CleftGeneDB-Search

Gene: RARG

Basic information

Tag	Content
Uniprot ID	P13631; B7Z492; B7Z4F1; B7ZAE4; J3KNP6; P22932; Q15281; Q52LZ8; Q9BYX8; Q9H1I3; Q9UJ38;
Entrez ID	5916
Genbank protein ID	AAA60253.1; BAH14630.1; AAH93729.1; CAB60726.1; AAA60254.1; BAH12537.1; AAG41595.1; AAA52692.1; BAH12478.1; EAW96676.1; AAA63254.1; AAG41594.2; CAA40548.1; AAH93727.1;
Genbank nucleotide ID	NM_001243730.1; NM_001042728.2; NM_000966.5; NM_001243732.1;
Ensembl protein ID	ENSP00000388510; ENSP00000343698; ENSP00000444335; ENSP00000377947;
Ensembl nucleotide ID	ENSG00000172819
Gene name	Retinoic acid receptor gamma
Gene symbol	RARG
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. In the absence of ligand, acts mainly as an activator of gene expression due to weak binding to corepressors. Required for limb bud development. In concert with RARA or RARB, required for skeletal growth, matrix homeostasis and growth plate function (By similarity).
Sequence	MATNKERLFA AGALGPGSGY PGAGFPFAFP GALRGSPPFE MLSPSFRGLG QPDLPKEMAS 60 LSVETQSTSS EEMVPSSPSP PPPPRVYKPC FVCNDKSSGY HYGVSSCEGC KGFFRRSIQK 120 NMVYTCHRDK NCIINKVTRN RCQYCRLQKC FEVGMSKEAV RNDRNKKKKE VKEEGSPDSY 180 ELSPQLEELI TKVSKAHQET FPSLCQLGKY TTNSSADHRV QLDLGLWDKF SELATKCIIK 240 IVEFAKRLPG FTGLSIADQI TLLKAACLDI LMLRICTRYT PEQDTMTFSD GLTLNRTQMH 300 NAGFGPLTDL VFAFAGQLLP LEMDDTETGL LSAICLICGD RMDLEEPEKV DKLQEPLLEA 360 LRLYARRRRP SQPYMFPRML MKITDLRGIS TKGAERAITL KMEIPGPMPP LIREMLENPE 420 MFEDDSSQPG PHPNASSEDE VPGGQGKGGL KSPA 454

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1EXA
1EXX
1FCX
1FCY
1FCZ
1FD0
2LBD
3LBD
4LBD
5M24
6FX0

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	RARG	540425	Q08DD4		Bos taurus	Prediction	More>>
1:1 ortholog	RARG	102178513	A0A452FTP1		Capra hircus	Prediction	More>>
1:1 ortholog	RARG	5916	P13631		Homo sapiens	Prediction	More>>
1:1 ortholog	Rarg	19411	P18911	CPO	Mus musculus	Publication	More>>
1:1 ortholog	RARG		A0A2I3T1N3		Pan troglodytes	Prediction	More>>
1:1 ortholog	Rarg	685072	D3ZF61		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1277802635	p.Thr3Ile	missense variant	-	NC_000012.12:g.53227538G>A	gnomAD
rs754859955	p.Glu6Lys	missense variant	-	NC_000012.12:g.53227530C>T	ExAC,gnomAD
rs1314152214	p.Arg7Gln	missense variant	-	NC_000012.12:g.53227526C>T	gnomAD
rs749068937	p.Arg7Ter	stop gained	-	NC_000012.12:g.53227527G>A	ExAC,TOPMed,gnomAD
rs369873803	p.Ala10Val	missense variant	-	NC_000012.12:g.53227517G>A	ESP,ExAC,TOPMed,gnomAD
rs369873803	p.Ala10Glu	missense variant	-	NC_000012.12:g.53227517G>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly12Cys	missense variant	-	NC_000012.12:g.53227512C>A	NCI-TCGA
rs200641282	p.Gly12Asp	missense variant	-	NC_000012.12:g.53227511C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs764558084	p.Ala13Gly	missense variant	-	NC_000012.12:g.53227508G>C	ExAC
rs764558084	p.Ala13Asp	missense variant	-	NC_000012.12:g.53227508G>T	ExAC
NCI-TCGA novel	p.Gly15Trp	missense variant	-	NC_000012.12:g.53227503C>A	NCI-TCGA
rs763361169	p.Gly15Val	missense variant	-	NC_000012.12:g.53227502C>A	ExAC
NCI-TCGA novel	p.Pro16LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.53227501C>-	NCI-TCGA
rs775786386	p.Pro16Ala	missense variant	-	NC_000012.12:g.53227500G>C	ExAC,gnomAD
COSM291614	p.Gly22Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53227482C>A	NCI-TCGA Cosmic
rs760179232	p.Gly22Ala	missense variant	-	NC_000012.12:g.53227481C>G	ExAC,TOPMed,gnomAD
rs986000449	p.Ala23Thr	missense variant	-	NC_000012.12:g.53227479C>T	TOPMed,gnomAD
rs772794468	p.Gly24Asp	missense variant	-	NC_000012.12:g.53227475C>T	ExAC,gnomAD
rs1480190572	p.Ala28Gly	missense variant	-	NC_000012.12:g.53227463G>C	gnomAD
rs147050100	p.Ala28Thr	missense variant	-	NC_000012.12:g.53227464C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1255854166	p.Phe29Ser	missense variant	-	NC_000012.12:g.53227460A>G	gnomAD
rs1217057963	p.Pro30Ser	missense variant	-	NC_000012.12:g.53227458G>A	gnomAD
rs1457086260	p.Gly31Arg	missense variant	-	NC_000012.12:g.53227455C>G	TOPMed
NCI-TCGA novel	p.Ala32GlyPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.53227451_53227452insC	NCI-TCGA
rs1278960828	p.Leu33Val	missense variant	-	NC_000012.12:g.53227449G>C	gnomAD
NCI-TCGA novel	p.Gly35Arg	missense variant	-	NC_000012.12:g.53227443C>T	NCI-TCGA
NCI-TCGA novel	p.Ser36LeuPheSerTerUnk	frameshift	-	NC_000012.12:g.53227441C>-	NCI-TCGA
rs577625236	p.Pro37Leu	missense variant	-	NC_000012.12:g.53227436G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs756369521	p.Pro38Ser	missense variant	-	NC_000012.12:g.53227434G>A	ExAC,gnomAD
rs141642280	p.Glu40Lys	missense variant	-	NC_000012.12:g.53227428C>T	ESP,ExAC,gnomAD
rs141642280	p.Glu40Gln	missense variant	-	NC_000012.12:g.53227428C>G	ESP,ExAC,gnomAD
rs147914026	p.Glu40Asp	missense variant	-	NC_000012.12:g.53227426C>G	ESP,TOPMed
NCI-TCGA novel	p.Met41Ile	missense variant	-	NC_000012.12:g.53227423C>G	NCI-TCGA
rs1162191476	p.Met41Ile	missense variant	-	NC_000012.12:g.53227423C>T	gnomAD
rs371795184	p.Met41Thr	missense variant	-	NC_000012.12:g.53227424A>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser43Ile	missense variant	-	NC_000012.12:g.53227418C>A	NCI-TCGA
rs1369624218	p.Ser43Gly	missense variant	-	NC_000012.12:g.53227419T>C	gnomAD
COSM3462624	p.Pro44Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53227415G>A	NCI-TCGA Cosmic
rs778278729	p.Pro44Arg	missense variant	-	NC_000012.12:g.53227415G>C	ExAC,gnomAD
rs1188181638	p.Pro44Ser	missense variant	-	NC_000012.12:g.53227416G>A	gnomAD
rs202210396	p.Ser45Asn	missense variant	-	NC_000012.12:g.53227412C>T	1000Genomes,ExAC,gnomAD
rs1200267590	p.Arg47Gln	missense variant	-	NC_000012.12:g.53227406C>T	gnomAD
NCI-TCGA novel	p.Gln51Leu	missense variant	-	NC_000012.12:g.53227394T>A	NCI-TCGA
rs200289157	p.Pro52Ser	missense variant	-	NC_000012.12:g.53227392G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1285968095	p.Asp53Glu	missense variant	-	NC_000012.12:g.53227387G>C	gnomAD
rs1285968095	p.Asp53Glu	missense variant	-	NC_000012.12:g.53227387G>T	gnomAD
rs1426174979	p.Lys56Asn	missense variant	-	NC_000012.12:g.53227378C>A	TOPMed,gnomAD
rs767255761	p.Ser60Cys	missense variant	-	NC_000012.12:g.53227367G>C	ExAC,gnomAD
rs1376775025	p.Ser60Pro	missense variant	-	NC_000012.12:g.53227368A>G	gnomAD
rs776428099	p.Ser62Leu	missense variant	-	NC_000012.12:g.53215794G>A	ExAC,gnomAD
rs766220605	p.Val63Ala	missense variant	-	NC_000012.12:g.53215791A>G	ExAC,gnomAD
rs368106601	p.Thr65Ile	missense variant	-	NC_000012.12:g.53215785G>A	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Ser67HisPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.53215779_53215780CT>-	NCI-TCGA
rs1199743374	p.Thr68Ile	missense variant	-	NC_000012.12:g.53215776G>A	gnomAD
rs772316902	p.Pro75Arg	missense variant	-	NC_000012.12:g.53215755G>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser77Leu	missense variant	-	NC_000012.12:g.53215749G>A	NCI-TCGA
rs868518896	p.Ser79Leu	missense variant	-	NC_000012.12:g.53215743G>A	gnomAD
rs1277703533	p.Pro81Leu	missense variant	-	NC_000012.12:g.53215737G>A	gnomAD
NCI-TCGA novel	p.Pro82Ala	missense variant	-	NC_000012.12:g.53215735G>C	NCI-TCGA
rs769476878	p.Pro82Leu	missense variant	-	NC_000012.12:g.53215734G>A	TOPMed,gnomAD
RCV000207406	p.Pro82Leu	missense variant	Irido-corneo-trabecular dysgenesis (ASGD5)	NC_000012.12:g.53215734G>A	ClinVar
rs769056213	p.Pro83Leu	missense variant	-	NC_000012.12:g.53215731G>A	ExAC,gnomAD
rs1051888927	p.Arg85Trp	missense variant	-	NC_000012.12:g.53215726G>A	TOPMed,gnomAD
COSM431377	p.Tyr87Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.53215718G>C	NCI-TCGA Cosmic
rs1211786111	p.Tyr87Cys	missense variant	-	NC_000012.12:g.53215719T>C	gnomAD
NCI-TCGA novel	p.Val92Met	missense variant	-	NC_000012.12:g.53215705C>T	NCI-TCGA
COSM1586586	p.Cys93Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53215701C>T	NCI-TCGA Cosmic
rs1373097113	p.Asn94Ser	missense variant	-	NC_000012.12:g.53215698T>C	TOPMed,gnomAD
rs756583376	p.Asn94Asp	missense variant	-	NC_000012.12:g.53215699T>C	ExAC,gnomAD
rs1383968565	p.Gly112Asp	missense variant	-	NC_000012.12:g.53215433C>T	TOPMed
NCI-TCGA novel	p.Arg115His	missense variant	-	NC_000012.12:g.53215424C>T	NCI-TCGA
COSM4865671	p.Arg115Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53215425G>A	NCI-TCGA Cosmic
COSM3749217	p.Arg116Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53215421C>T	NCI-TCGA Cosmic
rs1382493639	p.Arg116Ter	stop gained	-	NC_000012.12:g.53215422G>A	TOPMed
rs1368283166	p.Met122Ile	missense variant	-	NC_000012.12:g.53215402C>G	TOPMed
rs1353471159	p.Met122Val	missense variant	-	NC_000012.12:g.53215404T>C	gnomAD
rs771641542	p.Val123Leu	missense variant	-	NC_000012.12:g.53215401C>A	ExAC,gnomAD
rs747897352	p.Thr125Met	missense variant	-	NC_000012.12:g.53215394G>A	ExAC,gnomAD
NCI-TCGA novel	p.Arg128Ser	missense variant	-	NC_000012.12:g.53215386G>T	NCI-TCGA
rs141058411	p.Arg128His	missense variant	-	NC_000012.12:g.53215385C>T	ESP,ExAC,TOPMed,gnomAD
rs754556103	p.Arg128Cys	missense variant	-	NC_000012.12:g.53215386G>A	ExAC,TOPMed,gnomAD
rs755978003	p.Asp129Asn	missense variant	-	NC_000012.12:g.53215383C>T	ExAC,gnomAD
rs1380703070	p.Lys130Arg	missense variant	-	NC_000012.12:g.53215379T>C	gnomAD
COSM4929950	p.Asn131Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53215377T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile133Val	missense variant	-	NC_000012.12:g.53215371T>C	NCI-TCGA
rs767403543	p.Lys136Asn	missense variant	-	NC_000012.12:g.53215360C>A	ExAC,TOPMed,gnomAD
rs761508890	p.Arg141Gly	missense variant	-	NC_000012.12:g.53215347G>C	ExAC,TOPMed,gnomAD
rs751844553	p.Arg141His	missense variant	-	NC_000012.12:g.53215346C>T	ExAC,TOPMed,gnomAD
rs761508890	p.Arg141Cys	missense variant	-	NC_000012.12:g.53215347G>A	ExAC,TOPMed,gnomAD
COSM1299578	p.Gln143Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.53215341G>A	NCI-TCGA Cosmic
rs763146108	p.Tyr144His	missense variant	-	NC_000012.12:g.53215338A>G	ExAC,gnomAD
rs1254896676	p.Arg146Gln	missense variant	-	NC_000012.12:g.53215331C>T	TOPMed
rs770432568	p.Glu152Lys	missense variant	-	NC_000012.12:g.53215314C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala159Val	missense variant	-	NC_000012.12:g.53214606G>A	NCI-TCGA
COSM4549530	p.Ala159Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53215293C>T	NCI-TCGA Cosmic
COSM4867964	p.Arg161Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.53214601G>A	NCI-TCGA Cosmic
rs773410727	p.Arg161Gln	missense variant	-	NC_000012.12:g.53214600C>T	ExAC,gnomAD
rs1331919553	p.Asn162Ser	missense variant	-	NC_000012.12:g.53214597T>C	gnomAD
rs199861731	p.Arg164Gln	missense variant	-	NC_000012.12:g.53214591C>T	1000Genomes,ExAC,gnomAD
rs199861731	p.Arg164Leu	missense variant	-	NC_000012.12:g.53214591C>A	1000Genomes,ExAC,gnomAD
rs140755478	p.Arg164Trp	missense variant	-	NC_000012.12:g.53214592G>A	ESP,ExAC,TOPMed,gnomAD
rs745345035	p.Asn165Lys	missense variant	-	NC_000012.12:g.53214587G>C	ExAC,TOPMed,gnomAD
rs745345035	p.Asn165Lys	missense variant	-	NC_000012.12:g.53214587G>T	ExAC,TOPMed,gnomAD
rs746821114	p.Val171Leu	missense variant	-	NC_000012.12:g.53214571C>G	ExAC,TOPMed,gnomAD
rs746821114	p.Val171Met	missense variant	-	NC_000012.12:g.53214571C>T	ExAC,TOPMed,gnomAD
rs576999686	p.Lys172Met	missense variant	-	NC_000012.12:g.53214567T>A	1000Genomes,ExAC,gnomAD
rs200962839	p.Lys172Asn	missense variant	-	NC_000012.12:g.53214566C>A	1000Genomes
rs758257136	p.Glu173Lys	missense variant	-	NC_000012.12:g.53214565C>T	ExAC,gnomAD
rs753039007	p.Glu174Gln	missense variant	-	NC_000012.12:g.53214562C>G	ExAC,TOPMed
COSM3792752	p.Glu174Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214562C>T	NCI-TCGA Cosmic
rs755157558	p.Gly175Glu	missense variant	-	NC_000012.12:g.53214558C>T	ExAC,TOPMed,gnomAD
rs755157558	p.Gly175Ala	missense variant	-	NC_000012.12:g.53214558C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro177SerPheSerTerUnk	frameshift	-	NC_000012.12:g.53214542_53214554ATAGCTGTCAGGT>-	NCI-TCGA
rs372490193	p.Pro177Leu	missense variant	-	NC_000012.12:g.53214552G>A	ESP,ExAC,TOPMed,gnomAD
rs1012665089	p.Pro177Thr	missense variant	-	NC_000012.12:g.53214553G>T	gnomAD
rs1012665089	p.Pro177Ser	missense variant	-	NC_000012.12:g.53214553G>A	gnomAD
NCI-TCGA novel	p.Ser179Asn	missense variant	-	NC_000012.12:g.53214546C>T	NCI-TCGA
rs1263365408	p.Tyr180Cys	missense variant	-	NC_000012.12:g.53214543T>C	gnomAD
rs1462419082	p.Tyr180His	missense variant	-	NC_000012.12:g.53214544A>G	gnomAD
NCI-TCGA novel	p.Ser183GluPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.53214536_53214537insA	NCI-TCGA
rs1305270494	p.Pro184Thr	missense variant	-	NC_000012.12:g.53214532G>T	gnomAD
rs766941668	p.Gln185Lys	missense variant	-	NC_000012.12:g.53214529G>T	ExAC,gnomAD
rs761028583	p.Gln185Arg	missense variant	-	NC_000012.12:g.53214528T>C	ExAC,gnomAD
rs767936326	p.Glu188Asp	missense variant	-	NC_000012.12:g.53214518C>A	ExAC,gnomAD
rs775168526	p.Val193Ile	missense variant	-	NC_000012.12:g.53214505C>T	ExAC,gnomAD
rs1337655747	p.Ser194Arg	missense variant	-	NC_000012.12:g.53214502T>G	gnomAD
rs1203711077	p.Lys195Glu	missense variant	-	NC_000012.12:g.53214499T>C	TOPMed
NCI-TCGA novel	p.Ala196Ser	missense variant	-	NC_000012.12:g.53214496C>A	NCI-TCGA
NCI-TCGA novel	p.Gln198Ter	stop gained	-	NC_000012.12:g.53214490G>A	NCI-TCGA
NCI-TCGA novel	p.Glu199Lys	missense variant	-	NC_000012.12:g.53214487C>T	NCI-TCGA
rs1190599963	p.Pro202Leu	missense variant	-	NC_000012.12:g.53214477G>A	TOPMed
COSM1263818	p.Ser203Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214474G>A	NCI-TCGA Cosmic
COSM4869838	p.Leu207Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214462A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Tyr210Cys	missense variant	-	NC_000012.12:g.53214453T>C	NCI-TCGA
rs897676400	p.Thr212Met	missense variant	-	NC_000012.12:g.53214447G>A	gnomAD
rs760204680	p.Asn213Lys	missense variant	-	NC_000012.12:g.53214233G>C	ExAC,TOPMed,gnomAD
rs773336530	p.Ser214Phe	missense variant	-	NC_000012.12:g.53214231G>A	ExAC,gnomAD
rs1224674839	p.Ser215Cys	missense variant	-	NC_000012.12:g.53214229T>A	gnomAD
rs772086275	p.Asp217His	missense variant	-	NC_000012.12:g.53214223C>G	ExAC,gnomAD
rs1267232452	p.Asp217Glu	missense variant	-	NC_000012.12:g.53214221G>T	TOPMed
NCI-TCGA novel	p.Arg219Ser	missense variant	-	NC_000012.12:g.53214217G>T	NCI-TCGA
NCI-TCGA novel	p.Arg219Cys	missense variant	-	NC_000012.12:g.53214217G>A	NCI-TCGA
rs887576106	p.Val220Met	missense variant	-	NC_000012.12:g.53214214C>T	TOPMed
NCI-TCGA novel	p.Gln221Ter	stop gained	-	NC_000012.12:g.53214211G>A	NCI-TCGA
rs747987743	p.Gln221His	missense variant	-	NC_000012.12:g.53214209C>A	ExAC,gnomAD
rs1236591003	p.Gln221Arg	missense variant	-	NC_000012.12:g.53214210T>C	gnomAD
rs778785057	p.Gly225Arg	missense variant	-	NC_000012.12:g.53214199C>T	ExAC,gnomAD
COSM3462619	p.Leu226Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214195A>C	NCI-TCGA Cosmic
COSM1299577	p.Ala234Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214172C>G	NCI-TCGA Cosmic
rs928219970	p.Thr235Asn	missense variant	-	NC_000012.12:g.53214168G>T	TOPMed
rs1415224284	p.Ile241Val	missense variant	-	NC_000012.12:g.53214151T>C	TOPMed
COSM3792750	p.Val242Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214147A>G	NCI-TCGA Cosmic
rs1288724003	p.Val242Met	missense variant	-	NC_000012.12:g.53214148C>T	gnomAD
NCI-TCGA novel	p.Arg247Trp	missense variant	-	NC_000012.12:g.53214133G>A	NCI-TCGA
rs528795439	p.Arg247Leu	missense variant	-	NC_000012.12:g.53214132C>A	1000Genomes,ExAC,gnomAD
rs1045750229	p.Arg247Gly	missense variant	-	NC_000012.12:g.53214133G>C	TOPMed
COSM3871931	p.Pro249Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214126G>A	NCI-TCGA Cosmic
rs1292642280	p.Ile256Met	missense variant	-	NC_000012.12:g.53214104A>C	TOPMed,gnomAD
NCI-TCGA novel	p.Ala266Thr	missense variant	-	NC_000012.12:g.53214076C>T	NCI-TCGA
COSM3987030	p.Ile270Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53214063A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu271Val	missense variant	-	NC_000012.12:g.53214061G>C	NCI-TCGA
COSM5841354	p.Arg274Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213694G>A	NCI-TCGA Cosmic
rs1471979738	p.Arg274His	missense variant	-	NC_000012.12:g.53213693C>T	gnomAD
rs1459962750	p.Thr277Arg	missense variant	-	NC_000012.12:g.53213684G>C	TOPMed
NCI-TCGA novel	p.Tyr279His	missense variant	-	NC_000012.12:g.53213679A>G	NCI-TCGA
COSM1362661	p.Pro281GlnPheSerTerUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.53213672G>-	NCI-TCGA Cosmic
rs144015314	p.Pro281Ala	missense variant	-	NC_000012.12:g.53213673G>C	ESP,ExAC,TOPMed,gnomAD
rs1295132193	p.Asp284Gly	missense variant	-	NC_000012.12:g.53213663T>C	TOPMed
NCI-TCGA novel	p.Thr285Ile	missense variant	-	NC_000012.12:g.53213660G>A	NCI-TCGA
NCI-TCGA novel	p.Met286Val	missense variant	-	NC_000012.12:g.53213658T>C	NCI-TCGA
COSM1299576	p.Met286Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213656C>G	NCI-TCGA Cosmic
COSM4847600	p.Phe288Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213650G>C	NCI-TCGA Cosmic
COSM3792746	p.Ser289Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213648G>A	NCI-TCGA Cosmic
rs1249971915	p.Asp290Asn	missense variant	-	NC_000012.12:g.53213646C>T	gnomAD
NCI-TCGA novel	p.Gly291Arg	missense variant	-	NC_000012.12:g.53213643C>T	NCI-TCGA
rs778168925	p.Thr297Ser	missense variant	-	NC_000012.12:g.53213624G>C	ExAC,gnomAD
NCI-TCGA novel	p.Asn301Ser	missense variant	-	NC_000012.12:g.53213612T>C	NCI-TCGA
NCI-TCGA novel	p.Phe304Leu	missense variant	-	NC_000012.12:g.53213604A>G	NCI-TCGA
NCI-TCGA novel	p.Gly305Val	missense variant	-	NC_000012.12:g.53213600C>A	NCI-TCGA
COSM431376	p.Gly305Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213600C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe312Val	missense variant	-	NC_000012.12:g.53213580A>C	NCI-TCGA
COSM1322410	p.Ala313Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213577C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe314LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.53213575G>-	NCI-TCGA
NCI-TCGA novel	p.Phe314Ser	missense variant	-	NC_000012.12:g.53213573A>G	NCI-TCGA
NCI-TCGA novel	p.Ala315GlyPheSerTerUnk	frameshift	-	NC_000012.12:g.53213551_53213570CAGGGGCAGGAGCTGCCCAG>-	NCI-TCGA
rs1288518945	p.Gly316Glu	missense variant	-	NC_000012.12:g.53213567C>T	TOPMed
NCI-TCGA novel	p.Gln317AspPheSerTerUnk	frameshift	-	NC_000012.12:g.53213550_53213566CCAGGGGCAGGAGCTGC>-	NCI-TCGA
NCI-TCGA novel	p.Gln317GlyPheSerTerUnk	frameshift	-	NC_000012.12:g.53213546_53213565ATCTCCAGGGGCAGGAGCTG>-	NCI-TCGA
NCI-TCGA novel	p.Gln317GlyPheSerTerUnk	frameshift	-	NC_000012.12:g.53213553_53213566GGGGCAGGAGCTGC>-	NCI-TCGA
COSM3792744	p.Leu321Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213553G>C	NCI-TCGA Cosmic
rs1452750916	p.Asp324Tyr	missense variant	-	NC_000012.12:g.53213544C>A	TOPMed
NCI-TCGA novel	p.Asp325Asn	missense variant	-	NC_000012.12:g.53213541C>T	NCI-TCGA
COSM3792742	p.Glu327Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213535C>T	NCI-TCGA Cosmic
rs1386908598	p.Gly329Glu	missense variant	-	NC_000012.12:g.53213528C>T	gnomAD
rs1231566775	p.Ser332Gly	missense variant	-	NC_000012.12:g.53213520T>C	TOPMed
rs756849337	p.Ile337Thr	missense variant	-	NC_000012.12:g.53213504A>G	ExAC,gnomAD
NCI-TCGA novel	p.Gly339Glu	missense variant	-	NC_000012.12:g.53213498C>T	NCI-TCGA
COSM3688307	p.Gly339Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213498C>A	NCI-TCGA Cosmic
rs763938120	p.Gly339Arg	missense variant	-	NC_000012.12:g.53213499C>T	ExAC,TOPMed,gnomAD
rs865989392	p.Arg341His	missense variant	-	NC_000012.12:g.53213240C>T	-
rs754842832	p.Arg341Cys	missense variant	-	NC_000012.12:g.53213241G>A	ExAC
NCI-TCGA novel	p.Met342Ile	missense variant	-	NC_000012.12:g.53213236C>T	NCI-TCGA
rs376354739	p.Met342Val	missense variant	-	NC_000012.12:g.53213238T>C	ESP,ExAC,TOPMed,gnomAD
rs1203189000	p.Glu345Ala	missense variant	-	NC_000012.12:g.53213228T>G	gnomAD
rs1275045820	p.Glu348Lys	missense variant	-	NC_000012.12:g.53213220C>T	gnomAD
rs139581410	p.Lys352Arg	missense variant	-	NC_000012.12:g.53213207T>C	ESP,ExAC,TOPMed,gnomAD
rs1312605781	p.Leu353Met	missense variant	-	NC_000012.12:g.53213205G>T	gnomAD
rs774501958	p.Gln354His	missense variant	-	NC_000012.12:g.53213200C>G	ExAC,gnomAD
COSM4858847	p.Arg362Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53213177C>T	NCI-TCGA Cosmic
rs150579991	p.Ala365Thr	missense variant	-	NC_000012.12:g.53213169C>T	ESP,ExAC,TOPMed,gnomAD
rs150579991	p.Ala365Ser	missense variant	-	NC_000012.12:g.53213169C>A	ESP,ExAC,TOPMed,gnomAD
rs749572280	p.Arg366Trp	missense variant	-	NC_000012.12:g.53213166G>A	ExAC,TOPMed,gnomAD
rs749572280	p.Arg366Gly	missense variant	-	NC_000012.12:g.53213166G>C	ExAC,TOPMed,gnomAD
rs1446141610	p.Arg366Gln	missense variant	-	NC_000012.12:g.53213165C>T	gnomAD
rs1222949637	p.Arg367Cys	missense variant	-	NC_000012.12:g.53213163G>A	TOPMed,gnomAD
rs747661662	p.Arg367His	missense variant	-	NC_000012.12:g.53213162C>T	ExAC,gnomAD
rs754474376	p.Arg368Gln	missense variant	-	NC_000012.12:g.53213159C>T	ExAC,gnomAD
rs143739684	p.Arg368Trp	missense variant	-	NC_000012.12:g.53213160G>A	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Arg369Gln	missense variant	-	NC_000012.12:g.53213156C>T	NCI-TCGA
rs757349755	p.Arg369Trp	missense variant	-	NC_000012.12:g.53213157G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Ser371Cys	missense variant	-	NC_000012.12:g.53213151T>A	NCI-TCGA
rs749293562	p.Pro373Leu	missense variant	-	NC_000012.12:g.53213144G>A	ExAC,gnomAD
rs138240233	p.Tyr374His	missense variant	-	NC_000012.12:g.53213142A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs532295094	p.Tyr374Cys	missense variant	-	NC_000012.12:g.53213141T>C	1000Genomes,ExAC,gnomAD
rs532295094	p.Tyr374Phe	missense variant	-	NC_000012.12:g.53213141T>A	1000Genomes,ExAC,gnomAD
rs1313723970	p.Met375Ile	missense variant	-	NC_000012.12:g.53213137C>T	gnomAD
rs370081012	p.Met375Val	missense variant	-	NC_000012.12:g.53213139T>C	ExAC,gnomAD
rs751818808	p.Met379Ile	missense variant	-	NC_000012.12:g.53213125C>T	ExAC,gnomAD
rs1411023777	p.Asp385Glu	missense variant	-	NC_000012.12:g.53213107G>T	TOPMed,gnomAD
rs763093625	p.Asp385Asn	missense variant	-	NC_000012.12:g.53213109C>T	ExAC,gnomAD
rs776186919	p.Arg387Gln	missense variant	-	NC_000012.12:g.53213102C>T	ExAC,gnomAD
rs765615833	p.Thr391Ile	missense variant	-	NC_000012.12:g.53213090G>A	ExAC,gnomAD
rs1426949912	p.Thr391Ala	missense variant	-	NC_000012.12:g.53213091T>C	gnomAD
NCI-TCGA novel	p.Glu395Lys	missense variant	-	NC_000012.12:g.53211858C>T	NCI-TCGA
NCI-TCGA novel	p.Arg396Gly	missense variant	-	NC_000012.12:g.53211855T>C	NCI-TCGA
rs1384490766	p.Ala397Val	missense variant	-	NC_000012.12:g.53211851G>A	TOPMed
rs759902989	p.Lys401Thr	missense variant	-	NC_000012.12:g.53211839T>G	ExAC
rs201808801	p.Met402Thr	missense variant	-	NC_000012.12:g.53211836A>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu403Gln	missense variant	-	NC_000012.12:g.53211834C>G	NCI-TCGA
NCI-TCGA novel	p.Pro405Ala	missense variant	-	NC_000012.12:g.53211828G>C	NCI-TCGA
rs760999231	p.Pro407Leu	missense variant	-	NC_000012.12:g.53211821G>A	ExAC,gnomAD
rs760999231	p.Pro407Arg	missense variant	-	NC_000012.12:g.53211821G>C	ExAC,gnomAD
rs768255271	p.Arg413Gln	missense variant	-	NC_000012.12:g.53211803C>T	ExAC,TOPMed,gnomAD
COSM4931876	p.Asn418Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53211787G>C	NCI-TCGA Cosmic
rs1322959391	p.Pro419Arg	missense variant	-	NC_000012.12:g.53211785G>C	gnomAD
rs774801685	p.Glu420Gly	missense variant	-	NC_000012.12:g.53211782T>C	ExAC,gnomAD
rs769329543	p.Met421Ile	missense variant	-	NC_000012.12:g.53211778C>T	ExAC,gnomAD
rs745859701	p.Glu423Ala	missense variant	-	NC_000012.12:g.53211773T>G	ExAC,gnomAD
rs781152869	p.Glu423Asp	missense variant	-	NC_000012.12:g.53211772C>G	ExAC,gnomAD
rs2229774	p.Ser427Leu	missense variant	-	NC_000012.12:g.53211761G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1403311383	p.Gln428Pro	missense variant	-	NC_000012.12:g.53211758T>G	gnomAD
rs758628664	p.Gln428Lys	missense variant	-	NC_000012.12:g.53211759G>T	ExAC,gnomAD
VAR_036061	p.Gly430Ser	Missense	-	-	UniProt
rs937877745	p.His432Tyr	missense variant	-	NC_000012.12:g.53211747G>A	TOPMed,gnomAD
rs752835490	p.Pro433Thr	missense variant	-	NC_000012.12:g.53211744G>T	ExAC,gnomAD
rs1268784581	p.Ala435Val	missense variant	-	NC_000012.12:g.53211737G>A	TOPMed
COSM1299574	p.Ser437Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.53211730G>C	NCI-TCGA Cosmic
rs554853535	p.Ser437Ile	missense variant	-	NC_000012.12:g.53211731C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs555608509	p.Glu438Lys	missense variant	-	NC_000012.12:g.53211729C>T	TOPMed,gnomAD
rs1202245173	p.Asp439Asn	missense variant	-	NC_000012.12:g.53211726C>T	gnomAD
rs1483582359	p.Val441Phe	missense variant	-	NC_000012.12:g.53211720C>A	gnomAD
rs766890278	p.Pro442Ser	missense variant	-	NC_000012.12:g.53211717G>A	ExAC,gnomAD
rs1225817596	p.Gly443Val	missense variant	-	NC_000012.12:g.53211713C>A	gnomAD
rs750716751	p.Gly444Asp	missense variant	-	NC_000012.12:g.53211710C>T	ExAC,gnomAD
rs763746430	p.Gln445Arg	missense variant	-	NC_000012.12:g.53211707T>C	ExAC,gnomAD
rs1203039353	p.Gly448Glu	missense variant	-	NC_000012.12:g.53211698C>T	TOPMed
rs373212761	p.Leu450Arg	missense variant	-	NC_000012.12:g.53211692A>C	ESP,ExAC,TOPMed,gnomAD
rs776455132	p.Pro453Ser	missense variant	-	NC_000012.12:g.53211684G>A	ExAC,gnomAD
rs770953830	p.Ter455Ser	stop lost	-	NC_000012.12:g.53211677C>G	ExAC,TOPMed,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001418	Adenocarcinoma	group	BEFREE
C0002893	Refractory anemias	disease	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE;UNIPROT
C0007137	Squamous cell carcinoma	disease	BEFREE
C0008925	Cleft Palate	disease	CTD_human
C0009402	Colorectal Carcinoma	disease	BEFREE
C0016037	Fibrodysplasia Ossificans Progressiva	disease	BEFREE
C0017636	Glioblastoma	disease	BEFREE
C0018799	Heart Diseases	group	CTD_human
C0022596	Palmoplantar Keratosis	disease	BEFREE
C0023418	leukemia	disease	BEFREE;LHGDN
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE
C0023487	Acute Promyelocytic Leukemia	disease	BEFREE
C0025007	Measles	disease	BEFREE
C0027819	Neuroblastoma	group	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0030297	Pancreatic Neoplasm	disease	LHGDN
C0079731	B-Cell Lymphomas	group	BEFREE
C0085669	Acute leukemia	disease	BEFREE
C0151491	Congenital musculoskeletal anomalies	group	CTD_human
C0206664	Teratocarcinoma	disease	BEFREE
C0206698	Cholangiocarcinoma	disease	BEFREE
C0220620	Gastrointestinal Carcinoid Tumor	disease	BEFREE
C0220668	Congenital contractural arachnodactyly	disease	BEFREE
C0278704	Malignant Childhood Neoplasm	group	BEFREE;GWASCAT
C0280725	Adult Cholangiocarcinoma	disease	BEFREE
C0346629	Malignant neoplasm of large intestine	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0598766	Leukemogenesis	disease	BEFREE
C0677886	Epithelial ovarian cancer	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0700095	Central neuroblastoma	disease	BEFREE
C0740277	Bile duct carcinoma	disease	BEFREE
C0876994	Cardiotoxicity	disease	CTD_human;GWASCAT
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1837218	Cleft palate, isolated	disease	CTD_human
C2239176	Liver carcinoma	disease	BEFREE
C2937421	Prostatic Hyperplasia	disease	LHGDN
C3266262	Multiple Chronic Conditions	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000976	transcription regulatory region sequence-specific DNA binding	IBA
GO:0000977	RNA polymerase II regulatory region sequence-specific DNA binding	IBA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	IBA
GO:0003677	DNA binding	ISS
GO:0003700	DNA-binding transcription factor activity	ISS
GO:0003707	steroid hormone receptor activity	IEA
GO:0004879	nuclear receptor activity	IEA
GO:0005515	protein binding	IPI
GO:0008134	transcription factor binding	IBA
GO:0008270	zinc ion binding	IEA
GO:0030374	nuclear receptor transcription coactivator activity	IBA
GO:0038023	signaling receptor activity	IBA
GO:0046965	retinoid X receptor binding	ISS
GO:0098531	ligand-activated transcription factor activity	IBA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0000122	negative regulation of transcription by RNA polymerase II	ISS
GO:0000122	negative regulation of transcription by RNA polymerase II	IBA
GO:0001843	neural tube closure	IEA
GO:0002068	glandular epithelial cell development	IEA
GO:0003430	growth plate cartilage chondrocyte growth	IEA
GO:0006367	transcription initiation from RNA polymerase II promoter	TAS
GO:0007275	multicellular organism development	IBA
GO:0008284	positive regulation of cell population proliferation	IEA
GO:0008285	negative regulation of cell population proliferation	ISS
GO:0008361	regulation of cell size	TAS
GO:0009755	hormone-mediated signaling pathway	IBA
GO:0009952	anterior/posterior pattern specification	IEA
GO:0030154	cell differentiation	IBA
GO:0031076	embryonic camera-type eye development	IEA
GO:0031641	regulation of myelination	IEA
GO:0032331	negative regulation of chondrocyte differentiation	IEA
GO:0032526	response to retinoic acid	IDA
GO:0032526	response to retinoic acid	IBA
GO:0033993	response to lipid	IBA
GO:0035116	embryonic hindlimb morphogenesis	ISS
GO:0035264	multicellular organism growth	IEA
GO:0043065	positive regulation of apoptotic process	ISS
GO:0043068	positive regulation of programmed cell death	ISS
GO:0043401	steroid hormone mediated signaling pathway	IEA
GO:0045637	regulation of myeloid cell differentiation	IEA
GO:0045944	positive regulation of transcription by RNA polymerase II	ISS
GO:0045944	positive regulation of transcription by RNA polymerase II	IBA
GO:0048048	embryonic eye morphogenesis	ISS
GO:0048384	retinoic acid receptor signaling pathway	IDA
GO:0048384	retinoic acid receptor signaling pathway	IBA
GO:0048568	embryonic organ development	IBA
GO:0048732	gland development	IBA
GO:0060070	canonical Wnt signaling pathway	TAS
GO:0060324	face development	IEA
GO:0060349	bone morphogenesis	IBA
GO:0060429	epithelium development	IBA
GO:0060534	trachea cartilage development	IEA
GO:0060740	prostate gland epithelium morphogenesis	IEA
GO:0070384	Harderian gland development	IEA
GO:0071300	cellular response to retinoic acid	IBA
GO:1990830	cellular response to leukemia inhibitory factor	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000790	nuclear chromatin	ISA
GO:0000790	nuclear chromatin	IDA
GO:0005634	nucleus	ISS
GO:0005634	nucleus	IDA
GO:0005634	nucleus	IBA
GO:0005654	nucleoplasm	IDA
GO:0005654	nucleoplasm	TAS
GO:0005667	transcription factor complex	ISS
GO:0005737	cytoplasm	IEA
GO:0016021	integral component of membrane	NAS
GO:0090575	RNA polymerase II transcription factor complex	IBA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1266738	Developmental Biology	IEA
R-HSA-162582	Signal Transduction	TAS
R-HSA-212436	Generic Transcription Pathway	TAS
R-HSA-383280	Nuclear Receptor transcription pathway	TAS
R-HSA-5362517	Signaling by Retinoic Acid	TAS
R-HSA-5617472	Activation of anterior HOX genes in hindbrain development during early embryogenesis	IEA
R-HSA-5619507	Activation of HOX genes during differentiation	IEA
R-HSA-73857	RNA Polymerase II Transcription	TAS
R-HSA-74160	Gene expression (Transcription)	TAS
R-HSA-9006931	Signaling by Nuclear Receptors	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015081	2-Naphthylamine	2-Naphthylamine results in decreased expression of RARG mRNA	18247414
C529372	3-((4,6-diphenoxy-1,3,5-triazin-2-yl)amino)benzoic acid	3-((4,6-diphenoxy-1,3,5-triazin-2-yl)amino)benzoic acid results in increased activity of RARG protein	18398471
C472791	3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid	3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid binds to and results in increased activity of RARG protein	16788091
C472791	3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid	3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in increased activity of RARG protein	12958071
C054189	3,5-di-tert-butylchalcone 4'-carboxylic acid	3,5-di-tert-butylchalcone 4'-carboxylic acid results in increased expression of RARG mRNA	7934625
C496751	4-(1H-imidazol-1-yl)retinoic acid	4-(1H-imidazol-1-yl)retinoic acid binds to RARG protein	17387344
C038864	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid binds to and results in increased activity of RARG protein	15589975; 16178010;
C038864	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	RARG gene mutant form results in decreased susceptibility to 4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	10748128
C121616	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid binds to and results in decreased activity of RARG protein	16178010
C516309	4-(4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-quinoxalinyl)-1,3-thiazol-2-yl)benzoic acid	4-(4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-quinoxalinyl)-1,3-thiazol-2-yl)benzoic acid binds to and results in increased activity of RARG protein	17076708
C064545	4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid	4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid binds to RARG protein	15589975
C064545	4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid	Chlordan inhibits the reaction [4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid binds to RARG protein]	15589975
C019429	4-hydroxyretinoic acid	4-hydroxyretinoic acid results in increased activity of RARG protein	25492813
C002202	4-oxoretinoic acid	4-oxoretinoic acid results in increased activity of RARG protein	25492813
C012606	4-vinyl-1-cyclohexene dioxide	4-vinyl-1-cyclohexene dioxide results in increased expression of RARG mRNA	20829426
D015124	8-Bromo Cyclic Adenosine Monophosphate	8-Bromo Cyclic Adenosine Monophosphate results in increased expression of RARG mRNA	22079614
D000082	Acetaminophen	Acetaminophen results in decreased expression of RARG mRNA	26690555
D000068816	Adapalene	RARG protein affects the susceptibility to Adapalene	9990413
D000068816	Adapalene	Adapalene binds to and results in increased activity of RARG protein	10651997
D000068816	Adapalene	Adapalene binds to RARG protein	9990413
D016604	Aflatoxin B1	Aflatoxin B1 results in increased methylation of RARG gene	27153756
C090766	AGN 190299	AGN 190299 binds to and results in increased activity of RARG protein	16178010
C096920	AGN 193109	AGN 193109 binds to and results in decreased activity of RARG protein	15589975
D000452	Aldrin	Aldrin results in increased expression of RARG mRNA	15589975
D000077556	Alitretinoin	Alitretinoin binds to and results in increased activity of RARG protein	15615532; 18180267;
D000077556	Alitretinoin	Alitretinoin results in decreased expression of RARG protein	15375546; 19812349;
D000077556	Alitretinoin	RARG gene mutant form results in decreased susceptibility to Alitretinoin	10748128
D000077556	Alitretinoin	Alitretinoin binds to RARG protein	9144408
D018943	Anthracyclines	RARG gene SNP results in increased susceptibility to Anthracyclines	26237429
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased degradation of and results in decreased expression of RARG protein	15688020
D001205	Ascorbic Acid	Ascorbic Acid results in decreased expression of RARG mRNA	21281732
D001397	Azoxymethane	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of RARG mRNA	29950665
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of RARG mRNA	18247414
D000077610	Bexarotene	Bexarotene binds to RARG protein	9144408
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of RARG mRNA	30951980
C006780	bisphenol A	bisphenol A results in decreased expression of RARG mRNA	25047013
C006780	bisphenol A	bisphenol A results in increased expression of RARG mRNA	29275510
C006780	bisphenol A	bisphenol A affects the methylation of RARG promoter	27334623
C006780	bisphenol A	bisphenol A results in increased expression of RARG mRNA	30951980
C006780	bisphenol A	bisphenol A results in increased expression of RARG mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased methylation of RARG gene	28505145
C000611646	bisphenol F	bisphenol F results in increased expression of RARG mRNA	30951980
C514178	BMS 961	BMS 961 binds to and results in increased activity of RARG protein	18703560
D019256	Cadmium Chloride	Cadmium Chloride affects the expression of RARG mRNA	18974090
D019256	Cadmium Chloride	Cadmium Chloride results in decreased methylation of RARG promoter	22457795
D002338	Carotenoids	Carotenoids results in increased expression of RARG mRNA	11237167
C099555	CD 437	CD 437 binds to and results in increased activity of RARG protein	16788091
C099555	CD 437	CD 437 results in increased expression of RARG mRNA	21548569
D002706	Chlordan	Chlordan binds to RARG protein	15589975
D002706	Chlordan	Chlordan inhibits the reaction [4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-anthracenyl)benzoic acid binds to RARG protein]	15589975
D002706	Chlordan	Chlordan results in increased expression of RARG mRNA	15589975
D002945	Cisplatin	Cisplatin results in increased expression of RARG mRNA	27392435
D003520	Cyclophosphamide	Cyclophosphamide results in decreased expression of RARG mRNA	27281708
D000077209	Decitabine	[Decitabine co-treated with Tretinoin] results in increased expression of RARG mRNA	19524134
D000077209	Decitabine	Decitabine results in increased expression of RARG mRNA	17908484
D016264	Dextran Sulfate	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of RARG mRNA	29950665
D004026	Dieldrin	Dieldrin results in increased expression of RARG mRNA	15589975
D013196	Dihydrotestosterone	Dihydrotestosterone results in increased expression of RARG mRNA	17023530
D004221	Disulfiram	Disulfiram results in decreased expression of RARG mRNA	20530235
D004317	Doxorubicin	Doxorubicin results in decreased expression of RARG mRNA	29803840
D004726	Endosulfan	Endosulfan results in increased expression of RARG mRNA	15589975
D004732	Endrin	Endrin results in increased expression of RARG mRNA	15589975
C017435	enilconazole	enilconazole results in increased activity of RARG protein	20143881
D004958	Estradiol	[Estradiol co-treated with TGFB1 protein] results in decreased expression of RARG mRNA	30165855
D000431	Ethanol	Ethanol results in increased expression of RARG mRNA	28986285
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of RARG mRNA	17555576
D000069438	Ezetimibe	Ezetimibe results in decreased expression of RARG mRNA	16177187
D017313	Fenretinide	Fenretinide results in decreased expression of RARG protein	15375546
C010974	glyphosate	glyphosate results in increased expression of RARG mRNA	25636363
D006118	Griseofulvin	Griseofulvin results in increased expression of RARG mRNA	9548566
C000593030	GSK-J4	GSK-J4 results in decreased expression of RARG mRNA	29301935
C104181	HX 600	HX 600 affects the reaction [Tretinoin binds to and results in increased activity of RARG protein]	9144408
D015474	Isotretinoin	Isotretinoin results in decreased expression of RARG mRNA	19041696
C095104	LG 100268	LG 100268 results in increased expression of RARG mRNA	30027469
D008694	Methamphetamine	Methamphetamine results in increased expression of RARG mRNA	29802913
D008694	Methamphetamine	Methamphetamine results in increased expression of RARG mRNA	26307267
D008731	Methoxychlor	Methoxychlor results in decreased expression of RARG mRNA	25048109
D008731	Methoxychlor	Methoxychlor results in increased expression of RARG mRNA	20829426
D015735	Mifepristone	Mifepristone results in decreased expression of RARG mRNA	17584828
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in decreased expression of RARG mRNA	25554681
D009538	Nicotine	Nicotine results in decreased expression of RARG mRNA	18247414
D009966	Orphenadrine	Orphenadrine affects the expression of RARG mRNA	23665939
D010672	Phenytoin	Phenytoin results in increased expression of RARG mRNA	9988880
D010795	Phthalic Acids	Phthalic Acids results in increased expression of RARG mRNA	22112501
C027373	potassium chromate(VI)	potassium chromate(VI) results in decreased expression of RARG mRNA	22714537
D011192	Potassium Dichromate	Potassium Dichromate results in decreased expression of RARG mRNA	23608068
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of RARG mRNA	24780913
C005266	quinomethionate	quinomethionate affects the expression of RARG mRNA	15387888
D011810	Quinoxalines	Quinoxalines binds to and results in increased activity of RARG protein	17076708
C009166	retinol acetate	retinol acetate results in increased expression of RARG	16022748
C084904	Ro 41-5253	Ro 41-5253 inhibits the reaction [[RARG protein co-treated with RXRA protein] results in increased expression of SLC10A1 mRNA]	25550158
C513635	S-2-pentyl-4-pentynoic hydroxamic acid	S-2-pentyl-4-pentynoic hydroxamic acid results in decreased expression of RARG mRNA	21427059
D012906	Smoke	Smoke results in decreased expression of RARG mRNA	21095227
C017947	sodium arsenite	sodium arsenite results in decreased expression of RARG mRNA	12377979
D000077210	Sunitinib	Sunitinib results in decreased expression of RARG mRNA	31533062
C446685	systhane	systhane results in increased expression of RARG mRNA	24962053
C061133	tamibarotene	tamibarotene affects the expression of RARG mRNA	7934625
C086827	tazarotene	tazarotene metabolite binds to and results in increased activity of RARG protein	16178010
C086827	tazarotene	tazarotene binds to and affects the activity of RARG protein	16954431
D013739	Testosterone	Testosterone results in decreased expression of RARG mRNA	16432891
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of RARG mRNA	15075337; 23152189;
D013749	Tetrachlorodibenzodioxin	RARG results in increased susceptibility to Tetrachlorodibenzodioxin	21807577
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of RARG mRNA	21570461
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of RARG mRNA	24058054
D013844	Thiazoles	Thiazoles binds to and results in increased activity of RARG protein	17076708
D013853	Thioacetamide	Thioacetamide results in increased expression of RARG mRNA	23411599
D013893	Thiram	Thiram results in decreased expression of RARG mRNA	20530235
C009495	titanium dioxide	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of RARG mRNA	29950665
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARG protein	16839186
D014212	Tretinoin	Tretinoin results in increased expression of RARG mRNA	20530235
D014212	Tretinoin	[Decitabine co-treated with Tretinoin] results in increased expression of RARG mRNA	19524134
D014212	Tretinoin	IFNG protein promotes the reaction [Tretinoin results in increased expression of RARG mRNA]	16007204
D014212	Tretinoin	RARG protein affects the susceptibility to Tretinoin	11340568
D014212	Tretinoin	RARG protein promotes the reaction [Tretinoin results in increased expression of VEGFA mRNA]	17170094
D014212	Tretinoin	RARG protein results in increased susceptibility to Tretinoin	16236281
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARG protein	15615532; 16788091;
D014212	Tretinoin	Tretinoin binds to RARG protein	1318502; 31195007;
D014212	Tretinoin	Tretinoin inhibits the reaction [RARG protein binds to FOLR2 promoter]	16740727
D014212	Tretinoin	Tretinoin promotes the reaction [MAPT protein affects the localization of [MAPT protein binds to RARG protein]]	16417947
D014212	Tretinoin	Tretinoin promotes the reaction [RARG protein binds to CD1D promoter]	17392484
D014212	Tretinoin	Tretinoin results in decreased expression of RARG protein	15375546; 19812349;
D014212	Tretinoin	Tretinoin results in increased activity of RARG protein	25492813
D014212	Tretinoin	Tretinoin results in increased expression of and results in increased activity of RARG protein	16158052
D014212	Tretinoin	Tretinoin results in increased expression of RARG mRNA	10866818; 16007204; 17134824; 20507312; 21393419; 22906706;
D014212	Tretinoin	trichostatin A promotes the reaction [Tretinoin inhibits the reaction [RARG protein binds to FOLR2 promoter]]	16740727
D014212	Tretinoin	RARG gene mutant form results in decreased susceptibility to Tretinoin	10748128
D014212	Tretinoin	Tretinoin affects the localization of RARG protein	16417947
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARG protein	12504905; 16839186;
D014212	Tretinoin	Tretinoin inhibits the reaction [RARG gene mutant form results in increased expression of ITGB1 mRNA]	10748128
D014212	Tretinoin	Tretinoin promotes the reaction [[RARG protein binds to RXRA protein] which binds to CYP26A1 promoter]	16053444
D014212	Tretinoin	Tretinoin results in decreased expression of RARG mRNA	16604517
D014212	Tretinoin	Tretinoin results in increased activity of RARG protein	12223961
D014212	Tretinoin	Tretinoin results in increased expression of RARG	7934625
D014212	Tretinoin	Tretinoin results in increased expression of RARG mRNA	11237167; 16291826;
D014212	Tretinoin	Tretinoin results in increased phosphorylation of RARG protein	12032135
D014212	Tretinoin	HX 600 affects the reaction [Tretinoin binds to and results in increased activity of RARG protein]	9144408
D014212	Tretinoin	Tretinoin binds to and results in increased activity of RARG protein	16819260; 9144408;
D014212	Tretinoin	[Tretinoin binds to and results in increased activity of RARG protein] which results in increased expression of TNFRSF10B mRNA	9144408
D014212	Tretinoin	Tretinoin binds to RARG protein	17387344
D014212	Tretinoin	Tretinoin results in increased activity of RARG protein	18398471
C032910	triadimefon	triadimefon results in increased expression of RARG mRNA	24962053
C011559	tributyltin	tributyltin results in increased expression of RARG mRNA	21683754
D014241	Trichloroethylene	Trichloroethylene results in increased methylation of RARG gene	27618143
C012589	trichostatin A	trichostatin A promotes the reaction [Tretinoin inhibits the reaction [RARG protein binds to FOLR2 promoter]]	16740727
C015559	trimellitic anhydride	trimellitic anhydride results in decreased expression of RARG mRNA	19042947
C016805	tris(1,3-dichloro-2-propyl)phosphate	tris(1,3-dichloro-2-propyl)phosphate results in decreased expression of RARG mRNA	26179874
C525131	UVI 3003	UVI 3003 results in decreased expression of RARG mRNA	27894914
D014635	Valproic Acid	Valproic Acid results in decreased expression of RARG mRNA	21427059
D014801	Vitamin A	Vitamin A results in increased expression of RARG mRNA	16571146
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in decreased expression of COL2A1 mRNA]	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in decreased expression of SOX9 mRNA]	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in increased expression of MEIS1 mRNA]	16397886
D014801	Vitamin A	RARG gene mutant form inhibits the reaction [[RARA gene mutant form co-treated with Vitamin A] results in increased expression of MEIS2 mRNA]	16397886

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0025	Alternative splicing
KW-0963	Cytoplasm
KW-0238	DNA-binding
KW-1017	Isopeptide bond
KW-0479	Metal-binding
KW-0488	Methylation
KW-0539	Nucleus
KW-0621	Polymorphism
KW-0675	Receptor
KW-1185	Reference proteome
KW-0804	Transcription
KW-0805	Transcription regulation
KW-0832	Ubl conjugation
KW-0862	Zinc
KW-0863	Zinc-finger

Interpro

InterPro ID	InterPro Term
IPR035500	NHR-like_dom_sf
IPR000536	Nucl_hrmn_rcpt_lig-bd
IPR001723	Nuclear_hrmn_rcpt
IPR003078	Retinoic_acid_rcpt
IPR001628	Znf_hrmn_rcpt
IPR013088	Znf_NHR/GATA

PROSITE

PROSITE ID	PROSITE Term
PS51843	NR_LBD
PS00031	NUCLEAR_REC_DBD_1
PS51030	NUCLEAR_REC_DBD_2

Pfam

Pfam ID	Pfam Term
PF00104	Hormone_recep
PF00105	zf-C4

Gene: RARG

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction