CleftGeneDB-Search

Gene: KRT5

Basic information

Tag	Content
Uniprot ID	P13647; Q6PI71; Q6UBJ0; Q8TA91;
Entrez ID	3852
Genbank protein ID	AAQ81588.1; AAH71906.1; AAA36143.1; AAH42132.1; AAA36145.1; AAH24292.1; AAF97931.1;
Genbank nucleotide ID	NM_000424.3
Ensembl protein ID	ENSP00000252242
Ensembl nucleotide ID	ENSG00000186081
Gene name	Keratin, type II cytoskeletal 5
Gene symbol	KRT5
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description
Sequence	MSRQSSVSFR SGGSRSFSTA SAITPSVSRT SFTSVSRSGG GGGGGFGRVS LAGACGVGGY 60 GSRSLYNLGG SKRISISTSG GSFRNRFGAG AGGGYGFGGG AGSGFGFGGG AGGGFGLGGG 120 AGFGGGFGGP GFPVCPPGGI QEVTVNQSLL TPLNLQIDPS IQRVRTEERE QIKTLNNKFA 180 SFIDKVRFLE QQNKVLDTKW TLLQEQGTKT VRQNLEPLFE QYINNLRRQL DSIVGERGRL 240 DSELRNMQDL VEDFKNKYED EINKRTTAEN EFVMLKKDVD AAYMNKVELE AKVDALMDEI 300 NFMKMFFDAE LSQMQTHVSD TSVVLSMDNN RNLDLDSIIA EVKAQYEEIA NRSRTEAESW 360 YQTKYEELQQ TAGRHGDDLR NTKHEISEMN RMIQRLRAEI DNVKKQCANL QNAIADAEQR 420 GELALKDARN KLAELEEALQ KAKQDMARLL REYQELMNTK LALDVEIATY RKLLEGEECR 480 LSGEGVGPVN ISVVTSSVSS GYGSGSGYGG GLGGGLGGGL GGGLAGGSSG SYYSSSSGGV 540 GLGGGLSVGG SGFSASSGRG LGVGFGSGGG SSSSVKFVST TSSSRKSFKS

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
3TNU
6JFV

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	KRT5		A5D7M6		Bos taurus	Prediction	More>>
1:1 ortholog	KRT5		A0A452DMF8		Capra hircus	Prediction	More>>
1:1 ortholog	KRT5	3852	P13647		Homo sapiens	Prediction	More>>
1:1 ortholog	Krt5	110308	Q922U2	CPO	Mus musculus	Publication	More>>
1:1 ortholog	KRT5	100352658	G1TDN6		Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Krt5		F7FFV2		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
RCV000056584	p.Met1Thr	missense variant	-	NC_000012.12:g.52520295A>G	ClinVar
RCV000484793	p.Met1Val	missense variant	-	NC_000012.12:g.52520296T>C	ClinVar
rs770091254	p.Arg3His	missense variant	-	NC_000012.12:g.52520289C>T	ExAC,TOPMed,gnomAD
rs200156424	p.Arg3Cys	missense variant	-	NC_000012.12:g.52520290G>A	ExAC,TOPMed,gnomAD
rs267607455	p.Gln4Ter	stop gained	-	NC_000012.12:g.52520287G>A	-
rs1473238308	p.Gln4Pro	missense variant	-	NC_000012.12:g.52520286T>G	TOPMed,gnomAD
RCV000056543	p.Gln4Ter	nonsense	-	NC_000012.12:g.52520287G>A	ClinVar
RCV000015753	p.Ser5Ter	nonsense	Dowling-Degos disease 1	NC_000012.12:g.52520283G>T	ClinVar
rs58751565	p.Ser5Leu	missense variant	-	NC_000012.12:g.52520283G>A	ExAC,gnomAD
rs58751565	p.Ser5Ter	stop gained	-	NC_000012.12:g.52520283G>T	ExAC,gnomAD
rs1267266121	p.Ser5Pro	missense variant	-	NC_000012.12:g.52520284A>G	gnomAD
rs121912474	p.Val7Ala	missense variant	-	NC_000012.12:g.52520277A>G	TOPMed
rs121912474	p.Val7Glu	missense variant	-	NC_000012.12:g.52520277A>T	TOPMed
RCV000015752	p.Val7Ala	missense variant	Epidermolysis bullosa simplex, Koebner type	NC_000012.12:g.52520277A>G	ClinVar
rs913174272	p.Ser8Phe	missense variant	-	NC_000012.12:g.52520274G>A	gnomAD
rs367853808	p.Phe9Leu	missense variant	-	NC_000012.12:g.52520270G>C	ESP,ExAC
rs148526538	p.Arg10Trp	missense variant	-	NC_000012.12:g.52520269G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs148526538	p.Arg10Gly	missense variant	-	NC_000012.12:g.52520269G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs753298083	p.Arg10Gln	missense variant	-	NC_000012.12:g.52520268C>T	ExAC,TOPMed,gnomAD
rs750089477	p.Ser11Asn	missense variant	-	NC_000012.12:g.52520265C>T	ExAC,gnomAD
rs755664811	p.Ser11Gly	missense variant	-	NC_000012.12:g.52520266T>C	ExAC,gnomAD
rs751876144	p.Gly12Trp	missense variant	-	NC_000012.12:g.52520263C>A	ExAC,TOPMed,gnomAD
rs751876144	p.Gly12Arg	missense variant	-	NC_000012.12:g.52520263C>T	ExAC,TOPMed,gnomAD
rs1367644026	p.Gly13Val	missense variant	-	NC_000012.12:g.52520259C>A	TOPMed,gnomAD
rs1367644026	p.Gly13Asp	missense variant	-	NC_000012.12:g.52520259C>T	TOPMed,gnomAD
COSM5200365	p.Ser14GlnPheSerTerUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.52520258_52520259insC	NCI-TCGA Cosmic
rs372305341	p.Arg15Leu	missense variant	-	NC_000012.12:g.52520253C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs374322915	p.Arg15Cys	missense variant	-	NC_000012.12:g.52520254G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs372305341	p.Arg15His	missense variant	-	NC_000012.12:g.52520253C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs769963375	p.Thr19Ala	missense variant	-	NC_000012.12:g.52520242T>C	ExAC,gnomAD
rs1458034065	p.Thr19Ile	missense variant	-	NC_000012.12:g.52520241G>A	gnomAD
rs776895650	p.Ala20Thr	missense variant	-	NC_000012.12:g.52520239C>T	ExAC,TOPMed,gnomAD
rs368584130	p.Ser21Phe	missense variant	-	NC_000012.12:g.52520235G>A	ESP,ExAC,gnomAD
rs368584130	p.Ser21Tyr	missense variant	-	NC_000012.12:g.52520235G>T	ESP,ExAC,gnomAD
rs374462183	p.Ala22Gly	missense variant	-	NC_000012.12:g.52520232G>C	ESP,ExAC,TOPMed,gnomAD
rs1463762295	p.Ile23Val	missense variant	-	NC_000012.12:g.52520230T>C	gnomAD
rs768490644	p.Thr24Asn	missense variant	-	NC_000012.12:g.52520226G>T	ExAC,TOPMed,gnomAD
rs768490644	p.Thr24Ser	missense variant	-	NC_000012.12:g.52520226G>C	ExAC,TOPMed,gnomAD
RCV000015754	p.Pro25Leu	missense variant	Epidermolysis bullosa simplex with mottled pigmentation (EBSMP)	NC_000012.12:g.52520223G>A	ClinVar
rs57499817	p.Pro25Leu	missense variant	Epidermolysis bullosa simplex, with mottled pigmentation (MP-EBS)	NC_000012.12:g.52520223G>A	UniProt,dbSNP
VAR_010453	p.Pro25Leu	missense variant	Epidermolysis bullosa simplex, with mottled pigmentation (MP-EBS)	NC_000012.12:g.52520223G>A	UniProt
COSM3462325	p.Pro25Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52520224G>A	NCI-TCGA Cosmic
COSM694194	p.Ser26Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52520220G>A	NCI-TCGA Cosmic
rs1235374200	p.Val27Ile	missense variant	-	NC_000012.12:g.52520218C>T	gnomAD
rs1312675397	p.Ser28Phe	missense variant	-	NC_000012.12:g.52520214G>A	gnomAD
rs543574061	p.Arg29His	missense variant	-	NC_000012.12:g.52520211C>T	1000Genomes,ExAC,gnomAD
rs1274640779	p.Arg29Cys	missense variant	-	NC_000012.12:g.52520212G>A	TOPMed,gnomAD
rs543574061	p.Arg29Leu	missense variant	-	NC_000012.12:g.52520211C>A	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Ser31ProPheSerTerUnkUnkUnk	frameshift	-	NC_000012.12:g.52520207_52520208insGT	NCI-TCGA
rs1366922155	p.Thr33Asn	missense variant	-	NC_000012.12:g.52520199G>T	gnomAD
NCI-TCGA novel	p.Val35ProPheSerTerUnkUnkUnk	frameshift	-	NC_000012.12:g.52520194_52520195insGG	NCI-TCGA
rs374017172	p.Val35Met	missense variant	-	NC_000012.12:g.52520194C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000307467	p.Arg37Gln	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52520187C>T	ClinVar
rs61747181	p.Arg37Gln	missense variant	-	NC_000012.12:g.52520187C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs370714132	p.Arg37Trp	missense variant	-	NC_000012.12:g.52520188G>A	ESP,ExAC,TOPMed,gnomAD
rs61747181	p.Arg37Leu	missense variant	-	NC_000012.12:g.52520187C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1168120051	p.Ser38Phe	missense variant	-	NC_000012.12:g.52520184G>A	gnomAD
rs541279700	p.Ser38Ala	missense variant	-	NC_000012.12:g.52520185A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs146136560	p.Gly39Arg	missense variant	-	NC_000012.12:g.52520182C>T	ESP,ExAC,TOPMed,gnomAD
COSM3462324	p.Gly39Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52520181C>G	NCI-TCGA Cosmic
rs146136560	p.Gly39Trp	missense variant	-	NC_000012.12:g.52520182C>A	ESP,ExAC,TOPMed,gnomAD
RCV000268669	p.Gly39Arg	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52520182C>T	ClinVar
rs773464963	p.Gly39Val	missense variant	-	NC_000012.12:g.52520181C>A	ExAC,TOPMed,gnomAD
rs749140215	p.Gly40Asp	missense variant	-	NC_000012.12:g.52520178C>T	ExAC,gnomAD
rs749140215	p.Gly40Val	missense variant	-	NC_000012.12:g.52520178C>A	ExAC,gnomAD
rs1170652770	p.Gly41Asp	missense variant	-	NC_000012.12:g.52520175C>T	gnomAD
rs775353075	p.Gly41Ser	missense variant	-	NC_000012.12:g.52520176C>T	ExAC,gnomAD
rs201264698	p.Gly42Ser	missense variant	-	NC_000012.12:g.52520173C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs375759050	p.Gly44Val	missense variant	-	NC_000012.12:g.52520166C>A	ExAC,TOPMed,gnomAD
rs756838467	p.Gly45Ser	missense variant	-	NC_000012.12:g.52520164C>T	ExAC,gnomAD
rs777631293	p.Phe46Ile	missense variant	-	NC_000012.12:g.52520161A>T	ExAC,TOPMed,gnomAD
rs144480716	p.Gly47Ser	missense variant	-	NC_000012.12:g.52520158C>T	ESP,ExAC,TOPMed,gnomAD
rs61747180	p.Arg48Gly	missense variant	-	NC_000012.12:g.52520155T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1403548834	p.Arg48Lys	missense variant	-	NC_000012.12:g.52520154C>T	TOPMed,gnomAD
rs760876234	p.Val49Gly	missense variant	-	NC_000012.12:g.52520151A>C	ExAC,gnomAD
rs199505033	p.Ser50Thr	missense variant	-	NC_000012.12:g.52520148C>G	TOPMed
rs773410009	p.Ala52Val	missense variant	-	NC_000012.12:g.52520142G>A	ExAC,TOPMed,gnomAD
rs556992218	p.Gly53Asp	missense variant	-	NC_000012.12:g.52520139C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1366927682	p.Ala54Thr	missense variant	-	NC_000012.12:g.52520137C>T	TOPMed,gnomAD
rs769725141	p.Gly59Val	missense variant	-	NC_000012.12:g.52520121C>A	ExAC,gnomAD
COSM4923633	p.Tyr60Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52520119A>T	NCI-TCGA Cosmic
rs745773711	p.Ser62Arg	missense variant	-	NC_000012.12:g.52520111G>C	ExAC,gnomAD
rs375273687	p.Arg63Gln	missense variant	-	NC_000012.12:g.52520109C>T	ESP,ExAC,TOPMed,gnomAD
rs776667863	p.Arg63Trp	missense variant	-	NC_000012.12:g.52520110G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu65Ile	missense variant	-	NC_000012.12:g.52520104G>T	NCI-TCGA
rs1007089956	p.Asn67Ser	missense variant	-	NC_000012.12:g.52520097T>C	TOPMed
NCI-TCGA novel	p.Leu68Met	missense variant	-	NC_000012.12:g.52520095G>T	NCI-TCGA
rs1374537032	p.Gly69Glu	missense variant	-	NC_000012.12:g.52520091C>T	TOPMed
rs540081758	p.Gly70Ala	missense variant	-	NC_000012.12:g.52520088C>G	ExAC,TOPMed,gnomAD
rs540081758	p.Gly70Asp	missense variant	-	NC_000012.12:g.52520088C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly70AlaPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52520088C>-	NCI-TCGA
rs540081758	p.Gly70Val	missense variant	-	NC_000012.12:g.52520088C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser71LeuPheSerTerUnk	frameshift	-	NC_000012.12:g.52520087_52520088insC	NCI-TCGA
rs1285526841	p.Arg73Thr	missense variant	-	NC_000012.12:g.52520079C>G	gnomAD
rs1463063008	p.Ile74Thr	missense variant	-	NC_000012.12:g.52520076A>G	TOPMed
rs779166505	p.Ile74Leu	missense variant	-	NC_000012.12:g.52520077T>A	ExAC,gnomAD
rs779166505	p.Ile74Val	missense variant	-	NC_000012.12:g.52520077T>C	ExAC,gnomAD
rs1283483642	p.Ser75Pro	missense variant	-	NC_000012.12:g.52520074A>G	TOPMed,gnomAD
rs755413229	p.Ser75Tyr	missense variant	-	NC_000012.12:g.52520073G>T	ExAC,TOPMed,gnomAD
rs1288077456	p.Ile76Ser	missense variant	-	NC_000012.12:g.52520070A>C	gnomAD
NCI-TCGA novel	p.Ser77IlePheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52520067_52520068insATCAA	NCI-TCGA
rs754297557	p.Thr78Ser	missense variant	-	NC_000012.12:g.52520064G>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser79Ile	missense variant	-	NC_000012.12:g.52520061C>A	NCI-TCGA
rs1065115	p.Ser79Arg	missense variant	-	NC_000012.12:g.52520060A>T	-
rs1065115	p.Ser79Arg	missense variant	-	NC_000012.12:g.52520060A>T	UniProt,dbSNP
VAR_028763	p.Ser79Arg	missense variant	-	NC_000012.12:g.52520060A>T	UniProt
RCV000056582	p.Ser79Arg	missense variant	-	NC_000012.12:g.52520060A>T	ClinVar
rs1372929067	p.Phe83Leu	missense variant	-	NC_000012.12:g.52520050A>G	TOPMed,gnomAD
rs756129437	p.Asn85Ser	missense variant	-	NC_000012.12:g.52520043T>C	ExAC,TOPMed,gnomAD
rs762047842	p.Arg86Gln	missense variant	-	NC_000012.12:g.52520040C>T	ExAC,TOPMed,gnomAD
rs762047842	p.Arg86Pro	missense variant	-	NC_000012.12:g.52520040C>G	ExAC,TOPMed,gnomAD
rs373163099	p.Arg86Trp	missense variant	-	NC_000012.12:g.52520041G>A	ESP,ExAC,TOPMed,gnomAD
RCV000348479	p.Phe87Val	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52520038A>C	ClinVar
rs61747188	p.Phe87Val	missense variant	-	NC_000012.12:g.52520038A>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs375333850	p.Phe87Ser	missense variant	-	NC_000012.12:g.52520037A>G	ESP,ExAC,gnomAD
rs770910564	p.Gly88Cys	missense variant	-	NC_000012.12:g.52520035C>A	ExAC,TOPMed,gnomAD
rs770910564	p.Gly88Ser	missense variant	-	NC_000012.12:g.52520035C>T	ExAC,TOPMed,gnomAD
rs1207950244	p.Ala89Ser	missense variant	-	NC_000012.12:g.52520032C>A	TOPMed
rs1252446552	p.Ala89Val	missense variant	-	NC_000012.12:g.52520031G>A	gnomAD
rs142778320	p.Ala91Thr	missense variant	-	NC_000012.12:g.52520026C>T	ESP,ExAC,TOPMed,gnomAD
rs1428870322	p.Gly92Arg	missense variant	-	NC_000012.12:g.52520023C>T	TOPMed
rs1415918495	p.Gly93Ser	missense variant	-	NC_000012.12:g.52520020C>T	gnomAD
rs778696476	p.Gly94Asp	missense variant	-	NC_000012.12:g.52520016C>T	ExAC,TOPMed,gnomAD
rs138806570	p.Gly94Ser	missense variant	-	NC_000012.12:g.52520017C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1267955312	p.Tyr95Cys	missense variant	-	NC_000012.12:g.52520013T>C	gnomAD
rs768890570	p.Gly96Asp	missense variant	-	NC_000012.12:g.52520010C>T	ExAC,gnomAD
rs534913364	p.Gly98Val	missense variant	-	NC_000012.12:g.52520004C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs534913364	p.Gly98Glu	missense variant	-	NC_000012.12:g.52520004C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs780359251	p.Gly100Asp	missense variant	-	NC_000012.12:g.52519998C>T	ExAC,TOPMed,gnomAD
rs372204272	p.Ala101Thr	missense variant	-	NC_000012.12:g.52519996C>T	ESP,ExAC,TOPMed,gnomAD
rs1325571536	p.Ala101Asp	missense variant	-	NC_000012.12:g.52519995G>T	gnomAD
rs539432563	p.Gly102Ser	missense variant	-	NC_000012.12:g.52519993C>T	ExAC,TOPMed,gnomAD
rs757370875	p.Gly104Glu	missense variant	-	NC_000012.12:g.52519986C>T	ExAC,gnomAD
COSM3462323	p.Gly104Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519987C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe107Leu	missense variant	-	NC_000012.12:g.52519978A>G	NCI-TCGA
rs1237453275	p.Phe107Tyr	missense variant	-	NC_000012.12:g.52519977A>T	gnomAD
rs146022149	p.Gly108Ser	missense variant	-	NC_000012.12:g.52519975C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs146022149	p.Gly108Arg	missense variant	-	NC_000012.12:g.52519975C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs764430671	p.Gly108Asp	missense variant	-	NC_000012.12:g.52519974C>T	ExAC,gnomAD
rs766378801	p.Gly109Val	missense variant	-	NC_000012.12:g.52519971C>A	ExAC,gnomAD
rs753671394	p.Gly109Ser	missense variant	-	NC_000012.12:g.52519972C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala111Asp	missense variant	-	NC_000012.12:g.52519965G>T	NCI-TCGA
rs1245745607	p.Ala111Ser	missense variant	-	NC_000012.12:g.52519966C>A	gnomAD
rs760710214	p.Gly112Val	missense variant	-	NC_000012.12:g.52519962C>A	ExAC,gnomAD
rs1262403815	p.Phe115Ser	missense variant	-	NC_000012.12:g.52519953A>G	TOPMed
rs549383569	p.Gly116Glu	missense variant	-	NC_000012.12:g.52519950C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1219197486	p.Leu117Phe	missense variant	-	NC_000012.12:g.52519948G>A	TOPMed,gnomAD
rs1219197486	p.Leu117Ile	missense variant	-	NC_000012.12:g.52519948G>T	TOPMed,gnomAD
rs761445270	p.Leu117Arg	missense variant	-	NC_000012.12:g.52519947A>C	ExAC,gnomAD
RCV000405206	p.Gly118Ser	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52519945C>T	ClinVar
NCI-TCGA novel	p.Gly118Asp	missense variant	-	NC_000012.12:g.52519944C>T	NCI-TCGA
rs368543262	p.Gly118Arg	missense variant	-	NC_000012.12:g.52519945C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs368543262	p.Gly118Ser	missense variant	-	NC_000012.12:g.52519945C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs200116437	p.Gly120Arg	missense variant	-	NC_000012.12:g.52519939C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1345528074	p.Gly122Asp	missense variant	-	NC_000012.12:g.52519932C>T	gnomAD
rs781712315	p.Gly122Ser	missense variant	-	NC_000012.12:g.52519933C>T	ExAC,gnomAD
rs150390099	p.Phe127Leu	missense variant	-	NC_000012.12:g.52519916G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000278442	p.Phe127Leu	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52519916G>T	ClinVar
rs267607657	p.Gly128Ser	missense variant	-	NC_000012.12:g.52519915C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs267607657	p.Gly128Arg	missense variant	-	NC_000012.12:g.52519915C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000056585	p.Gly128Arg	missense variant	-	NC_000012.12:g.52519915C>G	ClinVar
rs758678109	p.Gly129Val	missense variant	-	NC_000012.12:g.52519911C>A	ExAC,TOPMed,gnomAD
rs1393784742	p.Pro130Leu	missense variant	-	NC_000012.12:g.52519908G>A	TOPMed
COSM3462322	p.Pro133Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519900G>A	NCI-TCGA Cosmic
rs1465043680	p.Pro136Ala	missense variant	-	NC_000012.12:g.52519891G>C	gnomAD
NCI-TCGA novel	p.Pro136ArgPheSerTerUnk	frameshift	-	NC_000012.12:g.52519858_52519891GGTTGACAGTGACCTCTTGGATACCTCCAGGAGG>-	NCI-TCGA
NCI-TCGA novel	p.Pro136Leu	missense variant	-	NC_000012.12:g.52519890G>A	NCI-TCGA
rs756012140	p.Pro137Ser	missense variant	-	NC_000012.12:g.52519888G>A	ExAC,TOPMed,gnomAD
rs756012140	p.Pro137Ala	missense variant	-	NC_000012.12:g.52519888G>C	ExAC,TOPMed,gnomAD
rs11170164	p.Gly138Glu	missense variant	-	NC_000012.12:g.52519884C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000056586	p.Gly138Glu	missense variant	-	NC_000012.12:g.52519884C>T	ClinVar
COSM3462321	p.Gly139Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519882C>T	NCI-TCGA Cosmic
rs759981510	p.Gly139Asp	missense variant	-	NC_000012.12:g.52519881C>T	TOPMed,gnomAD
RCV000015762	p.Ile140Ter	frameshift	Dowling-Degos disease 1	NC_000012.12:g.52519879dup	ClinVar
RCV000056587	p.Ile140Ter	frameshift	-	NC_000012.12:g.52519879dup	ClinVar
rs1349743696	p.Glu142Ala	missense variant	-	NC_000012.12:g.52519872T>G	TOPMed
rs776798169	p.Glu142Gln	missense variant	-	NC_000012.12:g.52519873C>G	gnomAD
rs59851104	p.Val143Ala	missense variant	-	NC_000012.12:g.52519869A>G	-
rs267607439	p.Val143Phe	missense variant	-	NC_000012.12:g.52519870C>A	-
RCV000056589	p.Val143Asp	missense variant	-	NC_000012.12:g.52519869A>T	ClinVar
RCV000056590	p.Val143Ala	missense variant	-	NC_000012.12:g.52519869A>G	ClinVar
rs59851104	p.Val143Asp	missense variant	-	NC_000012.12:g.52519869A>T	-
RCV000056588	p.Val143Phe	missense variant	-	NC_000012.12:g.52519870C>A	ClinVar
rs891300273	p.Thr144Ala	missense variant	-	NC_000012.12:g.52519867T>C	TOPMed
rs1235137513	p.Thr144Ser	missense variant	-	NC_000012.12:g.52519866G>C	gnomAD
NCI-TCGA novel	p.Val145Ala	missense variant	-	NC_000012.12:g.52519863A>G	NCI-TCGA
RCV000657959	p.Val145Asp	missense variant	-	NC_000012.12:g.52519863A>T	ClinVar
rs1555156480	p.Val145Asp	missense variant	-	NC_000012.12:g.52519863A>T	-
rs1398442332	p.Gln147Lys	missense variant	-	NC_000012.12:g.52519858G>T	gnomAD
NCI-TCGA novel	p.Ser148Asn	missense variant	-	NC_000012.12:g.52519854C>T	NCI-TCGA
RCV000056592	p.Leu149Pro	missense variant	-	NC_000012.12:g.52519851A>G	ClinVar
RCV000056591	p.Leu149Ter	frameshift	-	NC_000012.12:g.52519854_52519855CT[1]	ClinVar
COSM177294	p.Leu149Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519852G>T	NCI-TCGA Cosmic
rs267607449	p.Leu149Pro	missense variant	-	NC_000012.12:g.52519851A>G	-
RCV000056593	p.Leu150Pro	missense variant	-	NC_000012.12:g.52519848A>G	ClinVar
rs62635291	p.Leu150Pro	missense variant	-	NC_000012.12:g.52519848A>G	-
RCV000056594	p.Thr151Pro	missense variant	-	NC_000012.12:g.52519846T>G	ClinVar
rs267607450	p.Thr151Pro	missense variant	-	NC_000012.12:g.52519846T>G	-
rs761161855	p.Pro152Thr	missense variant	-	NC_000012.12:g.52519843G>T	ExAC,gnomAD
COSM3462320	p.Pro152Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519843G>A	NCI-TCGA Cosmic
RCV000056595	p.Pro152Leu	missense variant	-	NC_000012.12:g.52519842G>A	ClinVar
rs60617604	p.Pro152Leu	missense variant	-	NC_000012.12:g.52519842G>A	-
rs1230945384	p.Leu153Pro	missense variant	-	NC_000012.12:g.52519839A>G	gnomAD
rs1283445616	p.Leu155Met	missense variant	-	NC_000012.12:g.52519834G>T	TOPMed,gnomAD
rs1180564454	p.Gln156His	missense variant	-	NC_000012.12:g.52519829T>G	TOPMed,gnomAD
RCV000056596	p.Asp158Val	missense variant	-	NC_000012.12:g.52519824T>A	ClinVar
RCV000435783	p.Asp158Tyr	missense variant	-	NC_000012.12:g.52519825C>A	ClinVar
rs763608512	p.Asp158Asn	missense variant	-	NC_000012.12:g.52519825C>T	ExAC,gnomAD
rs763608512	p.Asp158Tyr	missense variant	-	NC_000012.12:g.52519825C>A	ExAC,gnomAD
rs61222761	p.Asp158Val	missense variant	-	NC_000012.12:g.52519824T>A	-
rs1244115077	p.Asp158Glu	missense variant	-	NC_000012.12:g.52519823G>T	gnomAD
rs1177284228	p.Ser160Gly	missense variant	-	NC_000012.12:g.52519819T>C	TOPMed
RCV000489360	p.Ile161Asn	missense variant	-	NC_000012.12:g.52519815A>T	ClinVar
rs58058996	p.Ile161Ser	missense variant	-	NC_000012.12:g.52519815A>C	-
RCV000015746	p.Ile161Ser	missense variant	Epidermolysis bullosa simplex, Cockayne-Touraine type	NC_000012.12:g.52519815A>C	ClinVar
RCV000056597	p.Ile161Ser	missense variant	-	NC_000012.12:g.52519815A>C	ClinVar
rs1368209148	p.Ile161Phe	missense variant	-	NC_000012.12:g.52519816T>A	gnomAD
rs58058996	p.Ile161Asn	missense variant	-	NC_000012.12:g.52519815A>T	-
COSM3462319	p.Gln162Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.52519813G>A	NCI-TCGA Cosmic
rs762648653	p.Gln162His	missense variant	-	NC_000012.12:g.52519811C>A	ExAC,gnomAD
rs267607436	p.Arg163Ser	missense variant	-	NC_000012.12:g.52519808C>A	TOPMed
RCV000056598	p.Arg163Ser	missense variant	-	NC_000012.12:g.52519808C>A	ClinVar
RCV000056599	p.Arg165Ser	missense variant	-	NC_000012.12:g.52519802C>A	ClinVar
rs267607456	p.Arg165Ser	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519802C>A	UniProt,dbSNP
VAR_071630	p.Arg165Ser	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519802C>A	UniProt
rs267607456	p.Arg165Ser	missense variant	-	NC_000012.12:g.52519802C>G	-
RCV000497581	p.Arg165Ser	missense variant	-	NC_000012.12:g.52519802C>G	ClinVar
RCV000056600	p.Glu167Lys	missense variant	-	NC_000012.12:g.52519798C>T	ClinVar
rs57378129	p.Glu167Lys	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52519798C>T	UniProt,dbSNP
VAR_026536	p.Glu167Lys	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52519798C>T	UniProt
rs57378129	p.Glu167Lys	missense variant	-	NC_000012.12:g.52519798C>T	ExAC,gnomAD
rs57378129	p.Glu167Gln	missense variant	-	NC_000012.12:g.52519798C>G	ExAC,gnomAD
RCV000056601	p.Glu168Lys	missense variant	-	NC_000012.12:g.52519795C>T	ClinVar
rs58619430	p.Glu168Lys	missense variant	-	NC_000012.12:g.52519795C>T	-
RCV000056602	p.Arg169Pro	missense variant	-	NC_000012.12:g.52519791C>G	ClinVar
rs60720877	p.Arg169His	missense variant	-	NC_000012.12:g.52519791C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs746285968	p.Arg169Cys	missense variant	-	NC_000012.12:g.52519792G>A	ExAC,TOPMed,gnomAD
rs60720877	p.Arg169Pro	missense variant	-	NC_000012.12:g.52519791C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs60720877	p.Arg169Pro	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519791C>G	UniProt,dbSNP
VAR_027723	p.Arg169Pro	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519791C>G	UniProt
rs746285968	p.Arg169Ser	missense variant	-	NC_000012.12:g.52519792G>T	ExAC,TOPMed,gnomAD
rs57408864	p.Glu170Gly	missense variant	-	NC_000012.12:g.52519788T>C	gnomAD
RCV000015763	p.Glu170Lys	missense variant	Epidermolysis bullosa simplex, autosomal recessive (EBSB1)	NC_000012.12:g.52519789C>T	ClinVar
RCV000015764	p.Glu170Lys	missense variant	Epidermolysis bullosa simplex, Cockayne-Touraine type	NC_000012.12:g.52519789C>T	ClinVar
RCV000056603	p.Glu170Lys	missense variant	-	NC_000012.12:g.52519789C>T	ClinVar
RCV000056604	p.Glu170Gly	missense variant	-	NC_000012.12:g.52519788T>C	ClinVar
rs57408864	p.Glu170Val	missense variant	-	NC_000012.12:g.52519788T>A	gnomAD
rs59115483	p.Glu170Lys	missense variant	-	NC_000012.12:g.52519789C>T	ExAC,TOPMed,gnomAD
rs59115483	p.Glu170Lys	missense variant	Epidermolysis bullosa simplex, autosomal recessive 1 (EBSB1)	NC_000012.12:g.52519789C>T	UniProt,dbSNP
VAR_026537	p.Glu170Lys	missense variant	Epidermolysis bullosa simplex, autosomal recessive 1 (EBSB1)	NC_000012.12:g.52519789C>T	UniProt
rs573548957	p.Gln171Glu	missense variant	-	NC_000012.12:g.52519786G>C	1000Genomes,ExAC,gnomAD
rs573548957	p.Gln171Lys	missense variant	-	NC_000012.12:g.52519786G>T	1000Genomes,ExAC,gnomAD
RCV000056606	p.Ile172Val	missense variant	-	NC_000012.12:g.52519783T>C	ClinVar
rs267607445	p.Ile172Val	missense variant	-	NC_000012.12:g.52519783T>C	-
RCV000056607	p.Lys173Asn	missense variant	-	NC_000012.12:g.52519778C>G	ClinVar
rs1308300982	p.Thr174Ile	missense variant	-	NC_000012.12:g.52519776G>A	TOPMed,gnomAD
rs57890479	p.Leu175Phe	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519774G>A	UniProt,dbSNP
VAR_010456	p.Leu175Phe	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519774G>A	UniProt
RCV000015751	p.Leu175Phe	missense variant	Epidermolysis bullosa herpetiformis, Dowling-Meara (EBSDM)	NC_000012.12:g.52519774G>A	ClinVar
RCV000056609	p.Asn176Ser	missense variant	-	NC_000012.12:g.52519770T>C	ClinVar
rs59092197	p.Asn176Ser	missense variant	-	NC_000012.12:g.52519770T>C	-
RCV000056610	p.Asn177Ser	missense variant	-	NC_000012.12:g.52519767T>C	ClinVar
rs61495052	p.Asn177Ser	missense variant	-	NC_000012.12:g.52519767T>C	-
RCV000056612	p.Phe179Ser	missense variant	-	NC_000012.12:g.52519761A>G	ClinVar
rs57781042	p.Phe179Ser	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519761A>G	UniProt,dbSNP
VAR_010458	p.Phe179Ser	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519761A>G	UniProt
rs57781042	p.Phe179Ser	missense variant	-	NC_000012.12:g.52519761A>G	-
rs267607451	p.Ala180Pro	missense variant	-	NC_000012.12:g.52519759C>G	-
rs58480900	p.Ala180Asp	missense variant	-	NC_000012.12:g.52519758G>T	-
RCV000056614	p.Ala180Asp	missense variant	-	NC_000012.12:g.52519758G>T	ClinVar
RCV000056613	p.Ala180Pro	missense variant	-	NC_000012.12:g.52519759C>G	ClinVar
RCV000056615	p.Ser181Pro	missense variant	-	NC_000012.12:g.52519756A>G	ClinVar
rs60715293	p.Ser181Pro	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519756A>G	UniProt,dbSNP
VAR_010459	p.Ser181Pro	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52519756A>G	UniProt
rs1348541655	p.Phe182Leu	missense variant	-	NC_000012.12:g.52519753A>G	gnomAD
RCV000056620	p.Ile183Met	missense variant	-	NC_000012.12:g.52519748G>C	ClinVar
RCV000056619	p.Ile183Thr	missense variant	-	NC_000012.12:g.52519749A>G	ClinVar
RCV000056616	p.Ile183Val	missense variant	-	NC_000012.12:g.52519750T>C	ClinVar
RCV000056617	p.Ile183Phe	missense variant	-	NC_000012.12:g.52519750T>A	ClinVar
rs58577926	p.Ile183Phe	missense variant	-	NC_000012.12:g.52519750T>A	-
rs267607661	p.Ile183Thr	missense variant	-	NC_000012.12:g.52519749A>G	-
rs267607443	p.Ile183Met	missense variant	-	NC_000012.12:g.52519748G>C	1000Genomes,ESP,ExAC,gnomAD
rs58577926	p.Ile183Val	missense variant	-	NC_000012.12:g.52519750T>C	-
rs751505210	p.Asp184Asn	missense variant	-	NC_000012.12:g.52519747C>T	ExAC,gnomAD
RCV000056626	p.Val186Glu	missense variant	-	NC_000012.12:g.52519159A>T	ClinVar
rs267607457	p.Val186Glu	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52519159A>T	UniProt,dbSNP
VAR_071631	p.Val186Glu	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52519159A>T	UniProt
rs267607457	p.Val186Glu	missense variant	-	NC_000012.12:g.52519159A>T	-
RCV000056624	p.Val186Met	missense variant	-	NC_000012.12:g.52519160C>T	ClinVar
rs121912475	p.Val186Leu	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52519160C>A	UniProt,dbSNP
VAR_013829	p.Val186Leu	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52519160C>A	UniProt
rs121912475	p.Val186Leu	missense variant	-	NC_000012.12:g.52519160C>A	-
rs121912475	p.Val186Met	missense variant	-	NC_000012.12:g.52519160C>T	-
rs121912475	p.Val186Met	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52519160C>T	UniProt,dbSNP
VAR_031642	p.Val186Met	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52519160C>T	UniProt
RCV000015758	p.Val186Leu	missense variant	Epidermolysis bullosa simplex, Koebner type	NC_000012.12:g.52519160C>A	ClinVar
RCV000056627	p.Arg187Pro	missense variant	-	NC_000012.12:g.52519156C>G	ClinVar
COSM940762	p.Arg187Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519157G>A	NCI-TCGA Cosmic
rs267607452	p.Arg187Pro	missense variant	-	NC_000012.12:g.52519156C>G	ESP,ExAC,gnomAD
rs267607452	p.Arg187Gln	missense variant	-	NC_000012.12:g.52519156C>T	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Phe188Leu	missense variant	-	NC_000012.12:g.52519152G>T	NCI-TCGA
RCV000056629	p.Glu190Asp	missense variant	-	NC_000012.12:g.52519146C>G	ClinVar
RCV000056628	p.Glu190Lys	missense variant	-	NC_000012.12:g.52519148C>T	ClinVar
rs267607437	p.Glu190Asp	missense variant	-	NC_000012.12:g.52519146C>G	-
rs58976397	p.Glu190Lys	missense variant	-	NC_000012.12:g.52519148C>T	-
RCV000056630	p.Gln191Pro	missense variant	-	NC_000012.12:g.52519144T>G	ClinVar
rs57751134	p.Gln191Pro	missense variant	-	NC_000012.12:g.52519144T>G	-
rs57751134	p.Gln191Pro	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52519144T>G	UniProt,dbSNP
VAR_031643	p.Gln191Pro	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52519144T>G	UniProt
rs1189534651	p.Gln192Arg	missense variant	-	NC_000012.12:g.52519141T>C	gnomAD
RCV000056631	p.Asn193Lys	missense variant	-	NC_000012.12:g.52519137G>T	ClinVar
RCV000056632	p.Asn193Lys	missense variant	-	NC_000012.12:g.52519137G>C	ClinVar
rs60586163	p.Asn193Lys	missense variant	-	NC_000012.12:g.52519137G>C	gnomAD
rs373124656	p.Asn193Ser	missense variant	-	NC_000012.12:g.52519138T>C	ESP,ExAC,TOPMed,gnomAD
rs60586163	p.Asn193Lys	missense variant	-	NC_000012.12:g.52519137G>T	gnomAD
rs1207891531	p.Lys194Glu	missense variant	-	NC_000012.12:g.52519136T>C	TOPMed,gnomAD
rs766733036	p.Val195Ile	missense variant	-	NC_000012.12:g.52519133C>T	ExAC,gnomAD
RCV000056634	p.Asp197Glu	missense variant	-	NC_000012.12:g.52519125G>T	ClinVar
rs641615	p.Asp197Glu	missense variant	-	NC_000012.12:g.52519125G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs761944980	p.Asp197Asn	missense variant	-	NC_000012.12:g.52519127C>T	ExAC,gnomAD
rs641615	p.Asp197Glu	missense variant	-	NC_000012.12:g.52519125G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs774595910	p.Asp197Gly	missense variant	-	NC_000012.12:g.52519126T>C	ExAC,gnomAD
RCV000056635	p.Thr198Ser	missense variant	-	NC_000012.12:g.52519123G>C	ClinVar
rs267607435	p.Thr198Ser	missense variant	-	NC_000012.12:g.52519123G>C	-
RCV000056639	p.Lys199Arg	missense variant	-	NC_000012.12:g.52519120T>C	ClinVar
rs58766676	p.Lys199Arg	missense variant	-	NC_000012.12:g.52519120T>C	-
RCV000056640	p.Lys199Met	missense variant	-	NC_000012.12:g.52519120T>A	ClinVar
RCV000056638	p.Lys199Thr	missense variant	-	NC_000012.12:g.52519120T>G	ClinVar
rs58766676	p.Lys199Met	missense variant	-	NC_000012.12:g.52519120T>A	-
rs58766676	p.Lys199Thr	missense variant	-	NC_000012.12:g.52519120T>G	-
rs1319408791	p.Trp200Cys	missense variant	-	NC_000012.12:g.52519116C>A	gnomAD
rs770749113	p.Leu202Pro	missense variant	-	NC_000012.12:g.52519111A>G	ExAC,gnomAD
rs770749113	p.Leu202Arg	missense variant	-	NC_000012.12:g.52519111A>C	ExAC,gnomAD
rs746791048	p.Glu205Lys	missense variant	-	NC_000012.12:g.52519103C>T	ExAC,gnomAD
rs1400188232	p.Gly207Asp	missense variant	-	NC_000012.12:g.52519096C>T	TOPMed
rs1377553555	p.Thr208Ile	missense variant	-	NC_000012.12:g.52519093G>A	gnomAD
rs376720840	p.Lys209Asn	missense variant	-	NC_000012.12:g.52519089C>A	ESP,ExAC,TOPMed,gnomAD
rs147498164	p.Val211Leu	missense variant	-	NC_000012.12:g.52519085C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs147498164	p.Val211Met	missense variant	-	NC_000012.12:g.52519085C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000224924	p.Val211Met	missense variant	-	NC_000012.12:g.52519085C>T	ClinVar
RCV000326575	p.Val211Met	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52519085C>T	ClinVar
rs1395946883	p.Arg212Thr	missense variant	-	NC_000012.12:g.52519081C>G	gnomAD
rs144845827	p.Leu215Met	missense variant	-	NC_000012.12:g.52519073G>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu216Ter	missense variant	-	NC_000012.12:g.52519070C>A	NCI-TCGA
COSM4042869	p.Glu216Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519069T>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro217Gln	missense variant	-	NC_000012.12:g.52519066G>T	NCI-TCGA
COSM4042868	p.Pro217Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519067G>A	NCI-TCGA Cosmic
rs569890901	p.Pro217Leu	missense variant	-	NC_000012.12:g.52519066G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs766003980	p.Leu218Ser	missense variant	-	NC_000012.12:g.52519063A>G	ExAC,gnomAD
rs756435108	p.Leu218Phe	missense variant	-	NC_000012.12:g.52519062C>A	ExAC,gnomAD
rs768019473	p.Glu220Lys	missense variant	-	NC_000012.12:g.52519058C>T	ExAC,gnomAD
rs1347917615	p.Gln221Ter	stop gained	-	NC_000012.12:g.52519055G>A	gnomAD
rs762388603	p.Gln221Leu	missense variant	-	NC_000012.12:g.52519054T>A	ExAC,gnomAD
rs762388603	p.Gln221Arg	missense variant	-	NC_000012.12:g.52519054T>C	ExAC,gnomAD
rs1261360013	p.Ile223Val	missense variant	-	NC_000012.12:g.52519049T>C	TOPMed
rs764268730	p.Asn225Lys	missense variant	-	NC_000012.12:g.52519041G>C	ExAC,gnomAD
rs1298273476	p.Leu226Ile	missense variant	-	NC_000012.12:g.52519040G>T	gnomAD
NCI-TCGA novel	p.Arg227Lys	missense variant	-	NC_000012.12:g.52519036C>T	NCI-TCGA
rs1301554451	p.Arg228Lys	missense variant	-	NC_000012.12:g.52519033C>T	gnomAD
COSM6072981	p.Leu230Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52519027A>T	NCI-TCGA Cosmic
rs1436696087	p.Ser232Gly	missense variant	-	NC_000012.12:g.52519022T>C	TOPMed,gnomAD
rs200333163	p.Ser232Asn	missense variant	-	NC_000012.12:g.52519021C>T	ExAC,gnomAD
rs746776082	p.Ile233Met	missense variant	-	NC_000012.12:g.52519017G>C	ExAC,TOPMed,gnomAD
rs201553621	p.Val234Met	missense variant	-	NC_000012.12:g.52519016C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs754470005	p.Gly235Ala	missense variant	-	NC_000012.12:g.52519012C>G	ExAC,TOPMed,gnomAD
rs1307449189	p.Gly235Arg	missense variant	-	NC_000012.12:g.52519013C>T	gnomAD
rs139036685	p.Glu236Lys	missense variant	-	NC_000012.12:g.52519010C>T	ESP,ExAC,gnomAD
rs978927000	p.Arg237Gln	missense variant	-	NC_000012.12:g.52519006C>T	TOPMed,gnomAD
rs537370039	p.Arg237Trp	missense variant	-	NC_000012.12:g.52519007G>A	1000Genomes,ExAC,gnomAD
rs537370039	p.Arg237Gly	missense variant	-	NC_000012.12:g.52519007G>C	1000Genomes,ExAC,gnomAD
rs570531194	p.Gly238Val	missense variant	-	NC_000012.12:g.52519003C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs570531194	p.Gly238Asp	missense variant	-	NC_000012.12:g.52519003C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1273357519	p.Gly238Ser	missense variant	-	NC_000012.12:g.52519004C>T	TOPMed,gnomAD
rs752102397	p.Arg239His	missense variant	-	NC_000012.12:g.52519000C>T	ExAC,gnomAD
rs757766724	p.Arg239Cys	missense variant	-	NC_000012.12:g.52519001G>A	ExAC,TOPMed,gnomAD
rs142744029	p.Leu240Pro	missense variant	-	NC_000012.12:g.52518997A>G	ESP,ExAC,TOPMed
COSM6137372	p.Asp241His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52518995C>G	NCI-TCGA Cosmic
rs765446846	p.Asn246Asp	missense variant	-	NC_000012.12:g.52518980T>C	ExAC,TOPMed,gnomAD
rs759651620	p.Asn246Ser	missense variant	-	NC_000012.12:g.52518979T>C	ExAC,TOPMed,gnomAD
rs1417219262	p.Met247Ile	missense variant	-	NC_000012.12:g.52518975C>T	gnomAD
rs1406802547	p.Leu250Pro	missense variant	-	NC_000012.12:g.52518967A>G	TOPMed,gnomAD
rs1307574245	p.Val251Met	missense variant	-	NC_000012.12:g.52518965C>T	gnomAD
rs1377668104	p.Asp253Ala	missense variant	-	NC_000012.12:g.52518958T>G	TOPMed
COSM6137373	p.Lys257Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52518946T>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Tyr258ThrPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52518162_52518163insCTTGTTCTTGAAGTCTTCCACCAGGT	NCI-TCGA
rs267603519	p.Glu261Lys	missense variant	-	NC_000012.12:g.52518153C>T	-
rs1290275972	p.Asn263Asp	missense variant	-	NC_000012.12:g.52518147T>C	TOPMed
RCV000056644	p.Arg265Pro	missense variant	-	NC_000012.12:g.52518140C>G	ClinVar
rs769176692	p.Arg265Cys	missense variant	-	NC_000012.12:g.52518141G>A	ExAC,TOPMed,gnomAD
rs201583229	p.Arg265Pro	missense variant	-	NC_000012.12:g.52518140C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs201583229	p.Arg265His	missense variant	-	NC_000012.12:g.52518140C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs780929128	p.Thr266Ile	missense variant	-	NC_000012.12:g.52518137G>A	ExAC,TOPMed,gnomAD
rs1478184608	p.Ala268Thr	missense variant	-	NC_000012.12:g.52518132C>T	TOPMed
NCI-TCGA novel	p.Glu269Asp	missense variant	-	NC_000012.12:g.52518127C>G	NCI-TCGA
NCI-TCGA novel	p.Glu269Gln	missense variant	-	NC_000012.12:g.52518129C>G	NCI-TCGA
rs770735188	p.Asn270Tyr	missense variant	-	NC_000012.12:g.52518126T>A	ExAC,gnomAD
RCV000761247	p.Phe272Ter	nonsense	Epidermolysis bullosa simplex	NC_000012.12:g.52518117del	ClinVar
NCI-TCGA novel	p.Val273CysPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52518117_52518118insA	NCI-TCGA
rs747325105	p.Met274Thr	missense variant	-	NC_000012.12:g.52518113A>G	ExAC,TOPMed,gnomAD
rs1387934183	p.Met274Leu	missense variant	-	NC_000012.12:g.52518114T>G	gnomAD
rs553755257	p.Leu275Pro	missense variant	-	NC_000012.12:g.52518110A>G	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Lys276GluPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52518109_52518110insA	NCI-TCGA
rs756254239	p.Asp278Asn	missense variant	-	NC_000012.12:g.52517992C>T	ExAC,gnomAD
rs1057500590	p.Met284Val	missense variant	-	NC_000012.12:g.52517974T>C	TOPMed,gnomAD
rs750633567	p.Val287Met	missense variant	-	NC_000012.12:g.52517965C>T	ExAC,TOPMed,gnomAD
rs1287965324	p.Glu290Gln	missense variant	-	NC_000012.12:g.52517956C>G	TOPMed
rs1336931805	p.Glu290Asp	missense variant	-	NC_000012.12:g.52517954C>G	gnomAD
rs758065668	p.Val293Ala	missense variant	-	NC_000012.12:g.52517946A>G	ExAC,gnomAD
rs886049625	p.Val293Ile	missense variant	-	NC_000012.12:g.52517947C>T	TOPMed
RCV000274907	p.Val293Ile	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52517947C>T	ClinVar
rs1370579888	p.Asp294Gly	missense variant	-	NC_000012.12:g.52517943T>C	gnomAD
rs765031976	p.Asp294Glu	missense variant	-	NC_000012.12:g.52517942A>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu299Lys	missense variant	-	NC_000012.12:g.52517929C>T	NCI-TCGA
rs776747513	p.Ile300Met	missense variant	-	NC_000012.12:g.52517924A>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn301LysPheSerTerUnk	frameshift	-	NC_000012.12:g.52517921_52517922insT	NCI-TCGA
rs1460187467	p.Asn301Lys	missense variant	-	NC_000012.12:g.52517921G>T	gnomAD
rs1325728628	p.Asn301Ile	missense variant	-	NC_000012.12:g.52517922T>A	TOPMed,gnomAD
rs1420710438	p.Phe302Ser	missense variant	-	NC_000012.12:g.52517919A>G	gnomAD
rs199854656	p.Met303Leu	missense variant	-	NC_000012.12:g.52517917T>A	ESP,ExAC,TOPMed,gnomAD
rs1484270830	p.Met305Leu	missense variant	-	NC_000012.12:g.52517911T>A	TOPMed
NCI-TCGA novel	p.Phe306Leu	missense variant	-	NC_000012.12:g.52517906G>T	NCI-TCGA
NCI-TCGA novel	p.Phe307Tyr	missense variant	-	NC_000012.12:g.52517904A>T	NCI-TCGA
rs757982689	p.Asp308Gly	missense variant	-	NC_000012.12:g.52517901T>C	ExAC,TOPMed,gnomAD
rs552561992	p.Ala309Glu	missense variant	-	NC_000012.12:g.52517898G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs552561992	p.Ala309Val	missense variant	-	NC_000012.12:g.52517898G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1253409127	p.Glu310Gln	missense variant	-	NC_000012.12:g.52517754C>G	gnomAD
rs1434489708	p.Leu311Val	missense variant	-	NC_000012.12:g.52517751G>C	TOPMed
rs59864957	p.Leu311Arg	missense variant	-	NC_000012.12:g.52517750A>C	ExAC,gnomAD
RCV000056645	p.Leu311Arg	missense variant	-	NC_000012.12:g.52517750A>C	ClinVar
rs59864957	p.Leu311Pro	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517750A>G	UniProt,dbSNP
VAR_026540	p.Leu311Pro	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517750A>G	UniProt
rs59864957	p.Leu311Pro	missense variant	-	NC_000012.12:g.52517750A>G	ExAC,gnomAD
rs1262405903	p.Ser312Tyr	missense variant	-	NC_000012.12:g.52517747G>T	gnomAD
rs1484890470	p.Ser312Ala	missense variant	-	NC_000012.12:g.52517748A>C	gnomAD
COSM940760	p.Gln315Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.52517739G>A	NCI-TCGA Cosmic
rs369447745	p.Thr316Met	missense variant	-	NC_000012.12:g.52517735G>A	ESP,ExAC,TOPMed,gnomAD
rs1340897979	p.His317Asn	missense variant	-	NC_000012.12:g.52517733G>T	TOPMed
rs541927296	p.His317Arg	missense variant	-	NC_000012.12:g.52517732T>C	1000Genomes,ExAC,gnomAD
rs1340897979	p.His317Tyr	missense variant	-	NC_000012.12:g.52517733G>A	TOPMed
NCI-TCGA novel	p.Asp320Gly	missense variant	-	NC_000012.12:g.52517723T>C	NCI-TCGA
rs769053414	p.Thr321Ile	missense variant	-	NC_000012.12:g.52517720G>A	ExAC,gnomAD
VAR_071632	p.Thr321Pro	Missense	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS) [MIM:131800]	-	UniProt
RCV000056646	p.Val323Ala	missense variant	-	NC_000012.12:g.52517714A>G	ClinVar
rs59840738	p.Val323Ala	missense variant	-	NC_000012.12:g.52517714A>G	-
rs59840738	p.Val323Ala	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52517714A>G	UniProt,dbSNP
VAR_010460	p.Val323Ala	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52517714A>G	UniProt
RCV000056648	p.Val324Ala	missense variant	-	NC_000012.12:g.52517711A>G	ClinVar
rs59335325	p.Val324Ala	missense variant	-	NC_000012.12:g.52517711A>G	-
rs1401028269	p.Val324Phe	missense variant	-	NC_000012.12:g.52517712C>A	TOPMed
RCV000056647	p.Val324Asp	missense variant	-	NC_000012.12:g.52517711A>T	ClinVar
rs59335325	p.Val324Asp	missense variant	-	NC_000012.12:g.52517711A>T	-
RCV000056649	p.Leu325Pro	missense variant	-	NC_000012.12:g.52517708A>G	ClinVar
rs58107458	p.Leu325Pro	missense variant	-	NC_000012.12:g.52517708A>G	-
RCV000056650	p.Met327Lys	missense variant	-	NC_000012.12:g.52517702A>T	ClinVar
RCV000762900	p.Met327Thr	missense variant	Epidermolysis bullosa simplex, Cockayne-Touraine type	NC_000012.12:g.52517702A>G	ClinVar
RCV000056651	p.Met327Thr	missense variant	-	NC_000012.12:g.52517702A>G	ClinVar
RCV000015747	p.Met327Thr	missense variant	Epidermolysis bullosa simplex, Cockayne-Touraine type	NC_000012.12:g.52517702A>G	ClinVar
rs56790237	p.Asp328His	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517700C>G	UniProt,dbSNP
VAR_010463	p.Asp328His	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517700C>G	UniProt
rs56790237	p.Asp328His	missense variant	-	NC_000012.12:g.52517700C>G	-
RCV000056653	p.Asp328Gly	missense variant	-	NC_000012.12:g.52517699T>C	ClinVar
RCV000056655	p.Asp328Glu	missense variant	-	NC_000012.12:g.52517698G>T	ClinVar
NCI-TCGA novel	p.Asp328Asn	missense variant	-	NC_000012.12:g.52517700C>T	NCI-TCGA
RCV000056652	p.Asp328His	missense variant	-	NC_000012.12:g.52517700C>G	ClinVar
RCV000056654	p.Asp328Val	missense variant	-	NC_000012.12:g.52517699T>A	ClinVar
rs57142010	p.Asp328Val	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517699T>A	UniProt,dbSNP
VAR_010464	p.Asp328Val	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517699T>A	UniProt
rs57142010	p.Asp328Val	missense variant	-	NC_000012.12:g.52517699T>A	-
rs59464425	p.Asp328Glu	missense variant	-	NC_000012.12:g.52517698G>T	TOPMed,gnomAD
rs57142010	p.Asp328Gly	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517699T>C	UniProt,dbSNP
VAR_026543	p.Asp328Gly	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52517699T>C	UniProt
rs57142010	p.Asp328Gly	missense variant	-	NC_000012.12:g.52517699T>C	-
RCV000056656	p.Asn329Ser	missense variant	-	NC_000012.12:g.52517696T>C	ClinVar
rs59730172	p.Asn329Lys	missense variant	-	NC_000012.12:g.52517695G>T	ExAC,TOPMed,gnomAD
rs59184265	p.Asn329Ser	missense variant	-	NC_000012.12:g.52517696T>C	-
RCV000015748	p.Asn329Lys	missense variant	Epidermolysis bullosa simplex, Cockayne-Touraine type	NC_000012.12:g.52517695G>T	ClinVar
rs1369493697	p.Asn330Lys	missense variant	-	NC_000012.12:g.52517692G>T	TOPMed
rs745902310	p.Asn330Ser	missense variant	-	NC_000012.12:g.52517693T>C	ExAC,gnomAD
RCV000056658	p.Arg331Ser	missense variant	-	NC_000012.12:g.52517691G>T	ClinVar
RCV000503703	p.Arg331Cys	missense variant	Epidermolysis bullosa simplex, Cockayne-Touraine type	NC_000012.12:g.52517691G>A	ClinVar
RCV000056661	p.Arg331His	missense variant	-	NC_000012.12:g.52517690C>T	ClinVar
RCV000056659	p.Arg331Gly	missense variant	-	NC_000012.12:g.52517691G>C	ClinVar
rs56729325	p.Arg331His	missense variant	-	NC_000012.12:g.52517690C>T	TOPMed
rs61297109	p.Arg331Cys	missense variant	-	NC_000012.12:g.52517691G>A	TOPMed,gnomAD
rs61297109	p.Arg331Gly	missense variant	-	NC_000012.12:g.52517691G>C	TOPMed,gnomAD
rs61297109	p.Arg331Ser	missense variant	-	NC_000012.12:g.52517691G>T	TOPMed,gnomAD
rs781305886	p.Asn332Ser	missense variant	-	NC_000012.12:g.52517687T>C	ExAC,TOPMed,gnomAD
rs770952740	p.Asp334Tyr	missense variant	-	NC_000012.12:g.52517682C>A	ExAC,gnomAD
rs777912551	p.Asp334Glu	missense variant	-	NC_000012.12:g.52517680G>T	ExAC,TOPMed,gnomAD
rs373891687	p.Asp336Asn	missense variant	-	NC_000012.12:g.52517676C>T	ESP,ExAC,gnomAD
COSM6137374	p.Ala340Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52517664C>A	NCI-TCGA Cosmic
rs780099328	p.Ala340Thr	missense variant	-	NC_000012.12:g.52517664C>T	ExAC,gnomAD
rs754348635	p.Ala340Val	missense variant	-	NC_000012.12:g.52517663G>A	-
COSM940759	p.Lys343Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52517653C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala344Asp	missense variant	-	NC_000012.12:g.52517651G>T	NCI-TCGA
rs1307364510	p.Ala344Thr	missense variant	-	NC_000012.12:g.52517652C>T	TOPMed
rs200832687	p.Gln345His	missense variant	-	NC_000012.12:g.52517647C>G	1000Genomes
rs1203058933	p.Tyr346Asn	missense variant	-	NC_000012.12:g.52517646A>T	TOPMed
rs750367973	p.Ala350Val	missense variant	-	NC_000012.12:g.52517633G>A	ExAC,gnomAD
rs1395973356	p.Asn351His	missense variant	-	NC_000012.12:g.52517631T>G	gnomAD
rs766857995	p.Arg352Leu	missense variant	-	NC_000012.12:g.52517627C>A	ExAC,TOPMed,gnomAD
rs766857995	p.Arg352His	missense variant	-	NC_000012.12:g.52517627C>T	ExAC,TOPMed,gnomAD
rs59112594	p.Arg352Ser	missense variant	-	NC_000012.12:g.52517628G>T	ESP,ExAC,TOPMed,gnomAD
RCV000056541	p.Arg352Ser	missense variant	-	NC_000012.12:g.52517628G>T	ClinVar
rs59112594	p.Arg352Cys	missense variant	-	NC_000012.12:g.52517628G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser353Ile	missense variant	-	NC_000012.12:g.52517624C>A	NCI-TCGA
rs148049379	p.Arg354Gln	missense variant	-	NC_000012.12:g.52517621C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs143630653	p.Arg354Trp	missense variant	-	NC_000012.12:g.52517622G>A	ESP,ExAC,TOPMed,gnomAD
rs1195131320	p.Glu356Lys	missense variant	-	NC_000012.12:g.52517616C>T	TOPMed
rs534833753	p.Glu358Lys	missense variant	-	NC_000012.12:g.52517610C>T	ExAC,TOPMed,gnomAD
rs771026976	p.Trp360Ter	stop gained	-	NC_000012.12:g.52517602C>T	ExAC,gnomAD
rs1168285971	p.Gln362Pro	missense variant	-	NC_000012.12:g.52517597T>G	TOPMed
rs747069497	p.Gln362His	missense variant	-	NC_000012.12:g.52517596C>A	ExAC,gnomAD
rs1351383433	p.Thr363Ile	missense variant	-	NC_000012.12:g.52517594G>A	TOPMed
rs760767549	p.Tyr365His	missense variant	-	NC_000012.12:g.52517232A>G	ExAC,TOPMed,gnomAD
rs1461921471	p.Glu367Lys	missense variant	-	NC_000012.12:g.52517226C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Glu367Gln	missense variant	-	NC_000012.12:g.52517226C>G	NCI-TCGA
rs138697843	p.Gln369Ter	stop gained	-	NC_000012.12:g.52517220G>A	ESP,ExAC,gnomAD
rs138697843	p.Gln369Lys	missense variant	-	NC_000012.12:g.52517220G>T	ESP,ExAC,gnomAD
COSM1362512	p.Gln370Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.52517217G>A	NCI-TCGA Cosmic
rs1006432596	p.Thr371Ile	missense variant	-	NC_000012.12:g.52517213G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Ala372Ser	missense variant	-	NC_000012.12:g.52517211C>A	NCI-TCGA
RCV000396205	p.Gly373Ala	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52517207C>G	ClinVar
rs561738497	p.Gly373Ala	missense variant	-	NC_000012.12:g.52517207C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs200072843	p.Arg374Leu	missense variant	-	NC_000012.12:g.52517204C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs200072843	p.Arg374Gln	missense variant	-	NC_000012.12:g.52517204C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs758181003	p.Arg374Trp	missense variant	-	NC_000012.12:g.52517205G>A	ExAC,TOPMed,gnomAD
rs1236961587	p.His375Tyr	missense variant	-	NC_000012.12:g.52517202G>A	gnomAD
rs757166763	p.His375Arg	missense variant	-	NC_000012.12:g.52517201T>C	ExAC,TOPMed,gnomAD
rs777237775	p.Asp377Asn	missense variant	-	NC_000012.12:g.52517196C>T	ExAC,gnomAD
rs757966253	p.Leu379Phe	missense variant	-	NC_000012.12:g.52517190G>A	ExAC,gnomAD
rs752329142	p.Arg380Cys	missense variant	-	NC_000012.12:g.52517187G>A	ExAC,TOPMed,gnomAD
rs764879342	p.Arg380His	missense variant	-	NC_000012.12:g.52517186C>T	ExAC,TOPMed,gnomAD
rs755300932	p.Asn381Ser	missense variant	-	NC_000012.12:g.52517183T>C	ExAC,gnomAD
rs1167883150	p.Thr382Ala	missense variant	-	NC_000012.12:g.52517181T>C	TOPMed
rs1156362973	p.Lys383Thr	missense variant	-	NC_000012.12:g.52517177T>G	gnomAD
rs1470865283	p.His384Arg	missense variant	-	NC_000012.12:g.52517174T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Glu385LeuPheSerTerUnk	frameshift	-	NC_000012.12:g.52517168_52517172ATCTC>-	NCI-TCGA
COSM2010757	p.Glu385Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52517172C>T	NCI-TCGA Cosmic
rs1364056877	p.Ile386Val	missense variant	-	NC_000012.12:g.52517169T>C	gnomAD
rs2669875	p.Ser387Thr	missense variant	-	NC_000012.12:g.52517166A>T	-
rs2669875	p.Ser387Thr	missense variant	-	NC_000012.12:g.52517166A>T	UniProt,dbSNP
VAR_028766	p.Ser387Thr	missense variant	-	NC_000012.12:g.52517166A>T	UniProt
RCV000056544	p.Ser387Thr	missense variant	-	NC_000012.12:g.52517166A>T	ClinVar
NCI-TCGA novel	p.Glu388Asp	missense variant	-	NC_000012.12:g.52517161C>G	NCI-TCGA
NCI-TCGA novel	p.Met389Ile	missense variant	-	NC_000012.12:g.52517158C>G	NCI-TCGA
rs766859647	p.Met389Val	missense variant	-	NC_000012.12:g.52517160T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn390Asp	missense variant	-	NC_000012.12:g.52517157T>C	NCI-TCGA
rs761063555	p.Arg391Trp	missense variant	-	NC_000012.12:g.52517154G>A	ExAC,TOPMed,gnomAD
rs747792410	p.Arg391Gln	missense variant	-	NC_000012.12:g.52517153C>T	ExAC,gnomAD
rs767692987	p.Met392Ile	missense variant	-	NC_000012.12:g.52517149C>T	ExAC,gnomAD
rs1403972059	p.Met392Val	missense variant	-	NC_000012.12:g.52517151T>C	TOPMed
rs761999937	p.Arg395Ser	missense variant	-	NC_000012.12:g.52517140C>G	ExAC,gnomAD
rs1203514715	p.Leu396Gln	missense variant	-	NC_000012.12:g.52517138A>T	gnomAD
rs141279000	p.Glu399Lys	missense variant	-	NC_000012.12:g.52517130C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ile400Phe	missense variant	-	NC_000012.12:g.52517127T>A	NCI-TCGA
rs979317659	p.Ile400Thr	missense variant	-	NC_000012.12:g.52517126A>G	TOPMed,gnomAD
rs776272199	p.Asn402His	missense variant	-	NC_000012.12:g.52517121T>G	ExAC,TOPMed,gnomAD
rs1292246354	p.Lys404Arg	missense variant	-	NC_000012.12:g.52517114T>C	TOPMed
rs60809982	p.Lys404Glu	missense variant	-	NC_000012.12:g.52517115T>C	-
RCV000056545	p.Lys404Glu	missense variant	-	NC_000012.12:g.52517115T>C	ClinVar
rs746940114	p.Lys405Arg	missense variant	-	NC_000012.12:g.52517111T>C	ExAC,TOPMed,gnomAD
rs778602599	p.Gln406Lys	missense variant	-	NC_000012.12:g.52517109G>T	TOPMed,gnomAD
rs778262903	p.Cys407Arg	missense variant	-	NC_000012.12:g.52516857A>G	ExAC,TOPMed,gnomAD
rs748888461	p.Ala408Thr	missense variant	-	NC_000012.12:g.52516854C>T	ExAC,TOPMed,gnomAD
rs1292567518	p.Asn409Tyr	missense variant	-	NC_000012.12:g.52516851T>A	gnomAD
rs779770273	p.Asn409Thr	missense variant	-	NC_000012.12:g.52516850T>G	ExAC,gnomAD
rs200597314	p.Gln411Arg	missense variant	-	NC_000012.12:g.52516844T>C	ExAC,gnomAD
NCI-TCGA novel	p.Asn412Asp	missense variant	-	NC_000012.12:g.52516842T>C	NCI-TCGA
rs1441032229	p.Asn412Ser	missense variant	-	NC_000012.12:g.52516841T>C	TOPMed,gnomAD
rs144359915	p.Asn412Lys	missense variant	-	NC_000012.12:g.52516840G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs757819698	p.Ala413Thr	missense variant	-	NC_000012.12:g.52516839C>T	ExAC,gnomAD
rs757819698	p.Ala413Ser	missense variant	-	NC_000012.12:g.52516839C>A	ExAC,gnomAD
rs1467489260	p.Ala413Val	missense variant	-	NC_000012.12:g.52516838G>A	gnomAD
rs752155719	p.Ala415Thr	missense variant	-	NC_000012.12:g.52516833C>T	ExAC,gnomAD
rs1470701148	p.Asp416Glu	missense variant	-	NC_000012.12:g.52516828A>T	TOPMed
NCI-TCGA novel	p.Asp416GluPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52516828_52516829insATCTTCTTGACAC	NCI-TCGA
rs763147225	p.Ala417Asp	missense variant	-	NC_000012.12:g.52516826G>T	ExAC,gnomAD
rs760420480	p.Glu418Asp	missense variant	-	NC_000012.12:g.52516822C>G	ExAC,gnomAD
NCI-TCGA novel	p.Glu418Val	missense variant	-	NC_000012.12:g.52516823T>A	NCI-TCGA
RCV000056546	p.Glu418Lys	missense variant	-	NC_000012.12:g.52516824C>T	ClinVar
rs121912476	p.Glu418Lys	missense variant	-	NC_000012.12:g.52516824C>T	ExAC,gnomAD
rs121912476	p.Glu418Lys	missense variant	Epidermolysis bullosa simplex, autosomal recessive 1 (EBSB1)	NC_000012.12:g.52516824C>T	UniProt,dbSNP
VAR_026544	p.Glu418Lys	missense variant	Epidermolysis bullosa simplex, autosomal recessive 1 (EBSB1)	NC_000012.12:g.52516824C>T	UniProt
rs374228362	p.Arg420Cys	missense variant	-	NC_000012.12:g.52516818G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs140660135	p.Arg420His	missense variant	-	NC_000012.12:g.52516817C>T	ESP,ExAC,TOPMed,gnomAD
rs761706455	p.Gly421Ala	missense variant	-	NC_000012.12:g.52516814C>G	ExAC,gnomAD
COSM4894756	p.Glu422Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52516812C>T	NCI-TCGA Cosmic
rs767993231	p.Glu422Ala	missense variant	-	NC_000012.12:g.52516811T>G	ExAC,TOPMed,gnomAD
rs767993231	p.Glu422Gly	missense variant	-	NC_000012.12:g.52516811T>C	ExAC,TOPMed,gnomAD
rs748836260	p.Ala424Pro	missense variant	-	NC_000012.12:g.52516806C>G	ExAC,TOPMed,gnomAD
rs748836260	p.Ala424Thr	missense variant	-	NC_000012.12:g.52516806C>T	ExAC,TOPMed,gnomAD
rs1312895916	p.Ala424Val	missense variant	-	NC_000012.12:g.52516805G>A	TOPMed,gnomAD
rs1312895916	p.Ala424Gly	missense variant	-	NC_000012.12:g.52516805G>C	TOPMed,gnomAD
rs779531180	p.Leu425Phe	missense variant	-	NC_000012.12:g.52516803G>A	ExAC,gnomAD
RCV000056547	p.Ala428Thr	missense variant	-	NC_000012.12:g.52516794C>T	ClinVar
rs267607458	p.Ala428Thr	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52516794C>T	UniProt,dbSNP
VAR_071633	p.Ala428Thr	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52516794C>T	UniProt
rs267607458	p.Ala428Thr	missense variant	-	NC_000012.12:g.52516794C>T	gnomAD
RCV000056548	p.Ala428Val	missense variant	-	NC_000012.12:g.52516793G>A	ClinVar
rs59243757	p.Ala428Val	missense variant	-	NC_000012.12:g.52516793G>A	-
rs985057511	p.Arg429Lys	missense variant	-	NC_000012.12:g.52516790C>T	gnomAD
rs1303632263	p.Arg429Ser	missense variant	-	NC_000012.12:g.52516789C>A	TOPMed,gnomAD
rs371739329	p.Asn430Lys	missense variant	-	NC_000012.12:g.52516786G>C	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn430Lys	missense variant	-	NC_000012.12:g.52516786G>T	NCI-TCGA
rs1401509310	p.Lys431Arg	missense variant	-	NC_000012.12:g.52516784T>C	gnomAD
rs577244472	p.Ala433Asp	missense variant	-	NC_000012.12:g.52516778G>T	ExAC,TOPMed,gnomAD
COSM4925539	p.Glu434Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000012.12:g.52516776C>A	NCI-TCGA Cosmic
rs757760193	p.Glu434Lys	missense variant	-	NC_000012.12:g.52516776C>T	ExAC,TOPMed,gnomAD
rs751992720	p.Glu434Val	missense variant	-	NC_000012.12:g.52516775T>A	ExAC,gnomAD
rs374535811	p.Glu436Asp	missense variant	-	NC_000012.12:g.52516768C>G	ESP,ExAC,TOPMed,gnomAD
rs1405839596	p.Glu436Gly	missense variant	-	NC_000012.12:g.52516769T>C	gnomAD
rs752855887	p.Glu437Gly	missense variant	-	NC_000012.12:g.52516766T>C	ExAC,gnomAD
rs57845028	p.Ala438Asp	missense variant	-	NC_000012.12:g.52516763G>T	-
rs57845028	p.Ala438Asp	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52516763G>T	UniProt,dbSNP
VAR_023727	p.Ala438Asp	missense variant	Epidermolysis bullosa simplex, Weber-Cockayne type (WC-EBS)	NC_000012.12:g.52516763G>T	UniProt
RCV000056550	p.Ala438Asp	missense variant	-	NC_000012.12:g.52516763G>T	ClinVar
rs1191511841	p.Ala438Pro	missense variant	-	NC_000012.12:g.52516764C>G	gnomAD
NCI-TCGA novel	p.Gln440LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52516759_52516760insTTTGAATCAATTTCTTAGTCAAATGATCATATAAA	NCI-TCGA
RCV000056551	p.Lys443Asn	missense variant	-	NC_000012.12:g.52516747C>G	ClinVar
rs1480537061	p.Lys443Arg	missense variant	-	NC_000012.12:g.52516748T>C	TOPMed
rs267607453	p.Lys443Asn	missense variant	-	NC_000012.12:g.52516747C>G	-
rs754100299	p.Met446Leu	missense variant	-	NC_000012.12:g.52516740T>G	ExAC,gnomAD
rs1194858931	p.Ala447Val	missense variant	-	NC_000012.12:g.52516736G>A	TOPMed
rs761655080	p.Arg448Leu	missense variant	-	NC_000012.12:g.52516733C>A	ExAC,TOPMed,gnomAD
rs761655080	p.Arg448Gln	missense variant	-	NC_000012.12:g.52516733C>T	ExAC,TOPMed,gnomAD
rs767296169	p.Arg448Trp	missense variant	-	NC_000012.12:g.52516734G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu449His	insertion	-	NC_000012.12:g.52516727_52516728insAAT	NCI-TCGA
NCI-TCGA novel	p.Leu450ThrPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52516728_52516729insTACTTTTCCATGTTTTTCTTTGAATTGT	NCI-TCGA
rs370060795	p.Arg451Cys	missense variant	-	NC_000012.12:g.52516725G>A	ESP,ExAC,TOPMed,gnomAD
RCV000519165	p.Arg451His	missense variant	-	NC_000012.12:g.52516724C>T	ClinVar
rs370060795	p.Arg451Ser	missense variant	-	NC_000012.12:g.52516725G>T	ESP,ExAC,TOPMed,gnomAD
rs200563006	p.Arg451Pro	missense variant	-	NC_000012.12:g.52516724C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs200563006	p.Arg451His	missense variant	-	NC_000012.12:g.52516724C>T	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu452ValPheSerTerUnk	frameshift	-	NC_000012.12:g.52516721_52516722insCA	NCI-TCGA
rs1439138800	p.Glu452Val	missense variant	-	NC_000012.12:g.52516721T>A	gnomAD
NCI-TCGA novel	p.Gln454Lys	missense variant	-	NC_000012.12:g.52516716G>T	NCI-TCGA
rs1294665232	p.Glu455Lys	missense variant	-	NC_000012.12:g.52516713C>T	gnomAD
RCV000760721	p.Glu455Ter	nonsense	-	NC_000012.12:g.52516713C>A	ClinVar
rs1271144622	p.Glu455Asp	missense variant	-	NC_000012.12:g.52516711C>A	TOPMed,gnomAD
RCV000056552	p.Glu455Ter	frameshift	-	NC_000012.12:g.52516711_52516714delinsTACCAGCT	ClinVar
rs745507253	p.Met457Leu	missense variant	-	NC_000012.12:g.52516707T>G	ExAC,gnomAD
rs1343526933	p.Thr459Ala	missense variant	-	NC_000012.12:g.52516701T>C	gnomAD
NCI-TCGA novel	p.Ala462Val	missense variant	-	NC_000012.12:g.52516691G>A	NCI-TCGA
RCV000015745	p.Leu463Pro	missense variant	Epidermolysis bullosa simplex, Koebner type	NC_000012.12:g.52516688A>G	ClinVar
RCV000056553	p.Leu463Pro	missense variant	-	NC_000012.12:g.52516688A>G	ClinVar
rs57599352	p.Leu463Pro	missense variant	-	NC_000012.12:g.52516688A>G	-
rs57599352	p.Leu463Pro	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52516688A>G	UniProt,dbSNP
VAR_003876	p.Leu463Pro	missense variant	Epidermolysis bullosa simplex, Koebner type (K-EBS)	NC_000012.12:g.52516688A>G	UniProt
rs1555156076	p.Val465Gly	missense variant	-	NC_000012.12:g.52516682A>C	-
RCV000505555	p.Val465Gly	missense variant	Epidermolysis bullosa simplex, Koebner type	NC_000012.12:g.52516682A>C	ClinVar
rs758969808	p.Val465Met	missense variant	-	NC_000012.12:g.52516683C>T	ExAC,TOPMed,gnomAD
RCV000056554	p.Glu466Asp	missense variant	-	NC_000012.12:g.52516678C>G	ClinVar
rs62642056	p.Glu466Asp	missense variant	-	NC_000012.12:g.52516678C>G	ExAC,gnomAD
RCV000056556	p.Ile467Thr	missense variant	-	NC_000012.12:g.52516676A>G	ClinVar
RCV000056557	p.Ile467Met	missense variant	-	NC_000012.12:g.52516675G>C	ClinVar
RCV000056555	p.Ile467Leu	missense variant	-	NC_000012.12:g.52516677T>G	ClinVar
rs58288198	p.Ile467Leu	missense variant	-	NC_000012.12:g.52516677T>G	-
rs60271599	p.Ile467Thr	missense variant	-	NC_000012.12:g.52516676A>G	-
rs60271599	p.Ile467Thr	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516676A>G	UniProt,dbSNP
VAR_010466	p.Ile467Thr	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516676A>G	UniProt
rs60062350	p.Ile467Met	missense variant	-	NC_000012.12:g.52516675G>C	ExAC,gnomAD
rs1131691471	p.Ala468Thr	missense variant	-	NC_000012.12:g.52516674C>T	gnomAD
rs1131691471	p.Ala468Ser	missense variant	-	NC_000012.12:g.52516674C>A	gnomAD
RCV000493793	p.Ala468Ser	missense variant	-	NC_000012.12:g.52516674C>A	ClinVar
rs60596287	p.Thr469Pro	missense variant	-	NC_000012.12:g.52516671T>G	-
rs60596287	p.Thr469Pro	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516671T>G	UniProt,dbSNP
VAR_027726	p.Thr469Pro	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516671T>G	UniProt
RCV000056558	p.Thr469Pro	missense variant	-	NC_000012.12:g.52516671T>G	ClinVar
rs1264710617	p.Thr469Ser	missense variant	-	NC_000012.12:g.52516670G>C	TOPMed,gnomAD
rs1264710617	p.Thr469Ile	missense variant	-	NC_000012.12:g.52516670G>A	TOPMed,gnomAD
RCV000056559	p.Arg471Cys	missense variant	-	NC_000012.12:g.52516665G>A	ClinVar
rs267607448	p.Arg471Ser	missense variant	-	NC_000012.12:g.52516665G>T	ExAC,TOPMed,gnomAD
rs267607448	p.Arg471Cys	missense variant	-	NC_000012.12:g.52516665G>A	ExAC,TOPMed,gnomAD
rs895084041	p.Arg471His	missense variant	-	NC_000012.12:g.52516664C>T	TOPMed,gnomAD
RCV000056560	p.Lys472Ter	nonsense	-	NC_000012.12:g.52516662T>A	ClinVar
rs57348201	p.Lys472Ter	stop gained	-	NC_000012.12:g.52516662T>A	ExAC,TOPMed,gnomAD
rs57348201	p.Lys472Gln	missense variant	-	NC_000012.12:g.52516662T>G	ExAC,TOPMed,gnomAD
rs1314336030	p.Glu475Asp	missense variant	-	NC_000012.12:g.52516651C>G	gnomAD
RCV000056561	p.Glu475Lys	missense variant	-	NC_000012.12:g.52516653C>T	ClinVar
RCV000056562	p.Glu475Gly	missense variant	-	NC_000012.12:g.52516652T>C	ClinVar
rs57155193	p.Glu475Lys	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516653C>T	UniProt,dbSNP
VAR_023728	p.Glu475Lys	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516653C>T	UniProt
rs57155193	p.Glu475Lys	missense variant	-	NC_000012.12:g.52516653C>T	-
rs61348633	p.Glu475Gly	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516652T>C	UniProt,dbSNP
VAR_003877	p.Glu475Gly	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516652T>C	UniProt
rs61348633	p.Glu475Gly	missense variant	-	NC_000012.12:g.52516652T>C	-
RCV000056563	p.Gly476Asp	missense variant	-	NC_000012.12:g.52516649C>T	ClinVar
RCV000056564	p.Gly476Ala	missense variant	-	NC_000012.12:g.52516649C>G	ClinVar
rs1302350258	p.Gly476Ser	missense variant	-	NC_000012.12:g.52516650C>T	gnomAD
rs56922686	p.Gly476Asp	missense variant	-	NC_000012.12:g.52516649C>T	-
rs56922686	p.Gly476Ala	missense variant	-	NC_000012.12:g.52516649C>G	-
rs59190510	p.Glu477Lys	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516647C>T	UniProt,dbSNP
VAR_010467	p.Glu477Lys	missense variant	Epidermolysis bullosa simplex, Dowling-Meara type (DM-EBS)	NC_000012.12:g.52516647C>T	UniProt
rs59190510	p.Glu477Lys	missense variant	-	NC_000012.12:g.52516647C>T	-
RCV000056566	p.Glu477Ter	nonsense	-	NC_000012.12:g.52516647C>A	ClinVar
RCV000020296	p.Glu477Lys	missense variant	Epidermolysis bullosa herpetiformis, Dowling-Meara (EBSDM)	NC_000012.12:g.52516647C>T	ClinVar
RCV000056567	p.Glu477Gly	missense variant	-	NC_000012.12:g.52516646T>C	ClinVar
rs59190510	p.Glu477Ter	stop gained	-	NC_000012.12:g.52516647C>A	-
rs58319159	p.Glu477Gly	missense variant	-	NC_000012.12:g.52516646T>C	-
RCV000056569	p.Glu478Ter	nonsense	-	NC_000012.12:g.52516639del	ClinVar
rs267607438	p.Glu478Lys	missense variant	-	NC_000012.12:g.52516644C>T	-
RCV000056568	p.Glu478Lys	missense variant	-	NC_000012.12:g.52516644C>T	ClinVar
rs374468864	p.Cys479Tyr	missense variant	-	NC_000012.12:g.52516640C>T	ESP,ExAC,gnomAD
RCV000056570	p.Arg480Gly	missense variant	-	NC_000012.12:g.52516638T>C	ClinVar
rs267607446	p.Arg480Gly	missense variant	-	NC_000012.12:g.52516638T>C	-
NCI-TCGA novel	p.Gly483Ter	stop gained	-	NC_000012.12:g.52515825C>A	NCI-TCGA
rs765274259	p.Glu484Ala	missense variant	-	NC_000012.12:g.52515821T>G	ExAC,gnomAD
rs369400727	p.Gly485Arg	missense variant	-	NC_000012.12:g.52515819C>T	ESP,ExAC,gnomAD
rs753424487	p.Val486Gly	missense variant	-	NC_000012.12:g.52515815A>C	ExAC,gnomAD
rs1456741479	p.Gly487Ala	missense variant	-	NC_000012.12:g.52515812C>G	gnomAD
rs765859104	p.Pro488Ser	missense variant	-	NC_000012.12:g.52515810G>A	ExAC,gnomAD
NCI-TCGA novel	p.Ile491PheGlyProValAsnIle	insertion	-	NC_000012.12:g.52515240_52515241insAGATGTTGACTGGTCCAA	NCI-TCGA
NCI-TCGA novel	p.Ser492TyrPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52515240_52515241insAGATGTTGACTGGTCCAACTCCTTCTCCACTGAGT	NCI-TCGA
NCI-TCGA novel	p.Ser492LeuPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52515240_52515241insAGATGTTGACTGGTCCAACTCCTTCTCCA	NCI-TCGA
NCI-TCGA novel	p.Ser492Ter	stop gained	-	NC_000012.12:g.52515240_52515241insAGATGTTGACTGGTCCAACTCCTTCTCCACTGAGTCTGCATTC	NCI-TCGA
rs1159675209	p.Ser492Phe	missense variant	-	NC_000012.12:g.52515240G>A	gnomAD
NCI-TCGA novel	p.Val493Ala	missense variant	-	NC_000012.12:g.52515237A>G	NCI-TCGA
NCI-TCGA novel	p.Val494Asp	missense variant	-	NC_000012.12:g.52515234A>T	NCI-TCGA
rs781440465	p.Ser496Ile	missense variant	-	NC_000012.12:g.52515228C>A	ExAC,gnomAD
rs747286504	p.Ser499Phe	missense variant	-	NC_000012.12:g.52515219G>A	ExAC,gnomAD
rs201274668	p.Ser499Pro	missense variant	-	NC_000012.12:g.52515220A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1452627937	p.Ser500Tyr	missense variant	-	NC_000012.12:g.52515216G>T	gnomAD
rs1477999089	p.Gly503Ser	missense variant	-	NC_000012.12:g.52515208C>T	TOPMed
rs754888747	p.Ser504Arg	missense variant	-	NC_000012.12:g.52515203A>C	ExAC,gnomAD
rs1171141730	p.Gly509Asp	missense variant	-	NC_000012.12:g.52515189C>T	TOPMed
NCI-TCGA novel	p.Gly510Cys	missense variant	-	NC_000012.12:g.52515187C>A	NCI-TCGA
rs1267846830	p.Gly510Ser	missense variant	-	NC_000012.12:g.52515187C>T	TOPMed
rs1304444355	p.Gly511Asp	missense variant	-	NC_000012.12:g.52515183C>T	TOPMed
rs145442570	p.Gly513Ser	missense variant	-	NC_000012.12:g.52515178C>T	ESP,ExAC,TOPMed,gnomAD
COSM4817788	p.Gly514Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52515175C>T	NCI-TCGA Cosmic
rs767103163	p.Leu516Pro	missense variant	-	NC_000012.12:g.52515168A>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu516Phe	missense variant	-	NC_000012.12:g.52515169G>A	NCI-TCGA
COSM940755	p.Leu516Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52515169G>T	NCI-TCGA Cosmic
RCV000056573	p.Gly517Asp	missense variant	-	NC_000012.12:g.52515165C>T	ClinVar
rs58608695	p.Gly517Asp	missense variant	-	NC_000012.12:g.52515165C>T	-
rs370820008	p.Gly518Ser	missense variant	-	NC_000012.12:g.52515163C>T	ESP,ExAC,TOPMed,gnomAD
rs370820008	p.Gly518Cys	missense variant	-	NC_000012.12:g.52515163C>A	ESP,ExAC,TOPMed,gnomAD
rs1360809513	p.Gly518Asp	missense variant	-	NC_000012.12:g.52515162C>T	gnomAD
rs140352947	p.Gly519Ser	missense variant	-	NC_000012.12:g.52515160C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000284119	p.Gly519Ser	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52515160C>T	ClinVar
rs1432426125	p.Leu520Phe	missense variant	-	NC_000012.12:g.52515157G>A	gnomAD
rs375140289	p.Gly521Ser	missense variant	-	NC_000012.12:g.52515154C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs375140289	p.Gly521Cys	missense variant	-	NC_000012.12:g.52515154C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1450553863	p.Gly522Glu	missense variant	-	NC_000012.12:g.52515150C>T	TOPMed
rs776555128	p.Gly523Asp	missense variant	-	NC_000012.12:g.52515147C>T	ExAC,TOPMed,gnomAD
rs1427446231	p.Ala525Asp	missense variant	-	NC_000012.12:g.52515141G>T	TOPMed
rs571604097	p.Gly526Arg	missense variant	-	NC_000012.12:g.52515139C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1489330570	p.Gly526Glu	missense variant	-	NC_000012.12:g.52515138C>T	gnomAD
rs200188533	p.Gly527Val	missense variant	-	NC_000012.12:g.52515135C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs200188533	p.Gly527Asp	missense variant	-	NC_000012.12:g.52515135C>T	1000Genomes,ExAC,TOPMed,gnomAD
RCV000244641	p.Ser528Gly	missense variant	-	NC_000012.12:g.52515133T>C	ClinVar
rs11549950	p.Ser528Gly	missense variant	-	NC_000012.12:g.52515133T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs11549950	p.Ser528Gly	missense variant	-	NC_000012.12:g.52515133T>C	UniProt,dbSNP
VAR_028767	p.Ser528Gly	missense variant	-	NC_000012.12:g.52515133T>C	UniProt
RCV000344518	p.Ser528Gly	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52515133T>C	ClinVar
rs780003015	p.Ser529Asn	missense variant	-	NC_000012.12:g.52515129C>T	ExAC,gnomAD
rs371846215	p.Ser529Arg	missense variant	-	NC_000012.12:g.52515128A>T	ESP,TOPMed,gnomAD
rs1338717205	p.Tyr532Cys	missense variant	-	NC_000012.12:g.52515120T>C	gnomAD
rs755981320	p.Ser534Ala	missense variant	-	NC_000012.12:g.52515115A>C	ExAC
rs186608084	p.Ser535Arg	missense variant	-	NC_000012.12:g.52515110G>T	1000Genomes,ExAC,gnomAD
rs921340055	p.Ser535Asn	missense variant	-	NC_000012.12:g.52515111C>T	TOPMed
rs200916228	p.Ser536Asn	missense variant	-	NC_000012.12:g.52515108C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs751150862	p.Ser537Arg	missense variant	-	NC_000012.12:g.52515106T>G	ExAC,gnomAD
rs1336614177	p.Gly538Glu	missense variant	-	NC_000012.12:g.52515102C>T	TOPMed,gnomAD
rs1360525919	p.Gly538Arg	missense variant	-	NC_000012.12:g.52515103C>T	TOPMed,gnomAD
rs753029185	p.Gly539Asp	missense variant	-	NC_000012.12:g.52515099C>T	ExAC,TOPMed,gnomAD
rs143566042	p.Gly539Ser	missense variant	-	NC_000012.12:g.52515100C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs200216169	p.Gly541Ser	missense variant	-	NC_000012.12:g.52515094C>T	1000Genomes,TOPMed,gnomAD
rs11549949	p.Gly543Cys	missense variant	-	NC_000012.12:g.52515088C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs11549949	p.Gly543Ser	missense variant	-	NC_000012.12:g.52515088C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs11549949	p.Gly543Ser	missense variant	-	NC_000012.12:g.52515088C>T	UniProt,dbSNP
VAR_028768	p.Gly543Ser	missense variant	-	NC_000012.12:g.52515088C>T	UniProt
rs11549949	p.Gly543Arg	missense variant	-	NC_000012.12:g.52515088C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000056575	p.Gly543Ser	missense variant	-	NC_000012.12:g.52515088C>T	ClinVar
rs543699099	p.Gly544Val	missense variant	-	NC_000012.12:g.52515084C>A	1000Genomes,ExAC,gnomAD
rs533422741	p.Gly545Glu	missense variant	-	NC_000012.12:g.52515081C>T	1000Genomes,ExAC,gnomAD
RCV000056576	p.Leu546Ter	frameshift	-	NC_000012.12:g.52515082del	ClinVar
rs114734812	p.Leu546Ile	missense variant	-	NC_000012.12:g.52515079G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000056577	p.Leu546Ile	missense variant	-	NC_000012.12:g.52515079G>T	ClinVar
NCI-TCGA novel	p.Ser547TrpPheSerTerUnkUnk	frameshift	-	NC_000012.12:g.52515070_52515083CCACACTGAGCCCA>-	NCI-TCGA
rs775116551	p.Ser547Gly	missense variant	-	NC_000012.12:g.52515076T>C	ExAC,gnomAD
rs761296995	p.Val548ValLeuTrpTerLeuUnk	stop gained	-	NC_000012.12:g.52515071_52515072insCTAATTACCATAAA	ExAC
rs745778115	p.Gly549Arg	missense variant	-	NC_000012.12:g.52515070C>G	ExAC,gnomAD
COSM3462312	p.Gly549Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000012.12:g.52515069C>T	NCI-TCGA Cosmic
rs1472218681	p.Gly549Ala	missense variant	-	NC_000012.12:g.52515069C>G	TOPMed
RCV000056578	p.Gly550Ter	frameshift	-	NC_000012.12:g.52515071del	ClinVar
RCV000015761	p.Gly550Ter	frameshift	Epidermolysis bullosa simplex with migratory circinate erythema	NC_000012.12:g.52515071del	ClinVar
rs746549590	p.Gly550Ala	missense variant	-	NC_000012.12:g.52515066C>G	ExAC,TOPMed,gnomAD
rs770359543	p.Gly550Ser	missense variant	-	NC_000012.12:g.52515067C>T	ExAC,gnomAD
rs752438760	p.Phe553Leu	missense variant	-	NC_000012.12:g.52515056G>T	ExAC,gnomAD
rs779144030	p.Ala555Thr	missense variant	-	NC_000012.12:g.52515052C>T	ExAC,gnomAD
rs1403642422	p.Ser557Thr	missense variant	-	NC_000012.12:g.52515045C>G	gnomAD
RCV000256176	p.Arg559Ter	nonsense	-	NC_000012.12:g.52515040G>A	ClinVar
rs182482982	p.Arg559Gln	missense variant	-	NC_000012.12:g.52515039C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs182482982	p.Arg559Leu	missense variant	-	NC_000012.12:g.52515039C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs754242209	p.Arg559Ter	stop gained	-	NC_000012.12:g.52515040G>A	ExAC,TOPMed,gnomAD
rs750554604	p.Gly560Arg	missense variant	-	NC_000012.12:g.52515037C>T	ExAC,TOPMed,gnomAD
rs1458198475	p.Leu561Arg	missense variant	-	NC_000012.12:g.52515033A>C	TOPMed,gnomAD
rs980414870	p.Gly562Arg	missense variant	-	NC_000012.12:g.52515031C>T	TOPMed
rs1242622848	p.Val563Gly	missense variant	-	NC_000012.12:g.52515027A>C	TOPMed
NCI-TCGA novel	p.Gly564Ser	missense variant	-	NC_000012.12:g.52515025C>T	NCI-TCGA
rs1323027579	p.Phe565Leu	missense variant	-	NC_000012.12:g.52515020A>C	gnomAD
NCI-TCGA novel	p.Gly566Ala	missense variant	-	NC_000012.12:g.52515018C>G	NCI-TCGA
rs1289903952	p.Gly566Asp	missense variant	-	NC_000012.12:g.52515018C>T	TOPMed,gnomAD
rs1222858963	p.Ser567Arg	missense variant	-	NC_000012.12:g.52515014A>C	gnomAD
rs1228364754	p.Gly568Asp	missense variant	-	NC_000012.12:g.52515012C>T	TOPMed
RCV000388341	p.Gly569Arg	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52515010C>T	ClinVar
rs148276250	p.Gly569Arg	missense variant	-	NC_000012.12:g.52515010C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs148276250	p.Gly569Trp	missense variant	-	NC_000012.12:g.52515010C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs148276250	p.Gly569Arg	missense variant	-	NC_000012.12:g.52515010C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs770872825	p.Gly569Glu	missense variant	-	NC_000012.12:g.52515009C>T	ExAC,gnomAD
rs771681325	p.Gly570Cys	missense variant	-	NC_000012.12:g.52515007C>A	ExAC,gnomAD
rs771681325	p.Gly570Arg	missense variant	-	NC_000012.12:g.52515007C>G	ExAC,gnomAD
rs771681325	p.Gly570Ser	missense variant	-	NC_000012.12:g.52515007C>T	ExAC,gnomAD
rs1434878695	p.Gly570Val	missense variant	-	NC_000012.12:g.52515006C>A	gnomAD
rs1351700157	p.Ser571Gly	missense variant	-	NC_000012.12:g.52515004T>C	gnomAD
rs778643234	p.Ser571Arg	missense variant	-	NC_000012.12:g.52515002G>C	ExAC
rs1419399135	p.Ser572Asn	missense variant	-	NC_000012.12:g.52515000C>T	gnomAD
rs755232621	p.Ser572Arg	missense variant	-	NC_000012.12:g.52515001T>G	ExAC,gnomAD
rs371399560	p.Ser573Phe	missense variant	-	NC_000012.12:g.52514997G>A	ESP
rs1044552514	p.Ser574Arg	missense variant	-	NC_000012.12:g.52514995T>G	gnomAD
rs572464702	p.Ser574Arg	missense variant	-	NC_000012.12:g.52514993G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs552694552	p.Val575Phe	missense variant	-	NC_000012.12:g.52514992C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs552694552	p.Val575Ile	missense variant	-	NC_000012.12:g.52514992C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs751037633	p.Lys576Glu	missense variant	-	NC_000012.12:g.52514989T>C	ExAC,gnomAD
RCV000056580	p.Phe577Tyr	missense variant	-	NC_000012.12:g.52514985A>T	ClinVar
rs767689296	p.Phe577Ile	missense variant	-	NC_000012.12:g.52514986A>T	ExAC,gnomAD
rs267607442	p.Phe577Tyr	missense variant	-	NC_000012.12:g.52514985A>T	-
rs1246854113	p.Val578Phe	missense variant	-	NC_000012.12:g.52514983C>A	TOPMed,gnomAD
RCV000333840	p.Ser579Tyr	missense variant	Epidermolysis bullosa simplex	NC_000012.12:g.52514979G>T	ClinVar
rs781707438	p.Ser579Tyr	missense variant	-	NC_000012.12:g.52514979G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser582Tyr	missense variant	-	NC_000012.12:g.52514970G>T	NCI-TCGA
rs975373821	p.Ser583Phe	missense variant	-	NC_000012.12:g.52514967G>A	TOPMed,gnomAD
rs1312600827	p.Ser584Pro	missense variant	-	NC_000012.12:g.52514965A>G	gnomAD
rs776384768	p.Arg585Leu	missense variant	-	NC_000012.12:g.52514961C>A	ExAC,gnomAD
rs759198073	p.Arg585Trp	missense variant	-	NC_000012.12:g.52514962G>A	ExAC,TOPMed,gnomAD
rs776384768	p.Arg585Gln	missense variant	-	NC_000012.12:g.52514961C>T	ExAC,gnomAD
NCI-TCGA novel	p.Ser587Asn	missense variant	-	NC_000012.12:g.52514955C>T	NCI-TCGA
rs1300949414	p.Lys589Asn	missense variant	-	NC_000012.12:g.52514948C>G	gnomAD
rs1354888572	p.Lys589Arg	missense variant	-	NC_000012.12:g.52514949T>C	gnomAD
rs770756355	p.Ser590Asn	missense variant	-	NC_000012.12:g.52514946C>T	ExAC,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001418	Adenocarcinoma	group	BEFREE;LHGDN
C0004763	Barrett Esophagus	disease	BEFREE
C0005684	Malignant neoplasm of urinary bladder	disease	BEFREE;RGD
C0005695	Bladder Neoplasm	group	BEFREE;RGD
C0005745	Blepharoptosis	disease	HPO
C0006118	Brain Neoplasms	group	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE;CTD_human
C0006826	Malignant Neoplasms	group	BEFREE
C0007097	Carcinoma	group	CTD_human
C0007117	Basal cell carcinoma	disease	CTD_human;GWASCAT
C0007124	Noninfiltrating Intraductal Carcinoma	disease	BEFREE
C0007131	Non-Small Cell Lung Carcinoma	disease	BEFREE
C0007137	Squamous cell carcinoma	disease	BEFREE;LHGDN
C0007621	Neoplastic Cell Transformation	phenotype	CTD_human
C0008626	Congenital chromosomal disease	group	BEFREE
C0010606	Adenoid Cystic Carcinoma	disease	CTD_human
C0014527	Epidermolysis Bullosa	disease	BEFREE;GENOMICS_ENGLAND;LHGDN
C0015230	Exanthema	phenotype	HPO
C0020458	Hyperhidrosis disorder	phenotype	HPO
C0020507	Hyperplasia	phenotype	LHGDN
C0021051	Immunologic Deficiency Syndromes	group	BEFREE
C0021400	Influenza	disease	BEFREE
C0022408	Arthropathy	group	BEFREE
C0022596	Palmoplantar Keratosis	disease	BEFREE;HPO
C0023532	Leukoplakia, Oral	disease	HPO
C0023903	Liver neoplasms	group	BEFREE
C0024117	Chronic Obstructive Airway Disease	disease	BEFREE
C0024667	Animal Mammary Neoplasms	group	CTD_human
C0024668	Mammary Neoplasms, Experimental	group	CTD_human
C0025500	Mesothelioma	disease	LHGDN
C0026896	Myasthenia Gravis	disease	BEFREE
C0026936	Mycoplasma Infections	group	BEFREE
C0027339	Nail Diseases	group	HPO
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0028880	Odontogenic Tumors	group	BEFREE
C0029408	Degenerative polyarthritis	disease	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0030354	Papilloma	disease	BEFREE
C0032927	Precancerous Conditions	group	BEFREE
C0033860	Psoriasis	disease	BEFREE
C0036095	Salivary Gland Neoplasms	group	CTD_human
C0037274	Dermatologic disorders	group	BEFREE
C0037277	Skin Diseases, Genetic	group	BEFREE
C0037286	Skin Neoplasms	group	BEFREE
C0038990	Sweating	phenotype	HPO
C0041834	Erythema	phenotype	HPO
C0079295	Epidermolysis Bullosa Herpetiformis Dowling-Meara	disease	BEFREE;CLINVAR;CTD_human;MGD;ORPHANET;UNIPROT
C0079298	Epidermolysis Bullosa Simplex	disease	BEFREE;CTD_human;LHGDN;MGD
C0079299	Epidermolysis Bullosa Simplex Kobner	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C0080333	Weber-Cockayne Syndrome	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C0151686	Growth retardation	phenotype	HPO
C0153381	Malignant neoplasm of mouth	disease	BEFREE
C0158266	Intervertebral Disc Degeneration	disease	BEFREE
C0162154	Atrophic scar	phenotype	HPO
C0162311	Androgenetic Alopecia	disease	BEFREE
C0205696	Anaplastic carcinoma	disease	CTD_human
C0205697	Carcinoma, Spindle-Cell	disease	CTD_human
C0205698	Undifferentiated carcinoma	phenotype	CTD_human
C0205699	Carcinomatosis	phenotype	CTD_human
C0206623	Adenosquamous carcinoma	disease	BEFREE
C0206686	Adrenocortical carcinoma	disease	BEFREE
C0206692	Carcinoma, Lobular	disease	LHGDN
C0206706	Verrucous carcinoma	disease	BEFREE
C0220636	Malignant neoplasm of salivary gland	disease	CTD_human
C0220641	Lip and Oral Cavity Carcinoma	disease	BEFREE
C0221228	Comedone	disease	BEFREE
C0221260	Dystrophia unguium	disease	HPO
C0241054	Skin bullae	phenotype	HPO
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0263367	K?bner phenomenon	disease	BEFREE
C0263537	Onychogryposis	disease	HPO
C0263580	Ichthyosis hystrix	disease	BEFREE
C0279671	Cervical Squamous Cell Carcinoma	disease	BEFREE
C0333693	Triploidy syndrome	disease	BEFREE
C0345996	Milium Cyst	phenotype	HPO
C0346402	Malignant neoplasm of adrenal cortex	disease	BEFREE
C0406557	Poikiloderma of Kindler	disease	BEFREE
C0406811	Reticulate acropigmentation of Kitamura	disease	CTD_human
C0423798	Increased tendency to bruise	phenotype	HPO
C0423820	Ridged nails	phenotype	HPO
C0432315	Epidermolysis bullosa simplex herpetiformis	disease	BEFREE
C0432316	Epidermolysis bullosa simplex with mottled pigmentation	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C0456070	Growth delay	phenotype	HPO
C0521158	Recurrent tumor	phenotype	BEFREE
C0549567	Pigmentation Disorders	group	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0677886	Epithelial ovarian cancer	disease	BEFREE
C0677944	Sentinel node (disorder)	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE;CTD_human
C0684249	Carcinoma of lung	disease	BEFREE
C0686619	Secondary malignant neoplasm of lymph node	disease	BEFREE
C0699885	Carcinoma of bladder	disease	BEFREE
C0700590	Increased sweating	phenotype	HPO
C0751401	Ophthalmoparesis	phenotype	HPO
C0751688	Malignant Squamous Cell Neoplasm	disease	BEFREE
C0853087	Nail abnormality	phenotype	HPO
C0854107	Subcutaneous hemorrhage	disease	HPO
C0858252	Breast adenocarcinoma	disease	BEFREE
C0860580	Medullary carcinoma of breast	disease	BEFREE
C0870082	Hyperkeratosis	group	BEFREE
C0878787	Growth failure	phenotype	HPO
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE
C1257925	Mammary Carcinoma, Animal	disease	CTD_human
C1257931	Mammary Neoplasms, Human	group	CTD_human
C1260926	Abnormal pigmentation	phenotype	HPO
C1306459	Primary malignant neoplasm	group	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1332629	Breast Fibrocystic Change, Proliferative Type	disease	BEFREE
C1368275	Pigmented Basal Cell Carcinoma	disease	CTD_human
C1458155	Mammary Neoplasms	group	CTD_human;LHGDN
C1704317	Leukokeratosis	phenotype	HPO
C1706827	Apocrine Carcinoma	disease	BEFREE
C1832926	EPIDERMOLYSIS BULLOSA SIMPLEX, AUTOSOMAL RECESSIVE (disorder)	disease	CLINVAR;CTD_human
C1834405	Nail dysplasia	disease	HPO
C1836284	Epidermolysis Bullosa Simplex with Migratory Circinate Erythema	disease	BEFREE;CLINVAR;CTD_human;ORPHANET
C1836735	hypopigmented skin patch	phenotype	HPO
C1837385	Poor growth	phenotype	HPO
C1837388	Abnormal pattern of respiration	phenotype	HPO
C1851551	Mottled pigmentation of the trunk and proximal extremities	phenotype	HPO
C1851552	Discrete 2 to 5-mm hyper- and hypopigmented macules	phenotype	HPO
C1853193	Recurrent skin infections	phenotype	HPO
C1855106	Neonatal onset	phenotype	HPO
C1857656	Prematurely aged appearance	phenotype	HPO
C1969913	Generalized hyperkeratosis	phenotype	HPO
C2132198	Abnormal blistering of the skin	phenotype	HPO
C2220104	Skin blisters	phenotype	HPO
C2239176	Liver carcinoma	disease	BEFREE
C3279575	Reticulated skin pigmentation	phenotype	HPO
C3279601	Reticular pigmentation pattern	phenotype	HPO
C3539878	Triple Negative Breast Neoplasms	disease	BEFREE
C3552463	Very poor growth	phenotype	HPO
C3642345	Luminal A Breast Carcinoma	disease	BEFREE
C3714534	dowling-degos disease	disease	BEFREE;CLINVAR;CTD_human;ORPHANET
C3811653	Experimental Organism Basal Cell Carcinoma	phenotype	BEFREE
C3814530	Skin Vesicle	phenotype	HPO
C4016235	EPIDERMOLYSIS BULLOSA SIMPLEX, DOWLING-MEARA TYPE, WITH SEVERE PALMOPLANTAR KERATODERMA	phenotype	CLINVAR
C4016236	EPIDERMOLYSIS BULLOSA SIMPLEX, GENERALIZED, WITH SEVERE PALMOPLANTAR KERATOSIS	phenotype	CLINVAR
C4021800	Abnormality of dental enamel	phenotype	HPO
C4024851	Punctate palmoplantar hyperkeratosis	disease	HPO
C4024872	Progressive reticulate hyperpigmentation	disease	HPO
C4024876	Palmoplantar blistering	phenotype	HPO
C4280262	Dystrophic tooth enamel	phenotype	HPO
C4280615	Defective tooth enamel	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0005200	structural constituent of cytoskeleton	TAS
GO:0005515	protein binding	IPI
GO:0097110	scaffold protein binding	IPI

GO:Biological Process

GO ID	GO Term	Evidence
GO:0007010	cytoskeleton organization	IEA
GO:0008544	epidermis development	TAS
GO:0031424	keratinization	TAS
GO:0031581	hemidesmosome assembly	TAS
GO:0070268	cornification	TAS

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005634	nucleus	HDA
GO:0005737	cytoplasm	IDA
GO:0005829	cytosol	TAS
GO:0005882	intermediate filament	IDA
GO:0005886	plasma membrane	IEA
GO:0016020	membrane	HDA
GO:0045095	keratin filament	IDA
GO:0070062	extracellular exosome	HDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1266738	Developmental Biology	TAS
R-HSA-1500931	Cell-Cell communication	TAS
R-HSA-446107	Type I hemidesmosome assembly	TAS
R-HSA-446728	Cell junction organization	TAS
R-HSA-6805567	Keratinization	TAS
R-HSA-6809371	Formation of the cornified envelope	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D020001	1-Butanol	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in decreased expression of KRT5 mRNA	25614096
C049584	2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine	2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased expression of KRT5 mRNA	12376462
C028451	3,4,3',4'-tetrachlorobiphenyl	3,4,3',4'-tetrachlorobiphenyl inhibits the reaction [Dietary Fats results in increased expression of KRT5 mRNA]	19467301
C038864	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid results in decreased expression of KRT5 mRNA	8853895
C009505	4,4'-diaminodiphenylmethane	4,4'-diaminodiphenylmethane results in decreased expression of KRT5 mRNA	18648102
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide results in increased expression of KRT5 protein	25670856
C041594	4-nonylphenol	[bisphenol A co-treated with 4-nonylphenol co-treated with Diethylhexyl Phthalate] affects the expression of KRT5 mRNA	30619083
C002202	4-oxoretinoic acid	4-oxoretinoic acid results in decreased expression of KRT5 mRNA	15982314
D015127	9,10-Dimethyl-1,2-benzanthracene	[9,10-Dimethyl-1,2-benzanthracene co-treated with Isoflavones] results in increased expression of KRT5 protein	22248470
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in increased expression of KRT5 mRNA	12376462; 19480007;
D000082	Acetaminophen	Acetaminophen results in decreased expression of KRT5 mRNA	22230336; 29067470;
D020106	Acrylamide	Acrylamide results in decreased expression of KRT5 protein	29784925
D020106	Acrylamide	Acrylamide results in increased expression of KRT5 mRNA	28959563
D000336	Aerosols	Aerosols results in decreased expression of KRT5 mRNA	29505817
D000077556	Alitretinoin	Alitretinoin results in decreased expression of KRT5 mRNA	15982314; 8853895;
D000535	Aluminum	[APP protein modified form binds to Aluminum] which results in decreased expression of KRT5 mRNA	21298039
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of KRT5 mRNA	16483693
C030419	andrographolide	[andrographolide co-treated with beta-Naphthoflavone] results in increased expression of KRT5 mRNA	19737545
C015001	arsenite	arsenite results in increased expression of KRT5 mRNA	22011395; 24704393;
C015001	arsenite	arsenite results in increased expression of KRT5 protein	22011395
C015001	arsenite	MIRLET7C mRNA inhibits the reaction [arsenite results in increased expression of KRT5 mRNA]	24704393
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased methylation of KRT5 promoter	28329817
D001564	Benzo(a)pyrene	Benzo(a)pyrene affects the methylation of KRT5 exon	30157460
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased mutagenesis of KRT5 gene	25435355
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of KRT5 mRNA	19770486; 21715664;
C026487	benzo(e)pyrene	benzo(e)pyrene results in increased methylation of KRT5 exon	30157460
D019324	beta-Naphthoflavone	[andrographolide co-treated with beta-Naphthoflavone] results in increased expression of KRT5 mRNA	19737545
D000077610	Bexarotene	Bexarotene results in decreased expression of KRT5 mRNA	8853895
C006780	bisphenol A	bisphenol A affects the expression of KRT5 mRNA	20170705
C006780	bisphenol A	bisphenol A results in increased expression of KRT5 mRNA	26363213
C006780	bisphenol A	[bisphenol A co-treated with 4-nonylphenol co-treated with Diethylhexyl Phthalate] affects the expression of KRT5 mRNA	30619083
C006780	bisphenol A	bisphenol A results in increased expression of KRT5 mRNA	30387366
C006780	bisphenol A	bisphenol A results in increased methylation of KRT5 gene	28505145
C000611646	bisphenol F	bisphenol F results in increased expression of KRT5 mRNA	30951980
D002104	Cadmium	[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of KRT5 mRNA	29741670
D002104	Cadmium	Cadmium results in increased expression of KRT5 protein	20049202
D002104	Cadmium	KRT5 protein binds to Cadmium	23896426
D019256	Cadmium Chloride	Cadmium Chloride affects the expression of KRT5 protein	24874008
D019256	Cadmium Chloride	[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of KRT5 mRNA	29741670
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of KRT5 protein	26220685
D002117	Calcitriol	Calcitriol results in increased expression of KRT5 mRNA	26485663
D002726	Chlorogenic Acid	Chlorogenic Acid results in increased expression of KRT5 mRNA	20706672
C100187	chloropicrin	chloropicrin affects the expression of KRT5 mRNA	26352163
C100187	chloropicrin	chloropicrin results in decreased expression of KRT5 mRNA	28476498
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of KRT5 mRNA	20938992
C074702	chromium hexavalent ion	chromium hexavalent ion affects the expression of KRT5 mRNA	24374135
D003300	Copper	Copper results in increased expression of KRT5 protein	22480594
D019327	Copper Sulfate	Copper Sulfate results in decreased expression of KRT5 mRNA	19020976
D000077209	Decitabine	Decitabine results in increased expression of KRT5 mRNA	17908484
D003907	Dexamethasone	Dexamethasone inhibits the reaction [RX3 gene mutant form affects the expression of KRT5 mRNA]	27941970
D004041	Dietary Fats	3,4,3',4'-tetrachlorobiphenyl inhibits the reaction [Dietary Fats results in increased expression of KRT5 mRNA]	19467301
D004041	Dietary Fats	Dietary Fats results in increased expression of KRT5 mRNA	19467301
D004051	Diethylhexyl Phthalate	[bisphenol A co-treated with 4-nonylphenol co-treated with Diethylhexyl Phthalate] affects the expression of KRT5 mRNA	30619083
D004052	Diethylnitrosamine	[Phenobarbital co-treated with Diethylnitrosamine] results in increased expression of KRT5 protein	20935162
C025605	diisobutyl phthalate	diisobutyl phthalate results in decreased expression of KRT5 mRNA	29458080
D004237	Diuron	Diuron results in increased expression of KRT5 mRNA	21551480
D004791	Enzyme Inhibitors	[Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of KRT5 protein	23301498
D004958	Estradiol	Estradiol results in decreased expression of KRT5 mRNA	29458080
D004958	Estradiol	[Estradiol co-treated with TGFB1 protein] results in decreased expression of KRT5 mRNA	30165855
D004958	Estradiol	Estradiol results in decreased expression of KRT5 mRNA	23019147
D000431	Ethanol	Ethanol results in decreased expression of KRT5 mRNA	29361514
D000431	Ethanol	[[Gasoline co-treated with Ethanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of KRT5 mRNA	20170705
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of KRT5 mRNA	17555576
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of KRT5 mRNA	17351261
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of KRT5 mRNA	15576828; 30387366;
C034814	ethyl-p-((E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthyl)-1-propenyl)benzoic acid	ethyl-p-((E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthyl)-1-propenyl)benzoic acid results in decreased expression of KRT5 mRNA	7505756
D005472	Fluorouracil	Fluorouracil results in decreased expression of KRT5 protein	15352031
D005472	Fluorouracil	KRT5 protein affects the susceptibility to Fluorouracil	15352031
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of KRT5 mRNA	20938992
D005742	Gasoline	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D005742	Gasoline	[[Gasoline co-treated with Ethanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D005742	Gasoline	[[Gasoline co-treated with isobutyl alcohol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D005742	Gasoline	[Gasoline results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D019833	Genistein	Genistein results in decreased expression of KRT5 mRNA	20706672
D019833	Genistein	Genistein results in increased expression of KRT5 mRNA	24365114
D019833	Genistein	Genistein results in increased expression of KRT5 mRNA	17341692
D000068877	Imatinib Mesylate	Imatinib Mesylate results in increased expression of KRT5 protein	15764042
C082359	imidacloprid	imidacloprid results in decreased expression of KRT5 mRNA	27782041
D000077146	Irinotecan	Irinotecan metabolite results in decreased expression of KRT5 mRNA	15956246
D000077146	Irinotecan	Irinotecan results in decreased expression of KRT5 mRNA	15956246
C040507	isobutyl alcohol	[[Gasoline co-treated with isobutyl alcohol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D007529	Isoflavones	[9,10-Dimethyl-1,2-benzanthracene co-treated with Isoflavones] results in increased expression of KRT5 protein	22248470
D015474	Isotretinoin	Isotretinoin results in decreased expression of KRT5 mRNA	15982314
D007854	Lead	KRT5 protein binds to Lead	23896426
D008627	Mercuric Chloride	Mercuric Chloride affects the expression of KRT5 protein	21458406
D008701	Methapyrilene	Methapyrilene results in increased methylation of KRT5 exon	30157460
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of KRT5 mRNA	20938992
C004925	methylmercuric chloride	methylmercuric chloride results in decreased expression of KRT5 mRNA	23458150
D008767	Methylmercury Compounds	Methylmercury Compounds results in decreased expression of KRT5 mRNA	27544571
D009020	Morphine	Morphine results in decreased expression of KRT5 protein	23056601
D009151	Mustard Gas	Mustard Gas promotes the reaction [KRT14 protein binds to KRT5 protein]	14644625
D009151	Mustard Gas	Mustard Gas promotes the reaction [KRT5 protein binds to KRT5 protein]	14644625
D009151	Mustard Gas	Mustard Gas results in increased alkylation of KRT5 protein	18342354
D009151	Mustard Gas	Mustard Gas results in increased phosphorylation of KRT5 protein	19845377
D009532	Nickel	KRT5 protein binds to Nickel	23896426
D009534	Niclosamide	Niclosamide results in decreased expression of KRT5 mRNA	30165700; 31398420;
C014707	nitrosobenzylmethylamine	nitrosobenzylmethylamine results in increased expression of KRT5 mRNA	17616710
C002741	N-nitrosomorpholine	N-nitrosomorpholine affects the expression of KRT5 protein	19716841
C485800	osajin	osajin results in increased expression of KRT5 mRNA	20706672
D052638	Particulate Matter	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D052638	Particulate Matter	[[Gasoline co-treated with Ethanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D052638	Particulate Matter	[[Gasoline co-treated with isobutyl alcohol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D052638	Particulate Matter	[Gasoline results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D010634	Phenobarbital	[Phenobarbital co-treated with Diethylnitrosamine] results in increased expression of KRT5 protein	20935162
C025319	phenyl isocyanate	phenyl isocyanate analog binds to KRT5 protein	26070416
D010936	Plant Extracts	Plant Extracts results in decreased expression of KRT5 mRNA	25051199
D011084	Polycyclic Aromatic Hydrocarbons	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D011084	Polycyclic Aromatic Hydrocarbons	[[Gasoline co-treated with Ethanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D011084	Polycyclic Aromatic Hydrocarbons	[[Gasoline co-treated with isobutyl alcohol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
D011084	Polycyclic Aromatic Hydrocarbons	[Gasoline results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of KRT5 mRNA	29432896
C474837	pomiferin	pomiferin results in increased expression of KRT5 mRNA	20706672
D011429	Propolis	Propolis results in increased expression of KRT5 mRNA	20706672
C006068	propylparaben	propylparaben results in decreased expression of KRT5 mRNA	29458080
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of KRT5 mRNA	24780913
D020849	Raloxifene Hydrochloride	Raloxifene Hydrochloride results in decreased expression of KRT5 mRNA	29458080
D000077185	Resveratrol	Resveratrol results in increased expression of KRT5 mRNA	20706672
D012906	Smoke	Smoke results in decreased expression of KRT5 mRNA	21095227
C009277	sodium arsenate	sodium arsenate results in decreased expression of KRT5 mRNA	16882884; 23922661;
C017947	sodium arsenite	sodium arsenite results in decreased expression of KRT5 mRNA	29361514
C017947	sodium arsenite	sodium arsenite affects the expression of KRT5 mRNA	20056578
C017947	sodium arsenite	sodium arsenite results in decreased expression of KRT5 mRNA	12634122
C017947	sodium arsenite	sodium arsenite results in decreased methylation of KRT5 gene	24570342
C017947	sodium arsenite	sodium arsenite results in increased expression of KRT5 mRNA	12016162; 19524636; 24068038; 24570342; 30167605;
C017947	sodium arsenite	sodium arsenite results in increased expression of KRT5 protein	19524636; 24068038;
C025462	sulindac sulfide	sulindac sulfide results in decreased expression of KRT5 mRNA	12734198
D013629	Tamoxifen	Tamoxifen affects the expression of KRT5 mRNA	17555576
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of KRT5 mRNA	24680724
C009495	titanium dioxide	titanium dioxide results in decreased expression of KRT5 mRNA	23557971
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of KRT5 mRNA	27865774
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of KRT5 protein	30291989
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased expression of KRT5 mRNA	25788831; 27404394; 29505817;
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased expression of KRT5 mRNA	29545142
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased expression of KRT5 protein	29545142
D014212	Tretinoin	Tretinoin results in decreased expression of KRT5 mRNA	18230668
D014212	Tretinoin	Tretinoin metabolite results in decreased expression of KRT5 mRNA	15982314
D014212	Tretinoin	Tretinoin results in decreased expression of KRT5 mRNA	15982314
D014635	Valproic Acid	Valproic Acid results in increased methylation of KRT5 gene	29154799
C025643	vinclozolin	vinclozolin results in decreased expression of KRT5 mRNA	29458080
D015025	Zearalenone	Zearalenone results in increased expression of KRT5 mRNA	28965971
D015032	Zinc	KRT5 protein binds to Zinc	23896426

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0175	Coiled coil
KW-0225	Disease mutation
KW-0263	Epidermolysis bullosa
KW-0403	Intermediate filament
KW-0416	Keratin
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-1185	Reference proteome

Interpro

InterPro ID	InterPro Term
IPR018039	IF_conserved
IPR039008	IF_rod_dom
IPR042180	IF_rod_dom_coil1B
IPR032444	Keratin_2_head
IPR003054	Keratin_II

PROSITE

PROSITE ID	PROSITE Term
PS00226	IF_ROD_1
PS51842	IF_ROD_2

Pfam

Pfam ID	Pfam Term
PF00038	Filament
PF16208	Keratin_2_head

Gene: KRT5

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction