CleftGeneDB-Search

Gene: RARA

Basic information

Tag	Content
Uniprot ID	P10276; B8Y636; P78456; Q13440; Q13441; Q96S41; Q9NQS0;
Entrez ID	5914
Genbank protein ID	CAA29787.1; CAA41532.1; AAH71733.1; AAF87249.1; CAA39533.1; AAB00112.1; AAD05222.1; BAB62809.1; AAH08727.1; AAB00113.1; ACK86665.1; CAA29829.1;
Genbank nucleotide ID	NM_001145301.2; XM_011525095.1; NM_001024809.3; XM_005257553.1; NM_000964.3; NM_001145302.2; XM_005257554.1;
Ensembl protein ID	ENSP00000389993; ENSP00000377649; ENSP00000254066; ENSP00000377643;
Ensembl nucleotide ID	ENSG00000131759
Gene name	Retinoic acid receptor alpha
Gene symbol	RARA
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type	CPO,CL/P
Developmental stage
Data sources	Manually collected
Reference	1361101; 11810291; 24265584;
Functional description	Receptor for retinoic acid (PubMed:19850744, PubMed:16417524, PubMed:20215566). Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes (PubMed:28167758). The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5 (PubMed:28167758). In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone deacetylation, chromatin condensation and transcriptional suppression (PubMed:16417524). On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation (PubMed:9267036, PubMed:19850744, PubMed:20215566). Formation of a complex with histone deacetylases might lead to inhibition of RARE DNA element binding and to transcriptional repression (PubMed:28167758). Transcriptional activation and RARE DNA element binding might be supported by the transcription factor KLF2 (PubMed:28167758). RARA plays an essential role in the regulation of retinoic acid-induced germ cell development during spermatogenesis (By similarity). Has a role in the survival of early spermatocytes at the beginning prophase of meiosis (By similarity). In Sertoli cells, may promote the survival and development of early meiotic prophase spermatocytes (By similarity). In concert with RARG, required for skeletal growth, matrix homeostasis and growth plate function (By similarity). Together with RXRA, positively regulates microRNA-10a expression, thereby inhibiting the GATA6/VCAM1 signaling response to pulsatile shear stress in vascular endothelial cells (PubMed:28167758). In association with HDAC3, HDAC5 and HDAC7 corepressors, plays a role in the repression of microRNA-10a and thereby promotes the inflammatory response (PubMed:28167758).
Sequence	MASNSSSCPT PGGGHLNGYP VPPYAFFFPP MLGGLSPPGA LTTLQHQLPV SGYSTPSPAT 60 IETQSSSSEE IVPSPPSPPP LPRIYKPCFV CQDKSSGYHY GVSACEGCKG FFRRSIQKNM 120 VYTCHRDKNC IINKVTRNRC QYCRLQKCFE VGMSKESVRN DRNKKKKEVP KPECSESYTL 180 TPEVGELIEK VRKAHQETFP ALCQLGKYTT NNSSEQRVSL DIDLWDKFSE LSTKCIIKTV 240 EFAKQLPGFT TLTIADQITL LKAACLDILI LRICTRYTPE QDTMTFSDGL TLNRTQMHNA 300 GFGPLTDLVF AFANQLLPLE MDDAETGLLS AICLICGDRQ DLEQPDRVDM LQEPLLEALK 360 VYVRKRRPSR PHMFPKMLMK ITDLRSISAK GAERVITLKM EIPGSMPPLI QEMLENSEGL 420 DTLSGQPGGG GRDGGGLAPP PGSCSPSLSP SSNRSSPATH SP 462

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1DKF
1DSZ
3A9E
3KMR
3KMZ
4DQM
5K13
1DSZ
3KMR

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Developmental stage	Species	Evidence	Details
1:1 ortholog	RARA	534280	F1MWQ3			Bos taurus	Prediction	More>>
1:1 ortholog	RARA	102188350	A0A452EMU9			Capra hircus	Prediction	More>>
1:1 ortholog	RARA	5914	P10276	CPO,CL/P		Homo sapiens	Publication	More>>
1:1 ortholog	Rara	19401	P11416	CPO	E14.5	Mus musculus	Publication	More>>
1:1 ortholog	RARA	454647	A0A2J8KGL7			Pan troglodytes	Prediction	More>>
1:1 ortholog	RARA	396709	A0A480PNE7			Sus scrofa	Prediction	More>>
1:1 ortholog	RARA		G1TI43			Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Rara	24705	A0A0G2JW78			Rattus norvegicus	Prediction	More>>
1:1 ortholog	raraa	30680	T2DKU4			Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1403940287	p.Ser3Asn	missense variant	-	NC_000017.11:g.40331226G>A	gnomAD
rs759886628	p.Asn4His	missense variant	-	NC_000017.11:g.40331228A>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser5Asn	missense variant	-	NC_000017.11:g.40331232G>A	NCI-TCGA
rs1173565250	p.Ser6Asn	missense variant	-	NC_000017.11:g.40331235G>A	TOPMed
rs1229353893	p.Ser6Gly	missense variant	-	NC_000017.11:g.40331234A>G	gnomAD
rs150291626	p.Ser7Cys	missense variant	-	NC_000017.11:g.40331238C>G	ESP,ExAC,TOPMed,gnomAD
rs762408148	p.Pro9Leu	missense variant	-	NC_000017.11:g.40331244C>T	ExAC,TOPMed,gnomAD
rs1419067649	p.Thr10Ala	missense variant	-	NC_000017.11:g.40331246A>G	TOPMed
NCI-TCGA novel	p.Gly12Trp	missense variant	-	NC_000017.11:g.40331252G>T	NCI-TCGA
rs137929765	p.Gly12Ala	missense variant	-	NC_000017.11:g.40331253G>C	ESP,ExAC,TOPMed,gnomAD
rs761512575	p.Gly13Asp	missense variant	-	NC_000017.11:g.40331256G>A	ExAC,gnomAD
rs750162967	p.His15Tyr	missense variant	-	NC_000017.11:g.40331261C>T	ExAC,gnomAD
rs368040095	p.Asn17Ser	missense variant	-	NC_000017.11:g.40331268A>G	ESP,ExAC,TOPMed,gnomAD
COSM6146637	p.Pro20Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40331276C>T	NCI-TCGA Cosmic
rs201015843	p.Pro20Ala	missense variant	-	NC_000017.11:g.40331276C>G	ESP,ExAC,TOPMed,gnomAD
rs371882393	p.Ala25Ser	missense variant	-	NC_000017.11:g.40331291G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs371882393	p.Ala25Thr	missense variant	-	NC_000017.11:g.40331291G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs746187167	p.Phe26Leu	missense variant	-	NC_000017.11:g.40331296C>A	ExAC,gnomAD
rs1297897531	p.Pro29His	missense variant	-	NC_000017.11:g.40331304C>A	TOPMed,gnomAD
COSM3517013	p.Pro29Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40331303C>T	NCI-TCGA Cosmic
rs1371891710	p.Pro30Ala	missense variant	-	NC_000017.11:g.40331306C>G	gnomAD
COSM2838983	p.Pro30LeuPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000017.11:g.40331302C>-	NCI-TCGA Cosmic
rs1313589879	p.Met31Val	missense variant	-	NC_000017.11:g.40331309A>G	gnomAD
rs1334285485	p.Met31Ile	missense variant	-	NC_000017.11:g.40331311G>A	TOPMed
rs775872347	p.Leu32Met	missense variant	-	NC_000017.11:g.40331312C>A	ExAC,TOPMed,gnomAD
rs1402282746	p.Leu32Arg	missense variant	-	NC_000017.11:g.40331313T>G	TOPMed
rs561629991	p.Pro37Leu	missense variant	-	NC_000017.11:g.40331328C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs576185106	p.Ala40Ser	missense variant	-	NC_000017.11:g.40331336G>T	ExAC,TOPMed,gnomAD
rs576185106	p.Ala40Thr	missense variant	-	NC_000017.11:g.40331336G>A	ExAC,TOPMed,gnomAD
rs576185106	p.Ala40Pro	missense variant	-	NC_000017.11:g.40331336G>C	ExAC,TOPMed,gnomAD
rs138781565	p.Leu41Val	missense variant	-	NC_000017.11:g.40331339C>G	ESP,ExAC,TOPMed,gnomAD
rs116538651	p.Thr43Ser	missense variant	-	NC_000017.11:g.40331346C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1433348499	p.Gln45His	missense variant	-	NC_000017.11:g.40331353G>C	gnomAD
rs562304039	p.His46Gln	missense variant	-	NC_000017.11:g.40331356C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs757297600	p.Gln47Ter	stop gained	-	NC_000017.11:g.40331357C>T	ExAC,gnomAD
rs781428265	p.Gly52Glu	missense variant	-	NC_000017.11:g.40331373G>A	ExAC,TOPMed,gnomAD
rs756376800	p.Thr55Pro	missense variant	-	NC_000017.11:g.40331381A>C	ExAC,gnomAD
rs780381092	p.Thr55Ile	missense variant	-	NC_000017.11:g.40331382C>T	ExAC
rs200014376	p.Ser57Pro	missense variant	-	NC_000017.11:g.40331387T>C	ExAC,gnomAD
rs774732066	p.Ala59Thr	missense variant	-	NC_000017.11:g.40331393G>A	ExAC,TOPMed,gnomAD
rs774732066	p.Ala59Ser	missense variant	-	NC_000017.11:g.40331393G>T	ExAC,TOPMed,gnomAD
rs999607343	p.Thr60Asn	missense variant	-	NC_000017.11:g.40348316C>A	TOPMed
rs1410890791	p.Ile61Thr	missense variant	-	NC_000017.11:g.40348319T>C	gnomAD
rs753325918	p.Glu62Lys	missense variant	-	NC_000017.11:g.40348321G>A	ExAC,gnomAD
rs1398822077	p.Ser65Ile	missense variant	-	NC_000017.11:g.40348331G>T	gnomAD
rs533798657	p.Ile71Thr	missense variant	-	NC_000017.11:g.40348349T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1240210247	p.Ser77Leu	missense variant	-	NC_000017.11:g.40348367C>T	TOPMed
NCI-TCGA novel	p.Pro78Ser	missense variant	-	NC_000017.11:g.40348369C>T	NCI-TCGA
rs752378107	p.Pro79Ala	missense variant	-	NC_000017.11:g.40348372C>G	ExAC,gnomAD
rs777603974	p.Pro80Ala	missense variant	-	NC_000017.11:g.40348375C>G	ExAC,gnomAD
COSM5139689	p.Leu81SerPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000017.11:g.40348371_40348372insC	NCI-TCGA Cosmic
rs1294572459	p.Pro82Leu	missense variant	-	NC_000017.11:g.40348382C>T	gnomAD
rs751370458	p.Arg83His	missense variant	-	NC_000017.11:g.40348385G>A	ExAC,TOPMed,gnomAD
rs1316046808	p.Arg83Cys	missense variant	-	NC_000017.11:g.40348384C>T	gnomAD
rs781003431	p.Tyr85Cys	missense variant	-	NC_000017.11:g.40348391A>G	ExAC,gnomAD
NCI-TCGA novel	p.Cys91Tyr	missense variant	-	NC_000017.11:g.40348409G>A	NCI-TCGA
NCI-TCGA novel	p.Lys94Arg	missense variant	-	NC_000017.11:g.40348418A>G	NCI-TCGA
rs768888762	p.Ser96Ala	missense variant	-	NC_000017.11:g.40348423T>G	ExAC,gnomAD
rs748355308	p.Val102Ile	missense variant	-	NC_000017.11:g.40348441G>A	ExAC,gnomAD
rs148477186	p.Ser103Arg	missense variant	-	NC_000017.11:g.40348446C>G	ESP,ExAC,TOPMed,gnomAD
rs773619675	p.Ala104Thr	missense variant	-	NC_000017.11:g.40348447G>A	ExAC,TOPMed,gnomAD
COSM706469	p.Cys108Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40348459T>A	NCI-TCGA Cosmic
rs779120079	p.Arg113Cys	missense variant	-	NC_000017.11:g.40349793C>T	ExAC,gnomAD
rs1280820027	p.Arg114His	missense variant	-	NC_000017.11:g.40349797G>A	gnomAD
rs1434179064	p.Arg114Cys	missense variant	-	NC_000017.11:g.40349796C>T	gnomAD
rs1238728084	p.Met120Thr	missense variant	-	NC_000017.11:g.40349815T>C	gnomAD
NCI-TCGA novel	p.Tyr122Cys	missense variant	-	NC_000017.11:g.40349821A>G	NCI-TCGA
rs1031458847	p.Thr123Met	missense variant	-	NC_000017.11:g.40349824C>T	TOPMed,gnomAD
rs367912717	p.Arg126Gln	missense variant	-	NC_000017.11:g.40349833G>A	ESP,ExAC,TOPMed,gnomAD
rs976474384	p.Arg126Trp	missense variant	-	NC_000017.11:g.40349832C>T	TOPMed
rs747353115	p.Ile131Val	missense variant	-	NC_000017.11:g.40349847A>G	ExAC,TOPMed,gnomAD
rs747353115	p.Ile131Leu	missense variant	-	NC_000017.11:g.40349847A>C	ExAC,TOPMed,gnomAD
rs945569487	p.Asn133Asp	missense variant	-	NC_000017.11:g.40349853A>G	TOPMed
rs543704273	p.Lys134Asn	missense variant	-	NC_000017.11:g.40349858G>C	1000Genomes,ExAC,gnomAD
rs1233921646	p.Arg137Gln	missense variant	-	NC_000017.11:g.40349866G>A	gnomAD
rs1454375439	p.Arg139Cys	missense variant	-	NC_000017.11:g.40349871C>T	TOPMed
rs565178707	p.Arg139His	missense variant	-	NC_000017.11:g.40349872G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1454375439	p.Arg139Ser	missense variant	-	NC_000017.11:g.40349871C>A	TOPMed
COSM472726	p.Gln146Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40349893A>G	NCI-TCGA Cosmic
rs762461183	p.Glu150Asp	missense variant	-	NC_000017.11:g.40349906A>C	ExAC,gnomAD
rs1164026646	p.Glu150Lys	missense variant	-	NC_000017.11:g.40349904G>A	gnomAD
rs1384825156	p.Val151Ala	missense variant	-	NC_000017.11:g.40349908T>C	gnomAD
rs1436372199	p.Val151Met	missense variant	-	NC_000017.11:g.40349907G>A	TOPMed
rs773905498	p.Lys155Arg	missense variant	-	NC_000017.11:g.40349920A>G	ExAC,gnomAD
COSM1588843	p.Ser157Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40349925T>C	NCI-TCGA Cosmic
rs1292720890	p.Asp161Glu	missense variant	-	NC_000017.11:g.40351923C>A	gnomAD
rs780436052	p.Asp161Gly	missense variant	-	NC_000017.11:g.40351922A>G	ExAC
rs1322125255	p.Arg162Ter	stop gained	-	NC_000017.11:g.40351924C>T	gnomAD
rs749735817	p.Arg162Gln	missense variant	-	NC_000017.11:g.40351925G>A	ExAC,gnomAD
rs1481572813	p.Lys164Asn	missense variant	-	NC_000017.11:g.40351932G>C	gnomAD
rs1437236573	p.Val169Leu	missense variant	-	NC_000017.11:g.40351945G>T	gnomAD
rs747695319	p.Pro170Leu	missense variant	-	NC_000017.11:g.40351949C>T	ExAC,gnomAD
rs1427039505	p.Lys171Glu	missense variant	-	NC_000017.11:g.40351951A>G	TOPMed
rs1413996628	p.Lys171Asn	missense variant	-	NC_000017.11:g.40351953G>C	gnomAD
rs771789973	p.Pro172His	missense variant	-	NC_000017.11:g.40351955C>A	ExAC,gnomAD
rs369501728	p.Glu173Lys	missense variant	-	NC_000017.11:g.40351957G>A	ExAC,TOPMed,gnomAD
rs369501728	p.Glu173Gln	missense variant	-	NC_000017.11:g.40351957G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Cys174Ser	missense variant	-	NC_000017.11:g.40351960T>A	NCI-TCGA
rs770822935	p.Ser175Phe	missense variant	-	NC_000017.11:g.40351964C>T	ExAC,TOPMed,gnomAD
rs776543112	p.Ser177Gly	missense variant	-	NC_000017.11:g.40351969A>G	ExAC,gnomAD
rs759379591	p.Tyr178His	missense variant	-	NC_000017.11:g.40351972T>C	ExAC,gnomAD
rs375401606	p.Thr179Met	missense variant	-	NC_000017.11:g.40351976C>T	ESP,TOPMed,gnomAD
rs367821941	p.Thr181Met	missense variant	-	NC_000017.11:g.40351982C>T	ESP,ExAC,TOPMed,gnomAD
rs767684695	p.Pro182Leu	missense variant	-	NC_000017.11:g.40351985C>T	ExAC,TOPMed,gnomAD
rs1480073657	p.Val184Met	missense variant	-	NC_000017.11:g.40351990G>A	gnomAD
rs1440999870	p.Glu186Gln	missense variant	-	NC_000017.11:g.40351996G>C	TOPMed
rs1456081508	p.Glu189Lys	missense variant	-	NC_000017.11:g.40352005G>A	gnomAD
rs780378953	p.Lys190Arg	missense variant	-	NC_000017.11:g.40352009A>G	ExAC,gnomAD
NCI-TCGA novel	p.Val191SerPheSerTerUnkUnk	frameshift	-	NC_000017.11:g.40352011_40352035GTGCGCAAAGCGCACCAGGAAACCT>-	NCI-TCGA
COSM5658255	p.Arg192Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352014C>T	NCI-TCGA Cosmic
rs754292583	p.Arg192His	missense variant	-	NC_000017.11:g.40352015G>A	ExAC,TOPMed,gnomAD
rs755371276	p.Lys193Arg	missense variant	-	NC_000017.11:g.40352018A>G	ExAC,gnomAD
rs779485530	p.Ala194Val	missense variant	-	NC_000017.11:g.40352021C>T	ExAC,gnomAD
rs1180532434	p.Ala194Thr	missense variant	-	NC_000017.11:g.40352020G>A	gnomAD
rs771740867	p.His195Gln	missense variant	-	NC_000017.11:g.40352025C>A	ExAC,gnomAD
NCI-TCGA novel	p.Gln196ProPheSerTerUnkUnk	frameshift	-	NC_000017.11:g.40352024_40352025insC	NCI-TCGA
rs1422032918	p.Gln196His	missense variant	-	NC_000017.11:g.40352028G>C	gnomAD
rs1328721893	p.Gln204Arg	missense variant	-	NC_000017.11:g.40352051A>G	TOPMed
NCI-TCGA novel	p.Thr210Met	missense variant	-	NC_000017.11:g.40352069C>T	NCI-TCGA
COSM472728	p.Thr210Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352068A>G	NCI-TCGA Cosmic
rs1301972280	p.Asn212Lys	missense variant	-	NC_000017.11:g.40352336C>G	TOPMed,gnomAD
COSM3517016	p.Ser214Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352341C>T	NCI-TCGA Cosmic
COSM472729	p.Glu215Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352344A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg217Pro	missense variant	-	NC_000017.11:g.40352350G>C	NCI-TCGA
NCI-TCGA novel	p.Arg217Gly	missense variant	-	NC_000017.11:g.40352349C>G	NCI-TCGA
NCI-TCGA novel	p.Arg217Ser	missense variant	-	NC_000017.11:g.40352349C>A	NCI-TCGA
NCI-TCGA novel	p.Arg217Cys	missense variant	-	NC_000017.11:g.40352349C>T	NCI-TCGA
COSM4995738	p.Arg217His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352350G>A	NCI-TCGA Cosmic
COSM5126894	p.Ser219Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352356C>A	NCI-TCGA Cosmic
rs201919660	p.Trp225Arg	missense variant	-	NC_000017.11:g.40352373T>C	1000Genomes
rs1043230133	p.Asp226Glu	missense variant	-	NC_000017.11:g.40352378C>G	TOPMed
rs745604036	p.Asp226Val	missense variant	-	NC_000017.11:g.40352377A>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys227Asn	missense variant	-	NC_000017.11:g.40352381G>T	NCI-TCGA
NCI-TCGA novel	p.Ser232Tyr	missense variant	-	NC_000017.11:g.40352395C>A	NCI-TCGA
rs769597380	p.Cys235Ser	missense variant	-	NC_000017.11:g.40352403T>A	ExAC,TOPMed,gnomAD
rs1220464444	p.Thr239Ser	missense variant	-	NC_000017.11:g.40352416C>G	gnomAD
rs775194260	p.Val240Ala	missense variant	-	NC_000017.11:g.40352419T>C	ExAC,gnomAD
rs773208934	p.Ala243Ser	missense variant	-	NC_000017.11:g.40352427G>T	ExAC,gnomAD
rs200827868	p.Gly248Asp	missense variant	-	NC_000017.11:g.40352443G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs373673287	p.Gly248Ser	missense variant	-	NC_000017.11:g.40352442G>A	ESP,ExAC,TOPMed,gnomAD
COSM4399066	p.Thr250Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352449C>T	NCI-TCGA Cosmic
rs1298679769	p.Thr253Asn	missense variant	-	NC_000017.11:g.40352458C>A	TOPMed
rs758973243	p.Ala255Thr	missense variant	-	NC_000017.11:g.40352463G>A	ExAC,gnomAD
COSM337029	p.Asp256Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352466G>T	NCI-TCGA Cosmic
COSM3517018	p.Asp256Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40352466G>A	NCI-TCGA Cosmic
rs1407524352	p.Ile258Val	missense variant	-	NC_000017.11:g.40352472A>G	TOPMed
NCI-TCGA novel	p.Thr259HisPheSerTerUnkUnk	frameshift	-	NC_000017.11:g.40352473_40352474insA	NCI-TCGA
rs1457382271	p.Arg272Gln	missense variant	-	NC_000017.11:g.40354309G>A	gnomAD
COSM1382961	p.Arg272Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354308C>T	NCI-TCGA Cosmic
rs757750800	p.Thr275Met	missense variant	-	NC_000017.11:g.40354318C>T	ExAC,TOPMed,gnomAD
RCV000171542	p.Arg276Trp	missense variant	-	NC_000017.11:g.40354320C>T	ClinVar
NCI-TCGA novel	p.Arg276Gln	missense variant	-	NC_000017.11:g.40354321G>A	NCI-TCGA
rs786205678	p.Arg276Trp	missense variant	-	NC_000017.11:g.40354320C>T	-
COSM5133155	p.Glu280Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354332G>A	NCI-TCGA Cosmic
rs1367641937	p.Gln281Glu	missense variant	-	NC_000017.11:g.40354335C>G	gnomAD
NCI-TCGA novel	p.Met284Ile	missense variant	-	NC_000017.11:g.40354346G>A	NCI-TCGA
rs1471663982	p.Thr285Ile	missense variant	-	NC_000017.11:g.40354348C>T	gnomAD
NCI-TCGA novel	p.Phe286Ile	missense variant	-	NC_000017.11:g.40354350T>A	NCI-TCGA
COSM1479531	p.Phe286Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354351T>C	NCI-TCGA Cosmic
COSM3356915	p.Arg294Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354374C>T	NCI-TCGA Cosmic
rs1328672864	p.Met297Ile	missense variant	-	NC_000017.11:g.40354385G>T	gnomAD
COSM3795579	p.Asn299Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354390A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly301Val	missense variant	-	NC_000017.11:g.40354396G>T	NCI-TCGA
rs1333053490	p.Gly301Ala	missense variant	-	NC_000017.11:g.40354396G>C	gnomAD
COSM4066169	p.Gly303Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354401G>A	NCI-TCGA Cosmic
rs374550237	p.Leu305Val	missense variant	-	NC_000017.11:g.40354407C>G	ESP,ExAC,TOPMed,gnomAD
rs763372641	p.Asp307Asn	missense variant	-	NC_000017.11:g.40354413G>A	ExAC,TOPMed,gnomAD
rs1257809729	p.Phe312Leu	missense variant	-	NC_000017.11:g.40354428T>C	gnomAD
rs762374504	p.Ala313Val	missense variant	-	NC_000017.11:g.40354432C>T	ExAC,gnomAD
rs145829003	p.Pro318His	missense variant	-	NC_000017.11:g.40354447C>A	ESP,ExAC,TOPMed,gnomAD
COSM1382962	p.Pro318Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40354446C>T	NCI-TCGA Cosmic
rs145829003	p.Pro318Arg	missense variant	-	NC_000017.11:g.40354447C>G	ESP,ExAC,TOPMed,gnomAD
rs1477443305	p.Met321Ile	missense variant	-	NC_000017.11:g.40354457G>A	gnomAD
rs148999974	p.Asp323Glu	missense variant	-	NC_000017.11:g.40354463T>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala324Val	missense variant	-	NC_000017.11:g.40354465C>T	NCI-TCGA
rs1219908764	p.Ala324Thr	missense variant	-	NC_000017.11:g.40354464G>A	TOPMed
NCI-TCGA novel	p.Glu325Asp	missense variant	-	NC_000017.11:g.40354469G>C	NCI-TCGA
NCI-TCGA novel	p.Thr326Ser	missense variant	-	NC_000017.11:g.40354470A>T	NCI-TCGA
rs752501819	p.Thr326Met	missense variant	-	NC_000017.11:g.40354471C>T	ExAC,gnomAD
rs1399533631	p.Gly327Arg	missense variant	-	NC_000017.11:g.40354473G>A	gnomAD
rs879250985	p.Ala331Ser	missense variant	-	NC_000017.11:g.40354485G>T	gnomAD
rs1303998335	p.Ile332Val	missense variant	-	NC_000017.11:g.40354488A>G	gnomAD
rs774786141	p.Cys336Tyr	missense variant	-	NC_000017.11:g.40354501G>A	ExAC,gnomAD
rs774786141	p.Cys336Phe	missense variant	-	NC_000017.11:g.40354501G>T	ExAC,gnomAD
rs1402577201	p.Arg339Leu	missense variant	-	NC_000017.11:g.40355266G>T	TOPMed,gnomAD
rs1416311365	p.Arg339Cys	missense variant	-	NC_000017.11:g.40355265C>T	TOPMed
rs1402577201	p.Arg339His	missense variant	-	NC_000017.11:g.40355266G>A	TOPMed,gnomAD
rs568539129	p.Pro345Leu	missense variant	-	NC_000017.11:g.40355284C>T	1000Genomes,ExAC,gnomAD
rs762709825	p.Arg347Leu	missense variant	-	NC_000017.11:g.40355290G>T	ExAC,gnomAD
rs138717943	p.Arg347Trp	missense variant	-	NC_000017.11:g.40355289C>T	ESP,ExAC,TOPMed,gnomAD
rs762709825	p.Arg347Gln	missense variant	-	NC_000017.11:g.40355290G>A	ExAC,gnomAD
rs1244011629	p.Val348Met	missense variant	-	NC_000017.11:g.40355292G>A	gnomAD
NCI-TCGA novel	p.Asp349Gly	missense variant	-	NC_000017.11:g.40355296A>G	NCI-TCGA
NCI-TCGA novel	p.Asp349Tyr	missense variant	-	NC_000017.11:g.40355295G>T	NCI-TCGA
rs1271139288	p.Met350Val	missense variant	-	NC_000017.11:g.40355298A>G	gnomAD
rs1458722746	p.Met350Lys	missense variant	-	NC_000017.11:g.40355299T>A	gnomAD
rs767570841	p.Leu351Gln	missense variant	-	NC_000017.11:g.40355302T>A	ExAC,TOPMed,gnomAD
rs757192084	p.Leu351Met	missense variant	-	NC_000017.11:g.40355301C>A	ExAC,gnomAD
NCI-TCGA novel	p.Pro354Gln	missense variant	-	NC_000017.11:g.40355311C>A	NCI-TCGA
rs755139197	p.Pro354Ser	missense variant	-	NC_000017.11:g.40355310C>T	ExAC,gnomAD
rs866375031	p.Ala358Glu	missense variant	-	NC_000017.11:g.40355323C>A	TOPMed,gnomAD
rs866375031	p.Ala358Val	missense variant	-	NC_000017.11:g.40355323C>T	TOPMed,gnomAD
rs1290171091	p.Val363Leu	missense variant	-	NC_000017.11:g.40355337G>C	TOPMed
rs758706699	p.Arg364Trp	missense variant	-	NC_000017.11:g.40355340C>T	ExAC,gnomAD
rs1353021557	p.Arg364Gln	missense variant	-	NC_000017.11:g.40355341G>A	gnomAD
rs777998360	p.Arg366Gln	missense variant	-	NC_000017.11:g.40355347G>A	ExAC,gnomAD
rs1213422214	p.Arg367Thr	missense variant	-	NC_000017.11:g.40355350G>C	TOPMed
rs771371291	p.Ser369Asn	missense variant	-	NC_000017.11:g.40355356G>A	ExAC,TOPMed,gnomAD
rs1379648717	p.Ser369Gly	missense variant	-	NC_000017.11:g.40355355A>G	gnomAD
rs771371291	p.Ser369Ile	missense variant	-	NC_000017.11:g.40355356G>T	ExAC,TOPMed,gnomAD
rs899025600	p.Arg370His	missense variant	-	NC_000017.11:g.40355359G>A	TOPMed,gnomAD
rs976585948	p.Arg370Cys	missense variant	-	NC_000017.11:g.40355358C>T	TOPMed,gnomAD
rs1256836398	p.Pro371Leu	missense variant	-	NC_000017.11:g.40355362C>T	gnomAD
rs777149587	p.Pro371Ser	missense variant	-	NC_000017.11:g.40355361C>T	ExAC,gnomAD
rs745346700	p.His372Asn	missense variant	-	NC_000017.11:g.40355364C>A	ExAC,gnomAD
rs954829630	p.Met373Val	missense variant	-	NC_000017.11:g.40355367A>G	TOPMed,gnomAD
rs1434768657	p.Met377Leu	missense variant	-	NC_000017.11:g.40355379A>T	TOPMed
rs1186254491	p.Met379Leu	missense variant	-	NC_000017.11:g.40355385A>T	gnomAD
COSM76167	p.Lys380Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40355390G>C	NCI-TCGA Cosmic
rs769158319	p.Ile381Val	missense variant	-	NC_000017.11:g.40355391A>G	ExAC,gnomAD
rs1165788898	p.Thr382Ile	missense variant	-	NC_000017.11:g.40355395C>T	TOPMed
rs775118101	p.Arg385Gln	missense variant	-	NC_000017.11:g.40355404G>A	ExAC,gnomAD
rs1417493977	p.Ser386Asn	missense variant	-	NC_000017.11:g.40355407G>A	gnomAD
rs376831612	p.Ile387Val	missense variant	-	NC_000017.11:g.40355409A>G	ESP,ExAC,gnomAD
rs773956341	p.Ala389Thr	missense variant	-	NC_000017.11:g.40355415G>A	ExAC,TOPMed,gnomAD
rs1381078028	p.Gly391Ala	missense variant	-	NC_000017.11:g.40356009G>C	gnomAD
rs1381078028	p.Gly391Glu	missense variant	-	NC_000017.11:g.40356009G>A	gnomAD
NCI-TCGA novel	p.Ala392Ser	missense variant	-	NC_000017.11:g.40356011G>T	NCI-TCGA
rs951728975	p.Ala392Thr	missense variant	-	NC_000017.11:g.40356011G>A	TOPMed
COSM4924070	p.Glu393Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40356014G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg394Trp	missense variant	-	NC_000017.11:g.40356017C>T	NCI-TCGA
rs866777491	p.Arg394Leu	missense variant	-	NC_000017.11:g.40356018G>T	gnomAD
rs866777491	p.Arg394Gln	missense variant	-	NC_000017.11:g.40356018G>A	gnomAD
rs1199779742	p.Thr397Ser	missense variant	-	NC_000017.11:g.40356026A>T	TOPMed
rs898360191	p.Glu401Lys	missense variant	-	NC_000017.11:g.40356038G>A	gnomAD
rs762998209	p.Pro403Leu	missense variant	-	NC_000017.11:g.40356045C>T	TOPMed
rs1377181510	p.Met406Ile	missense variant	-	NC_000017.11:g.40356055G>A	gnomAD
rs1278125009	p.Pro408His	missense variant	-	NC_000017.11:g.40356060C>A	gnomAD
RCV000171543	p.Leu409del	stop lost	-	NC_000017.11:g.40356063_40356227del	ClinVar
rs1467197849	p.Met413Ile	missense variant	-	NC_000017.11:g.40356076G>A	gnomAD
rs1239076616	p.Asn416Ser	missense variant	-	NC_000017.11:g.40356084A>G	gnomAD
COSM417550	p.Glu418Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000017.11:g.40356089G>A	NCI-TCGA Cosmic
rs1230989677	p.Asp421Glu	missense variant	-	NC_000017.11:g.40356100C>A	gnomAD
rs1414395843	p.Thr422Ser	missense variant	-	NC_000017.11:g.40356102C>G	TOPMed
rs1400353822	p.Thr422Ala	missense variant	-	NC_000017.11:g.40356101A>G	TOPMed
rs768180703	p.Leu423Pro	missense variant	-	NC_000017.11:g.40356105T>C	ExAC,gnomAD
rs778615243	p.Ser424Thr	missense variant	-	NC_000017.11:g.40356108G>C	ExAC,gnomAD
rs747786910	p.Ser424Arg	missense variant	-	NC_000017.11:g.40356109C>G	ExAC,TOPMed,gnomAD
rs1400641137	p.Gly425Arg	missense variant	-	NC_000017.11:g.40356110G>A	TOPMed,gnomAD
rs1326400235	p.Gln426Pro	missense variant	-	NC_000017.11:g.40356114A>C	gnomAD
rs771916537	p.Gln426Lys	missense variant	-	NC_000017.11:g.40356113C>A	ExAC,gnomAD
rs1176965878	p.Pro427Leu	missense variant	-	NC_000017.11:g.40356117C>T	TOPMed
rs1379873029	p.Pro427Ala	missense variant	-	NC_000017.11:g.40356116C>G	TOPMed
rs1293284406	p.Gly428Val	missense variant	-	NC_000017.11:g.40356120G>T	gnomAD
rs1449127199	p.Gly428Trp	missense variant	-	NC_000017.11:g.40356119G>T	gnomAD
rs1449127199	p.Gly428Arg	missense variant	-	NC_000017.11:g.40356119G>A	gnomAD
rs1293284406	p.Gly428Ala	missense variant	-	NC_000017.11:g.40356120G>C	gnomAD
rs539116380	p.Gly429Cys	missense variant	-	NC_000017.11:g.40356122G>T	1000Genomes,ExAC,gnomAD
COSM4614165	p.Gly429ValPheSerTerUnkUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000017.11:g.40356118G>-	NCI-TCGA Cosmic
rs776663600	p.Gly429Val	missense variant	-	NC_000017.11:g.40356123G>T	ExAC,gnomAD
rs776663600	p.Gly429Asp	missense variant	-	NC_000017.11:g.40356123G>A	ExAC,gnomAD
rs1194321465	p.Gly430Ala	missense variant	-	NC_000017.11:g.40356126G>C	gnomAD
rs759435121	p.Gly430Arg	missense variant	-	NC_000017.11:g.40356125G>A	ExAC,TOPMed,gnomAD
rs759435121	p.Gly430Trp	missense variant	-	NC_000017.11:g.40356125G>T	ExAC,TOPMed,gnomAD
rs759435121	p.Gly430Arg	missense variant	-	NC_000017.11:g.40356125G>C	ExAC,TOPMed,gnomAD
rs774473938	p.Arg432Leu	missense variant	-	NC_000017.11:g.40356132G>T	ExAC,TOPMed,gnomAD
rs774473938	p.Arg432Gln	missense variant	-	NC_000017.11:g.40356132G>A	ExAC,TOPMed,gnomAD
rs1188389540	p.Arg432Trp	missense variant	-	NC_000017.11:g.40356131C>T	TOPMed,gnomAD
rs1188389540	p.Arg432Gly	missense variant	-	NC_000017.11:g.40356131C>G	TOPMed,gnomAD
rs762021232	p.Asp433Glu	missense variant	-	NC_000017.11:g.40356136C>A	ExAC,TOPMed,gnomAD
rs762021232	p.Asp433Glu	missense variant	-	NC_000017.11:g.40356136C>G	ExAC,TOPMed,gnomAD
rs553921530	p.Gly434Glu	missense variant	-	NC_000017.11:g.40356138G>A	1000Genomes,ExAC,gnomAD
rs1055195329	p.Gly434Arg	missense variant	-	NC_000017.11:g.40356137G>A	TOPMed,gnomAD
rs1055195329	p.Gly434Arg	missense variant	-	NC_000017.11:g.40356137G>C	TOPMed,gnomAD
rs553921530	p.Gly434Val	missense variant	-	NC_000017.11:g.40356138G>T	1000Genomes,ExAC,gnomAD
rs1403898124	p.Gly435Asp	missense variant	-	NC_000017.11:g.40356141G>A	gnomAD
rs572392003	p.Gly436Ser	missense variant	-	NC_000017.11:g.40356143G>A	1000Genomes,ExAC,gnomAD
rs1402428481	p.Leu437Pro	missense variant	-	NC_000017.11:g.40356147T>C	gnomAD
rs950687847	p.Ala438Val	missense variant	-	NC_000017.11:g.40356150C>T	TOPMed,gnomAD
rs950687847	p.Ala438Gly	missense variant	-	NC_000017.11:g.40356150C>G	TOPMed,gnomAD
rs1441911200	p.Ala438Pro	missense variant	-	NC_000017.11:g.40356149G>C	TOPMed,gnomAD
rs1014673601	p.Pro439Ala	missense variant	-	NC_000017.11:g.40356152C>G	TOPMed
rs1258058775	p.Pro440Ser	missense variant	-	NC_000017.11:g.40356155C>T	gnomAD
rs747666789	p.Pro440Leu	missense variant	-	NC_000017.11:g.40356156C>T	ExAC,TOPMed,gnomAD
rs747666789	p.Pro440Arg	missense variant	-	NC_000017.11:g.40356156C>G	ExAC,TOPMed,gnomAD
rs1279305609	p.Pro441Ser	missense variant	-	NC_000017.11:g.40356158C>T	gnomAD
rs1484545278	p.Ser443Arg	missense variant	-	NC_000017.11:g.40356166C>A	gnomAD
rs1218734380	p.Cys444Tyr	missense variant	-	NC_000017.11:g.40356168G>A	gnomAD
rs1408995903	p.Ser445Arg	missense variant	-	NC_000017.11:g.40356170A>C	TOPMed
rs746742357	p.Pro446Ser	missense variant	-	NC_000017.11:g.40356173C>T	ExAC,TOPMed,gnomAD
rs1190379367	p.Ser449Asn	missense variant	-	NC_000017.11:g.40356183G>A	gnomAD
rs957564687	p.Pro450Leu	missense variant	-	NC_000017.11:g.40356186C>T	gnomAD
rs1172581482	p.Ser451Asn	missense variant	-	NC_000017.11:g.40356189G>A	TOPMed,gnomAD
rs1172581482	p.Ser451Thr	missense variant	-	NC_000017.11:g.40356189G>C	TOPMed,gnomAD
rs536574354	p.Pro457Leu	missense variant	-	NC_000017.11:g.40356207C>T	1000Genomes,TOPMed,gnomAD
rs1421848816	p.Pro457Ser	missense variant	-	NC_000017.11:g.40356206C>T	gnomAD
rs1421848816	p.Pro457Ala	missense variant	-	NC_000017.11:g.40356206C>G	gnomAD
rs770732457	p.Pro462Leu	missense variant	-	NC_000017.11:g.40356222C>T	ExAC,TOPMed,gnomAD
rs1233885208	p.Ter463Gly	stop lost	-	NC_000017.11:g.40356224T>G	gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001418	Adenocarcinoma	group	BEFREE
C0002726	Amyloidosis	disease	BEFREE
C0002736	Amyotrophic Lateral Sclerosis	disease	RGD
C0002893	Refractory anemias	disease	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0004096	Asthma	disease	BEFREE
C0005779	Blood Coagulation Disorders	group	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE;CTD_human
C0006826	Malignant Neoplasms	group	BEFREE
C0007115	Malignant neoplasm of thyroid	disease	BEFREE
C0007131	Non-Small Cell Lung Carcinoma	disease	BEFREE
C0007137	Squamous cell carcinoma	disease	BEFREE;LHGDN
C0007847	Malignant tumor of cervix	disease	BEFREE
C0008073	Developmental Disabilities	group	BEFREE
C0008370	Cholestasis	disease	BEFREE
C0008626	Congenital chromosomal disease	group	BEFREE
C0009319	Colitis	disease	BEFREE
C0009402	Colorectal Carcinoma	disease	BEFREE
C0010674	Cystic Fibrosis	disease	BEFREE
C0010701	Phyllodes Tumor	disease	BEFREE;CTD_human
C0011570	Mental Depression	disease	BEFREE
C0011581	Depressive disorder	disease	BEFREE
C0014859	Esophageal Neoplasms	group	BEFREE
C0015695	Fatty Liver	disease	BEFREE
C0016033	Nonproliferative fibrocystic disease	disease	BEFREE
C0016034	Breast Fibrocystic Disease	disease	BEFREE
C0017658	Glomerulonephritis	disease	BEFREE
C0017668	Focal glomerulosclerosis	disease	BEFREE
C0019196	Hepatitis C	disease	BEFREE
C0021051	Immunologic Deficiency Syndromes	group	BEFREE
C0022584	Keratoderma, Palmoplantar, Diffuse	disease	BEFREE
C0022596	Palmoplantar Keratosis	disease	BEFREE
C0023418	leukemia	disease	BEFREE;LHGDN
C0023440	Acute Erythroblastic Leukemia	disease	BEFREE
C0023448	Lymphoid leukemia	disease	BEFREE
C0023449	Acute lymphocytic leukemia	disease	BEFREE
C0023452	Childhood Acute Lymphoblastic Leukemia	disease	BEFREE
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE;LHGDN
C0023470	Myeloid Leukemia	disease	BEFREE
C0023473	Myeloid Leukemia, Chronic	disease	BEFREE
C0023487	Acute Promyelocytic Leukemia	disease	BEFREE;CTD_human;HPO;LHGDN;ORPHANET
C0023524	Leukoencephalopathy, Progressive Multifocal	disease	BEFREE
C0024299	Lymphoma	group	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025007	Measles	disease	BEFREE
C0025202	melanoma	disease	BEFREE
C0026764	Multiple Myeloma	disease	BEFREE
C0026769	Multiple Sclerosis	disease	BEFREE
C0027022	Myeloproliferative disease	group	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027708	Nephroblastoma	disease	BEFREE
C0027721	Lipoid nephrosis	disease	BEFREE
C0027819	Neuroblastoma	group	BEFREE
C0029463	Osteosarcoma	disease	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0030193	Pain	phenotype	BEFREE
C0032927	Precancerous Conditions	group	BEFREE
C0033578	Prostatic Neoplasms	group	LHGDN
C0035335	Retinoblastoma	disease	BEFREE
C0035412	Rhabdomyosarcoma	disease	BEFREE
C0036323	Schistosomiasis	disease	BEFREE
C0036341	Schizophrenia	disease	BEFREE;PSYGENET
C0037286	Skin Neoplasms	group	BEFREE
C0040034	Thrombocytopenia	phenotype	BEFREE
C0078911	AIDS-Associated Nephropathy	disease	BEFREE
C0079588	Ichthyosis, X-Linked	disease	BEFREE
C0079731	B-Cell Lymphomas	group	BEFREE
C0079772	T-Cell Lymphoma	disease	BEFREE
C0079773	Lymphoma, T-Cell, Cutaneous	disease	BEFREE
C0085183	Neoplasms, Second Primary	group	CTD_human
C0085669	Acute leukemia	disease	BEFREE
C0086696	Neoplasms, Therapy-Associated	group	CTD_human
C0149940	Sciatic Neuropathy	disease	CTD_human
C0152018	Esophageal carcinoma	disease	BEFREE
C0153676	Secondary malignant neoplasm of lung	disease	BEFREE
C0154748	Lesion of Sciatic Nerve	group	CTD_human
C0178874	Tumor Progression	phenotype	BEFREE
C0206650	Fibroadenoma	disease	BEFREE;CTD_human
C0206664	Teratocarcinoma	disease	BEFREE
C0206682	Follicular thyroid carcinoma	disease	BEFREE
C0238198	Gastrointestinal Stromal Tumors	group	BEFREE
C0239946	Fibrosis, Liver	disease	BEFREE
C0242013	Sciatic Neuritis	disease	CTD_human
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0242596	Neoplasm, Residual	phenotype	BEFREE
C0270814	Spastic syndrome	disease	BEFREE
C0275524	Coinfection	phenotype	BEFREE
C0279000	Liver and Intrahepatic Biliary Tract Carcinoma	disease	BEFREE
C0279628	Adenocarcinoma Of Esophagus	disease	BEFREE
C0302592	Cervix carcinoma	disease	BEFREE
C0345904	Malignant neoplasm of liver	disease	BEFREE
C0346629	Malignant neoplasm of large intestine	disease	BEFREE
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0432412	Chromosome 8, trisomy	disease	BEFREE
C0525045	Mood Disorders	group	BEFREE;PSYGENET
C0546837	Malignant neoplasm of esophagus	disease	BEFREE
C0549473	Thyroid carcinoma	disease	BEFREE
C0585442	Osteosarcoma of bone	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0598766	Leukemogenesis	disease	BEFREE
C0600066	Malignant Cystosarcoma Phyllodes	disease	CTD_human
C0600139	Prostate carcinoma	disease	BEFREE
C0677936	Refractory cancer	phenotype	BEFREE
C0677944	Sentinel node (disorder)	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE;CTD_human
C0684249	Carcinoma of lung	disease	BEFREE
C0686619	Secondary malignant neoplasm of lymph node	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0700095	Central neuroblastoma	disease	BEFREE
C0740457	Malignant neoplasm of kidney	disease	BEFREE
C0751924	Neuralgia-Neuritis, Sciatic Nerve	disease	CTD_human
C0751925	Sciatic Nerve Palsy	disease	CTD_human
C0795864	Smith-Magenis syndrome	disease	BEFREE
C0877578	Treatment related secondary malignancy	phenotype	CTD_human
C0919267	ovarian neoplasm	disease	BEFREE
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1153706	Endometrial adenocarcinoma	disease	BEFREE
C1257931	Mammary Neoplasms, Human	group	CTD_human
C1261473	Sarcoma	group	BEFREE
C1292769	Precursor B-cell lymphoblastic leukemia	disease	BEFREE
C1292778	Chronic myeloproliferative disorder	disease	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1332977	Childhood Leukemia	disease	BEFREE
C1335302	Pancreatic Ductal Adenocarcinoma	disease	BEFREE
C1378703	Renal carcinoma	disease	BEFREE
C1458155	Mammary Neoplasms	group	BEFREE;CTD_human;LHGDN
C1512409	Hepatocarcinogenesis	disease	BEFREE
C1512981	Mammary Tumorigenesis	phenotype	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1837218	Cleft palate, isolated	disease	BEFREE
C1859592	ATRICHIA WITH PAPULAR LESIONS	disease	BEFREE
C1879321	Acute Myeloid Leukemia (AML-M2)	disease	BEFREE
C1961102	Precursor Cell Lymphoblastic Leukemia Lymphoma	disease	BEFREE
C2239176	Liver carcinoma	disease	BEFREE;CTD_human
C2711227	Steatohepatitis	disease	BEFREE
C2717836	Steroid Sulfatase Deficiency Disease	disease	BEFREE
C2745900	Promyelocytic leukemia	disease	BEFREE
C2854122	Acute myeloblastic leukemia with t(8;21)	disease	BEFREE
C3463824	MYELODYSPLASTIC SYNDROME	group	BEFREE
C3805089	Hyperfibrinolysis	disease	BEFREE
C3888194	MIXED LINEAGE LEUKEMIA	disease	BEFREE
C4023031	Abnormality of cells of the granulocytic lineage	phenotype	HPO
C4048328	cervical cancer	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000900	translation repressor activity, mRNA regulatory element binding	IEA
GO:0000976	transcription regulatory region sequence-specific DNA binding	IBA
GO:0000977	RNA polymerase II regulatory region sequence-specific DNA binding	IDA
GO:0000977	RNA polymerase II regulatory region sequence-specific DNA binding	IBA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	IBA
GO:0001972	retinoic acid binding	IDA
GO:0003700	DNA-binding transcription factor activity	IDA
GO:0003707	steroid hormone receptor activity	IEA
GO:0003713	transcription coactivator activity	IMP
GO:0003713	transcription coactivator activity	IDA
GO:0003714	transcription corepressor activity	IDA
GO:0004879	nuclear receptor activity	IDA
GO:0005102	signaling receptor binding	IDA
GO:0005515	protein binding	IPI
GO:0008134	transcription factor binding	IPI
GO:0008134	transcription factor binding	IBA
GO:0008144	drug binding	IEA
GO:0008270	zinc ion binding	IEA
GO:0019899	enzyme binding	IPI
GO:0019904	protein domain specific binding	IPI
GO:0030374	nuclear receptor transcription coactivator activity	IBA
GO:0031490	chromatin DNA binding	IDA
GO:0038023	signaling receptor activity	IBA
GO:0038023	signaling receptor activity	IDA
GO:0042826	histone deacetylase binding	IEA
GO:0043422	protein kinase B binding	IPI
GO:0044323	retinoic acid-responsive element binding	IDA
GO:0048027	mRNA 5'-UTR binding	IEA
GO:0051018	protein kinase A binding	IDA
GO:0051393	alpha-actinin binding	IPI
GO:0098531	ligand-activated transcription factor activity	IBA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0000122	negative regulation of transcription by RNA polymerase II	IBA
GO:0001657	ureteric bud development	IEA
GO:0001843	neural tube closure	IEA
GO:0001889	liver development	IBA
GO:0002068	glandular epithelial cell development	IEA
GO:0003148	outflow tract septum morphogenesis	IEA
GO:0003417	growth plate cartilage development	IEA
GO:0006367	transcription initiation from RNA polymerase II promoter	TAS
GO:0006468	protein phosphorylation	IMP
GO:0007165	signal transduction	IDA
GO:0007275	multicellular organism development	IBA
GO:0007281	germ cell development	IEA
GO:0007283	spermatogenesis	IEA
GO:0007565	female pregnancy	IEA
GO:0008284	positive regulation of cell population proliferation	IMP
GO:0008285	negative regulation of cell population proliferation	IEA
GO:0009755	hormone-mediated signaling pathway	IBA
GO:0017148	negative regulation of translation	IEA
GO:0021766	hippocampus development	IEA
GO:0030154	cell differentiation	IBA
GO:0030850	prostate gland development	IEA
GO:0030853	negative regulation of granulocyte differentiation	IDA
GO:0031076	embryonic camera-type eye development	IEA
GO:0031641	regulation of myelination	IEA
GO:0032355	response to estradiol	IEA
GO:0032526	response to retinoic acid	IMP
GO:0032526	response to retinoic acid	IBA
GO:0032689	negative regulation of interferon-gamma production	IDA
GO:0032720	negative regulation of tumor necrosis factor production	IDA
GO:0032736	positive regulation of interleukin-13 production	IDA
GO:0032753	positive regulation of interleukin-4 production	IDA
GO:0032754	positive regulation of interleukin-5 production	IDA
GO:0033189	response to vitamin A	IEA
GO:0033993	response to lipid	IBA
GO:0034097	response to cytokine	IEA
GO:0035264	multicellular organism growth	IEA
GO:0043066	negative regulation of apoptotic process	IEA
GO:0043277	apoptotic cell clearance	IMP
GO:0043401	steroid hormone mediated signaling pathway	IEA
GO:0045471	response to ethanol	IEA
GO:0045630	positive regulation of T-helper 2 cell differentiation	IDA
GO:0045666	positive regulation of neuron differentiation	IEA
GO:0045787	positive regulation of cell cycle	IMP
GO:0045892	negative regulation of transcription, DNA-templated	IDA
GO:0045893	positive regulation of transcription, DNA-templated	IDA
GO:0045893	positive regulation of transcription, DNA-templated	IMP
GO:0045944	positive regulation of transcription by RNA polymerase II	IDA
GO:0045944	positive regulation of transcription by RNA polymerase II	IMP
GO:0045944	positive regulation of transcription by RNA polymerase II	IBA
GO:0048167	regulation of synaptic plasticity	IEA
GO:0048384	retinoic acid receptor signaling pathway	IMP
GO:0048384	retinoic acid receptor signaling pathway	IBA
GO:0048568	embryonic organ development	IBA
GO:0048732	gland development	IBA
GO:0051099	positive regulation of binding	IMP
GO:0055012	ventricular cardiac muscle cell differentiation	IEA
GO:0060010	Sertoli cell fate commitment	IEA
GO:0060173	limb development	IEA
GO:0060324	face development	IEA
GO:0060349	bone morphogenesis	IBA
GO:0060429	epithelium development	IBA
GO:0060534	trachea cartilage development	IEA
GO:0060591	chondroblast differentiation	IEA
GO:0061037	negative regulation of cartilage development	IEA
GO:0071222	cellular response to lipopolysaccharide	IEA
GO:0071300	cellular response to retinoic acid	IDA
GO:0071300	cellular response to retinoic acid	IBA
GO:0071391	cellular response to estrogen stimulus	IDA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000790	nuclear chromatin	ISA
GO:0000790	nuclear chromatin	IDA
GO:0005634	nucleus	IDA
GO:0005634	nucleus	IBA
GO:0005654	nucleoplasm	IDA
GO:0005654	nucleoplasm	TAS
GO:0005737	cytoplasm	IDA
GO:0005829	cytosol	IDA
GO:0009986	cell surface	IC
GO:0015629	actin cytoskeleton	IDA
GO:0030425	dendrite	IEA
GO:0048471	perinuclear region of cytoplasm	IEA
GO:0090575	RNA polymerase II transcription factor complex	IBA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1266738	Developmental Biology	IEA
R-HSA-1266738	Developmental Biology	TAS
R-HSA-162582	Signal Transduction	TAS
R-HSA-212436	Generic Transcription Pathway	TAS
R-HSA-2990846	SUMOylation	TAS
R-HSA-3108232	SUMO E3 ligases SUMOylate target proteins	TAS
R-HSA-383280	Nuclear Receptor transcription pathway	TAS
R-HSA-392499	Metabolism of proteins	TAS
R-HSA-4090294	SUMOylation of intracellular receptors	TAS
R-HSA-5362517	Signaling by Retinoic Acid	TAS
R-HSA-5617472	Activation of anterior HOX genes in hindbrain development during early embryogenesis	IEA
R-HSA-5619507	Activation of HOX genes during differentiation	IEA
R-HSA-597592	Post-translational protein modification	TAS
R-HSA-73857	RNA Polymerase II Transcription	TAS
R-HSA-74160	Gene expression (Transcription)	TAS
R-HSA-9006931	Signaling by Nuclear Receptors	TAS
R-HSA-9616222	Transcriptional regulation of granulopoiesis	IEA
R-HSA-9616222	Transcriptional regulation of granulopoiesis	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
C016780	11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid	[Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of RARA gene	30521419
C028474	1,4-bis(2-(3,5-dichloropyridyloxy))benzene	1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of RARA mRNA	28903501
D019307	1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine	1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine inhibits the reaction [TGFB1 protein results in increased expression of RARA mRNA]	8940178
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RARA mRNA	28628672
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RARA mRNA	28628672
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of RARA mRNA	24810058
C111118	2',3,3',4',5-pentachloro-4-hydroxybiphenyl	2',3,3',4',5-pentachloro-4-hydroxybiphenyl results in decreased expression of RARA mRNA	19114083
C009407	2,5,2',5'-tetrachlorobiphenyl	2,5,2',5'-tetrachlorobiphenyl results in decreased expression of RARA mRNA	23829299
C022776	2-bromopalmitate	2-bromopalmitate binds to and results in increased expression of RARA protein	30076181
C022776	2-bromopalmitate	2-bromopalmitate inhibits the reaction [Am 580 results in decreased expression of RARA protein]	30076181
C022776	2-bromopalmitate	2-bromopalmitate inhibits the reaction [Tretinoin results in decreased expression of RARA protein]	30076181
C022776	2-bromopalmitate	[2-bromopalmitate results in increased susceptibility to Tretinoin] which results in increased expression of RARA protein	30076181
C025946	3-methyladenine	3-methyladenine inhibits the reaction [4-amino-2-trifluoromethyl-phenyl retinate results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	28130038
C496751	4-(1H-imidazol-1-yl)retinoic acid	4-(1H-imidazol-1-yl)retinoic acid binds to RARA protein	17387344
C038864	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid binds to and results in increased activity of RARA protein	15589975; 16178010;
C121616	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid binds to and results in decreased activity of RARA protein	16178010
C009505	4,4'-diaminodiphenylmethane	4,4'-diaminodiphenylmethane results in decreased expression of RARA mRNA	18648102
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Arsenic Trioxide results in increased degradation of RARA protein]	17018029
C064545	4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid	4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid binds to RARA protein	15589975
C585745	4-amino-2-trifluoromethyl-phenyl retinate	3-methyladenine inhibits the reaction [4-amino-2-trifluoromethyl-phenyl retinate results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	28130038
C585745	4-amino-2-trifluoromethyl-phenyl retinate	4-amino-2-trifluoromethyl-phenyl retinate results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]	28130038
C585745	4-amino-2-trifluoromethyl-phenyl retinate	ATG5 protein promotes the reaction [4-amino-2-trifluoromethyl-phenyl retinate results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	28130038
C585745	4-amino-2-trifluoromethyl-phenyl retinate	N-(N-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester inhibits the reaction [4-amino-2-trifluoromethyl-phenyl retinate results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	28130038
D015761	4-Aminopyridine	[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D015761	4-Aminopyridine	Dizocilpine Maleate inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D015761	4-Aminopyridine	KN 62 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D015761	4-Aminopyridine	STO 609 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in decreased expression of RARA mRNA	19191707
C019429	4-hydroxyretinoic acid	4-hydroxyretinoic acid results in increased activity of RARA protein	25492813
C002202	4-oxoretinoic acid	4-oxoretinoic acid results in increased activity of RARA protein	25492813
C002202	4-oxoretinoic acid	4-oxoretinoic acid results in increased expression of RARA mRNA	17034753
C041819	4-oxoretinol	4-oxoretinol results in increased expression of RARA mRNA	17034753
C496492	abrine	abrine results in increased expression of RARA mRNA	31054353
D000068816	Adapalene	Adapalene binds to RARA protein	21864882
C106812	adefovir dipivoxil	adefovir dipivoxil results in decreased expression of RARA mRNA	25596134
C016601	afimoxifene	afimoxifene inhibits the reaction [Estrogens results in increased expression of RARA mRNA]	21233418
D016604	Aflatoxin B1	Aflatoxin B1 results in increased methylation of RARA intron	30157460
C096920	AGN 193109	AGN 193109 binds to and results in decreased activity of RARA protein	15589975
C096920	AGN 193109	AGN 193109 binds to and results in decreased activity of RARA protein	16982809
C492393	AGN 195183	AGN 195183 binds to and results in increased activity of RARA protein	16178010
C492393	AGN 195183	AGN 195183 binds to and results in increased activity of RARA protein	17318068
D019386	Alendronate	Alendronate affects the expression of RARA mRNA	16079270
D000077556	Alitretinoin	Alitretinoin binds to and results in increased activity of RARA protein	18180267
D000077556	Alitretinoin	Alitretinoin promotes the reaction [RARA protein binds to PRAME protein]	16179254
D000077556	Alitretinoin	Alitretinoin results in decreased expression of RARA protein	15375546
D000077556	Alitretinoin	Alitretinoin results in increased expression of RARA mRNA	11139446; 17034753;
D000077556	Alitretinoin	RARA protein promotes the reaction [Alitretinoin results in increased expression of ABCC6 mRNA]	17045963
D000077556	Alitretinoin	Alitretinoin results in increased expression of RARA mRNA	8892963
D000077556	Alitretinoin	Alitretinoin results in increased expression of RARA protein	16043492
D000077556	Alitretinoin	[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D000077556	Alitretinoin	CAMK4 protein promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D000077556	Alitretinoin	Dizocilpine Maleate inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D000077556	Alitretinoin	KN 62 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D000077556	Alitretinoin	Okadaic Acid promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D000077556	Alitretinoin	STO 609 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D000077556	Alitretinoin	trichostatin A promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D000487	Allethrins	Allethrins results in increased activity of RARA protein	20143881
C068073	Am 580	2-bromopalmitate inhibits the reaction [Am 580 results in decreased expression of RARA protein]	30076181
C068073	Am 580	Am 580 binds to and results in increased activity of RARA protein	10779427; 16178010;
C068073	Am 580	Am 580 inhibits the reaction [Ro 41-5253 results in decreased activity of RARA protein]	17290005
C068073	Am 580	Am 580 results in decreased expression of RARA protein	30076181
C068073	Am 580	Am 580 results in increased expression of RARA protein	16636311
C068073	Am 580	Am 580 binds to and affects the activity of RARA protein	16982809
C068073	Am 580	Am 580 binds to and results in increased activity of RARA protein	10651997; 15855632; 17392484;
C068073	Am 580	Am 580 results in increased activity of RARA protein	17460283
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of RARA mRNA	16483693
D000661	Amphetamine	Amphetamine results in increased expression of RARA mRNA	30779732
D000726	Androgen Antagonists	[Pesticides co-treated with Phthalic Acids co-treated with Androgen Antagonists] results in increased expression of RARA mRNA	29945228
D000966	Antimony Potassium Tartrate	Antimony Potassium Tartrate results in increased degradation of RARA protein mutant form	9834237
C037554	antimony trioxide	antimony trioxide results in increased degradation of RARA protein mutant form	9834237
D018501	Antirheumatic Agents	Antirheumatic Agents results in decreased expression of RARA mRNA	24449571
C004984	apocarotenal	apocarotenal results in decreased expression of RARA mRNA	17034753
D000077237	Arsenic Trioxide	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Arsenic Trioxide results in increased degradation of RARA protein]	17018029
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [puerarin results in decreased expression of RARA mRNA alternative form]	20416161
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [tetraarsenic tetrasulfide results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	26110921
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of RARA mRNA mutant form	27770503
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of RARA protein	23469683
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of RARA protein mutant form	27189198
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]	26110921
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased degradation of RARA protein	17018029
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased degradation of RARA protein mutant form	15748426; 16891316; 17217047; 9834237;
D000077237	Arsenic Trioxide	cobaltous chloride promotes the reaction [Arsenic Trioxide results in increased degradation of RARA protein mutant form]	16330433
D000077237	Arsenic Trioxide	RARA gene mutant form inhibits the reaction [Tretinoin inhibits the reaction [Arsenic Trioxide results in increased expression of HMOX1 protein]]	25003661
D000077237	Arsenic Trioxide	RARA gene mutant form inhibits the reaction [Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	25003661
D000077237	Arsenic Trioxide	RARA gene mutant form results in decreased susceptibility to Arsenic Trioxide	26728337
D000077237	Arsenic Trioxide	tetraarsenic tetrasulfide promotes the reaction [Arsenic Trioxide results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	26110921
D000077237	Arsenic Trioxide	[Tretinoin co-treated with Arsenic Trioxide] results in decreased expression of RARA mRNA alternative form	19225113
D000077237	Arsenic Trioxide	[Vorinostat co-treated with Arsenic Trioxide] results in decreased expression of RARA protein mutant form	27189198
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased degradation of and results in decreased expression of RARA protein	15688020
C045816	arsenic trisulfide	arsenic trisulfide results in increased degradation of and results in decreased expression of RARA protein	12513809
C045816	arsenic trisulfide	arsenic trisulfide results in increased degradation of and results in decreased expression of RARA protein mutant form	12513809
C015001	arsenite	arsenite results in increased methylation of RARA promoter	23974009
C030935	benz(a)anthracene	benz(a)anthracene results in increased expression of RARA mRNA	26377693
D001564	Benzo(a)pyrene	Benzo(a)pyrene affects the activity of RARA protein	20624995
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of RARA mRNA	21803694
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Tretinoin results in decreased expression of RARA protein]	24819975
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Tretinoin results in increased degradation of RARA protein]	20945414
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased ubiquitination of RARA protein	20945414
D019207	beta Carotene	beta Carotene results in decreased expression of RARA mRNA	17034753
D000077610	Bexarotene	Bexarotene binds to RARA protein	9144408
D001640	Bicuculline	[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D001640	Bicuculline	Dizocilpine Maleate inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D001640	Bicuculline	KN 62 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D001640	Bicuculline	STO 609 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
C006780	bisphenol A	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RARA mRNA	28628672
C006780	bisphenol A	bisphenol A affects the methylation of RARA promoter	27334623
C006780	bisphenol A	bisphenol A results in decreased expression of RARA mRNA	14967906
C006780	bisphenol A	bisphenol A results in increased expression of RARA mRNA	14967906; 15738621;
C006780	bisphenol A	bisphenol A results in increased expression of RARA mRNA	25181051
C000611646	bisphenol F	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RARA mRNA	28628672
C083997	buprofezin	buprofezin results in increased activity of RARA protein	20143881
D002087	Butyrates	[Tretinoin co-treated with Butyrates] results in increased cleavage of RARA protein mutant form	12130515
D002104	Cadmium	Cadmium results in decreased expression of RARA mRNA	21297354
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester promotes the reaction [Tretinoin results in increased activity of RARA protein]	16766008
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester results in increased activity of RARA protein	16766008
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester results in increased expression of RARA mRNA	16766008
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester results in increased expression of RARA protein	16766008
C055494	caffeic acid phenethyl ester	[Tretinoin co-treated with caffeic acid phenethyl ester] results in increased expression of RARA mRNA	16766008
C055494	caffeic acid phenethyl ester	[Tretinoin co-treated with caffeic acid phenethyl ester] results in increased expression of RARA protein	16766008
D002166	Camptothecin	Camptothecin results in increased methylation of RARA gene	30720231
D002186	Cannabinoids	[Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of RARA gene	30521419
D002251	Carbon Tetrachloride	[Carbon Tetrachloride co-treated with Diethylnitrosamine] results in decreased expression of RARA mRNA	26778414
C099555	CD 437	[CD 437 results in increased activity of CASP3 protein] which results in increased degradation of RARA protein	10374879
C099555	CD 437	CD 437 results in increased expression of RARA mRNA	21548569
C004656	chloroacetaldehyde	chloroacetaldehyde results in decreased expression of RARA mRNA	25596134
D002726	Chlorogenic Acid	Chlorogenic Acid results in increased expression of RARA mRNA	20706672
D002746	Chlorpromazine	Chlorpromazine results in decreased expression of RARA mRNA	18246545
D002762	Cholecalciferol	RARA protein mutant form inhibits the reaction [[Cholecalciferol co-treated with TGFB1 protein] results in increased expression of CD14 mRNA]	15988048
D002762	Cholecalciferol	Cholecalciferol inhibits the reaction [Methylnitrosourea results in increased expression of RARA mRNA]	21843606
D002791	Cholesterol, Dietary	[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased expression of RARA protein	27394961
D002791	Cholesterol, Dietary	MET gene mutant form inhibits the reaction [[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased expression of RARA protein]	27394961
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of RARA gene	20938992
D000077404	Cidofovir	Cidofovir results in increased expression of RARA mRNA	25596134
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in decreased expression of RARA mRNA	27392435
D002945	Cisplatin	Cisplatin results in decreased expression of RARA mRNA	25596134; 27392435;
D002945	Cisplatin	Cisplatin results in increased expression of RARA mRNA	18172885
D004002	Clodronic Acid	Clodronic Acid results in decreased expression of RARA mRNA	25596134
C018021	cobaltous chloride	cobaltous chloride promotes the reaction [Arsenic Trioxide results in increased degradation of RARA protein mutant form]	16330433
D003372	Coumaphos	Coumaphos results in increased activity of RARA protein	20143881
D003474	Curcumin	Curcumin inhibits the reaction [TGFB1 protein results in increased expression of RARA mRNA]	8940178
D003520	Cyclophosphamide	Cyclophosphamide results in increased expression of RARA mRNA	16141653
D016572	Cyclosporine	Cyclosporine results in decreased expression of RARA mRNA	25596134
D000077209	Decitabine	[Decitabine co-treated with Tretinoin] results in increased expression of RARA mRNA	19524134
D000077209	Decitabine	Decitabine promotes the reaction [Vorinostat results in increased expression of RARA mRNA]	17417771
D003840	Deoxycholic Acid	[gluconic acid co-treated with Deoxycholic Acid] results in increased expression of RARA mRNA	16556975
D003907	Dexamethasone	Dexamethasone results in increased expression of RARA mRNA	19022236
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RARA mRNA	28628672
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RARA mRNA	28628672
D003976	Diazinon	Diazinon affects the expression of RARA mRNA	22546817
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in decreased expression of RARA mRNA	21266533
C000944	dicrotophos	dicrotophos results in increased expression of RARA mRNA	28302478
D004026	Dieldrin	Dieldrin affects the expression of RARA mRNA	22546817
D004052	Diethylnitrosamine	[Carbon Tetrachloride co-treated with Diethylnitrosamine] results in decreased expression of RARA mRNA	26778414
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with kojic acid co-treated with Diethylnitrosamine] results in decreased expression of RARA mRNA	18544905
D004052	Diethylnitrosamine	[Fenofibrate co-treated with Diethylnitrosamine] results in decreased expression of RARA mRNA	18253720
D016291	Dizocilpine Maleate	Dizocilpine Maleate inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D004317	Doxorubicin	Doxorubicin results in decreased expression of RARA mRNA	29803840
D004726	Endosulfan	Endosulfan results in decreased expression of RARA mRNA	29391264
C017435	enilconazole	enilconazole results in increased activity of RARA protein	20143881
C045651	epigallocatechin gallate	epigallocatechin gallate results in increased expression of RARA mRNA	12628509; 20706672;
D015251	Epirubicin	Epirubicin affects the mutagenesis of RARA gene	19884644
D004958	Estradiol	[Estradiol co-treated with Tetrachlorodibenzodioxin] results in decreased expression of RARA mRNA	19619570
D004958	Estradiol	Estradiol results in decreased expression of RARA mRNA	19619570
D004958	Estradiol	Estradiol results in increased expression of RARA mRNA	23019147
D004967	Estrogens	afimoxifene inhibits the reaction [Estrogens results in increased expression of RARA mRNA]	21233418
D004967	Estrogens	Estrogens results in increased expression of RARA mRNA	21233418
D000431	Ethanol	Ethanol results in increased expression of RARA mRNA	28986285
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of RARA mRNA	17555576
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of RARA mRNA	17942748
D004997	Ethinyl Estradiol	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of RARA mRNA	17942748
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of RARA mRNA	16079270
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of RARA mRNA	23550701
D011345	Fenofibrate	Fenofibrate results in decreased expression of RARA mRNA	25596134
D011345	Fenofibrate	[Fenofibrate co-treated with Diethylnitrosamine] results in decreased expression of RARA mRNA	18253720
D017313	Fenretinide	Fenretinide results in decreased expression of RARA protein	15375546
D017313	Fenretinide	Fenretinide results in increased expression of RARA mRNA	15735044
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of RARA gene	20938992
D004397	Fonofos	Fonofos results in increased methylation of RARA promoter	22847954
D005557	Formaldehyde	Formaldehyde results in increased expression of RARA mRNA	23649840
D005620	Freund's Adjuvant	Freund's Adjuvant results in decreased expression of RARA mRNA	20846436
C039281	furan	furan results in increased methylation of RARA gene	22079235
D005839	Gentamicins	Gentamicins results in decreased expression of RARA mRNA	22061828
D005839	Gentamicins	Gentamicins results in increased expression of RARA mRNA	18172885
C030691	gluconic acid	[gluconic acid co-treated with Deoxycholic Acid] results in increased expression of RARA mRNA	16556975
D006118	Griseofulvin	Griseofulvin results in increased expression of RARA mRNA	9548566
D001556	Hexachlorocyclohexane	Hexachlorocyclohexane results in increased activity of RARA protein	20143881
C014026	hexamethylene bisacetamide	[Tretinoin co-treated with hexamethylene bisacetamide] results in increased cleavage of RARA protein mutant form	12130515
C104181	HX 600	HX 600 affects the reaction [Tretinoin binds to and results in increased activity of RARA protein]	9144408
C104181	HX 600	HX 600 promotes the reaction [[Tretinoin binds to and results in increased activity of RARA protein] which results in increased expression of TNFRSF10B mRNA]	9144408
C422175	HX 630	HX 630 binds to RARA protein	9144408
D006918	Hydroxyurea	Hydroxyurea results in increased mutagenesis of RARA gene	16868089
D007052	Ibuprofen	Ibuprofen results in decreased expression of RARA mRNA	25596134
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RARA mRNA	28628672
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RARA mRNA	28628672
D015474	Isotretinoin	Isotretinoin results in increased expression of RARA mRNA	9262057
D015474	Isotretinoin	Isotretinoin results in decreased expression of RARA mRNA	19041696
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in decreased expression of RARA mRNA	27392435
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in decreased expression of RARA mRNA	23086925; 24297863;
C063302	KN 62	KN 62 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
C011890	kojic acid	[Diethylnitrosamine co-treated with kojic acid co-treated with Diethylnitrosamine] results in decreased expression of RARA mRNA	18544905
C008261	lead acetate	lead acetate results in decreased expression of RARA mRNA	22609695
D000077222	Limonene	Limonene results in decreased expression of RARA mRNA	12815608
D008070	Lipopolysaccharides	Lipopolysaccharides promotes the reaction [Tretinoin results in increased expression of RARA mRNA]	17216566
D008070	Lipopolysaccharides	Lipopolysaccharides results in decreased expression of RARA protein	16002565
D008550	Melatonin	[Melatonin co-treated with Tretinoin] results in increased activity of RARA protein	10965999
D008550	Melatonin	Melatonin promotes the reaction [Tretinoin results in increased activity of RARA protein]	15813899
D008628	Mercury	Mercury results in decreased expression of RARA mRNA	22688007
D008694	Methamphetamine	Methamphetamine results in increased expression of RARA mRNA	29802913
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of RARA gene	20938992
D008731	Methoxychlor	Methoxychlor affects the expression of RARA mRNA	20829426
D008770	Methylnitrosourea	Methylnitrosourea results in increased mutagenesis of RARA gene	16868089
D008770	Methylnitrosourea	Cholecalciferol inhibits the reaction [Methylnitrosourea results in increased expression of RARA mRNA]	21843606
D008770	Methylnitrosourea	Methylnitrosourea results in increased expression of RARA mRNA	21843606
D008942	Mitoxantrone	Mitoxantrone affects the mutagenesis of RARA gene	19884644
C119536	nickel acetate	nickel acetate affects the expression of RARA mRNA	12915101
C022838	nickel chloride	nickel chloride affects the expression of RARA mRNA	22546817
C028007	nickel monoxide	nickel monoxide results in increased expression of RARA mRNA	19167457
C007350	nitrofen	nitrofen results in decreased expression of RARA mRNA	20638522
C007350	nitrofen	nitrofen results in decreased expression of RARA protein	24972641; 26672737;
C007350	nitrofen	nitrofen results in increased expression of RARA mRNA	17270546; 26672737;
C007350	nitrofen	nitrofen results in increased expression of RARA protein	24352370
C007350	nitrofen	Tretinoin inhibits the reaction [nitrofen results in decreased expression of RARA protein]	26672737
C007350	nitrofen	Tretinoin inhibits the reaction [nitrofen results in increased expression of RARA protein]	24352370
C007350	nitrofen	Tretinoin promotes the reaction [nitrofen results in increased expression of RARA mRNA]	26672737
C419410	N-(N-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester	N-(N-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester inhibits the reaction [4-amino-2-trifluoromethyl-phenyl retinate results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	28130038
C508934	N-retinoylglucosamine	N-retinoylglucosamine results in increased expression of RARA mRNA	16280019
C025589	ochratoxin A	ochratoxin A results in decreased expression of RARA mRNA	23358140
D019319	Okadaic Acid	Okadaic Acid promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
C485800	osajin	osajin results in increased expression of RARA mRNA	20706672
D010100	Oxygen	Oxygen deficiency results in increased expression of RARA mRNA	25596134
D010278	Parathion	Parathion results in increased methylation of RARA promoter	22847954
D052638	Particulate Matter	Particulate Matter results in decreased methylation of RARA gene	28495853
C568608	PCI 5002	[PCI 5002 co-treated with Zinc] results in increased expression of RARA mRNA	18593933
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in decreased expression of RARA mRNA	19162173
C023036	perfluorooctanoic acid	perfluorooctanoic acid results in decreased expression of RARA mRNA	19162173
D010575	Pesticides	[Pesticides co-treated with Phthalic Acids co-treated with Androgen Antagonists] results in increased expression of RARA mRNA	29945228
D010672	Phenytoin	Phenytoin results in decreased expression of RARA mRNA	9118846
D010672	Phenytoin	Phenytoin results in increased expression of RARA mRNA	9988880
C003117	phosalone	phosalone results in increased activity of RARA protein	20143881
D010795	Phthalic Acids	[Pesticides co-treated with Phthalic Acids co-treated with Androgen Antagonists] results in increased expression of RARA mRNA	29945228
D010795	Phthalic Acids	Phthalic Acids results in increased expression of RARA mRNA	22112501
D010936	Plant Extracts	Plant Extracts results in decreased expression of RARA mRNA	23557933
D011078	Polychlorinated Biphenyls	Polychlorinated Biphenyls results in increased expression of RARA protein	17287035
C474837	pomiferin	pomiferin results in increased expression of RARA mRNA	20706672
C045362	prochloraz	prochloraz results in increased activity of RARA protein	20143881
D011374	Progesterone	Progesterone results in decreased expression of RARA mRNA	23018184
C045950	propiconazole	propiconazole results in increased activity of RARA protein	20143881
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of RARA mRNA	24780913
C033607	puerarin	Arsenic Trioxide promotes the reaction [puerarin results in decreased expression of RARA mRNA alternative form]	20416161
C033607	puerarin	puerarin results in decreased expression of RARA mRNA alternative form	20416161
C033607	puerarin	puerarin results in increased expression of RARA mRNA	20706672
D011692	Puromycin Aminonucleoside	Puromycin Aminonucleoside results in increased expression of RARA mRNA	12660332
D011692	Puromycin Aminonucleoside	Puromycin Aminonucleoside results in increased expression of RARA protein	12660332
C513428	pyrachlostrobin	pyrachlostrobin results in increased activity of RARA protein	20143881
C470613	quinoxyfen	quinoxyfen results in increased activity of RARA protein	20143881
D020849	Raloxifene Hydrochloride	Raloxifene Hydrochloride affects the expression of RARA mRNA	16079270
D000077185	Resveratrol	Resveratrol results in increased expression of RARA mRNA	20706672
D012176	Retinoids	RARA protein promotes the reaction [Retinoids results in increased expression of FOXK2 mRNA]	12075115
D012176	Retinoids	RARA protein promotes the reaction [Retinoids results in increased expression of TGM2 mRNA]	12075115
D012176	Retinoids	Retinoids binds to and results in increased activity of RARA protein	12075115
C014794	retinol palmitate	retinol palmitate promotes the reaction [RARA protein binds to MMP9 protein]	17164434
C084904	Ro 41-5253	Am 580 inhibits the reaction [Ro 41-5253 results in decreased activity of RARA protein]	17290005
C084904	Ro 41-5253	RARA protein results in increased susceptibility to Ro 41-5253	25550158
C084904	Ro 41-5253	Ro 41-5253 binds to and results in decreased activity of RARA protein	10779427; 7556191;
C084904	Ro 41-5253	Ro 41-5253 inhibits the reaction [[RARA protein co-treated with RXRA protein] results in increased expression of SLC10A1 mRNA]	25550158
C084904	Ro 41-5253	Ro 41-5253 inhibits the reaction [Tretinoin results in increased expression of RARA mRNA]	17216566
C084904	Ro 41-5253	Ro 41-5253 results in decreased activity of RARA protein	17290005
C084904	Ro 41-5253	Ro 41-5253 binds to and results in decreased activity of RARA protein	8838863
C084904	Ro 41-5253	Ro 41-5253 binds to and results in decreased activity of RARA protein	16085646; 16872382; 20695457;
C018381	salvin	[Tetradecanoylphorbol Acetate co-treated with salvin] results in increased expression of RARA protein	11504768
C078903	seocalcitol	seocalcitol results in increased expression of RARA mRNA	21843606
D012834	Silver	Silver results in increased expression of RARA mRNA	26014281
C017947	sodium arsenite	sodium arsenite results in decreased expression of RARA mRNA	20371982
D020358	Sodium Cholate	[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased expression of RARA protein	27394961
D020358	Sodium Cholate	MET gene mutant form inhibits the reaction [[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased expression of RARA protein]	27394961
D012967	Sodium Dodecyl Sulfate	Sodium Dodecyl Sulfate results in decreased expression of RARA mRNA	12815608
C458525	STO 609	STO 609 inhibits the reaction [[Bicuculline co-treated with 4-Aminopyridine] promotes the reaction [Alitretinoin results in increased activity of RARA protein]]	15773917
D000077210	Sunitinib	Sunitinib results in increased expression of RARA mRNA	31533062
C112689	TAC 101	TAC 101 binds to RARA protein	17436592
C061133	tamibarotene	RARA results in decreased susceptibility to tamibarotene	17611697
C061133	tamibarotene	tamibarotene inhibits the reaction [KLF5 protein binds to [RARA protein binds to RXRA protein]]	16224062
C061133	tamibarotene	tamibarotene inhibits the reaction [[KLF5 protein binds to [RARA protein binds to RXRA protein]] which binds to PDGFA promoter]	16224062
C061133	tamibarotene	tamibarotene inhibits the reaction [[RARA co-treated with RXRA] promotes the reaction [KLF5 results in increased expression of PDGFA mRNA]]	16224062
C061133	tamibarotene	tamibarotene inhibits the reaction [RARA protein binds to PDGFA promoter]	16224062
C061133	tamibarotene	tamibarotene results in increased expression of RARA protein	19457078
C061133	tamibarotene	tamibarotene binds to and affects the activity of RARA protein	16982755
C061133	tamibarotene	tamibarotene binds to and results in increased activity of RARA protein	16819260
C061133	tamibarotene	tamibarotene binds to RARA protein	9144408
C061133	tamibarotene	tamibarotene results in increased activity of RARA protein	27737899
D013629	Tamoxifen	Tamoxifen affects the expression of RARA mRNA	17555576
C012568	terbufos	terbufos results in increased methylation of RARA promoter	22847954
D013739	Testosterone	Testosterone results in decreased expression of RARA mRNA	16432891
C534735	tetraarsenic tetrasulfide	Arsenic Trioxide promotes the reaction [tetraarsenic tetrasulfide results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	26110921
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide inhibits the reaction [SET protein results in increased expression of [PML protein mutant form binds to RARA protein mutant form]]	24430359
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide promotes the reaction [Arsenic Trioxide results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]]	26110921
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]	26110921
D013749	Tetrachlorodibenzodioxin	[Estradiol co-treated with Tetrachlorodibenzodioxin] results in decreased expression of RARA mRNA	19619570
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of RARA mRNA	19619570
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of RARA mRNA	21570461; 24058054;
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of RARA mRNA	17942748
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of RARA mRNA	26290441
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of RARA mRNA	15667827
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with salvin] results in increased expression of RARA protein	11504768
D013876	Thiophenes	Thiophenes analog promotes the reaction [Tretinoin results in increased expression of RARA mRNA alternative form]	16140955
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased methylation of RARA gene	26756918
D014212	Tretinoin	Tretinoin results in increased expression of RARA mRNA	12921748
D014212	Tretinoin	2-bromopalmitate inhibits the reaction [Tretinoin results in decreased expression of RARA protein]	30076181
D014212	Tretinoin	[2-bromopalmitate results in increased susceptibility to Tretinoin] which results in increased expression of RARA protein	30076181
D014212	Tretinoin	benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Tretinoin results in decreased expression of RARA protein]	24819975
D014212	Tretinoin	benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Tretinoin results in increased degradation of RARA protein]	20945414
D014212	Tretinoin	caffeic acid phenethyl ester promotes the reaction [Tretinoin results in increased activity of RARA protein]	16766008
D014212	Tretinoin	CYP26A1 protein inhibits the reaction [Tretinoin results in increased expression of RARA mRNA]	15703382
D014212	Tretinoin	[Decitabine co-treated with Tretinoin] results in increased expression of RARA mRNA	19524134
D014212	Tretinoin	IFNG protein promotes the reaction [Tretinoin results in increased expression of RARA mRNA]	16007204
D014212	Tretinoin	Lipopolysaccharides promotes the reaction [Tretinoin results in increased expression of RARA mRNA]	17216566
D014212	Tretinoin	[Melatonin co-treated with Tretinoin] results in increased activity of RARA protein	10965999
D014212	Tretinoin	Melatonin promotes the reaction [Tretinoin results in increased activity of RARA protein]	15813899
D014212	Tretinoin	[PCNA protein binds to RARA protein] which affects the susceptibility to Tretinoin	16055921
D014212	Tretinoin	RARA gene mutant form inhibits the reaction [Tretinoin inhibits the reaction [Arsenic Trioxide results in increased expression of HMOX1 protein]]	25003661
D014212	Tretinoin	RARA gene mutant form inhibits the reaction [Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	25003661
D014212	Tretinoin	RARA gene mutant form results in decreased susceptibility to Tretinoin	25003661
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin results in decreased expression of CYP1A1 mRNA]	22177959
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin results in decreased secretion of IFNG protein]	16872382
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin results in decreased secretion of [IL12A protein binds to IL12B protein]]	16872382
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin results in increased expression of CYP26A1 mRNA]	16194896
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin results in increased secretion of IL10 protein]	16872382
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin results in increased secretion of IL4 protein]	16872382
D014212	Tretinoin	[RARA protein binds to RXRA protein] promotes the reaction [Tretinoin results in increased degradation of NCOA3 protein]	16456540
D014212	Tretinoin	RARA protein promotes the reaction [Tretinoin results in increased activity of STS protein]	16178010
D014212	Tretinoin	RARA protein promotes the reaction [Tretinoin results in increased expression of VEGFA mRNA]	17170094
D014212	Tretinoin	RARA protein results in increased susceptibility to Tretinoin	16287870; 20945414; 23830798; 24819975;
D014212	Tretinoin	[RARA protein results in increased susceptibility to Tretinoin] which results in increased expression of ITGAM	24819975
D014212	Tretinoin	Ro 41-5253 inhibits the reaction [Tretinoin results in increased expression of RARA mRNA]	17216566
D014212	Tretinoin	Thiophenes analog promotes the reaction [Tretinoin results in increased expression of RARA mRNA alternative form]	16140955
D014212	Tretinoin	Tretinoin affects the localization of RARA protein	16636311
D014212	Tretinoin	[Tretinoin binds to and affects the activity of RARA protein] which results in increased activity of CDKN1A protein	16765349
D014212	Tretinoin	Tretinoin binds to RARA protein	1318502; 31195007;
D014212	Tretinoin	Tretinoin binds to [RXRA protein binds to RARA protein]	16757381
D014212	Tretinoin	[Tretinoin binds to [RXRA protein binds to RARA protein]] which binds to PDK4 promoter	16757381
D014212	Tretinoin	[Tretinoin co-treated with Arsenic Trioxide] results in decreased expression of RARA mRNA alternative form	19225113
D014212	Tretinoin	[Tretinoin co-treated with Butyrates] results in increased cleavage of RARA protein mutant form	12130515
D014212	Tretinoin	[Tretinoin co-treated with caffeic acid phenethyl ester] results in increased expression of RARA mRNA	16766008
D014212	Tretinoin	[Tretinoin co-treated with caffeic acid phenethyl ester] results in increased expression of RARA protein	16766008
D014212	Tretinoin	[Tretinoin co-treated with hexamethylene bisacetamide] results in increased cleavage of RARA protein mutant form	12130515
D014212	Tretinoin	[Tretinoin co-treated with RARA protein co-treated with RXRA protein] results in increased expression of CYP26A1 mRNA	17244623
D014212	Tretinoin	Tretinoin inhibits the reaction [BTG2 protein binds to RARA protein]	16782888
D014212	Tretinoin	Tretinoin inhibits the reaction [CCNH protein binds to and results in increased phosphorylation of RARA protein mutant form]	16935935
D014212	Tretinoin	Tretinoin inhibits the reaction [PRMT1 protein binds to RARA protein]	16782888
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA protein mutant form results in decreased expression of SPI1 mRNA]	16352814
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA protein mutant form results in decreased expression of SPI1 protein]	16352814
D014212	Tretinoin	Tretinoin inhibits the reaction [SIN3A protein binds to RARA protein]	16782888
D014212	Tretinoin	Tretinoin promotes the reaction [CREBBP protein binds to RARA protein]	16417649
D014212	Tretinoin	Tretinoin promotes the reaction [NCOA3 protein binds to RARA protein]	16456540
D014212	Tretinoin	Tretinoin promotes the reaction [PCNA protein binds to RARA protein]	16055921
D014212	Tretinoin	Tretinoin promotes the reaction [RARA protein binds to CD1D promoter]	17392484
D014212	Tretinoin	Tretinoin promotes the reaction [RARA protein binds to FOLR2 promoter]	16740727
D014212	Tretinoin	Tretinoin promotes the reaction [RARA protein binds to NCOA1 protein]	15578590
D014212	Tretinoin	Tretinoin promotes the reaction [RARA protein binds to NCOA2 protein]	15578590
D014212	Tretinoin	Tretinoin promotes the reaction [RARA protein binds to NCOA3 protein]	15578590
D014212	Tretinoin	Tretinoin promotes the reaction [RARA protein binds to PRAME protein]	16179254
D014212	Tretinoin	Tretinoin promotes the reaction [[RARA protein binds to RXRA protein] which binds to NOS2A promoter]	17306764
D014212	Tretinoin	Tretinoin results in decreased expression of RARA protein	15171703; 15194426; 15375546; 16740359; 24819975; 30076181;
D014212	Tretinoin	Tretinoin results in increased activity of RARA protein	16766008; 25492813;
D014212	Tretinoin	Tretinoin results in increased activity of [RARA protein binds to RXRA protein]	14592536; 20008677;
D014212	Tretinoin	Tretinoin results in increased cleavage of RARA protein mutant form	12130515
D014212	Tretinoin	Tretinoin results in increased degradation of [PML protein mutant form binds to RARA protein mutant form]	28130038
D014212	Tretinoin	Tretinoin results in increased degradation of RARA protein	16456540
D014212	Tretinoin	Tretinoin results in increased degradation of RARA protein mutant form	15748426; 16352814; 17217047; 19029980; 9834237;
D014212	Tretinoin	Tretinoin results in increased expression of and results in increased activity of RARA protein	16158052
D014212	Tretinoin	Tretinoin results in increased expression of RARA mRNA	14592536; 15171703; 15703382; 16007204; 16766008; 17034753; 17138961; 17216566; 20507312; 21393419; 21934132; 22906706; 23724009;
D014212	Tretinoin	Tretinoin results in increased expression of RARA mRNA alternative form	16140955
D014212	Tretinoin	Tretinoin results in increased expression of RARA protein	15171703; 16636311; 16766008; 20507312;
D014212	Tretinoin	Tretinoin results in increased phosphorylation of RARA protein mutant form	19029980
D014212	Tretinoin	Tretinoin results in increased sumoylation of and results in decreased degradation of RARA protein	15171703
D014212	Tretinoin	[Tretinoin results in increased sumoylation of and results in decreased degradation of RARA protein] promotes the reaction [RARA protein binds to RXRA protein]	15171703
D014212	Tretinoin	Tretinoin results in increased ubiquitination of and results in increased degradation of RARA protein	15171703; 20945414;
D014212	Tretinoin	[Tretinoin results in increased ubiquitination of and results in increased degradation of RARA protein] inhibits the reaction [RARA protein binds to RXRA protein]	15171703
D014212	Tretinoin	ZNF366 protein promotes the reaction [Tretinoin results in increased activity of [RARA protein binds to RXRA protein]]	20008677
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin affects the expression of CYP26A1 mRNA]	16261163
D014212	Tretinoin	RARA protein affects the reaction [Tretinoin affects the expression of RARB mRNA]	16261163
D014212	Tretinoin	RARA protein inhibits the reaction [Tretinoin results in increased activity of [CLOCK protein binds to ARNTL protein]]	17069763
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARA protein	12504905; 16839186;
D014212	Tretinoin	[Tretinoin binds to RARA protein] which binds to NRL promoter	16854989
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA gene mutant form results in decreased expression of KRT19 mRNA]	10748128
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA gene mutant form results in increased expression of ITGA2 mRNA]	10748128
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA gene mutant form results in increased expression of ITGB4 mRNA]	10748128
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA gene mutant form results in increased expression of JUN mRNA]	10748128
D014212	Tretinoin	Tretinoin inhibits the reaction [RARA gene mutant form results in increased expression of JUN protein]	10748128
D014212	Tretinoin	Tretinoin promotes the reaction [RARA gene mutant form results in decreased expression of ITGB1 mRNA]	10748128
D014212	Tretinoin	Tretinoin promotes the reaction [RARA gene mutant form results in decreased expression of KRT10 mRNA]	10748128
D014212	Tretinoin	Tretinoin promotes the reaction [RARA gene mutant form results in decreased expression of KRT6 mRNA]	10748128
D014212	Tretinoin	Tretinoin results in decreased expression of RARA protein	15646024
D014212	Tretinoin	Tretinoin results in increased expression of RARA mRNA	8892963
D014212	Tretinoin	IL1B protein promotes the reaction [Tretinoin affects the localization of RARA protein]	17078027
D014212	Tretinoin	Tretinoin affects the localization of RARA protein	17078027
D014212	Tretinoin	Tretinoin inhibits the reaction [nitrofen results in decreased expression of RARA protein]	26672737
D014212	Tretinoin	Tretinoin inhibits the reaction [nitrofen results in increased expression of RARA protein]	24352370
D014212	Tretinoin	Tretinoin promotes the reaction [nitrofen results in increased expression of RARA mRNA]	26672737
D014212	Tretinoin	Tretinoin results in increased expression of RARA mRNA	26672737
D014212	Tretinoin	Tretinoin results in increased expression of RARA protein	16043492; 26672737;
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARA protein	16839186
D014212	Tretinoin	HX 600 affects the reaction [Tretinoin binds to and results in increased activity of RARA protein]	9144408
D014212	Tretinoin	HX 600 promotes the reaction [[Tretinoin binds to and results in increased activity of RARA protein] which results in increased expression of TNFRSF10B mRNA]	9144408
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARA protein	16819260; 9144408;
D014212	Tretinoin	[Tretinoin binds to and results in increased activity of RARA protein] which results in increased expression of TNFRSF10B mRNA	9144408
D014212	Tretinoin	Tretinoin binds to RARA protein	17387344
D014212	Tretinoin	Tretinoin results in increased activity of RARA protein	17290005; 18398471;
C012589	trichostatin A	trichostatin A promotes the reaction [Alitretinoin results in increased activity of RARA protein]	15773917
D014284	Triiodothyronine	Triiodothyronine results in increased expression of RARA mRNA	17403546
D000077288	Troglitazone	[RARA gene mutant form co-treated with NPM1 gene mutant form] affects the susceptibility to Troglitazone	14508522
C525131	UVI 3003	UVI 3003 results in decreased expression of RARA mRNA	27894914
D014635	Valproic Acid	Valproic Acid results in decreased methylation of RARA gene	28853863; 29201983;
D014635	Valproic Acid	Valproic Acid results in increased expression of RARA mRNA	15799026
C034028	vanadyl sulfate	vanadyl sulfate results in decreased expression of RARA mRNA	16330358
D001335	Vehicle Emissions	Vehicle Emissions results in decreased methylation of RARA gene	25560391; 28495853;
C025643	vinclozolin	vinclozolin results in increased expression of RARA mRNA	23034163
C025643	vinclozolin	vinclozolin results in decreased expression of RARA mRNA	22496781
D014801	Vitamin A	Vitamin A results in increased expression of RARA mRNA	12921748
D014801	Vitamin A	[Vitamin A co-treated with RARA protein co-treated with RXRA protein] results in increased expression of CYP26A1 mRNA	17244623
D014801	Vitamin A	Vitamin A results in increased expression of RARA mRNA	17034753; 17225872;
D014801	Vitamin A	[RARA gene mutant form co-treated with Vitamin A] results in decreased expression of COL2A1 mRNA	16397886
D014801	Vitamin A	[RARA gene mutant form co-treated with Vitamin A] results in decreased expression of SOX9 mRNA	16397886
D014801	Vitamin A	[RARA gene mutant form co-treated with Vitamin A] results in increased expression of MEIS1 mRNA	16397886
D014801	Vitamin A	[RARA gene mutant form co-treated with Vitamin A] results in increased expression of MEIS2 mRNA	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in decreased expression of COL2A1 mRNA]	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in decreased expression of SOX9 mRNA]	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in increased expression of MEIS1 mRNA]	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in increased expression of MEIS2 mRNA]	16397886
D014801	Vitamin A	Vitamin A results in increased expression of RARA mRNA	30944279
D014801	Vitamin A	Vitamin A deficiency results in increased expression of RARA mRNA	7519440
D000077337	Vorinostat	Decitabine promotes the reaction [Vorinostat results in increased expression of RARA mRNA]	17417771
D000077337	Vorinostat	[Vorinostat co-treated with Arsenic Trioxide] results in decreased expression of RARA protein mutant form	27189198
D000077337	Vorinostat	Vorinostat results in decreased expression of RARA protein mutant form	27189198
D000077337	Vorinostat	Vorinostat results in increased expression of RARA mRNA	17417771
D015032	Zinc	[PCI 5002 co-treated with Zinc] results in increased expression of RARA mRNA	18593933
D015032	Zinc	Zinc deficiency results in increased expression of RARA mRNA	22171008
D015032	Zinc	Zinc results in increased expression of RARA protein mutant form	16330433
D000077211	Zoledronic Acid	Zoledronic Acid results in decreased expression of RARA mRNA	24714768; 25596134;

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0025	Alternative splicing
KW-0160	Chromosomal rearrangement
KW-0963	Cytoplasm
KW-0238	DNA-binding
KW-1017	Isopeptide bond
KW-0479	Metal-binding
KW-0539	Nucleus
KW-0597	Phosphoprotein
KW-0656	Proto-oncogene
KW-0675	Receptor
KW-1185	Reference proteome
KW-0804	Transcription
KW-0805	Transcription regulation
KW-0832	Ubl conjugation
KW-0862	Zinc
KW-0863	Zinc-finger

Interpro

InterPro ID	InterPro Term
IPR035500	NHR-like_dom_sf
IPR000536	Nucl_hrmn_rcpt_lig-bd
IPR001723	Nuclear_hrmn_rcpt
IPR003078	Retinoic_acid_rcpt
IPR001628	Znf_hrmn_rcpt
IPR013088	Znf_NHR/GATA

PROSITE

PROSITE ID	PROSITE Term
PS51843	NR_LBD
PS00031	NUCLEAR_REC_DBD_1
PS51030	NUCLEAR_REC_DBD_2

Pfam

Pfam ID	Pfam Term
PF00104	Hormone_recep
PF00105	zf-C4

Gene: RARA

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction