Glioma	disease	BEFREE;LHGDN
C0018552	Hamartoma	group	HPO
C0018777	Conductive hearing loss	disease	HPO
C0018784	Sensorineural Hearing Loss (disorder)	disease	BEFREE;HPO
C0018834	Heartburn	phenotype	HPO
C0018916	Hemangioma	disease	HPO
C0020534	Orbital separation excessive	phenotype	HPO
C0021296	Infant, Small for Gestational Age	phenotype	HPO
C0021846	Intestinal Polyps	phenotype	BEFREE
C0022658	Kidney Diseases	group	CTD_human
C0022679	Cystic kidney	disease	BEFREE;HPO
C0022821	Kyphosis deformity of spine	phenotype	HPO
C0022906	Lacrimal Duct Obstruction	phenotype	HPO
C0023418	leukemia	disease	BEFREE
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE
C0023473	Myeloid Leukemia, Chronic	disease	BEFREE
C0024003	Lordosis	phenotype	HPO
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025202	melanoma	disease	BEFREE;LHGDN
C0025990	Micrognathism	disease	HPO
C0026010	Microphthalmos	disease	HPO
C0026106	Mild Mental Retardation	disease	HPO
C0026499	Monosomy	group	BEFREE
C0027092	Myopia	disease	HPO
C0027430	Nasal Polyps	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027962	Melanocytic nevus	disease	BEFREE
C0028738	Nystagmus	disease	HPO
C0029925	Ovarian Carcinoma	disease	BEFREE
C0032019	Pituitary Neoplasms	group	BEFREE
C0032580	Adenomatous Polyposis Coli	disease	BEFREE
C0033578	Prostatic Neoplasms	group	LHGDN
C0034194	Pyloric Stenosis	phenotype	HPO
C0035335	Retinoblastoma	disease	BEFREE
C0036341	Schizophrenia	disease	BEFREE;PSYGENET
C0036572	Seizures	phenotype	HPO
C0037822	Speech Disorders	group	HPO
C0038379	Strabismus	disease	HPO
C0086543	Cataract	disease	GENOMICS_ENGLAND;HPO
C0151779	Cutaneous Melanoma	disease	BEFREE
C0152013	Adenocarcinoma of lung (disorder)	disease	BEFREE
C0152423	Congenital small ears	disease	HPO
C0152427	Polydactyly	disease	GENOMICS_ENGLAND
C0154823	Retinal defect	phenotype	BEFREE
C0178874	Tumor Progression	phenotype	BEFREE
C0206698	Cholangiocarcinoma	disease	BEFREE
C0220756	Niemann-Pick Disease, Type C	disease	BEFREE
C0221358	Long narrow head	phenotype	HPO
C0235974	Pancreatic carcinoma	disease	BEFREE
C0239234	Low set ears	phenotype	HPO
C0240063	Coloboma of iris	phenotype	HPO
C0240340	Microdontia (disorder)	disease	HPO
C0240635	Byzanthine arch palate	disease	HPO
C0240896	Fundus coloboma	disease	HPO
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0262444	Abnormality of the dentition	phenotype	HPO
C0263498	Premature canities	phenotype	HPO
C0265234	Branchio-Oto-Renal Syndrome	disease	CTD_human
C0265989	Congenital scar	disease	HPO
C0266011	Accessory nipple	phenotype	HPO
C0266196	Malrotation of colon	disease	HPO
C0266292	Congenital anomaly of the kidney	group	BEFREE
C0266610	Preauricular dimple	disease	HPO
C0266625	Congenital preauricular sinus	disease	HPO
C0268074	Indian childhood cirrhosis	disease	BEFREE
C0278488	Carcinoma breast stage IV	disease	BEFREE
C0278701	Gastric Adenocarcinoma	disease	BEFREE
C0278883	Metastatic melanoma	disease	BEFREE
C0280725	Adult Cholangiocarcinoma	disease	BEFREE
C0282160	Aplasia Cutis Congenita	disease	BEFREE;HPO
C0302592	Cervix carcinoma	disease	BEFREE
C0311245	Congenital cystic kidney disease	disease	BEFREE
C0334438	Superficial spreading malignant melanoma of skin	disease	BEFREE
C0344312	White forelock	phenotype	HPO
C0344559	Irido-corneo-trabecular dysgenesis (disorder)	disease	BEFREE
C0346647	Malignant neoplasm of pancreas	disease	BEFREE
C0346990	Carcinomatosis of peritoneal cavity	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0376524	Branchio-Oculo-Facial Syndrome	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C0376634	Craniofacial Abnormalities	group	CTD_human
C0395905	Postauricular fistula	phenotype	HPO
C0409338	Flexion contracture - elbow	phenotype	HPO
C0423109	Upward slant of palpebral fissure	phenotype	HPO
C0423113	Telecanthus	phenotype	HPO
C0424688	Small head	phenotype	HPO
C0424731	Single transverse palmar crease	phenotype	HPO
C0426429	Broad nasal tip	phenotype	HPO
C0431399	Familial aplasia of the vermis	disease	HPO
C0431478	Posteriorly rotated ear	disease	HPO
C0431483	Simple ear	phenotype	HPO
C0431890	Hypoplasia of thumb	disease	HPO
C0454555	Hypernasal voice	phenotype	HPO
C0521525	Short neck	phenotype	HPO
C0542519	Congenital absence of kidney	disease	HPO
C0546969	Preauricular Fistulae, Congenital	disease	HPO
C0566620	Nasal voice	phenotype	HPO
C0576962	Tooth problem	phenotype	HPO
C0596263	Carcinogenesis	phenotype	BEFREE
C0598766	Leukemogenesis	disease	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE;CTD_human
C0684249	Carcinoma of lung	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0810364	Cleft Lip with or without Cleft Palate	disease	BEFREE
C0848558	Hypospadias	group	HPO
C0857379	Abnormality of the pinna	phenotype	HPO
C0870082	Hyperkeratosis	group	BEFREE
C0878544	Cardiomyopathies	group	LHGDN
C0950123	Genetic Diseases, Inborn	group	CLINVAR
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1168327	High-Grade Prostatic Intraepithelial Neoplasia	disease	BEFREE
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE
C1257931	Mammary Neoplasms, Human	group	CTD_human
C1261473	Sarcoma	group	LHGDN
C1281931	Obstruction of nasolacrimal duct	phenotype	HPO
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1335302	Pancreatic Ductal Adenocarcinoma	disease	BEFREE
C1386048	Intrauterine retardation	phenotype	HPO
C1395852	Polydactyly preaxial type 1	disease	HPO
C1449563	Cardiomyopathy, Familial Idiopathic	disease	BEFREE
C1458155	Mammary Neoplasms	group	BEFREE;CTD_human;LHGDN
C1510497	Lens Opacities	phenotype	HPO
C1512127	HER2 gene amplification	phenotype	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1691215	Penile hypospadias	disease	HPO
C1691228	Cystic Kidney Diseases	group	BEFREE
C1827524	Wide spaced nipples	phenotype	HPO
C1833142	contracture of elbow	phenotype	HPO
C1833369	OROFACIAL CLEFT 3	disease	MGD
C1833563	Cleft Lip, Congenital Healed	disease	MGD
C1835894	Orofacial Cleft 9	disease	MGD
C1836542	Depressed nasal bridge	phenotype	HPO
C1837210	OROFACIAL CLEFT 5	disease	MGD
C1837731	Overfolded helix	phenotype	HPO
C1839764	Broad flat nasal bridge	phenotype	HPO
C1839797	Deep philtrum	phenotype	HPO
C1842143	Orofacial Cleft 4	disease	MGD
C1844857	Short nasal septum	phenotype	HPO
C1845112	Hyperkyphosis	phenotype	HPO
C1845250	Small forehead	phenotype	HPO
C1849367	Nasal bridge wide	phenotype	HPO
C1850049	Clinodactyly of the 5th finger	disease	HPO
C1853246	Everted lower lip vermilion	phenotype	HPO
C1855728	Low posterior hairline	phenotype	HPO
C1856786	Hypoplastic fingernail	phenotype	HPO
C1857130	Hypoplastic mandible condyle	phenotype	HPO
C1857486	Low-set, posteriorly rotated ears	phenotype	HPO
C1858085	Malar flattening	phenotype	HPO
C1861537	OROFACIAL CLEFT 1	disease	MGD
C1861544	Lower lip pit	phenotype	HPO
C1862059	Supraauricular pit	disease	HPO
C1862066	Branchial anomaly	disease	HPO
C1862068	Fusion of middle ear ossicles	phenotype	HPO
C1864323	OROFACIAL CLEFT 2	disease	MGD
C1865305	Hypoplastic superior helix	phenotype	HPO
C1865572	Proximal placement of thumb	phenotype	HPO
C1866070	OROFACIAL CLEFT 10	disease	MGD
C1866234	Protruding lower lip	phenotype	HPO
C1867020	SCALP-EAR-NIPPLE SYNDROME	disease	BEFREE
C1970479	Branchiootorenal Syndrome 2	disease	CTD_human
C2677434	OROFACIAL CLEFT 11	disease	MGD
C2748505	Orofacial Cleft 12	disease	MGD
C2931822	Nasopharyngeal carcinoma	disease	BEFREE
C2981150	Uranostaphyloschisis	disease	HPO
C3151222	OROFACIAL CLEFT 13	disease	MGD
C3550546	Depressed nasal root/bridge	phenotype	HPO
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND
C3875321	Inflammatory dermatosis	group	BEFREE
C3887499	Renal cyst	phenotype	HPO
C4014596	OROFACIAL CLEFT 14	disease	MGD
C4020861	Depressed philtrum	phenotype	HPO
C4020952	Fingernail dysplasia	disease	HPO
C4021020	Non-midline cleft lip	disease	HPO
C4021786	Atypical scarring of skin	phenotype	HPO
C4023795	Ectopic thymus tissue	phenotype	HPO
C4024202	Reduced number of teeth	phenotype	HPO
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4025234	Duplication of internal organs	phenotype	HPO
C4048328	cervical cancer	disease	BEFREE
C4083050	Tooth agenesis	phenotype	HPO
C4280495	Concave bridge of nose	phenotype	HPO
C4280538	Curvature of little finger	phenotype	HPO
C4280611	Decreased size of teeth	phenotype	HPO
C4280612	Decreased width of tooth	phenotype	HPO
C4280625	Decreased size of eyeball	phenotype	HPO
C4280633	Hypotrophic forehead	phenotype	HPO
C4280634	Hypoplasia of forehead	phenotype	HPO
C4280651	Hypotrophic malar bone	phenotype	HPO
C4280653	Turridolichocephaly	disease	HPO
C4280654	Narrow skull shape	disease	HPO
C4280655	Narrow head shape	disease	HPO
C4280656	Narrow cranium shape	disease	HPO
C4280808	Abnormally small eyeball	phenotype	HPO
C4317146	Acid reflux	phenotype	HPO
C4476523	Decreased projection of lower jaw	phenotype	HPO
C4476524	Decreased projection of mandible	phenotype	HPO
C4476525	Retrusion of lower jaw	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000976	transcription regulatory region sequence-specific DNA binding	IDA
GO:0000977	RNA polymerase II regulatory region sequence-specific DNA binding	IBA
GO:0000978	RNA polymerase II cis-regulatory region sequence-specific DNA binding	IDA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	IDA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	IBA
GO:0000987	cis-regulatory region sequence-specific DNA binding	IDA
GO:0001227	DNA-binding transcription repressor activity, RNA polymerase II-specific	IDA
GO:0001228	DNA-binding transcription activator activity, RNA polymerase II-specific	IDA
GO:0003682	chromatin binding	ISS
GO:0003713	transcription coactivator activity	IDA
GO:0005515	protein binding	IPI
GO:0042802	identical protein binding	IPI
GO:0043565	sequence-specific DNA binding	IDA
GO:0043565	sequence-specific DNA binding	IMP
GO:0044212	transcription regulatory region DNA binding	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0000122	negative regulation of transcription by RNA polymerase II	IDA
GO:0000122	negative regulation of transcription by RNA polymerase II	TAS
GO:0001822	kidney development	IMP
GO:0003404	optic vesicle morphogenesis	ISS
GO:0003409	optic cup structural organization	ISS
GO:0006357	regulation of transcription by RNA polymerase II	IBA
GO:0006357	regulation of transcription by RNA polymerase II	TAS
GO:0007605	sensory perception of sound	IMP
GO:0008285	negative regulation of cell population proliferation	IDA
GO:0010628	positive regulation of gene expression	ISS
GO:0010842	retina layer formation	IEP
GO:0010944	negative regulation of transcription by competitive promoter binding	IMP
GO:0021559	trigeminal nerve development	ISS
GO:0021623	oculomotor nerve formation	ISS
GO:0030501	positive regulation of bone mineralization	IDA
GO:0035115	embryonic forelimb morphogenesis	ISS
GO:0042127	regulation of cell population proliferation	IBA
GO:0042472	inner ear morphogenesis	IMP
GO:0043066	negative regulation of apoptotic process	IDA
GO:0043525	positive regulation of neuron apoptotic process	IDA
GO:0045595	regulation of cell differentiation	IDA
GO:0045892	negative regulation of transcription, DNA-templated	IDA
GO:0045893	positive regulation of transcription, DNA-templated	ISS
GO:0045893	positive regulation of transcription, DNA-templated	IDA
GO:0045944	positive regulation of transcription by RNA polymerase II	IDA
GO:0045944	positive regulation of transcription by RNA polymerase II	TAS
GO:0048701	embryonic cranial skeleton morphogenesis	ISS
GO:0060021	roof of mouth development	IMP
GO:0060349	bone morphogenesis	ISS
GO:0061029	eyelid development in camera-type eye	ISS
GO:0070172	positive regulation of tooth mineralization	IDA
GO:0071281	cellular response to iron ion	IDA
GO:2000378	negative regulation of reactive oxygen species metabolic process	IDA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000790	nuclear chromatin	ISA
GO:0005634	nucleus	IMP
GO:0005634	nucleus	IDA
GO:0005654	nucleoplasm	IDA
GO:0005654	nucleoplasm	TAS

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-212436	Generic Transcription Pathway	IEA
R-HSA-212436	Generic Transcription Pathway	TAS
R-HSA-2990846	SUMOylation	IEA
R-HSA-3108232	SUMO E3 ligases SUMOylate target proteins	IEA
R-HSA-3232118	SUMOylation of transcription factors	IEA
R-HSA-392499	Metabolism of proteins	IEA
R-HSA-597592	Post-translational protein modification	IEA
R-HSA-73857	RNA Polymerase II Transcription	IEA
R-HSA-73857	RNA Polymerase II Transcription	TAS
R-HSA-74160	Gene expression (Transcription)	IEA
R-HSA-74160	Gene expression (Transcription)	TAS
R-HSA-8864260	Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors	IEA
R-HSA-8864260	Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors	TAS
R-HSA-8866904	Negative regulation of activity of TFAP2 (AP-2) family transcription factors	IEA
R-HSA-8866904	Negative regulation of activity of TFAP2 (AP-2) family transcription factors	TAS
R-HSA-8866906	TFAP2 (AP-2) family regulates transcription of other transcription factors	TAS
R-HSA-8866907	Activation of the TFAP2 (AP-2) family of transcription factors	TAS
R-HSA-8866910	TFAP2 (AP-2) family regulates transcription of growth factors and their receptors	TAS
R-HSA-8866911	TFAP2 (AP-2) family regulates transcription of cell cycle factors	TAS
R-HSA-8869496	TFAP2A acts as a transcriptional repressor during retinoic acid induced cell differentiation	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
C495626	14-deoxy-11,12-didehydroandrographolide	14-deoxy-11,12-didehydroandrographolide results in increased expression of TFAP2A mRNA	22101062
C046760	15-acetyldeoxynivalenol	15-acetyldeoxynivalenol results in increased expression of TFAP2A mRNA	23792671
D020001	1-Butanol	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of TFAP2A mRNA	29432896
D015056	1-Methyl-3-isobutylxanthine	[1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of TFAP2A mRNA	30409764
D015056	1-Methyl-3-isobutylxanthine	Acrylamide inhibits the reaction [[1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of TFAP2A mRNA]	30409764
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased expression of TFAP2A mRNA	31326446
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [Cytarabine results in increased expression of TFAP2A mRNA]	23264188
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in decreased expression of TFAP2A mRNA	19150397; 20018196;
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in increased expression of TFAP2A mRNA	17944540
D000082	Acetaminophen	Acetaminophen results in decreased expression of TFAP2A mRNA	26690555
D000082	Acetaminophen	Acetaminophen results in increased expression of TFAP2A mRNA	29067470
D020106	Acrylamide	Acrylamide inhibits the reaction [[1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of TFAP2A mRNA]	30409764
D020106	Acrylamide	Acrylamide promotes the reaction [Dietary Fats results in increased expression of TFAP2A mRNA]	30409764
C016601	afimoxifene	afimoxifene results in decreased expression of TFAP2A mRNA	19901195
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of TFAP2A gene	27153756
D018501	Antirheumatic Agents	Antirheumatic Agents results in decreased expression of TFAP2A mRNA	24449571
C015001	arsenite	arsenite results in decreased methylation of TFAP2A promoter	23974009
C487081	belinostat	belinostat results in increased expression of TFAP2A mRNA	26272509
C487081	belinostat	[NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of TFAP2A mRNA	22228805
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in decreased expression of TFAP2A mRNA	30951980
C006780	bisphenol A	bisphenol A affects the expression of TFAP2A mRNA	23557687
C006780	bisphenol A	bisphenol A affects the methylation of TFAP2A promoter	27334623
C006780	bisphenol A	bisphenol A results in decreased expression of TFAP2A mRNA	25181051
C000611646	bisphenol F	bisphenol F results in decreased expression of TFAP2A mRNA	30951980
C027561	butylbenzyl phthalate	butylbenzyl phthalate affects the localization of TFAP2A protein	22552774
C027561	butylbenzyl phthalate	butylbenzyl phthalate promotes the reaction [TFAP2A protein binds to HDAC6 promoter]	22552774
C027561	butylbenzyl phthalate	[butylbenzyl phthalate promotes the reaction [TFAP2A protein binds to HDAC6 promoter]] which results in increased expression of HDAC6 mRNA	22552774
C027561	butylbenzyl phthalate	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [butylbenzyl phthalate affects the localization of TFAP2A protein]	22552774
C027561	butylbenzyl phthalate	RTKI cpd inhibits the reaction [butylbenzyl phthalate affects the localization of TFAP2A protein]	22552774
C027561	butylbenzyl phthalate	TFAP2A mutant form inhibits the reaction [butylbenzyl phthalate results in increased expression of HDAC6 protein]	22552774
C018475	butyraldehyde	butyraldehyde results in decreased expression of TFAP2A mRNA	26079696
D002117	Calcitriol	Calcitriol results in increased expression of TFAP2A mRNA	26485663
D016190	Carboplatin	TFAP2A protein results in increased susceptibility to Carboplatin	16204029
D000068579	Celecoxib	Celecoxib results in decreased expression of TFAP2A mRNA	28201806
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of TFAP2A gene	20938992
D000077404	Cidofovir	Cidofovir results in decreased expression of TFAP2A mRNA	25596134
D002945	Cisplatin	Cisplatin results in decreased expression of TFAP2A mRNA	25596134
D002945	Cisplatin	Cisplatin results in increased expression of TFAP2A protein	16204029
D002945	Cisplatin	[Decitabine results in increased expression of TFAP2A protein] which results in increased susceptibility to Cisplatin	16204029
D002945	Cisplatin	TFAP2A protein affects the susceptibility to Cisplatin	16217747
D002945	Cisplatin	[TFAP2A protein co-treated with TP53 gene mutant form] results in decreased susceptibility to Cisplatin	21489314
D002945	Cisplatin	TFAP2A protein results in increased susceptibility to Cisplatin	16204029; 21489314;
D004002	Clodronic Acid	Clodronic Acid results in decreased expression of TFAP2A mRNA	25596134
D002996	Clomiphene	Clomiphene results in increased expression of TFAP2A mRNA	26865669
D003300	Copper	Copper results in decreased expression of TFAP2A mRNA	26293553
D003471	Cuprizone	Cuprizone results in increased expression of TFAP2A mRNA	27523638
D016572	Cyclosporine	Cyclosporine results in decreased expression of TFAP2A mRNA	25596134
D003561	Cytarabine	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [Cytarabine results in increased expression of TFAP2A mRNA]	23264188
D003561	Cytarabine	Cytarabine results in increased expression of TFAP2A mRNA	23264188
C010902	decabromobiphenyl ether	decabromobiphenyl ether results in increased expression of TFAP2A mRNA	31326446
D000077209	Decitabine	Decitabine results in increased expression of TFAP2A mRNA	16204029
D000077209	Decitabine	Decitabine results in increased expression of TFAP2A protein	16204029
D000077209	Decitabine	[Decitabine results in increased expression of TFAP2A protein] which results in increased susceptibility to Cisplatin	16204029
D000077209	Decitabine	[Decitabine results in increased expression of TFAP2A protein] which results in increased susceptibility to Doxorubicin	16204029
D003703	Demecolcine	Demecolcine results in decreased expression of TFAP2A mRNA	23649840
D003907	Dexamethasone	Dexamethasone inhibits the reaction [RX3 gene mutant form affects the expression of TFAP2A mRNA]	27941970
D003907	Dexamethasone	Dexamethasone results in increased expression of TFAP2A protein	28453788
D003907	Dexamethasone	[1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of TFAP2A mRNA	30409764
D003907	Dexamethasone	Acrylamide inhibits the reaction [[1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of TFAP2A mRNA]	30409764
D003993	Dibutyl Phthalate	Dibutyl Phthalate affects the localization of TFAP2A protein	22552774
D003993	Dibutyl Phthalate	Dibutyl Phthalate promotes the reaction [TFAP2A protein binds to HDAC6 promoter]	22552774
D003993	Dibutyl Phthalate	[Dibutyl Phthalate promotes the reaction [TFAP2A protein binds to HDAC6 promoter]] which results in increased expression of HDAC6 mRNA	22552774
D003993	Dibutyl Phthalate	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Dibutyl Phthalate affects the localization of TFAP2A protein]	22552774
D003993	Dibutyl Phthalate	RTKI cpd inhibits the reaction [Dibutyl Phthalate affects the localization of TFAP2A protein]	22552774
D003993	Dibutyl Phthalate	TFAP2A mutant form inhibits the reaction [Dibutyl Phthalate results in increased expression of HDAC6 protein]	22552774
C036042	dicyclohexyl phthalate	dicyclohexyl phthalate results in increased expression of TFAP2A mRNA	26924002
D004041	Dietary Fats	Acrylamide promotes the reaction [Dietary Fats results in increased expression of TFAP2A mRNA]	30409764
D004041	Dietary Fats	Dietary Fats results in increased expression of TFAP2A mRNA	25016146; 30409764;
D004054	Diethylstilbestrol	Diethylstilbestrol results in decreased expression of TFAP2A mRNA	26865669
C024629	dimethyl phthalate	dimethyl phthalate affects the expression of TFAP2A mRNA	26924002
C516138	dorsomorphin	[NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D004317	Doxorubicin	[Decitabine results in increased expression of TFAP2A protein] which results in increased susceptibility to Doxorubicin	16204029
D004317	Doxorubicin	Doxorubicin results in increased expression of TFAP2A protein	16204029
D004317	Doxorubicin	TFAP2A protein results in increased susceptibility to Doxorubicin	16204029
C118739	entinostat	entinostat results in increased expression of TFAP2A mRNA	26272509
C118739	entinostat	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D000069347	Erlotinib Hydrochloride	Erlotinib Hydrochloride inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]	21499124; 21951556;
D000069347	Erlotinib Hydrochloride	Tetradecanoylphorbol Acetate inhibits the reaction [Erlotinib Hydrochloride inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]]	21499124; 21951556;
D004958	Estradiol	Estradiol affects the expression of TFAP2A mRNA	23557687
D004958	Estradiol	Estradiol results in decreased expression of TFAP2A mRNA	26865669; 28711546;
D000431	Ethanol	Ethanol results in decreased expression of TFAP2A protein	28919490
D000431	Ethanol	Ethanol results in increased expression of TFAP2A mRNA	28986285
D005047	Etoposide	TFAP2A protein affects the susceptibility to Etoposide	16217747
D005047	Etoposide	TFAP2A protein results in increased susceptibility to Etoposide	16204029
D017313	Fenretinide	Fenretinide results in increased expression of TFAP2A mRNA	28973697
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of TFAP2A gene	20938992
D000077267	Fulvestrant	Fulvestrant results in increased expression of TFAP2A mRNA	26865669
C039281	furan	furan results in increased expression of TFAP2A mRNA	25539665
D005742	Gasoline	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of TFAP2A mRNA	29432896
D000077156	Gefitinib	Gefitinib inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]	21499124; 21951556;
D000077156	Gefitinib	Tetradecanoylphorbol Acetate inhibits the reaction [Gefitinib inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]]	21499124; 21951556;
C056507	gemcitabine	[TFAP2A protein co-treated with TP53 gene mutant form] results in decreased susceptibility to gemcitabine	21489314
C056507	gemcitabine	TFAP2A protein results in increased susceptibility to gemcitabine	21489314
D019833	Genistein	Genistein results in decreased expression of TFAP2A mRNA	26865669
C007836	geraniol	geraniol results in increased expression of TFAP2A mRNA	27683099
D006220	Haloperidol	Haloperidol results in decreased expression of TFAP2A mRNA	29458080
D006589	Hexestrol	Hexestrol results in decreased expression of TFAP2A mRNA	26865669
D007069	Ifosfamide	Ifosfamide results in decreased expression of TFAP2A mRNA	25596134
D019469	Indinavir	Indinavir results in decreased expression of TFAP2A mRNA	17926646
C544151	jinfukang	jinfukang results in increased expression of TFAP2A mRNA	27392435
C053401	kahweol	kahweol results in decreased expression of TFAP2A mRNA	30205135
C053401	kahweol	kahweol results in decreased expression of TFAP2A protein	30205135
D008345	Manganese	Manganese results in increased expression of TFAP2A protein	24845367
C042720	mercuric bromide	mercuric bromide results in increased expression of TFAP2A mRNA	26272509
C042720	mercuric bromide	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D008656	Mestranol	Mestranol results in decreased expression of TFAP2A mRNA	26865669
D008694	Methamphetamine	Methamphetamine results in increased expression of TFAP2A mRNA	28341135
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of TFAP2A gene	20938992
D008727	Methotrexate	Methotrexate affects the expression of TFAP2A mRNA	18502557
C004925	methylmercuric chloride	methylmercuric chloride results in decreased expression of TFAP2A mRNA	28001369
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of TFAP2A mRNA	23179753; 26272509;
D016685	Mitomycin	TFAP2A protein affects the susceptibility to Mitomycin	16217747
C517284	monomethyl phthalate	monomethyl phthalate affects the expression of TFAP2A mRNA	26924002
C063509	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [butylbenzyl phthalate affects the localization of TFAP2A protein]	22552774
C063509	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Dibutyl Phthalate affects the localization of TFAP2A protein]	22552774
C017557	nickel subsulfide	nickel subsulfide results in decreased expression of TFAP2A mRNA	12760830
D009534	Niclosamide	Niclosamide results in decreased expression of TFAP2A mRNA	31398420
D010126	Ozone	Ozone promotes the reaction [TFAP2A protein binds to BRS3 promoter]	17355223
D010126	Ozone	Ozone results in increased activity of TFAP2A protein	17355223
D010126	Ozone	TFAP2A protein affects the reaction [Ozone results in increased expression of BRS3 mRNA]	17355223
D017239	Paclitaxel	Paclitaxel results in increased expression of TFAP2A protein	16204029
D017239	Paclitaxel	TFAP2A protein results in increased susceptibility to Paclitaxel	16204029
D000077767	Panobinostat	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D000077767	Panobinostat	Panobinostat results in increased expression of TFAP2A mRNA	26272509
D017374	Paroxetine	Paroxetine results in increased expression of TFAP2A protein	28844482
D052638	Particulate Matter	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of TFAP2A mRNA	29432896
D052638	Particulate Matter	Particulate Matter results in increased expression of TFAP2A mRNA	21703343; 29703138;
D020245	p-Chloromercuribenzoic Acid	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D020245	p-Chloromercuribenzoic Acid	p-Chloromercuribenzoic Acid results in increased expression of TFAP2A mRNA	26272509
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in increased expression of TFAP2A mRNA	26272509
D010795	Phthalic Acids	Phthalic Acids results in decreased expression of TFAP2A mRNA	21061450
C006253	pirinixic acid	pirinixic acid results in increased expression of TFAP2A mRNA	18445702
D010936	Plant Extracts	Plant Extracts results in decreased expression of TFAP2A mRNA	23684756
D011084	Polycyclic Aromatic Hydrocarbons	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of TFAP2A mRNA	29432896
D011441	Propylthiouracil	Propylthiouracil results in increased expression of TFAP2A mRNA	24780913
D020849	Raloxifene Hydrochloride	Raloxifene Hydrochloride results in increased expression of TFAP2A mRNA	26865669
D000077185	Resveratrol	Resveratrol results in increased localization of and results in increased activity of TFAP2A protein	16488535
C085746	rottlerin	rottlerin inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]	21499124
C101044	RTKI cpd	RTKI cpd inhibits the reaction [butylbenzyl phthalate affects the localization of TFAP2A protein]	22552774
C101044	RTKI cpd	RTKI cpd inhibits the reaction [Dibutyl Phthalate affects the localization of TFAP2A protein]	22552774
C078903	seocalcitol	seocalcitol results in increased expression of TFAP2A mRNA	12040012
D020280	Sertraline	Sertraline results in increased expression of TFAP2A protein	28844482
C017947	sodium arsenite	sodium arsenite results in decreased expression of TFAP2A mRNA	29361514
D018119	Stavudine	Stavudine results in decreased expression of TFAP2A mRNA	17926646
D013311	Streptozocin	MFN2 protein mutant form inhibits the reaction [Streptozocin promotes the reaction [TFAP2A protein binds to COL4A1 promoter]]	27997345
D013311	Streptozocin	Streptozocin promotes the reaction [TFAP2A protein binds to COL4A1 promoter]	27997345
C020806	tetrabromobisphenol A	tetrabromobisphenol A results in increased expression of TFAP2A mRNA	31326446
C041181	tetrachlorodian	tetrachlorodian results in increased expression of TFAP2A mRNA	31326446
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of TFAP2A mRNA	19901195; 22903824; 23152189;
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of TFAP2A mRNA	21570461; 24058054;
D013749	Tetrachlorodibenzodioxin	TFAP2A mRNA affects the reaction [Tetrachlorodibenzodioxin results in increased degradation of AHR protein]	16085934
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate inhibits the reaction [Erlotinib Hydrochloride inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]]	21499124; 21951556;
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate inhibits the reaction [Gefitinib inhibits the reaction [TFAP2A protein binds to ULBP1 promoter]]	21499124; 21951556;
D014212	Tretinoin	Tretinoin results in increased expression of TFAP2A mRNA	14534139
D014212	Tretinoin	Tretinoin affects the localization of TFAP2A protein	17229153
D014212	Tretinoin	Tretinoin inhibits the reaction [TFAP2A protein binds to DPYSL2 promoter]	17229153
D014212	Tretinoin	Tretinoin promotes the reaction [NPM1 protein binds to TFAP2A protein]	17318229
D014212	Tretinoin	Tretinoin promotes the reaction [[NPM1 protein binds to TFAP2A protein] which binds to NPM1 promoter]	17318229
D014212	Tretinoin	Tretinoin results in increased expression of TFAP2A mRNA	17138961; 17318229; 21934132;
D014241	Trichloroethylene	Trichloroethylene results in increased expression of TFAP2A mRNA	21135412
C012589	trichostatin A	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
C012589	trichostatin A	trichostatin A results in increased expression of TFAP2A mRNA	24935251; 26272509;
D014260	Triclosan	Triclosan results in decreased expression of TFAP2A mRNA	30510588
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of TFAP2A mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in decreased expression of TFAP2A mRNA	28001369
D014635	Valproic Acid	Valproic Acid results in decreased methylation of TFAP2A gene	29154799
D014635	Valproic Acid	Valproic Acid results in increased expression of TFAP2A mRNA	23179753; 24383497; 24935251; 26272509;
D014635	Valproic Acid	Valproic Acid affects the expression of TFAP2A mRNA	17292431
D014635	Valproic Acid	Valproic Acid results in decreased expression of TFAP2A mRNA	31445079
D001335	Vehicle Emissions	Vehicle Emissions results in decreased methylation of TFAP2A gene	25560391
D014750	Vincristine	Vincristine results in decreased expression of TFAP2A mRNA	23649840
D000077337	Vorinostat	[NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TFAP2A mRNA	27188386
D000077337	Vorinostat	Vorinostat results in increased expression of TFAP2A mRNA	26272509
D015215	Zidovudine	Zidovudine results in decreased expression of TFAP2A mRNA	17926646

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0010	Activator
KW-0025	Alternative splicing
KW-0903	Direct protein sequencing
KW-0225	Disease mutation
KW-0238	DNA-binding
KW-1017	Isopeptide bond
KW-0539	Nucleus
KW-0597	Phosphoprotein
KW-1185	Reference proteome
KW-0804	Transcription
KW-0805	Transcription regulation
KW-0832	Ubl conjugation

Interpro

InterPro ID	InterPro Term
IPR004979	TF_AP2
IPR008121	TF_AP2_alpha_N
IPR013854	TF_AP2_C

PROSITE

PROSITE ID	PROSITE Term

Pfam

Pfam ID	Pfam Term
PF03299	TF_AP-2

Gene: TFAP2A

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

There is no orthologous record for this gene !

Identified variants/mutations related to cleft phenotype

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction