CleftGeneDB-Search

Gene: ITGB6

Basic information

Tag	Content
Uniprot ID	P18564; B2R9W5; C9JA97; Q0VA95; Q16500; Q53RG5; Q53RR6;
Entrez ID	3694
Genbank protein ID	BAG36662.1; AAI21179.1; AAA36122.2; AAX93093.1; AAY24053.1; EAX11390.1; AAB23690.1;
Genbank nucleotide ID	NM_001282388.1; NM_001282355.1; NM_001282353.1; NM_000888.4;
Ensembl protein ID	ENSP00000386828; ENSP00000283249; ENSP00000386367;
Ensembl nucleotide ID	ENSG00000115221
Gene name	Integrin beta-6
Gene symbol	ITGB6
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Integrin alpha-V:beta-6 (ITGAV:ITGB6) is a receptor for fibronectin and cytotactin (PubMed:17545607, PubMed:17158881). It recognizes the sequence R-G-D in its ligands (PubMed:17545607, PubMed:17158881). Internalisation of integrin alpha-V/beta-6 via clathrin-mediated endocytosis promotes carcinoma cell invasion (PubMed:17545607, PubMed:17158881). ITGAV:ITGB6 acts as a receptor for fibrillin-1 (FBN1) and mediates R-G-D-dependent cell adhesion to FBN1 (PubMed:17158881). Integrin alpha-V:beta-6 (ITGAV:ITGB6) mediates R-G-D-dependent release of transforming growth factor beta-1 (TGF-beta-1) from regulatory Latency-associated peptide (LAP), thereby playing a key role in TGF-beta-1 activation (PubMed:15184403, PubMed:22278742, PubMed:28117447).
Sequence	MGIELLCLFF LFLGRNDHVQ GGCALGGAET CEDCLLIGPQ CAWCAQENFT HPSGVGERCD 60 TPANLLAKGC QLNFIENPVS QVEILKNKPL SVGRQKNSSD IVQIAPQSLI LKLRPGGAQT 120 LQVHVRQTED YPVDLYYLMD LSASMDDDLN TIKELGSRLS KEMSKLTSNF RLGFGSFVEK 180 PVSPFVKTTP EEIANPCSSI PYFCLPTFGF KHILPLTNDA ERFNEIVKNQ KISANIDTPE 240 GGFDAIMQAA VCKEKIGWRN DSLHLLVFVS DADSHFGMDS KLAGIVIPND GLCHLDSKNE 300 YSMSTVLEYP TIGQLIDKLV QNNVLLIFAV TQEQVHLYEN YAKLIPGATV GLLQKDSGNI 360 LQLIISAYEE LRSEVELEVL GDTEGLNLSF TAICNNGTLF QHQKKCSHMK VGDTASFSVT 420 VNIPHCERRS RHIIIKPVGL GDALELLVSP ECNCDCQKEV EVNSSKCHHG NGSFQCGVCA 480 CHPGHMGPRC ECGEDMLSTD SCKEAPDHPS CSGRGDCYCG QCICHLSPYG NIYGPYCQCD 540 NFSCVRHKGL LCGGNGDCDC GECVCRSGWT GEYCNCTTST DSCVSEDGVL CSGRGDCVCG 600 KCVCTNPGAS GPTCERCPTC GDPCNSKRSC IECHLSAAGQ AREECVDKCK LAGATISEEE 660 DFSKDGSVSC SLQGENECLI TFLITTDNEG KTIIHSINEK DCPKPPNIPM IMLGVSLAIL 720 LIGVVLLCIW KLLVSFHDRK EVAKFEAERS KAKWQTGTNP LYRGSTSTFK NVTYKHREKQ 780 KVDLSTDC 788

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1LH9
4UM8
4UM9
5FFG
5FFO
5NEM
5NER
5NET
5NEU
4UM8
4UM9
5FFG

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	ITGB6	282644	Q8SQB8		Bos taurus	Prediction	More>>
1:1 ortholog	ITGB6	102188539	A0A452EJ04		Capra hircus	Prediction	More>>
1:1 ortholog	ITGB6	3694	P18564		Homo sapiens	Prediction	More>>
1:1 ortholog	Itgb6	16420	Q9Z0T9	CPO	Mus musculus	Publication	More>>
1:1 ortholog	ITGB6		A0A2I3SC11		Pan troglodytes	Prediction	More>>
1:1 ortholog			A0A480ES98		Sus scrofa	Prediction	More>>
1:1 ortholog	Itgb6	311061	Q6AYF4		Rattus norvegicus	Prediction	More>>
1:1 ortholog	itgb6	100499533	F1QGX0		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1429580834	p.Gly2Glu	missense variant	-	NC_000002.12:g.160200059C>T	gnomAD
NCI-TCGA novel	p.Gly2Arg	missense variant	-	NC_000002.12:g.160200060C>T	NCI-TCGA
rs142866134	p.Ile3Phe	missense variant	-	NC_000002.12:g.160200057T>A	ESP,ExAC
NCI-TCGA novel	p.Glu4Lys	missense variant	-	NC_000002.12:g.160200054C>T	NCI-TCGA
rs568630388	p.Leu6Phe	missense variant	-	NC_000002.12:g.160200048G>A	1000Genomes
NCI-TCGA novel	p.Leu6IlePheSerTerUnkUnk	frameshift	-	NC_000002.12:g.160200015_160200048CATTCCTTCCTAGAAATAGAAAGAACAGGCAAAG>-	NCI-TCGA
NCI-TCGA novel	p.Cys7Ter	stop gained	-	NC_000002.12:g.160200043G>T	NCI-TCGA
NCI-TCGA novel	p.Leu8Met	missense variant	-	NC_000002.12:g.160200042G>T	NCI-TCGA
rs750372730	p.Phe9Leu	missense variant	-	NC_000002.12:g.160200037G>T	ExAC,TOPMed,gnomAD
rs765208666	p.Leu11Pro	missense variant	-	NC_000002.12:g.160200032A>G	ExAC,gnomAD
rs1442512337	p.Leu13Gln	missense variant	-	NC_000002.12:g.160200026A>T	gnomAD
rs776446082	p.Gly14Glu	missense variant	-	NC_000002.12:g.160200023C>T	ExAC,TOPMed,gnomAD
rs370341448	p.Gly14Arg	missense variant	-	NC_000002.12:g.160200024C>T	ESP,ExAC,TOPMed,gnomAD
rs776446082	p.Gly14Glu	missense variant	-	NC_000002.12:g.160200023C>T	NCI-TCGA
rs188990572	p.Arg15Lys	missense variant	-	NC_000002.12:g.160200020C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs144155990	p.Asn16His	missense variant	-	NC_000002.12:g.160200018T>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn16Lys	missense variant	-	NC_000002.12:g.160200016A>C	NCI-TCGA
rs760097625	p.Val19Ile	missense variant	-	NC_000002.12:g.160200009C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln20Pro	missense variant	-	NC_000002.12:g.160200005T>G	NCI-TCGA
COSM4911524	p.Gly22Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160199256C>T	NCI-TCGA Cosmic
rs753809581	p.Ala24Asp	missense variant	-	NC_000002.12:g.160199249G>T	ExAC,gnomAD
rs1338078187	p.Gly26Glu	missense variant	-	NC_000002.12:g.160199243C>T	gnomAD
NCI-TCGA novel	p.Gly26Arg	missense variant	-	NC_000002.12:g.160199244C>T	NCI-TCGA
NCI-TCGA novel	p.Ala28GlnPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.160199238C>-	NCI-TCGA
rs1455056622	p.Glu29Gly	missense variant	-	NC_000002.12:g.160199234T>C	gnomAD
rs933060964	p.Thr30Ser	missense variant	-	NC_000002.12:g.160199231G>C	TOPMed
rs933060964	p.Thr30Asn	missense variant	-	NC_000002.12:g.160199231G>T	TOPMed
rs1288818021	p.Asp33Glu	missense variant	-	NC_000002.12:g.160199221G>T	TOPMed
rs1447908074	p.Cys34Ter	stop gained	-	NC_000002.12:g.160199218G>T	TOPMed
rs1407406012	p.Leu36Pro	missense variant	-	NC_000002.12:g.160199213A>G	gnomAD
rs1456041794	p.Ile37Val	missense variant	-	NC_000002.12:g.160199211T>C	TOPMed,gnomAD
rs755954161	p.Pro39Leu	missense variant	-	NC_000002.12:g.160199204G>A	ExAC,gnomAD
rs755954161	p.Pro39Leu	missense variant	-	NC_000002.12:g.160199204G>A	NCI-TCGA
rs558509748	p.Gln40Arg	missense variant	-	NC_000002.12:g.160199201T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1406168951	p.Gln40Lys	missense variant	-	NC_000002.12:g.160199202G>T	gnomAD
rs558509748	p.Gln40Leu	missense variant	-	NC_000002.12:g.160199201T>A	1000Genomes,ExAC,TOPMed,gnomAD
rs767191750	p.Cys41Tyr	missense variant	-	NC_000002.12:g.160199198C>T	ExAC
rs150547491	p.Ala42Gly	missense variant	-	NC_000002.12:g.160199195G>C	ESP,ExAC,TOPMed,gnomAD
rs755330939	p.Trp43Ter	stop gained	-	NC_000002.12:g.160199191C>T	ExAC,TOPMed,gnomAD
rs765905953	p.Cys44Arg	missense variant	-	NC_000002.12:g.160199190A>G	ExAC,gnomAD
rs763423532	p.Ala45Val	missense variant	-	NC_000002.12:g.160199186G>A	ExAC,gnomAD
rs1370036283	p.Asn48Ser	missense variant	-	NC_000002.12:g.160196419T>C	gnomAD
NCI-TCGA novel	p.Asn48Lys	missense variant	-	NC_000002.12:g.160196418A>C	NCI-TCGA
rs1322939202	p.Phe49Leu	missense variant	-	NC_000002.12:g.160196415A>T	TOPMed
rs762386614	p.Thr50Ala	missense variant	-	NC_000002.12:g.160196414T>C	ExAC,gnomAD
NCI-TCGA novel	p.Thr50Ile	missense variant	-	NC_000002.12:g.160196413G>A	NCI-TCGA
rs1014857218	p.His51Tyr	missense variant	-	NC_000002.12:g.160196411G>A	TOPMed,gnomAD
rs1420201963	p.His51Leu	missense variant	-	NC_000002.12:g.160196410T>A	gnomAD
rs1014857218	p.His51Tyr	missense variant	-	NC_000002.12:g.160196411G>A	NCI-TCGA Cosmic
rs761037603	p.Ser53Pro	missense variant	-	NC_000002.12:g.160196405A>G	ExAC,TOPMed,gnomAD
rs895833975	p.Ser53Cys	missense variant	-	NC_000002.12:g.160196404G>C	TOPMed
rs895833975	p.Ser53Cys	missense variant	-	NC_000002.12:g.160196404G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser53Thr	missense variant	-	NC_000002.12:g.160196405A>T	NCI-TCGA
NCI-TCGA novel	p.Gly54GlnPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.160196403_160196404insATTGT	NCI-TCGA
rs1270760123	p.Val55Ala	missense variant	-	NC_000002.12:g.160196398A>G	gnomAD
rs1482484963	p.Gly56Ser	missense variant	-	NC_000002.12:g.160196396C>T	gnomAD
rs143336326	p.Gly56Asp	missense variant	-	NC_000002.12:g.160196395C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs774250804	p.Glu57Lys	missense variant	-	NC_000002.12:g.160196393C>T	ExAC,TOPMed,gnomAD
rs774250804	p.Glu57Lys	missense variant	-	NC_000002.12:g.160196393C>T	NCI-TCGA,NCI-TCGA Cosmic
rs1274368531	p.Arg58Met	missense variant	-	NC_000002.12:g.160196389C>A	TOPMed,gnomAD
rs1274368531	p.Arg58Thr	missense variant	-	NC_000002.12:g.160196389C>G	TOPMed,gnomAD
NCI-TCGA novel	p.Cys59Tyr	missense variant	-	NC_000002.12:g.160196386C>T	NCI-TCGA
rs1378844949	p.Asp60Glu	missense variant	-	NC_000002.12:g.160196382A>T	TOPMed
rs1219149761	p.Thr61Ile	missense variant	-	NC_000002.12:g.160196380G>A	TOPMed,gnomAD
rs1219149761	p.Thr61Asn	missense variant	-	NC_000002.12:g.160196380G>T	TOPMed,gnomAD
rs748070197	p.Pro62Leu	missense variant	-	NC_000002.12:g.160196377G>A	ExAC,gnomAD
rs531441228	p.Pro62Ser	missense variant	-	NC_000002.12:g.160196378G>A	1000Genomes,ExAC,gnomAD
rs531441228	p.Pro62Ala	missense variant	-	NC_000002.12:g.160196378G>C	1000Genomes,ExAC,gnomAD
rs1350054159	p.Asn64His	missense variant	-	NC_000002.12:g.160196372T>G	gnomAD
rs139380804	p.Asn64Lys	missense variant	-	NC_000002.12:g.160196370G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs139380804	p.Asn64Lys	missense variant	-	NC_000002.12:g.160196370G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs369726068	p.Leu65Ile	missense variant	-	NC_000002.12:g.160196369G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs369726068	p.Leu65Val	missense variant	-	NC_000002.12:g.160196369G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs369726068	p.Leu65Phe	missense variant	-	NC_000002.12:g.160196369G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs764621080	p.Cys70Arg	missense variant	-	NC_000002.12:g.160196354A>G	ExAC,TOPMed,gnomAD
rs764621080	p.Cys70Ser	missense variant	-	NC_000002.12:g.160196354A>T	ExAC,TOPMed,gnomAD
rs1176834548	p.Gln71Lys	missense variant	-	NC_000002.12:g.160196351G>T	gnomAD
NCI-TCGA novel	p.Gln71Ter	stop gained	-	NC_000002.12:g.160196351G>A	NCI-TCGA
rs913009965	p.Ile75Phe	missense variant	-	NC_000002.12:g.160196339T>A	TOPMed
rs764638718	p.Glu76Ter	stop gained	-	NC_000002.12:g.160196336C>A	ExAC,TOPMed,gnomAD
rs764638718	p.Glu76Lys	missense variant	-	NC_000002.12:g.160196336C>T	ExAC,TOPMed,gnomAD
rs1480709067	p.Asn77Lys	missense variant	-	NC_000002.12:g.160196331G>C	gnomAD
rs943658539	p.Ser80Phe	missense variant	-	NC_000002.12:g.160196323G>A	TOPMed,gnomAD
rs1460342706	p.Val82Ile	missense variant	-	NC_000002.12:g.160196318C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Val82Leu	missense variant	-	NC_000002.12:g.160196318C>A	NCI-TCGA
rs752967555	p.Ile84Val	missense variant	-	NC_000002.12:g.160196312T>C	ExAC,gnomAD
rs571733477	p.Ile84Met	missense variant	-	NC_000002.12:g.160196310T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1328875561	p.Leu85Phe	missense variant	-	NC_000002.12:g.160196309G>A	gnomAD
COSM1008251	p.Leu85Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160196309G>T	NCI-TCGA Cosmic
rs759659602	p.Asn87Ser	missense variant	-	NC_000002.12:g.160196302T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys88Thr	missense variant	-	NC_000002.12:g.160196299T>G	NCI-TCGA
rs770981055	p.Leu90Val	missense variant	-	NC_000002.12:g.160196294G>C	ExAC,gnomAD
rs1450395230	p.Ser91Asn	missense variant	-	NC_000002.12:g.160196290C>T	TOPMed,gnomAD
rs1450395230	p.Ser91Ile	missense variant	-	NC_000002.12:g.160196290C>A	TOPMed,gnomAD
rs374377727	p.Ser91Gly	missense variant	-	NC_000002.12:g.160196291T>C	ESP
rs200784593	p.Val92Ile	missense variant	-	NC_000002.12:g.160196288C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs200784593	p.Val92Leu	missense variant	-	NC_000002.12:g.160196288C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1268887120	p.Arg94Lys	missense variant	-	NC_000002.12:g.160196281C>T	TOPMed
COSM4085928	p.Gln95His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160196277C>A	NCI-TCGA Cosmic
rs768539900	p.Lys96Gln	missense variant	-	NC_000002.12:g.160196276T>G	ExAC,TOPMed,gnomAD
rs375627531	p.Asn97Ser	missense variant	-	NC_000002.12:g.160196272T>C	gnomAD
rs545332900	p.Ser98Cys	missense variant	-	NC_000002.12:g.160196270T>A	1000Genomes,ExAC,TOPMed,gnomAD
rs750388139	p.Ser99Ala	missense variant	-	NC_000002.12:g.160196267A>C	ExAC,TOPMed,gnomAD
rs771795596	p.Asp100Glu	missense variant	-	NC_000002.12:g.160196262G>T	ExAC,TOPMed,gnomAD
rs1445901435	p.Ile101Val	missense variant	-	NC_000002.12:g.160196261T>C	gnomAD
rs745503924	p.Val102Phe	missense variant	-	NC_000002.12:g.160196258C>A	ExAC,gnomAD
rs1456621730	p.Val102Ala	missense variant	-	NC_000002.12:g.160196257A>G	TOPMed
rs61758143	p.Ala105Val	missense variant	-	NC_000002.12:g.160196248G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs753334452	p.Pro106Leu	missense variant	-	NC_000002.12:g.160196245G>A	ExAC,gnomAD
rs778458175	p.Gln107Ter	stop gained	-	NC_000002.12:g.160196243G>A	ExAC,TOPMed,gnomAD
rs756642881	p.Ser108Ile	missense variant	-	NC_000002.12:g.160196239C>A	ExAC,gnomAD
rs371257499	p.Ile110Thr	missense variant	-	NC_000002.12:g.160196233A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs371257499	p.Ile110Asn	missense variant	-	NC_000002.12:g.160196233A>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1229767855	p.Leu111Phe	missense variant	-	NC_000002.12:g.160196231G>A	TOPMed
rs1014930748	p.Leu111Arg	missense variant	-	NC_000002.12:g.160196230A>C	TOPMed
rs759857053	p.Leu113Ser	missense variant	-	NC_000002.12:g.160196224A>G	ExAC,gnomAD
rs767745535	p.Leu113Met	missense variant	-	NC_000002.12:g.160196225A>T	ExAC,TOPMed,gnomAD
rs1382519914	p.Pro115Gln	missense variant	-	NC_000002.12:g.160196218G>T	gnomAD
rs567764082	p.Gly116Arg	missense variant	-	NC_000002.12:g.160196216C>G	1000Genomes,ExAC,gnomAD
rs567764082	p.Gly116Cys	missense variant	-	NC_000002.12:g.160196216C>A	1000Genomes,ExAC,gnomAD
rs544813266	p.Ala118Val	missense variant	-	NC_000002.12:g.160195609G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs758595294	p.Gln122His	missense variant	-	NC_000002.12:g.160195596C>A	ExAC,gnomAD
rs1337499144	p.Gln122Arg	missense variant	-	NC_000002.12:g.160195597T>C	gnomAD
rs758595294	p.Gln122His	missense variant	-	NC_000002.12:g.160195596C>G	ExAC,gnomAD
rs1322574269	p.His124Arg	missense variant	-	NC_000002.12:g.160195591T>C	gnomAD
rs765295259	p.His124Gln	missense variant	-	NC_000002.12:g.160195590A>T	ExAC,gnomAD
rs1406422933	p.Val125Phe	missense variant	-	NC_000002.12:g.160195589C>A	gnomAD
rs775303141	p.Arg126His	missense variant	-	NC_000002.12:g.160195585C>T	ExAC,TOPMed,gnomAD
rs760724592	p.Arg126Cys	missense variant	-	NC_000002.12:g.160195586G>A	ExAC,gnomAD
rs775303141	p.Arg126Leu	missense variant	-	NC_000002.12:g.160195585C>A	ExAC,TOPMed,gnomAD
rs1327113841	p.Thr128Ser	missense variant	-	NC_000002.12:g.160195579G>C	TOPMed
rs373385870	p.Asp130Asn	missense variant	-	NC_000002.12:g.160195574C>T	ESP,ExAC,TOPMed,gnomAD
rs1262966274	p.Asp130Glu	missense variant	-	NC_000002.12:g.160195572G>C	TOPMed
rs770759542	p.Asp130Gly	missense variant	-	NC_000002.12:g.160195573T>C	ExAC,gnomAD
rs748921832	p.Tyr131Cys	missense variant	-	NC_000002.12:g.160195570T>C	ExAC,gnomAD
rs369275471	p.Pro132Leu	missense variant	-	NC_000002.12:g.160195567G>A	ESP,ExAC,TOPMed,gnomAD
rs1473599554	p.Val133Ala	missense variant	-	NC_000002.12:g.160195564A>G	TOPMed
rs574179737	p.Asp134Gly	missense variant	-	NC_000002.12:g.160195561T>C	1000Genomes,ExAC,gnomAD
rs747421856	p.Leu135Ser	missense variant	-	NC_000002.12:g.160195558A>G	ExAC,TOPMed,gnomAD
rs780364416	p.Tyr136His	missense variant	-	NC_000002.12:g.160195556A>G	ExAC,gnomAD
NCI-TCGA novel	p.Tyr137Ter	stop gained	-	NC_000002.12:g.160195551_160195552insCCTC	NCI-TCGA
rs758685362	p.Leu138Pro	missense variant	-	NC_000002.12:g.160195549A>G	ExAC,gnomAD
rs750629583	p.Met139Thr	missense variant	-	NC_000002.12:g.160195546A>G	ExAC,TOPMed,gnomAD
rs1490234134	p.Leu141His	missense variant	-	NC_000002.12:g.160195540A>T	gnomAD
rs140015315	p.Ala143Thr	missense variant	-	NC_000002.12:g.160195535C>T	ESP,ExAC,TOPMed,gnomAD
rs140015315	p.Ala143Thr	missense variant	Amelogenesis imperfecta 1H (AI1H)	NC_000002.12:g.160195535C>T	UniProt,dbSNP
VAR_073328	p.Ala143Thr	missense variant	Amelogenesis imperfecta 1H (AI1H)	NC_000002.12:g.160195535C>T	UniProt
RCV000157638	p.Ala143Thr	missense variant	Amelogenesis imperfecta, type IH (AI1H)	NC_000002.12:g.160195535C>T	ClinVar
COSM3568368	p.Ser144Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160195531G>A	NCI-TCGA Cosmic
rs1305834846	p.Met145Val	missense variant	-	NC_000002.12:g.160195529T>C	TOPMed,gnomAD
rs767381287	p.Met145Thr	missense variant	-	NC_000002.12:g.160195528A>G	ExAC,gnomAD
rs1337026770	p.Asp147Asn	missense variant	-	NC_000002.12:g.160195523C>T	gnomAD
NCI-TCGA novel	p.Asp148Asn	missense variant	-	NC_000002.12:g.160195520C>T	NCI-TCGA
rs766276805	p.Thr151Ala	missense variant	-	NC_000002.12:g.160195511T>C	ExAC,gnomAD
rs1415659289	p.Ile152Met	missense variant	-	NC_000002.12:g.160195506T>C	TOPMed
rs938761545	p.Glu154Ter	stop gained	-	NC_000002.12:g.160195502C>A	TOPMed,gnomAD
rs1020941015	p.Glu154Ala	missense variant	-	NC_000002.12:g.160195501T>G	TOPMed,gnomAD
rs1365638497	p.Leu155Arg	missense variant	-	NC_000002.12:g.160195498A>C	gnomAD
rs773000820	p.Gly156Val	missense variant	-	NC_000002.12:g.160195495C>A	ExAC,TOPMed,gnomAD
rs573373997	p.Arg158Trp	missense variant	-	NC_000002.12:g.160195490G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs747631436	p.Arg158Gln	missense variant	-	NC_000002.12:g.160195489C>T	ExAC,TOPMed,gnomAD
rs776182333	p.Leu159Phe	missense variant	-	NC_000002.12:g.160195487G>A	ExAC,gnomAD
rs558188627	p.Leu159Arg	missense variant	-	NC_000002.12:g.160195486A>C	1000Genomes,ExAC,gnomAD
rs747510097	p.Lys161Glu	missense variant	-	NC_000002.12:g.160195481T>C	ExAC,TOPMed,gnomAD
rs780454470	p.Glu162Lys	missense variant	-	NC_000002.12:g.160195478C>T	ExAC,gnomAD
rs147372514	p.Glu162Asp	missense variant	-	NC_000002.12:g.160195476C>A	ESP,TOPMed,gnomAD
rs539806416	p.Met163Ile	missense variant	-	NC_000002.12:g.160195473C>A	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Ser164Pro	missense variant	-	NC_000002.12:g.160195472A>G	NCI-TCGA
rs779037207	p.Arg171Lys	missense variant	-	NC_000002.12:g.160195450C>T	ExAC,gnomAD
rs377415826	p.Arg171Ser	missense variant	-	NC_000002.12:g.160195449T>A	ESP,ExAC,TOPMed,gnomAD
COSM4085926	p.Leu172Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160195447A>G	NCI-TCGA Cosmic
rs373088517	p.Gly173Ser	missense variant	-	NC_000002.12:g.160195445C>T	ESP,ExAC,gnomAD
rs1387477826	p.Gly173Ala	missense variant	-	NC_000002.12:g.160195444C>G	gnomAD
rs755036686	p.Gly175Arg	missense variant	-	NC_000002.12:g.160195439C>T	ExAC,TOPMed,gnomAD
rs369951064	p.Ser176Tyr	missense variant	-	NC_000002.12:g.160195435G>T	ESP,ExAC,TOPMed,gnomAD
rs1185357592	p.Ser176Pro	missense variant	-	NC_000002.12:g.160195436A>G	gnomAD
rs1241333934	p.Glu179Lys	missense variant	-	NC_000002.12:g.160195427C>T	gnomAD
rs142717768	p.Val182Ile	missense variant	-	NC_000002.12:g.160195418C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1050990851	p.Phe185Tyr	missense variant	-	NC_000002.12:g.160195408A>T	gnomAD
rs1050990851	p.Phe185Ser	missense variant	-	NC_000002.12:g.160195408A>G	gnomAD
rs1404113499	p.Phe185Leu	missense variant	-	NC_000002.12:g.160195407A>C	TOPMed
rs375472275	p.Val186Leu	missense variant	-	NC_000002.12:g.160195406C>A	ESP,ExAC,TOPMed,gnomAD
rs375472275	p.Val186Leu	missense variant	-	NC_000002.12:g.160195406C>G	ESP,ExAC,TOPMed,gnomAD
rs750190939	p.Thr188Ile	missense variant	-	NC_000002.12:g.160195399G>A	ExAC,TOPMed,gnomAD
rs750190939	p.Thr188Lys	missense variant	-	NC_000002.12:g.160195399G>T	ExAC,TOPMed,gnomAD
rs755932139	p.Pro190Gln	missense variant	-	NC_000002.12:g.160195393G>T	TOPMed,gnomAD
rs1248844448	p.Glu192Val	missense variant	-	NC_000002.12:g.160195387T>A	gnomAD
NCI-TCGA novel	p.Glu192Lys	missense variant	-	NC_000002.12:g.160195388C>T	NCI-TCGA
rs764843609	p.Ala194Thr	missense variant	-	NC_000002.12:g.160195382C>T	ExAC,TOPMed,gnomAD
rs1277066102	p.Ala194Val	missense variant	-	NC_000002.12:g.160195381G>A	TOPMed
rs764843609	p.Ala194Ser	missense variant	-	NC_000002.12:g.160195382C>A	ExAC,TOPMed,gnomAD
rs1038189073	p.Asn195Lys	missense variant	-	NC_000002.12:g.160195377G>T	-
rs730880298	p.Pro196Ser	missense variant	-	NC_000002.12:g.160195376G>A	ExAC,gnomAD
rs730880298	p.Pro196Thr	missense variant	-	NC_000002.12:g.160195376G>T	ExAC,gnomAD
rs941116570	p.Pro196His	missense variant	-	NC_000002.12:g.160195375G>T	gnomAD
RCV000157641	p.Pro196Thr	missense variant	Amelogenesis imperfecta, type IH (AI1H)	NC_000002.12:g.160195376G>T	ClinVar
rs372144143	p.Ser198Gly	missense variant	-	NC_000002.12:g.160195370T>C	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Ser199Asn	missense variant	-	NC_000002.12:g.160174137C>T	NCI-TCGA
rs946554296	p.Ile200Val	missense variant	-	NC_000002.12:g.160174135T>C	TOPMed,gnomAD
rs374721403	p.Tyr202His	missense variant	-	NC_000002.12:g.160174129A>G	ESP,TOPMed
rs935729522	p.Tyr202Phe	missense variant	-	NC_000002.12:g.160174128T>A	TOPMed
rs372264340	p.Phe203Leu	missense variant	-	NC_000002.12:g.160174124G>C	ESP,ExAC,gnomAD
rs1424112088	p.Leu205Ter	stop gained	-	NC_000002.12:g.160174119A>T	gnomAD
rs1479322018	p.Pro206Leu	missense variant	-	NC_000002.12:g.160174116G>A	gnomAD
rs772617473	p.Pro206Ser	missense variant	-	NC_000002.12:g.160174117G>A	ExAC,gnomAD
rs1199690484	p.Thr207Ile	missense variant	-	NC_000002.12:g.160174113G>A	gnomAD
rs561588576	p.Gly209Ter	stop gained	-	NC_000002.12:g.160174108C>A	1000Genomes,ExAC,gnomAD
rs367990097	p.Phe210Leu	missense variant	-	NC_000002.12:g.160174103G>T	ESP,ExAC,TOPMed,gnomAD
rs1235642411	p.Lys211Asn	missense variant	-	NC_000002.12:g.160174100C>G	TOPMed
rs1203036584	p.His212Asn	missense variant	-	NC_000002.12:g.160174099G>T	gnomAD
rs1440017757	p.Leu214Ser	missense variant	-	NC_000002.12:g.160174092A>G	gnomAD
rs749561988	p.Leu216Ser	missense variant	-	NC_000002.12:g.160174086A>G	ExAC,TOPMed,gnomAD
rs1321852853	p.Thr217Ala	missense variant	-	NC_000002.12:g.160174084T>C	gnomAD
NCI-TCGA novel	p.Glu221Lys	missense variant	-	NC_000002.12:g.160174072C>T	NCI-TCGA
rs944385067	p.Arg222Ile	missense variant	-	NC_000002.12:g.160174068C>A	-
rs1219980649	p.Phe223Leu	missense variant	-	NC_000002.12:g.160174064G>C	gnomAD
rs373488084	p.Asn224Ser	missense variant	-	NC_000002.12:g.160174062T>C	ESP,ExAC,TOPMed,gnomAD
rs912839150	p.Glu225Lys	missense variant	-	NC_000002.12:g.160174060C>T	gnomAD
rs758180810	p.Lys228Asn	missense variant	-	NC_000002.12:g.160174049C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys231Asn	missense variant	-	NC_000002.12:g.160174040T>G	NCI-TCGA
rs543211346	p.Ile232Ser	missense variant	-	NC_000002.12:g.160174038A>C	1000Genomes,ExAC,gnomAD
COSM1008248	p.Ile232Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160174037A>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser233Tyr	missense variant	-	NC_000002.12:g.160174035G>T	NCI-TCGA
rs778657225	p.Ala234Thr	missense variant	-	NC_000002.12:g.160174033C>T	ExAC
rs1018582237	p.Ala234Val	missense variant	-	NC_000002.12:g.160174032G>A	TOPMed
NCI-TCGA novel	p.Asn235Ser	missense variant	-	NC_000002.12:g.160174029T>C	NCI-TCGA
rs1176349010	p.Thr238Arg	missense variant	-	NC_000002.12:g.160174020G>C	gnomAD
rs140624114	p.Glu240Lys	missense variant	-	NC_000002.12:g.160174015C>T	ESP,ExAC,TOPMed,gnomAD
rs755742636	p.Gly241Ser	missense variant	-	NC_000002.12:g.160174012C>T	ExAC,gnomAD
rs752247019	p.Gly242Arg	missense variant	-	NC_000002.12:g.160174009C>T	ExAC,gnomAD
rs1239393732	p.Phe243Cys	missense variant	-	NC_000002.12:g.160174005A>C	TOPMed,gnomAD
rs1203575130	p.Ala245Thr	missense variant	-	NC_000002.12:g.160174000C>T	TOPMed,gnomAD
rs1265317930	p.Ile246Val	missense variant	-	NC_000002.12:g.160173997T>C	gnomAD
rs369609347	p.Gln248Ter	stop gained	-	NC_000002.12:g.160173991G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala249Val	missense variant	-	NC_000002.12:g.160173987G>A	NCI-TCGA
rs1316507140	p.Ala250Thr	missense variant	-	NC_000002.12:g.160173985C>T	gnomAD
rs528310931	p.Val251Met	missense variant	-	NC_000002.12:g.160173982C>T	1000Genomes,gnomAD
rs528310931	p.Val251Leu	missense variant	-	NC_000002.12:g.160173982C>A	1000Genomes,gnomAD
rs1211465275	p.Lys253Glu	missense variant	-	NC_000002.12:g.160173976T>C	gnomAD
rs541375604	p.Glu254Gly	missense variant	-	NC_000002.12:g.160172729T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1424429623	p.Lys255Asn	missense variant	-	NC_000002.12:g.160172725T>G	TOPMed
rs765694627	p.Lys255Ile	missense variant	-	NC_000002.12:g.160172726T>A	ExAC,TOPMed,gnomAD
rs765694627	p.Lys255Arg	missense variant	-	NC_000002.12:g.160172726T>C	ExAC,TOPMed,gnomAD
rs1370745345	p.Ile256Phe	missense variant	-	NC_000002.12:g.160172724T>A	gnomAD
rs532660177	p.Ile256Thr	missense variant	-	NC_000002.12:g.160172723A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs532660177	p.Ile256Asn	missense variant	-	NC_000002.12:g.160172723A>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1428351211	p.Gly257Arg	missense variant	-	NC_000002.12:g.160172721C>G	gnomAD
rs149747755	p.Arg259Trp	missense variant	-	NC_000002.12:g.160172715G>A	ESP,ExAC,TOPMed,gnomAD
rs760839315	p.Arg259Gln	missense variant	-	NC_000002.12:g.160172714C>T	ExAC,TOPMed,gnomAD
rs149747755	p.Arg259Gly	missense variant	-	NC_000002.12:g.160172715G>C	ESP,ExAC,TOPMed,gnomAD
rs1318143553	p.Asn260Lys	missense variant	-	NC_000002.12:g.160172710A>T	TOPMed
rs775400949	p.Asn260Asp	missense variant	-	NC_000002.12:g.160172712T>C	ExAC
rs1268292637	p.Leu263Phe	missense variant	-	NC_000002.12:g.160172703G>A	gnomAD
rs749165480	p.His264Tyr	missense variant	-	NC_000002.12:g.160172700G>A	ExAC,gnomAD
rs139649173	p.Val267Leu	missense variant	-	NC_000002.12:g.160172691C>G	ESP,ExAC,TOPMed
rs1489486330	p.Val267Gly	missense variant	-	NC_000002.12:g.160172690A>C	TOPMed,gnomAD
rs1305560456	p.Asp271Glu	missense variant	-	NC_000002.12:g.160172677A>T	gnomAD
rs747875880	p.Asp271Gly	missense variant	-	NC_000002.12:g.160172678T>C	ExAC,gnomAD
rs747875880	p.Asp271Ala	missense variant	-	NC_000002.12:g.160172678T>G	ExAC,gnomAD
COSM3568367	p.Asp271Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160172679C>T	NCI-TCGA Cosmic
rs61737770	p.Asp273Glu	missense variant	-	NC_000002.12:g.160172671A>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs751132914	p.Ser274Cys	missense variant	-	NC_000002.12:g.160172669G>C	ExAC
NCI-TCGA novel	p.Ser274Phe	missense variant	-	NC_000002.12:g.160172669G>A	NCI-TCGA
rs730882118	p.His275Gln	missense variant	-	NC_000002.12:g.160172665A>T	-
RCV000157639	p.His275Gln	missense variant	Amelogenesis imperfecta, type IH (AI1H)	NC_000002.12:g.160172665A>T	ClinVar
rs1336914628	p.Phe276Tyr	missense variant	-	NC_000002.12:g.160172663A>T	TOPMed
rs1218889954	p.Gly277Arg	missense variant	-	NC_000002.12:g.160172661C>G	gnomAD
rs1300871316	p.Met278Ile	missense variant	-	NC_000002.12:g.160172656C>T	gnomAD
rs1406315767	p.Asp279Val	missense variant	-	NC_000002.12:g.160172654T>A	gnomAD
NCI-TCGA novel	p.Asp279Tyr	missense variant	-	NC_000002.12:g.160172655C>A	NCI-TCGA
NCI-TCGA novel	p.Ser280ThrPheSerTerUnk	frameshift	-	NC_000002.12:g.160172651C>-	NCI-TCGA
rs1461862005	p.Lys281Asn	missense variant	-	NC_000002.12:g.160172647T>A	TOPMed,gnomAD
rs1444999650	p.Leu282Gln	missense variant	-	NC_000002.12:g.160172645A>T	TOPMed
rs143852527	p.Leu282Val	missense variant	-	NC_000002.12:g.160172646G>C	ESP,ExAC,TOPMed,gnomAD
rs762290626	p.Ala283Pro	missense variant	-	NC_000002.12:g.160172643C>G	ExAC,gnomAD
rs576531469	p.Val286Ile	missense variant	-	NC_000002.12:g.160172634C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs576531469	p.Val286Leu	missense variant	-	NC_000002.12:g.160172634C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs775695114	p.Pro288Ser	missense variant	-	NC_000002.12:g.160172628G>A	ExAC,gnomAD
rs772038274	p.Pro288Leu	missense variant	-	NC_000002.12:g.160172627G>A	ExAC,TOPMed,gnomAD
rs561446961	p.Asn289His	missense variant	-	NC_000002.12:g.160172625T>G	1000Genomes,ExAC,TOPMed,gnomAD
rs769665409	p.Asp290Glu	missense variant	-	NC_000002.12:g.160172620G>T	ExAC,TOPMed,gnomAD
rs144253582	p.Gly291Arg	missense variant	-	NC_000002.12:g.160172619C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs887381626	p.Leu295Ser	missense variant	-	NC_000002.12:g.160172606A>G	gnomAD
rs1299690741	p.Leu295Phe	missense variant	-	NC_000002.12:g.160172605C>A	TOPMed
rs188645370	p.Asp296Gly	missense variant	-	NC_000002.12:g.160172603T>C	1000Genomes,ExAC,gnomAD
COSM1008246	p.Asp296Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160172604C>T	NCI-TCGA Cosmic
rs768415795	p.Ser297Arg	missense variant	-	NC_000002.12:g.160172599G>T	ExAC,TOPMed,gnomAD
rs746639859	p.Asn299Ser	missense variant	-	NC_000002.12:g.160172594T>C	ExAC,TOPMed,gnomAD
rs779692470	p.Glu300Lys	missense variant	-	NC_000002.12:g.160172592C>T	ExAC,gnomAD
RCV000201256	p.Glu300Lys	missense variant	Adolescent alopeciam dentogingival abnormalitites and intellectual disability	NC_000002.12:g.160172592C>T	ClinVar
rs1310602357	p.Tyr301Phe	missense variant	-	NC_000002.12:g.160172588T>A	TOPMed
rs1391345733	p.Tyr301His	missense variant	-	NC_000002.12:g.160172589A>G	gnomAD
rs1395024664	p.Met303Val	missense variant	-	NC_000002.12:g.160172583T>C	TOPMed,gnomAD
rs371374688	p.Val306Leu	missense variant	-	NC_000002.12:g.160172574C>G	ESP,ExAC,TOPMed,gnomAD
COSM1400386	p.Leu307Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160172569C>A	NCI-TCGA Cosmic
rs757895371	p.Glu308Asp	missense variant	-	NC_000002.12:g.160169305T>G	ExAC,gnomAD
rs1189419812	p.Thr311Ala	missense variant	-	NC_000002.12:g.160169298T>C	gnomAD
rs1442752369	p.Gly313Arg	missense variant	-	NC_000002.12:g.160169292C>T	gnomAD
rs1260682322	p.Gln314Arg	missense variant	-	NC_000002.12:g.160169288T>C	gnomAD
rs1286063802	p.Ile316Ser	missense variant	-	NC_000002.12:g.160169282A>C	gnomAD
rs753053909	p.Val320Glu	missense variant	-	NC_000002.12:g.160169270A>T	ExAC,TOPMed,gnomAD
rs753053909	p.Val320Ala	missense variant	-	NC_000002.12:g.160169270A>G	ExAC,TOPMed,gnomAD
rs138313490	p.Asn323Lys	missense variant	-	NC_000002.12:g.160169260G>T	ESP,ExAC,TOPMed,gnomAD
rs751699169	p.Val324Met	missense variant	-	NC_000002.12:g.160169259C>T	ExAC,TOPMed,gnomAD
rs1453707252	p.Ile327Phe	missense variant	-	NC_000002.12:g.160169250T>A	TOPMed
NCI-TCGA novel	p.Ile327Met	missense variant	-	NC_000002.12:g.160169248G>C	NCI-TCGA
rs1287594216	p.Ile327Ser	missense variant	-	NC_000002.12:g.160169249A>C	TOPMed
rs762957132	p.Phe328Ser	missense variant	-	NC_000002.12:g.160169246A>G	ExAC,gnomAD
rs764045213	p.Ala329Thr	missense variant	-	NC_000002.12:g.160169244C>T	ExAC,TOPMed,gnomAD
rs760420082	p.Ala329Gly	missense variant	-	NC_000002.12:g.160169243G>C	ExAC
rs1381679184	p.Val330Glu	missense variant	-	NC_000002.12:g.160169240A>T	TOPMed
rs771900116	p.Gln332Arg	missense variant	-	NC_000002.12:g.160169234T>C	ExAC,gnomAD
rs142185271	p.Glu333Gly	missense variant	-	NC_000002.12:g.160169231T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs774070136	p.Gln334Lys	missense variant	-	NC_000002.12:g.160169229G>T	ExAC
rs770567732	p.His336Asn	missense variant	-	NC_000002.12:g.160169223G>T	ExAC,gnomAD
rs770567732	p.His336Tyr	missense variant	-	NC_000002.12:g.160169223G>A	ExAC,gnomAD
rs1321753703	p.Tyr338Cys	missense variant	-	NC_000002.12:g.160169216T>C	TOPMed
rs113506485	p.Asn340Thr	missense variant	-	NC_000002.12:g.160142070T>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs113506485	p.Asn340Ser	missense variant	-	NC_000002.12:g.160142070T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs140967203	p.Ala342Thr	missense variant	-	NC_000002.12:g.160142065C>T	ESP,ExAC,TOPMed,gnomAD
rs148922939	p.Leu344Phe	missense variant	-	NC_000002.12:g.160142059G>A	ESP,ExAC,TOPMed,gnomAD
rs148922939	p.Leu344Val	missense variant	-	NC_000002.12:g.160142059G>C	ESP,ExAC,TOPMed,gnomAD
rs762398057	p.Ala348Val	missense variant	-	NC_000002.12:g.160142046G>A	ExAC,TOPMed,gnomAD
rs772743429	p.Val350Ile	missense variant	-	NC_000002.12:g.160142041C>T	ExAC,gnomAD
rs1047205910	p.Leu353His	missense variant	-	NC_000002.12:g.160142031A>T	TOPMed
rs748688893	p.Gln354Leu	missense variant	-	NC_000002.12:g.160142028T>A	ExAC,TOPMed,gnomAD
rs770266214	p.Gln354Ter	stop gained	-	NC_000002.12:g.160142029G>A	ExAC
rs1197184529	p.Lys355Thr	missense variant	-	NC_000002.12:g.160142025T>G	gnomAD
rs769024553	p.Gly358Arg	missense variant	-	NC_000002.12:g.160142017C>T	ExAC,TOPMed,gnomAD
rs1374128495	p.Leu361Pro	missense variant	-	NC_000002.12:g.160142007A>G	TOPMed
rs1437007812	p.Ile365Val	missense variant	-	NC_000002.12:g.160141996T>C	TOPMed
rs780288634	p.Ala367Pro	missense variant	-	NC_000002.12:g.160141990C>G	ExAC,gnomAD
rs1335141872	p.Tyr368Cys	missense variant	-	NC_000002.12:g.160141986T>C	gnomAD
NCI-TCGA novel	p.Glu370Lys	missense variant	-	NC_000002.12:g.160138199C>T	NCI-TCGA
NCI-TCGA novel	p.Glu370Ter	stop gained	-	NC_000002.12:g.160138199C>A	NCI-TCGA
rs747415493	p.Arg372Trp	missense variant	-	NC_000002.12:g.160138193G>A	ExAC,TOPMed,gnomAD
rs780376574	p.Arg372Gln	missense variant	-	NC_000002.12:g.160138192C>T	ExAC,TOPMed,gnomAD
rs1475767024	p.Ser373Phe	missense variant	-	NC_000002.12:g.160138189G>A	gnomAD
NCI-TCGA novel	p.Ser373Cys	missense variant	-	NC_000002.12:g.160138189G>C	NCI-TCGA
rs778933431	p.Glu374Val	missense variant	-	NC_000002.12:g.160138186T>A	ExAC,gnomAD
NCI-TCGA novel	p.Glu374Lys	missense variant	-	NC_000002.12:g.160138187C>T	NCI-TCGA
rs181269473	p.Glu374Ter	stop gained	-	NC_000002.12:g.160138187C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1211021472	p.Val375Met	missense variant	-	NC_000002.12:g.160138184C>T	gnomAD
COSM476097	p.Glu376Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160138181C>G	NCI-TCGA Cosmic
rs757370505	p.Glu378Lys	missense variant	-	NC_000002.12:g.160138175C>T	ExAC,gnomAD
rs921918641	p.Gly381Glu	missense variant	-	NC_000002.12:g.160138165C>T	TOPMed,gnomAD
rs1354382788	p.Thr383Pro	missense variant	-	NC_000002.12:g.160138160T>G	TOPMed,gnomAD
rs1354382788	p.Thr383Ser	missense variant	-	NC_000002.12:g.160138160T>A	TOPMed,gnomAD
rs753916892	p.Gly385Arg	missense variant	-	NC_000002.12:g.160138154C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly385Glu	missense variant	-	NC_000002.12:g.160138153C>T	NCI-TCGA
rs781307303	p.Leu386Phe	missense variant	-	NC_000002.12:g.160138151G>A	ExAC,gnomAD
NCI-TCGA novel	p.Asn387Ter	frameshift	-	NC_000002.12:g.160138148_160138149insA	NCI-TCGA
NCI-TCGA novel	p.Asn387His	missense variant	-	NC_000002.12:g.160138148T>G	NCI-TCGA
rs1303080299	p.Leu388Val	missense variant	-	NC_000002.12:g.160138145A>C	gnomAD
rs1358107510	p.Phe390Leu	missense variant	-	NC_000002.12:g.160138139A>G	TOPMed,gnomAD
rs1201159309	p.Thr391Ala	missense variant	-	NC_000002.12:g.160138136T>C	gnomAD
rs766195598	p.Ala392Thr	missense variant	-	NC_000002.12:g.160138133C>T	ExAC,gnomAD
rs374723421	p.Ala392Val	missense variant	-	NC_000002.12:g.160138132G>A	ESP,ExAC,TOPMed,gnomAD
rs766195598	p.Ala392Pro	missense variant	-	NC_000002.12:g.160138133C>G	ExAC,gnomAD
rs750105853	p.Ile393Val	missense variant	-	NC_000002.12:g.160138130T>C	ExAC,gnomAD
rs764751218	p.Cys394Arg	missense variant	-	NC_000002.12:g.160138127A>G	ExAC,gnomAD
rs1422449131	p.Asn396Asp	missense variant	-	NC_000002.12:g.160138121T>C	gnomAD
rs776089189	p.Gly397Ser	missense variant	-	NC_000002.12:g.160138118C>T	ExAC,gnomAD
rs764634066	p.Thr398Ala	missense variant	-	NC_000002.12:g.160138115T>C	ExAC,TOPMed,gnomAD
rs764634066	p.Thr398Pro	missense variant	-	NC_000002.12:g.160138115T>G	ExAC,TOPMed,gnomAD
rs761158424	p.Leu399Val	missense variant	-	NC_000002.12:g.160138112G>C	ExAC,TOPMed,gnomAD
rs1488654094	p.Gln401Ter	stop gained	-	NC_000002.12:g.160138106G>A	gnomAD
rs772489907	p.His402Arg	missense variant	-	NC_000002.12:g.160138102T>C	ExAC,TOPMed,gnomAD
rs746158392	p.His402Gln	missense variant	-	NC_000002.12:g.160138101G>T	ExAC,TOPMed,gnomAD
rs772489907	p.His402Pro	missense variant	-	NC_000002.12:g.160138102T>G	ExAC,TOPMed,gnomAD
COSM1325836	p.His402Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160138101G>C	NCI-TCGA Cosmic
COSM1211047	p.Lys404Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160138095C>A	NCI-TCGA Cosmic
COSM441311	p.Lys404Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160138095C>G	NCI-TCGA Cosmic
rs774654149	p.Lys405Ile	missense variant	-	NC_000002.12:g.160138093T>A	ExAC,gnomAD
rs147811874	p.Ser407Tyr	missense variant	-	NC_000002.12:g.160138087G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1279696049	p.His408Asn	missense variant	-	NC_000002.12:g.160138085G>T	gnomAD
rs755020309	p.Met409Val	missense variant	-	NC_000002.12:g.160138082T>C	ExAC,TOPMed,gnomAD
rs755020309	p.Met409Leu	missense variant	-	NC_000002.12:g.160138082T>G	ExAC,TOPMed,gnomAD
rs1340840158	p.Lys410Glu	missense variant	-	NC_000002.12:g.160138079T>C	gnomAD
rs746951303	p.Asp413Asn	missense variant	-	NC_000002.12:g.160138070C>T	ExAC
rs1206326219	p.Thr414Pro	missense variant	-	NC_000002.12:g.160138067T>G	TOPMed
rs779801184	p.Thr414Arg	missense variant	-	NC_000002.12:g.160138066G>C	ExAC,gnomAD
rs756971112	p.Ala415Ser	missense variant	-	NC_000002.12:g.160137851C>A	ExAC,gnomAD
rs1312246698	p.Phe417Cys	missense variant	-	NC_000002.12:g.160137844A>C	gnomAD
rs144315908	p.Ser418Arg	missense variant	-	NC_000002.12:g.160137840G>T	ESP,ExAC,TOPMed,gnomAD
rs755642266	p.Val419Leu	missense variant	-	NC_000002.12:g.160137839C>G	ExAC,TOPMed,gnomAD
rs755642266	p.Val419Met	missense variant	-	NC_000002.12:g.160137839C>T	ExAC,TOPMed,gnomAD
rs1333730175	p.Val421Leu	missense variant	-	NC_000002.12:g.160137833C>G	gnomAD
rs201585236	p.Asn422Asp	missense variant	-	NC_000002.12:g.160137830T>C	ExAC,gnomAD
rs1401813627	p.Pro424Leu	missense variant	-	NC_000002.12:g.160137823G>A	TOPMed,gnomAD
rs1460296616	p.His425Arg	missense variant	-	NC_000002.12:g.160137820T>C	TOPMed
rs763356279	p.Glu427Lys	missense variant	-	NC_000002.12:g.160137815C>T	ExAC,gnomAD
rs763356279	p.Glu427Gln	missense variant	-	NC_000002.12:g.160137815C>G	ExAC,gnomAD
rs950615749	p.Arg428Lys	missense variant	-	NC_000002.12:g.160137811C>T	TOPMed,gnomAD
rs1157575873	p.Ser430Arg	missense variant	-	NC_000002.12:g.160137804G>T	TOPMed
rs773594504	p.Arg431Ser	missense variant	-	NC_000002.12:g.160137801C>A	ExAC,gnomAD
NCI-TCGA novel	p.His432Tyr	missense variant	-	NC_000002.12:g.160137800G>A	NCI-TCGA
rs61748239	p.Ile433Met	missense variant	-	NC_000002.12:g.160137795A>C	ESP,ExAC,TOPMed,gnomAD
rs761994942	p.Ile433Thr	missense variant	-	NC_000002.12:g.160137796A>G	ExAC,gnomAD
rs770103682	p.Ile433Val	missense variant	-	NC_000002.12:g.160137797T>C	ExAC,TOPMed,gnomAD
rs745790038	p.Ile434Val	missense variant	-	NC_000002.12:g.160137794T>C	ExAC,gnomAD
rs745790038	p.Ile434Leu	missense variant	-	NC_000002.12:g.160137794T>G	ExAC,gnomAD
rs2305820	p.Pro437Thr	missense variant	-	NC_000002.12:g.160137785G>T	UniProt,dbSNP
VAR_049636	p.Pro437Thr	missense variant	-	NC_000002.12:g.160137785G>T	UniProt
rs2305820	p.Pro437Thr	missense variant	-	NC_000002.12:g.160137785G>T	1000Genomes,ExAC,gnomAD
rs61737764	p.Val438Met	missense variant	-	NC_000002.12:g.160137782C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Val438AlaPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.160137739_160137781CATTCTGGGCTGACAAGTAATTCCAGGGCATCCCCCAGCCCCA>-	NCI-TCGA
rs557230094	p.Gly439Glu	missense variant	-	NC_000002.12:g.160137778C>T	1000Genomes,ExAC,gnomAD
rs1405236795	p.Leu440Gln	missense variant	-	NC_000002.12:g.160137775A>T	TOPMed
COSM1400385	p.Gly441TrpPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.160137773_160137774insA	NCI-TCGA Cosmic
rs1338460810	p.Gly441Ala	missense variant	-	NC_000002.12:g.160137772C>G	TOPMed
rs755729961	p.Asp442Asn	missense variant	-	NC_000002.12:g.160137770C>T	ExAC,gnomAD
rs752297911	p.Ala443Asp	missense variant	-	NC_000002.12:g.160137766G>T	ExAC,gnomAD
rs1332447279	p.Ala443Thr	missense variant	-	NC_000002.12:g.160137767C>T	gnomAD
rs1340786035	p.Leu446Phe	missense variant	-	NC_000002.12:g.160137756T>A	TOPMed
rs780549686	p.Val448Ala	missense variant	-	NC_000002.12:g.160137751A>G	ExAC,gnomAD
rs755571854	p.Glu451Gly	missense variant	-	NC_000002.12:g.160137742T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu451Ter	stop gained	-	NC_000002.12:g.160137743C>A	NCI-TCGA
rs1382170524	p.Cys452Arg	missense variant	-	NC_000002.12:g.160137740A>G	TOPMed,gnomAD
rs1159163609	p.Asn453Lys	missense variant	-	NC_000002.12:g.160137735G>T	gnomAD
rs201552904	p.Asp455Asn	missense variant	-	NC_000002.12:g.160137731C>T	ExAC,TOPMed,gnomAD
rs201552904	p.Asp455Tyr	missense variant	-	NC_000002.12:g.160137731C>A	ExAC,TOPMed,gnomAD
rs765605951	p.Cys456Phe	missense variant	-	NC_000002.12:g.160137727C>A	ExAC,TOPMed,gnomAD
rs765605951	p.Cys456Tyr	missense variant	-	NC_000002.12:g.160137727C>T	ExAC,TOPMed,gnomAD
rs1261992701	p.Gln457Arg	missense variant	-	NC_000002.12:g.160137724T>C	gnomAD
rs200295975	p.Gln457Ter	stop gained	-	NC_000002.12:g.160137725G>A	ExAC,TOPMed,gnomAD
COSM1400384	p.Glu459Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.160137719C>A	NCI-TCGA Cosmic
rs768624598	p.Val460Leu	missense variant	-	NC_000002.12:g.160137716C>G	ExAC,gnomAD
rs768624598	p.Val460Leu	missense variant	-	NC_000002.12:g.160137716C>A	ExAC,gnomAD
rs760749196	p.Glu461Gln	missense variant	-	NC_000002.12:g.160137713C>G	ExAC,gnomAD
rs1437561442	p.Asn463Tyr	missense variant	-	NC_000002.12:g.160137707T>A	TOPMed
rs770815372	p.Ser464Ile	missense variant	-	NC_000002.12:g.160137703C>A	ExAC,TOPMed,gnomAD
rs1282738944	p.Ser465Thr	missense variant	-	NC_000002.12:g.160137701A>T	gnomAD
rs1030364807	p.Lys466Glu	missense variant	-	NC_000002.12:g.160137698T>C	TOPMed
rs749120125	p.Lys466Asn	missense variant	-	NC_000002.12:g.160137696T>A	ExAC,gnomAD
rs996563498	p.Cys467Phe	missense variant	-	NC_000002.12:g.160137694C>A	TOPMed
rs1277804797	p.His468Leu	missense variant	-	NC_000002.12:g.160137691T>A	gnomAD
rs1356386845	p.His468Tyr	missense variant	-	NC_000002.12:g.160137692G>A	gnomAD
rs142197545	p.His469Asn	missense variant	-	NC_000002.12:g.160137689G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs55841905	p.Gly470Arg	missense variant	-	NC_000002.12:g.160137686C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs148881693	p.Gly470Val	missense variant	-	NC_000002.12:g.160137685C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs746489935	p.Asn471Ser	missense variant	-	NC_000002.12:g.160137682T>C	ExAC,gnomAD
rs750875825	p.Gly472Asp	missense variant	-	NC_000002.12:g.160137679C>T	ExAC,TOPMed,gnomAD
rs758952593	p.Gly472Ser	missense variant	-	NC_000002.12:g.160137680C>T	ExAC,TOPMed,gnomAD
rs750875825	p.Gly472Ala	missense variant	-	NC_000002.12:g.160137679C>G	ExAC,TOPMed,gnomAD
rs758952593	p.Gly472Cys	missense variant	-	NC_000002.12:g.160137680C>A	ExAC,TOPMed,gnomAD
rs765694694	p.Ser473Phe	missense variant	-	NC_000002.12:g.160137676G>A	ExAC,TOPMed,gnomAD
rs373568907	p.Gln475Arg	missense variant	-	NC_000002.12:g.160137670T>C	ESP,ExAC,TOPMed,gnomAD
rs1194548328	p.Cys476Arg	missense variant	-	NC_000002.12:g.160137668A>G	gnomAD
rs570810791	p.Gly477Val	missense variant	-	NC_000002.12:g.160137664C>A	1000Genomes,ExAC,gnomAD
rs570810791	p.Gly477Ala	missense variant	-	NC_000002.12:g.160137664C>G	1000Genomes,ExAC,gnomAD
rs1335898880	p.Cys479Arg	missense variant	-	NC_000002.12:g.160137659A>G	gnomAD
rs760699404	p.Ala480Ser	missense variant	-	NC_000002.12:g.160137656C>A	ExAC,gnomAD
rs775516477	p.Ala480Val	missense variant	-	NC_000002.12:g.160137655G>A	ExAC,gnomAD
NCI-TCGA novel	p.Ala480LeuPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.160137656_160137657CA>-	NCI-TCGA
rs1225916314	p.Cys481Tyr	missense variant	-	NC_000002.12:g.160137652C>T	TOPMed
rs762861083	p.His482Gln	missense variant	-	NC_000002.12:g.160137648G>T	ExAC,TOPMed,gnomAD
rs766349364	p.His482Asn	missense variant	-	NC_000002.12:g.160137650G>T	ExAC,TOPMed,gnomAD
rs1194415476	p.Gly484Asp	missense variant	-	NC_000002.12:g.160137643C>T	TOPMed
rs1329310318	p.His485Gln	missense variant	-	NC_000002.12:g.160137639G>T	gnomAD
rs147011033	p.Met486Val	missense variant	-	NC_000002.12:g.160137638T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs193920975	p.Gly487Glu	missense variant	-	NC_000002.12:g.160137634C>T	gnomAD
rs769477320	p.Gly487Arg	missense variant	-	NC_000002.12:g.160137635C>T	ExAC,gnomAD
rs193920975	p.Gly487Val	missense variant	-	NC_000002.12:g.160137634C>A	gnomAD
rs769477320	p.Gly487Trp	missense variant	-	NC_000002.12:g.160137635C>A	ExAC,gnomAD
RCV000149009	p.Gly487Glu	missense variant	Malignant tumor of prostate	NC_000002.12:g.160137634C>T	ClinVar
rs147828856	p.Pro488Thr	missense variant	-	NC_000002.12:g.160137632G>T	ESP,ExAC
rs369831997	p.Arg489His	missense variant	-	NC_000002.12:g.160137628C>T	ESP,ExAC,TOPMed,gnomAD
rs369831997	p.Arg489Leu	missense variant	-	NC_000002.12:g.160137628C>A	ESP,ExAC,TOPMed,gnomAD
rs776181453	p.Arg489Cys	missense variant	-	NC_000002.12:g.160137629G>A	ExAC,TOPMed,gnomAD
rs374801905	p.Glu494Gln	missense variant	-	NC_000002.12:g.160137614C>G	ESP,ExAC,TOPMed,gnomAD
rs374801905	p.Glu494Lys	missense variant	-	NC_000002.12:g.160137614C>T	ESP,ExAC,TOPMed,gnomAD
rs1201576711	p.Glu494Ala	missense variant	-	NC_000002.12:g.160137613T>G	gnomAD
rs1237908560	p.Met496Leu	missense variant	-	NC_000002.12:g.160137608T>G	gnomAD
rs1461342856	p.Leu497Met	missense variant	-	NC_000002.12:g.160137605G>T	TOPMed
COSM1400382	p.Leu497Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160137604A>G	NCI-TCGA Cosmic
rs1320329851	p.Ser498Arg	missense variant	-	NC_000002.12:g.160137600G>T	gnomAD
rs372571486	p.Ser498Asn	missense variant	-	NC_000002.12:g.160137601C>T	ESP,ExAC,gnomAD
rs562815517	p.Thr499Ala	missense variant	-	NC_000002.12:g.160137599T>C	1000Genomes,ExAC,gnomAD
rs1218788898	p.Ser501Tyr	missense variant	-	NC_000002.12:g.160137592G>T	gnomAD
rs756336739	p.Glu504Asp	missense variant	-	NC_000002.12:g.160137582C>A	ExAC
rs909210743	p.Ala505Thr	missense variant	-	NC_000002.12:g.160137581C>T	gnomAD
rs752829523	p.Pro506Leu	missense variant	-	NC_000002.12:g.160137577G>A	ExAC,TOPMed,gnomAD
rs983417389	p.Pro506Ala	missense variant	-	NC_000002.12:g.160137578G>C	gnomAD
rs752829523	p.Pro506Gln	missense variant	-	NC_000002.12:g.160137577G>T	ExAC,TOPMed,gnomAD
rs1329111126	p.Asp507His	missense variant	-	NC_000002.12:g.160137575C>G	gnomAD
rs917818547	p.His508Asn	missense variant	-	NC_000002.12:g.160137572G>T	TOPMed,gnomAD
rs1302648317	p.His508Arg	missense variant	-	NC_000002.12:g.160137571T>C	TOPMed
rs767576153	p.Pro509His	missense variant	-	NC_000002.12:g.160137568G>T	ExAC,gnomAD
rs767576153	p.Pro509Arg	missense variant	-	NC_000002.12:g.160137568G>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser510Phe	missense variant	-	NC_000002.12:g.160137565G>A	NCI-TCGA
rs1326345622	p.Ser512Asn	missense variant	-	NC_000002.12:g.160137559C>T	TOPMed
rs759543622	p.Ser512Arg	missense variant	-	NC_000002.12:g.160137558G>T	ExAC,gnomAD
rs978656099	p.Gly513Glu	missense variant	-	NC_000002.12:g.160137556C>T	TOPMed
rs199564092	p.Gly513Arg	missense variant	-	NC_000002.12:g.160137557C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1176108647	p.Arg514Ser	missense variant	-	NC_000002.12:g.160137552C>A	TOPMed,gnomAD
rs765183944	p.Arg514Lys	missense variant	-	NC_000002.12:g.160137553C>T	ExAC,TOPMed,gnomAD
rs1455046465	p.Gly515Cys	missense variant	-	NC_000002.12:g.160137551C>A	gnomAD
rs1290541705	p.Gly515Val	missense variant	-	NC_000002.12:g.160137550C>A	TOPMed
rs1489665110	p.Asp516Asn	missense variant	-	NC_000002.12:g.160137548C>T	TOPMed
rs768254862	p.Gly520Val	missense variant	-	NC_000002.12:g.160137535C>A	ExAC,TOPMed,gnomAD
rs746655063	p.Gln521Lys	missense variant	-	NC_000002.12:g.160137533G>T	ExAC,gnomAD
rs746655063	p.Gln521Glu	missense variant	-	NC_000002.12:g.160137533G>C	ExAC,gnomAD
rs775217432	p.Cys522Gly	missense variant	-	NC_000002.12:g.160137530A>C	ExAC,TOPMed,gnomAD
rs745321994	p.Ile523Met	missense variant	-	NC_000002.12:g.160137525G>C	ExAC,gnomAD
COSM71215	p.Ile523Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160137527T>C	NCI-TCGA Cosmic
rs1280767330	p.Cys524Arg	missense variant	-	NC_000002.12:g.160137524A>G	gnomAD
rs184765465	p.Leu526Trp	missense variant	-	NC_000002.12:g.160137517A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs184765465	p.Leu526Ser	missense variant	-	NC_000002.12:g.160137517A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs749662298	p.Tyr529Cys	missense variant	-	NC_000002.12:g.160137508T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ile532Met	missense variant	-	NC_000002.12:g.160137498A>C	NCI-TCGA
rs376026402	p.Ile532Thr	missense variant	-	NC_000002.12:g.160137499A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1373720934	p.Gly534Glu	missense variant	-	NC_000002.12:g.160137493C>T	TOPMed,gnomAD
rs1242129602	p.Gly534Arg	missense variant	-	NC_000002.12:g.160137494C>T	gnomAD
rs979172663	p.Pro535Leu	missense variant	-	NC_000002.12:g.160137490G>A	gnomAD
NCI-TCGA novel	p.Tyr536His	missense variant	-	NC_000002.12:g.160137488A>G	NCI-TCGA
rs1383537674	p.Gln538His	missense variant	-	NC_000002.12:g.160137480C>A	gnomAD
rs756353631	p.Gln538Arg	missense variant	-	NC_000002.12:g.160137481T>C	ExAC,TOPMed,gnomAD
rs781330759	p.Cys539Arg	missense variant	-	NC_000002.12:g.160137479A>G	ExAC,gnomAD
rs781330759	p.Cys539Ser	missense variant	-	NC_000002.12:g.160137479A>T	ExAC,gnomAD
rs755084704	p.Asp540Glu	missense variant	-	NC_000002.12:g.160137474G>T	ExAC,TOPMed,gnomAD
rs1418523966	p.Asn541Asp	missense variant	-	NC_000002.12:g.160137473T>C	gnomAD
rs1418523966	p.Asn541His	missense variant	-	NC_000002.12:g.160137473T>G	gnomAD
rs1459564158	p.Phe542Ser	missense variant	-	NC_000002.12:g.160137469A>G	TOPMed
rs765140343	p.Ser543Tyr	missense variant	-	NC_000002.12:g.160137466G>T	ExAC,TOPMed,gnomAD
rs144967638	p.Val545Met	missense variant	-	NC_000002.12:g.160137461C>T	ESP,ExAC,TOPMed,gnomAD
rs763955136	p.Val545Gly	missense variant	-	NC_000002.12:g.160137460A>C	ExAC,gnomAD
rs760491071	p.His547Asn	missense variant	-	NC_000002.12:g.160137455G>T	ExAC,gnomAD
rs1319454224	p.His547Gln	missense variant	-	NC_000002.12:g.160137453G>T	TOPMed,gnomAD
rs1313996466	p.Lys548Glu	missense variant	-	NC_000002.12:g.160137452T>C	TOPMed
rs1239402477	p.Gly549Arg	missense variant	-	NC_000002.12:g.160137449C>T	TOPMed,gnomAD
rs775305706	p.Leu550Arg	missense variant	-	NC_000002.12:g.160137445A>C	ExAC,gnomAD
rs144680666	p.Leu551Phe	missense variant	-	NC_000002.12:g.160137443G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs139038668	p.Cys552Ter	stop gained	-	NC_000002.12:g.160137438G>T	ESP,ExAC,TOPMed,gnomAD
rs139038668	p.Cys552Trp	missense variant	-	NC_000002.12:g.160137438G>C	ESP,ExAC,TOPMed,gnomAD
rs188076755	p.Gly553Arg	missense variant	-	NC_000002.12:g.160137437C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs188076755	p.Gly553Ter	stop gained	-	NC_000002.12:g.160137437C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1226374205	p.Gly554Ser	missense variant	-	NC_000002.12:g.160137434C>T	gnomAD
rs546972685	p.Gly554Asp	missense variant	-	NC_000002.12:g.160126601C>T	1000Genomes,TOPMed,gnomAD
rs748564787	p.Gly556Cys	missense variant	-	NC_000002.12:g.160126596C>A	ExAC,TOPMed,gnomAD
rs748564787	p.Gly556Ser	missense variant	-	NC_000002.12:g.160126596C>T	ExAC,TOPMed,gnomAD
rs143914557	p.Asp557Asn	missense variant	-	NC_000002.12:g.160126593C>T	ESP,ExAC,TOPMed,gnomAD
rs143914557	p.Asp557Tyr	missense variant	-	NC_000002.12:g.160126593C>A	ESP,ExAC,TOPMed,gnomAD
rs1201520091	p.Cys558Gly	missense variant	-	NC_000002.12:g.160126590A>C	TOPMed
rs1477208637	p.Gly561Ala	missense variant	-	NC_000002.12:g.160126580C>G	TOPMed
rs1253352527	p.Cys563Phe	missense variant	-	NC_000002.12:g.160126574C>A	gnomAD
rs1197756453	p.Val564Glu	missense variant	-	NC_000002.12:g.160126571A>T	TOPMed,gnomAD
rs780082370	p.Cys565Arg	missense variant	-	NC_000002.12:g.160126569A>G	ExAC,gnomAD
rs758528594	p.Cys565Tyr	missense variant	-	NC_000002.12:g.160126568C>T	ExAC,gnomAD
rs745898382	p.Arg566Ser	missense variant	-	NC_000002.12:g.160126564C>A	ExAC,gnomAD
rs1385559013	p.Ser567Asn	missense variant	-	NC_000002.12:g.160126562C>T	TOPMed,gnomAD
rs756097127	p.Ser567Arg	missense variant	-	NC_000002.12:g.160126561G>T	ExAC,gnomAD
rs777895050	p.Ser567Cys	missense variant	-	NC_000002.12:g.160126563T>A	ExAC,gnomAD
rs752597141	p.Gly568Ser	missense variant	-	NC_000002.12:g.160126560C>T	ExAC,gnomAD
rs1446463021	p.Trp569Arg	missense variant	-	NC_000002.12:g.160126557A>G	gnomAD
rs767415409	p.Thr570Ala	missense variant	-	NC_000002.12:g.160126554T>C	ExAC,TOPMed,gnomAD
rs754659009	p.Gly571Asp	missense variant	-	NC_000002.12:g.160126550C>T	ExAC,gnomAD
rs144758639	p.Glu572Lys	missense variant	-	NC_000002.12:g.160126548C>T	ESP,ExAC,gnomAD
rs1173904734	p.Tyr573Ter	stop gained	-	NC_000002.12:g.160126543G>C	gnomAD
rs888701114	p.Cys574Ter	stop gained	-	NC_000002.12:g.160126540G>T	TOPMed
rs772576883	p.Cys574Arg	missense variant	-	NC_000002.12:g.160126542A>G	ExAC,gnomAD
rs1395579738	p.Asn575Lys	missense variant	-	NC_000002.12:g.160126537G>T	gnomAD
COSM3837150	p.Cys576Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160126535C>A	NCI-TCGA Cosmic
rs762307594	p.Thr577Asn	missense variant	-	NC_000002.12:g.160126532G>T	ExAC,gnomAD
rs777059897	p.Thr578Asn	missense variant	-	NC_000002.12:g.160126529G>T	ExAC,gnomAD
rs1398209178	p.Ser579Gly	missense variant	-	NC_000002.12:g.160126527T>C	TOPMed
rs769022285	p.Thr580Lys	missense variant	-	NC_000002.12:g.160126523G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp581Asn	missense variant	-	NC_000002.12:g.160126521C>T	NCI-TCGA
NCI-TCGA novel	p.Ser582Cys	missense variant	-	NC_000002.12:g.160126517G>C	NCI-TCGA
rs772152565	p.Cys583Trp	missense variant	-	NC_000002.12:g.160126513G>C	ExAC,TOPMed,gnomAD
rs770284828	p.Val584Ile	missense variant	-	NC_000002.12:g.160126512C>T	ExAC,TOPMed,gnomAD
rs756187131	p.Ser585Phe	missense variant	-	NC_000002.12:g.160126508G>A	ExAC,gnomAD
COSM1008244	p.Ser585Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160126509A>G	NCI-TCGA Cosmic
COSM6154604	p.Glu586Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160126506C>T	NCI-TCGA Cosmic
rs1292368259	p.Val589Met	missense variant	-	NC_000002.12:g.160126497C>T	TOPMed
rs1487949347	p.Cys591Tyr	missense variant	-	NC_000002.12:g.160126490C>T	TOPMed
rs781213934	p.Cys591Gly	missense variant	-	NC_000002.12:g.160126491A>C	ExAC
rs751270189	p.Ser592Arg	missense variant	-	NC_000002.12:g.160126486G>T	ExAC,gnomAD
rs200492977	p.Gly593Arg	missense variant	-	NC_000002.12:g.160126485C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs757977525	p.Arg594His	missense variant	-	NC_000002.12:g.160126481C>T	ExAC,TOPMed,gnomAD
rs1433404920	p.Arg594Cys	missense variant	-	NC_000002.12:g.160126482G>A	TOPMed,gnomAD
rs764735670	p.Gly595Arg	missense variant	-	NC_000002.12:g.160126479C>T	ExAC,gnomAD
rs1376058943	p.Asp596Tyr	missense variant	-	NC_000002.12:g.160126476C>A	gnomAD
rs1437600372	p.Cys597Arg	missense variant	-	NC_000002.12:g.160126473A>G	gnomAD
rs777145845	p.Gly600Asp	missense variant	-	NC_000002.12:g.160126463C>T	ExAC,gnomAD
rs764546149	p.Cys602Ser	missense variant	-	NC_000002.12:g.160126458A>T	ExAC,gnomAD
rs761142877	p.Cys604Gly	missense variant	-	NC_000002.12:g.160126452A>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Cys604Tyr	missense variant	-	NC_000002.12:g.160126451C>T	NCI-TCGA
rs1212478399	p.Thr605Pro	missense variant	-	NC_000002.12:g.160126449T>G	gnomAD
rs543986673	p.Thr605Ile	missense variant	-	NC_000002.12:g.160126448G>A	1000Genomes,gnomAD
COSM5139725	p.Pro607LeuPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.160126442G>-	NCI-TCGA Cosmic
rs775693403	p.Thr613Pro	missense variant	-	NC_000002.12:g.160126425T>G	ExAC,TOPMed,gnomAD
rs775693403	p.Thr613Ala	missense variant	-	NC_000002.12:g.160126425T>C	ExAC,TOPMed,gnomAD
rs730880297	p.Arg616Ter	stop gained	-	NC_000002.12:g.160126416G>A	ExAC,TOPMed,gnomAD
rs144493660	p.Arg616Pro	missense variant	-	NC_000002.12:g.160126415C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000157640	p.Arg616Ter	nonsense	Amelogenesis imperfecta, type IH (AI1H)	NC_000002.12:g.160126416G>A	ClinVar
rs771143977	p.Cys617Phe	missense variant	-	NC_000002.12:g.160126412C>A	ExAC,gnomAD
rs1188139931	p.Cys617Gly	missense variant	-	NC_000002.12:g.160126413A>C	TOPMed,gnomAD
NCI-TCGA novel	p.Cys617Ter	stop gained	-	NC_000002.12:g.160126411A>T	NCI-TCGA
rs749328795	p.Thr619Ile	missense variant	-	NC_000002.12:g.160126406G>A	ExAC,TOPMed,gnomAD
rs1385780826	p.Thr619Ala	missense variant	-	NC_000002.12:g.160126407T>C	TOPMed
rs1310842796	p.Asp622Asn	missense variant	-	NC_000002.12:g.160126398C>T	TOPMed
NCI-TCGA novel	p.Asp622Tyr	missense variant	-	NC_000002.12:g.160126398C>A	NCI-TCGA
rs768444834	p.Pro623His	missense variant	-	NC_000002.12:g.160126394G>T	ExAC,gnomAD
rs746882289	p.Cys624Ter	stop gained	-	NC_000002.12:g.160126390A>T	ExAC,gnomAD
rs1261784033	p.Arg628Gln	missense variant	-	NC_000002.12:g.160126379C>T	TOPMed,gnomAD
rs202195621	p.Arg628Gly	missense variant	-	NC_000002.12:g.160126380G>C	ExAC,TOPMed,gnomAD
rs202195621	p.Arg628Trp	missense variant	-	NC_000002.12:g.160126380G>A	ExAC,TOPMed,gnomAD
rs1261784033	p.Arg628Pro	missense variant	-	NC_000002.12:g.160126379C>G	TOPMed,gnomAD
rs574352340	p.Ser629Gly	missense variant	-	NC_000002.12:g.160123887T>C	1000Genomes,ExAC,gnomAD
rs997117450	p.Ser629Asn	missense variant	-	NC_000002.12:g.160123886C>T	gnomAD
rs370714170	p.Ile631Thr	missense variant	-	NC_000002.12:g.160123880A>G	ESP,ExAC,TOPMed,gnomAD
rs1321188375	p.Glu632Val	missense variant	-	NC_000002.12:g.160123877T>A	gnomAD
rs150163379	p.His634Arg	missense variant	-	NC_000002.12:g.160123871T>C	ESP,ExAC,TOPMed,gnomAD
rs142919023	p.His634Tyr	missense variant	-	NC_000002.12:g.160123872G>A	ESP,ExAC,gnomAD
rs771235788	p.Leu635Pro	missense variant	-	NC_000002.12:g.160123868A>G	ExAC,gnomAD
rs376329044	p.Ala637Val	missense variant	-	NC_000002.12:g.160123862G>A	ESP,ExAC,TOPMed,gnomAD
rs552791527	p.Gly639Asp	missense variant	-	NC_000002.12:g.160123856C>T	1000Genomes
rs773414491	p.Gly639Ser	missense variant	-	NC_000002.12:g.160123857C>T	ExAC,gnomAD
NCI-TCGA novel	p.Gln640Glu	missense variant	-	NC_000002.12:g.160123854G>C	NCI-TCGA
rs61737767	p.Arg642Ter	stop gained	-	NC_000002.12:g.160123848G>A	ExAC,TOPMed,gnomAD
rs200145370	p.Arg642Gln	missense variant	-	NC_000002.12:g.160123847C>T	ExAC,TOPMed,gnomAD
COSM282009	p.Glu644Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.160123842C>A	NCI-TCGA Cosmic
rs745623919	p.Cys645Arg	missense variant	-	NC_000002.12:g.160123839A>G	ExAC,gnomAD
rs1441324615	p.Cys645Tyr	missense variant	-	NC_000002.12:g.160123838C>T	gnomAD
rs778578823	p.Val646Met	missense variant	-	NC_000002.12:g.160123836C>T	ExAC,gnomAD
rs920657730	p.Asp647Gly	missense variant	-	NC_000002.12:g.160123832T>C	TOPMed,gnomAD
rs775754627	p.Lys648Asn	missense variant	-	NC_000002.12:g.160123828C>A	ExAC,TOPMed,gnomAD
rs1411158973	p.Lys648Gln	missense variant	-	NC_000002.12:g.160123830T>G	TOPMed,gnomAD
NCI-TCGA novel	p.Cys649Tyr	missense variant	-	NC_000002.12:g.160123826C>T	NCI-TCGA
rs753402565	p.Leu651Pro	missense variant	-	NC_000002.12:g.160123820A>G	ExAC,gnomAD
rs887228629	p.Ala652Val	missense variant	-	NC_000002.12:g.160123817G>A	gnomAD
rs150971153	p.Ala654Val	missense variant	-	NC_000002.12:g.160123811G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs150971153	p.Ala654Gly	missense variant	-	NC_000002.12:g.160123811G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs768015188	p.Thr655Asn	missense variant	-	NC_000002.12:g.160123808G>T	ExAC,TOPMed,gnomAD
rs1469181840	p.Thr655Ala	missense variant	-	NC_000002.12:g.160123809T>C	gnomAD
rs755421198	p.Ser657Ile	missense variant	-	NC_000002.12:g.160123802C>A	ExAC,TOPMed,gnomAD
rs751938984	p.Glu659Lys	missense variant	-	NC_000002.12:g.160123797C>T	ExAC,TOPMed,gnomAD
rs1199919769	p.Glu660Lys	missense variant	-	NC_000002.12:g.160123794C>T	gnomAD
rs1295424870	p.Asp661Val	missense variant	-	NC_000002.12:g.160112199T>A	TOPMed
rs1315401429	p.Phe662Ser	missense variant	-	NC_000002.12:g.160112196A>G	gnomAD
NCI-TCGA novel	p.Lys664Asn	missense variant	-	NC_000002.12:g.160112189C>A	NCI-TCGA
rs1435834258	p.Asp665Gly	missense variant	-	NC_000002.12:g.160112187T>C	gnomAD
rs750633028	p.Gly666Asp	missense variant	-	NC_000002.12:g.160112184C>T	ExAC,gnomAD
rs750633028	p.Gly666Val	missense variant	-	NC_000002.12:g.160112184C>A	ExAC,gnomAD
rs376470109	p.Val668Ile	missense variant	-	NC_000002.12:g.160112179C>T	ESP,ExAC,TOPMed,gnomAD
rs761842374	p.Ser669Pro	missense variant	-	NC_000002.12:g.160112176A>G	ExAC,TOPMed,gnomAD
rs761842374	p.Ser669Thr	missense variant	-	NC_000002.12:g.160112176A>T	ExAC,TOPMed,gnomAD
rs776752490	p.Cys670Ter	stop gained	-	NC_000002.12:g.160112171G>T	ExAC,gnomAD
rs1474284689	p.Ser671Phe	missense variant	-	NC_000002.12:g.160112169G>A	gnomAD
rs1481294410	p.Leu672Pro	missense variant	-	NC_000002.12:g.160112166A>G	gnomAD
NCI-TCGA novel	p.Leu672Val	missense variant	-	NC_000002.12:g.160112167G>C	NCI-TCGA
rs1188718105	p.Gln673Lys	missense variant	-	NC_000002.12:g.160112164G>T	gnomAD
rs200660753	p.Gly674Arg	missense variant	-	NC_000002.12:g.160112161C>T	ExAC,TOPMed,gnomAD
rs964592128	p.Gly674Glu	missense variant	-	NC_000002.12:g.160112160C>T	TOPMed,gnomAD
COSM1008242	p.Glu677Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.160112152C>A	NCI-TCGA Cosmic
rs1217745574	p.Cys678Arg	missense variant	-	NC_000002.12:g.160112149A>G	gnomAD
rs774204391	p.Leu679Val	missense variant	-	NC_000002.12:g.160112146G>C	ExAC,gnomAD
rs1191570106	p.Phe682Leu	missense variant	-	NC_000002.12:g.160112135G>T	TOPMed
rs749058952	p.Leu683Pro	missense variant	-	NC_000002.12:g.160112133A>G	ExAC,gnomAD
rs772770914	p.Thr685Ile	missense variant	-	NC_000002.12:g.160112127G>A	ExAC,gnomAD
rs1398818207	p.Thr686Lys	missense variant	-	NC_000002.12:g.160112124G>T	gnomAD
rs747659835	p.Asp687Tyr	missense variant	-	NC_000002.12:g.160112122C>A	ExAC,gnomAD
rs1260897929	p.Asn688Ser	missense variant	-	NC_000002.12:g.160112118T>C	TOPMed
rs1190490436	p.Glu689Gln	missense variant	-	NC_000002.12:g.160112116C>G	TOPMed
rs1164506403	p.Glu689Asp	missense variant	-	NC_000002.12:g.160112114C>A	gnomAD
rs754473547	p.Gly690Glu	missense variant	-	NC_000002.12:g.160112112C>T	ExAC,TOPMed,gnomAD
rs1460115362	p.Gly690Arg	missense variant	-	NC_000002.12:g.160112113C>T	gnomAD
rs1165829377	p.Lys691Glu	missense variant	-	NC_000002.12:g.160112110T>C	gnomAD
COSM1564737	p.Lys691Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160112108T>A	NCI-TCGA Cosmic
rs1427977643	p.Ile693Val	missense variant	-	NC_000002.12:g.160112104T>C	gnomAD
rs139804091	p.Ile694Phe	missense variant	-	NC_000002.12:g.160112101T>A	ESP,ExAC,TOPMed,gnomAD
rs139804091	p.Ile694Leu	missense variant	-	NC_000002.12:g.160112101T>G	ESP,ExAC,TOPMed,gnomAD
rs139804091	p.Ile694Val	missense variant	-	NC_000002.12:g.160112101T>C	ESP,ExAC,TOPMed,gnomAD
rs1252096609	p.Ser696Arg	missense variant	-	NC_000002.12:g.160112095T>G	gnomAD
rs1233486573	p.Ile697Ser	missense variant	-	NC_000002.12:g.160112091A>C	gnomAD
rs577005383	p.Asn698Ile	missense variant	-	NC_000002.12:g.160112088T>A	1000Genomes,ExAC,TOPMed,gnomAD
rs779056066	p.Asn698Asp	missense variant	-	NC_000002.12:g.160112089T>C	ExAC
rs577005383	p.Asn698Ser	missense variant	-	NC_000002.12:g.160112088T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs764161553	p.Glu699Gly	missense variant	-	NC_000002.12:g.160112085T>C	ExAC,gnomAD
rs1360357955	p.Glu699Asp	missense variant	-	NC_000002.12:g.160112084T>G	TOPMed
rs753934656	p.Glu699Ter	stop gained	-	NC_000002.12:g.160112086C>A	ExAC,gnomAD
rs895658072	p.Lys700Glu	missense variant	-	NC_000002.12:g.160112083T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Cys702Phe	missense variant	-	NC_000002.12:g.160107842C>A	NCI-TCGA
rs369122182	p.Pro703Arg	missense variant	-	NC_000002.12:g.160107839G>C	ESP,ExAC,TOPMed,gnomAD
rs369122182	p.Pro703Leu	missense variant	-	NC_000002.12:g.160107839G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro703Ser	missense variant	-	NC_000002.12:g.160107840G>A	NCI-TCGA
NCI-TCGA novel	p.Lys704Asn	missense variant	-	NC_000002.12:g.160107835C>G	NCI-TCGA
rs777918545	p.Pro705Thr	missense variant	-	NC_000002.12:g.160107834G>T	ExAC,gnomAD
rs777918545	p.Pro705Ala	missense variant	-	NC_000002.12:g.160107834G>C	ExAC,gnomAD
rs756213093	p.Pro706Ala	missense variant	-	NC_000002.12:g.160107831G>C	ExAC,gnomAD
rs766351579	p.Asn707Ile	missense variant	-	NC_000002.12:g.160107827T>A	ExAC,TOPMed,gnomAD
rs377135299	p.Asn707Asp	missense variant	-	NC_000002.12:g.160107828T>C	ESP,ExAC,gnomAD
rs1416979649	p.Met710Arg	missense variant	-	NC_000002.12:g.160107818A>C	TOPMed,gnomAD
rs1416979649	p.Met710Thr	missense variant	-	NC_000002.12:g.160107818A>G	TOPMed,gnomAD
rs1159479045	p.Met710Val	missense variant	-	NC_000002.12:g.160107819T>C	TOPMed
rs372646338	p.Ile711Val	missense variant	-	NC_000002.12:g.160107816T>C	ESP,ExAC,gnomAD
rs750251062	p.Ile711Thr	missense variant	-	NC_000002.12:g.160107815A>G	ExAC,gnomAD
rs367865998	p.Met712Thr	missense variant	-	NC_000002.12:g.160107812A>G	ESP,ExAC,TOPMed,gnomAD
rs1280244580	p.Leu713Val	missense variant	-	NC_000002.12:g.160107810A>C	gnomAD
rs757207082	p.Gly714Arg	missense variant	-	NC_000002.12:g.160107807C>T	ExAC,gnomAD
rs776455815	p.Val715Ile	missense variant	-	NC_000002.12:g.160107804C>T	ExAC
rs573911717	p.Val715Asp	missense variant	-	NC_000002.12:g.160107803A>T	1000Genomes,ExAC,gnomAD
rs573911717	p.Val715Gly	missense variant	-	NC_000002.12:g.160107803A>C	1000Genomes,ExAC,gnomAD
rs775131133	p.Ser716Phe	missense variant	-	NC_000002.12:g.160107800G>A	ExAC,gnomAD
rs979599332	p.Ala718Pro	missense variant	-	NC_000002.12:g.160107795C>G	TOPMed
rs979599332	p.Ala718Thr	missense variant	-	NC_000002.12:g.160107795C>T	TOPMed
rs1374016397	p.Ile719Val	missense variant	-	NC_000002.12:g.160107792T>C	TOPMed
rs1238745539	p.Leu721Pro	missense variant	-	NC_000002.12:g.160107785A>G	gnomAD
rs966484703	p.Gly723Arg	missense variant	-	NC_000002.12:g.160107780C>G	TOPMed,gnomAD
COSM1008240	p.Gly723Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160107780C>T	NCI-TCGA Cosmic
rs146397669	p.Val724Phe	missense variant	-	NC_000002.12:g.160107777C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs146397669	p.Val724Leu	missense variant	-	NC_000002.12:g.160107777C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs146397669	p.Val724Ile	missense variant	-	NC_000002.12:g.160107777C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Val725Ile	missense variant	-	NC_000002.12:g.160107774C>T	NCI-TCGA
rs749610054	p.Leu727Arg	missense variant	-	NC_000002.12:g.160107767A>C	ExAC,TOPMed,gnomAD
COSM1008238	p.Ile729Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160107761A>C	NCI-TCGA Cosmic
rs778009963	p.Trp730Cys	missense variant	-	NC_000002.12:g.160107757C>A	ExAC,TOPMed,gnomAD
rs1256164920	p.Leu732Val	missense variant	-	NC_000002.12:g.160107753G>C	TOPMed
rs374327754	p.Val734Met	missense variant	-	NC_000002.12:g.160107747C>T	ESP,ExAC,TOPMed,gnomAD
rs781242094	p.Ser735Pro	missense variant	-	NC_000002.12:g.160107744A>G	ExAC,TOPMed,gnomAD
rs754956643	p.His737Arg	missense variant	-	NC_000002.12:g.160107737T>C	ExAC,gnomAD
rs1189425088	p.Asp738Tyr	missense variant	-	NC_000002.12:g.160107735C>A	gnomAD
rs1486964947	p.Asp738Gly	missense variant	-	NC_000002.12:g.160107734T>C	gnomAD
rs757115141	p.Arg739Leu	missense variant	-	NC_000002.12:g.160107731C>A	ExAC,gnomAD
rs757115141	p.Arg739Pro	missense variant	-	NC_000002.12:g.160107731C>G	ExAC,gnomAD
rs757115141	p.Arg739His	missense variant	-	NC_000002.12:g.160107731C>T	ExAC,gnomAD
rs750398020	p.Arg739Cys	missense variant	-	NC_000002.12:g.160107732G>A	ExAC,TOPMed,gnomAD
rs750398020	p.Arg739Gly	missense variant	-	NC_000002.12:g.160107732G>C	ExAC,TOPMed,gnomAD
rs753667027	p.Glu741Val	missense variant	-	NC_000002.12:g.160107725T>A	ExAC,gnomAD
rs760403120	p.Lys744Asn	missense variant	-	NC_000002.12:g.160107715T>A	ExAC,gnomAD
rs1416692961	p.Glu746Asp	missense variant	-	NC_000002.12:g.160107709T>G	TOPMed,gnomAD
COSM6154605	p.Glu748Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160107705C>G	NCI-TCGA Cosmic
rs199651918	p.Arg749Ter	stop gained	-	NC_000002.12:g.160107702G>A	ExAC,gnomAD
rs540109604	p.Arg749Gln	missense variant	-	NC_000002.12:g.160107701C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs771306762	p.Ser750Thr	missense variant	-	NC_000002.12:g.160107699A>T	ExAC,gnomAD
rs773552663	p.Trp754Arg	missense variant	-	NC_000002.12:g.160107687A>T	ExAC,gnomAD
rs150867142	p.Thr756Met	missense variant	-	NC_000002.12:g.160107680G>A	ESP,ExAC,TOPMed,gnomAD
rs150867142	p.Thr756Lys	missense variant	-	NC_000002.12:g.160107680G>T	ESP,ExAC,TOPMed,gnomAD
rs747175115	p.Gly757Arg	missense variant	-	NC_000002.12:g.160101834C>T	ExAC,gnomAD
rs772215000	p.Pro760Ser	missense variant	-	NC_000002.12:g.160101825G>A	ExAC,gnomAD
rs772215000	p.Pro760Thr	missense variant	-	NC_000002.12:g.160101825G>T	ExAC,gnomAD
rs777800965	p.Tyr762Cys	missense variant	-	NC_000002.12:g.160101818T>C	ExAC,gnomAD
rs1320721685	p.Tyr762His	missense variant	-	NC_000002.12:g.160101819A>G	TOPMed
rs756002087	p.Gly764Ala	missense variant	-	NC_000002.12:g.160101812C>G	ExAC,gnomAD
NCI-TCGA novel	p.Ser765Phe	missense variant	-	NC_000002.12:g.160101809G>A	NCI-TCGA
rs754573154	p.Thr766Ile	missense variant	-	NC_000002.12:g.160101806G>A	ExAC,gnomAD
rs1274695997	p.Thr766Ala	missense variant	-	NC_000002.12:g.160101807T>C	TOPMed
rs751147195	p.Thr768Ile	missense variant	-	NC_000002.12:g.160101800G>A	ExAC,TOPMed,gnomAD
rs1434516613	p.Lys770Gln	missense variant	-	NC_000002.12:g.160101795T>G	gnomAD
NCI-TCGA novel	p.Lys770Asn	missense variant	-	NC_000002.12:g.160101793T>G	NCI-TCGA
rs765876600	p.Thr773Asn	missense variant	-	NC_000002.12:g.160101785G>T	ExAC,gnomAD
rs762389754	p.Tyr774Cys	missense variant	-	NC_000002.12:g.160101782T>C	ExAC,gnomAD
rs201494177	p.Lys775Ter	stop gained	-	NC_000002.12:g.160101780T>A	ESP,ExAC,gnomAD
rs765704356	p.Lys775Asn	missense variant	-	NC_000002.12:g.160101778T>A	ExAC,gnomAD
rs540706226	p.His776Pro	missense variant	-	NC_000002.12:g.160101776T>G	1000Genomes,ExAC,TOPMed,gnomAD
rs540706226	p.His776Arg	missense variant	-	NC_000002.12:g.160101776T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1275269809	p.Arg777Ser	missense variant	-	NC_000002.12:g.160101772C>G	gnomAD
COSM3568364	p.Arg777Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.160101773C>T	NCI-TCGA Cosmic
rs1210024151	p.Gln780Arg	missense variant	-	NC_000002.12:g.160101764T>C	gnomAD
NCI-TCGA novel	p.Gln780Ter	stop gained	-	NC_000002.12:g.160101766_160101767insATGTTCCTACTGGTTTCAC	NCI-TCGA
rs760815776	p.Val782Ile	missense variant	-	NC_000002.12:g.160101759C>T	ExAC,gnomAD
rs775725788	p.Asp783Asn	missense variant	-	NC_000002.12:g.160101756C>T	ExAC,gnomAD
rs1349576201	p.Asp783Glu	missense variant	-	NC_000002.12:g.160101754G>T	gnomAD
rs1277349276	p.Leu784Ile	missense variant	-	NC_000002.12:g.160101753G>T	gnomAD
rs1350520068	p.Ser785Pro	missense variant	-	NC_000002.12:g.160101750A>G	gnomAD
rs1246721689	p.Asp787Gly	missense variant	-	NC_000002.12:g.160101743T>C	TOPMed
rs745899695	p.Cys788Trp	missense variant	-	NC_000002.12:g.160101739G>C	ExAC,TOPMed,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0000768	Congenital Abnormality	group	BEFREE
C0000786	Spontaneous abortion	phenotype	CTD_human
C0000822	Abortion, Tubal	disease	CTD_human
C0002170	Alopecia	disease	HPO
C0002452	Amelogenesis Imperfecta	disease	BEFREE;GENOMICS_ENGLAND;HPO
C0004096	Asthma	disease	MGD
C0004364	Autoimmune Diseases	group	CTD_human
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0007102	Malignant tumor of colon	disease	BEFREE
C0007137	Squamous cell carcinoma	disease	BEFREE;LHGDN
C0008311	Cholangitis	disease	CTD_human
C0009375	Colonic Neoplasms	group	BEFREE;LHGDN
C0011053	Deafness	phenotype	HPO
C0011351	Dental Enamel Hypoplasia	disease	HPO
C0014544	Epilepsy	disease	HPO
C0017638	Glioma	disease	BEFREE
C0018772	Hearing Loss, Partial	phenotype	HPO
C0020757	Ichthyoses	disease	HPO
C0023893	Liver Cirrhosis, Experimental	disease	CTD_human
C0023895	Liver diseases	group	CTD_human
C0025362	Mental Retardation	disease	HPO
C0026827	Muscle hypotonia	phenotype	HPO
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0029607	Other emphysema	disease	MGD
C0034063	Pulmonary Edema	disease	BEFREE
C0034067	Pulmonary Emphysema	disease	BEFREE;CTD_human
C0034069	Pulmonary Fibrosis	disease	BEFREE
C0036572	Seizures	phenotype	HPO
C0085636	Photophobia	phenotype	HPO
C0086565	Liver Dysfunction	phenotype	CTD_human
C0151611	Electroencephalogram abnormal	phenotype	HPO
C0221227	Centriacinar Emphysema	disease	CTD_human
C0221357	Brachydactyly	disease	HPO
C0221373	Claw hand	disease	HPO
C0235974	Pancreatic carcinoma	disease	BEFREE
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0264393	Panacinar Emphysema	disease	CTD_human
C0339789	Congenital deafness	disease	HPO
C0349588	Short stature	phenotype	HPO
C0399367	Amelogenesis imperfecta local hypoplastic form	disease	ORPHANET
C0399376	Amelogenesis Imperfecta, Type III	disease	ORPHANET
C0423903	Low intelligence	phenotype	HPO
C0424688	Small head	phenotype	HPO
C0455829	Waist Circumference	phenotype	GWASCAT
C0524910	Hepatitis C, Chronic	disease	CTD_human
C0541764	Delayed bone age	phenotype	HPO
C0578022	Finding of body mass index	phenotype	GWASCAT
C0596263	Carcinogenesis	phenotype	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0684249	Carcinoma of lung	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0746102	Chronic lung disease	group	BEFREE
C0796085	Nance-Horan syndrome	disease	BEFREE
C0917816	Mental deficiency	disease	HPO
C0948896	Primary hypogonadism	disease	HPO
C1305855	Body mass index	phenotype	GWASCAT
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1335302	Pancreatic Ductal Adenocarcinoma	disease	BEFREE
C1384666	hearing impairment	phenotype	HPO
C1843367	Poor school performance	phenotype	HPO
C1848765	Sparse/absent eyebrows	phenotype	HPO
C1851854	Thin dental enamel	phenotype	HPO
C1857042	Sparse scalp hair	phenotype	HPO
C1860711	Dental enamel pits	phenotype	HPO
C1862863	Sparse body hair	phenotype	HPO
C1863008	Yellow-brown discoloration of the teeth	phenotype	HPO
C2266639	Absence of eyebrow	phenotype	HPO
C2350878	Focal Emphysema	disease	CTD_human
C2931280	Perniola Krajewska Carnevale syndrome	disease	ORPHANET
C3551430	Sparse or absent eyebrows	phenotype	HPO
C3714636	Pneumonitis	disease	BEFREE
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND;HPO
C4015557	AMELOGENESIS IMPERFECTA, TYPE IH	disease	CLINVAR;CTD_human;UNIPROT
C4020876	Dull intelligence	phenotype	HPO
C4020887	Photodysphoria	phenotype	HPO
C4021902	Short corpus callosum	phenotype	HPO
C4021956	Aplasia/Hypoplasia of the eyebrow	phenotype	HPO
C4024598	Anterior open-bite malocclusion	phenotype	HPO
C4280456	Dysplasia of tooth enamel	phenotype	HPO
C4280457	Defective enamel matrix	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0001618	virus receptor activity	IEA
GO:0005178	integrin binding	IBA
GO:0005515	protein binding	IPI
GO:0038023	signaling receptor activity	IEA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0006954	inflammatory response	IEA
GO:0007155	cell adhesion	TAS
GO:0007160	cell-matrix adhesion	IBA
GO:0007229	integrin-mediated signaling pathway	IBA
GO:0016477	cell migration	IBA
GO:0030198	extracellular matrix organization	TAS
GO:0033627	cell adhesion mediated by integrin	IDA
GO:0033627	cell adhesion mediated by integrin	IBA
GO:0038044	transforming growth factor-beta secretion	IEA
GO:0046718	viral entry into host cell	IEA
GO:1901388	regulation of transforming growth factor beta activation	IDA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005654	nucleoplasm	IDA
GO:0005813	centrosome	IDA
GO:0005886	plasma membrane	TAS
GO:0005925	focal adhesion	IDA
GO:0005925	focal adhesion	IBA
GO:0008305	integrin complex	TAS
GO:0009897	external side of plasma membrane	IEA
GO:0030054	cell junction	IDA
GO:0034685	integrin alphav-beta6 complex	IBA
GO:0034685	integrin alphav-beta6 complex	IDA
GO:0043235	receptor complex	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1474244	Extracellular matrix organization	TAS
R-HSA-1566948	Elastic fibre formation	TAS
R-HSA-2129379	Molecules associated with elastic fibres	TAS
R-HSA-216083	Integrin cell surface interactions	TAS
R-HSA-3000178	ECM proteoglycans	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in decreased expression of ITGB6 mRNA	28801915
D015058	1-Naphthylisothiocyanate	1-Naphthylisothiocyanate results in increased expression of [ITGB6 protein co-treated with ITGA5 protein]	21037076
D015058	1-Naphthylisothiocyanate	[1-Naphthylisothiocyanate results in increased expression of [ITGB6 protein co-treated with ITGA5 protein]] which results in increased activity of TGFB1 protein	21037076
D015058	1-Naphthylisothiocyanate	F2R protein promotes the reaction [1-Naphthylisothiocyanate results in increased expression of [ITGB6 protein co-treated with ITGA5 protein]]	21037076
D015058	1-Naphthylisothiocyanate	F3 protein promotes the reaction [1-Naphthylisothiocyanate results in increased expression of [ITGB6 protein co-treated with ITGA5 protein]]	21037076
D015058	1-Naphthylisothiocyanate	1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA	21037076; 24633426; 26921287; 28049044;
D015058	1-Naphthylisothiocyanate	1-Naphthylisothiocyanate results in increased expression of ITGB6 protein	22094456
D015058	1-Naphthylisothiocyanate	EGR1 protein affects the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 protein]	22094456
D015058	1-Naphthylisothiocyanate	F2R protein promotes the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	21037076
D015058	1-Naphthylisothiocyanate	F3 protein promotes the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	21037076
D015058	1-Naphthylisothiocyanate	FGG protein affects the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	26921287
D015058	1-Naphthylisothiocyanate	FGG protein affects the reaction [leukadherin-1 inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]]	26921287
D015058	1-Naphthylisothiocyanate	IFNG protein affects the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	26921287
D015058	1-Naphthylisothiocyanate	[ITGA5 protein co-treated with ITGB6 protein] promotes the reaction [1-Naphthylisothiocyanate results in increased phosphorylation of SMAD2 protein]	21037076
D015058	1-Naphthylisothiocyanate	leukadherin-1 inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	26921287
D015058	1-Naphthylisothiocyanate	RAG1 gene mutant form inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	28049044
D015058	1-Naphthylisothiocyanate	TGFB1 protein promotes the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	21037076
C111118	2',3,3',4',5-pentachloro-4-hydroxybiphenyl	2',3,3',4',5-pentachloro-4-hydroxybiphenyl results in decreased expression of ITGB6 mRNA	19114083
C090942	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [TGFB1 protein results in increased expression of ITGB6 mRNA]	21303922
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITGB6 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITGB6 mRNA	27188386
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in decreased expression of ITGB6 mRNA	12419474
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in increased expression of ITGB6 mRNA	19480007
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of ITGB6 gene	27153756
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of ITGB6 mRNA	23630614
D000639	Amitriptyline	Amitriptyline results in decreased expression of ITGB6 mRNA	22341215
D001280	Atrazine	Atrazine results in decreased expression of ITGB6 mRNA	29505797
D001397	Azoxymethane	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of ITGB6 mRNA	29950665
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of ITGB6 mRNA	22178795
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of ITGB6 mRNA	21569818; 22228805;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of ITGB6 mRNA	21839799
C022921	benzo(k)fluoranthene	benzo(k)fluoranthene results in decreased expression of ITGB6 mRNA	26377693
D019324	beta-Naphthoflavone	[Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of ITGB6 mRNA	18164116
D000077610	Bexarotene	Bexarotene results in increased expression of ITGB6 mRNA	17178900
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of ITGB6 mRNA	30951980
C006780	bisphenol A	bisphenol A results in increased expression of ITGB6 mRNA	26063408
C006780	bisphenol A	bisphenol A results in decreased expression of ITGB6 mRNA	25181051; 30816183;
C000611646	bisphenol F	bisphenol F results in increased expression of ITGB6 mRNA	30951980
D000069286	Bortezomib	Bortezomib results in increased expression of ITGB6 mRNA	20977926
D002101	Cacodylic Acid	Cacodylic Acid results in decreased expression of ITGB6 mRNA	17720352
D019256	Cadmium Chloride	Cadmium Chloride results in decreased expression of ITGB6 mRNA	23741332
D002117	Calcitriol	Calcitriol results in increased expression of ITGB6 mRNA	21592394
D002117	Calcitriol	[Testosterone co-treated with Calcitriol] results in increased expression of ITGB6 mRNA	21592394
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of ITGB6 mRNA	25827057
D002737	Chloroprene	Chloroprene results in decreased expression of ITGB6 mRNA	23125180
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of ITGB6 mRNA	20938992
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in decreased expression of ITGB6 mRNA	27392435
D002945	Cisplatin	Cisplatin results in decreased expression of ITGB6 mRNA	27392435
C018021	cobaltous chloride	cobaltous chloride results in decreased expression of ITGB6 mRNA	24386269
D003042	Cocaine	Cocaine results in increased expression of ITGB6 mRNA	18000554
D003300	Copper	[Copper deficiency co-treated with tetrathiomolybdate] results in decreased expression of ITGB6 mRNA	22276220
D003471	Cuprizone	Cuprizone results in increased expression of ITGB6 mRNA	26577399
D003513	Cycloheximide	Cycloheximide inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of ITGB6 mRNA]	11007951
D003513	Cycloheximide	Cycloheximide inhibits the reaction [TGFB1 protein results in increased expression of ITGB6 mRNA]	21303922
D016572	Cyclosporine	Cyclosporine results in decreased expression of ITGB6 mRNA	27989131
C017160	cypermethrin	cypermethrin results in increased expression of ITGB6 mRNA	22528246
D003907	Dexamethasone	Dexamethasone inhibits the reaction [RX3 gene mutant form affects the expression of ITGB6 mRNA]	27941970
D016264	Dextran Sulfate	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of ITGB6 mRNA	29950665
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in increased expression of ITGB6 mRNA	21266533
D004041	Dietary Fats	Dietary Fats results in decreased expression of ITGB6 mRNA	25016146
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in decreased expression of ITGB6 protein	31163220
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of ITGB6 mRNA	31163220
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of ITGB6 mRNA	18164116
C516138	dorsomorphin	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITGB6 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITGB6 mRNA	27188386
C529593	EMD 527040	EMD 527040 binds to and results in decreased activity of [ITGA5 protein binds to ITGB6 protein]	18221819
D004726	Endosulfan	Endosulfan results in decreased expression of ITGB6 mRNA	29391264
D004958	Estradiol	EGF protein inhibits the reaction [Estradiol results in decreased expression of ITGB6 mRNA]	24758408
D004958	Estradiol	[Estradiol co-treated with Progesterone] results in decreased expression of ITGB6 mRNA	20660070
D004958	Estradiol	[Estradiol co-treated with TGFB1 protein] results in increased expression of ITGB6 mRNA	30165855
D004958	Estradiol	Estradiol results in decreased expression of ITGB6 mRNA	23019147; 24758408; 25321415;
D004958	Estradiol	[Progesterone co-treated with Estradiol] results in decreased expression of ITGB6 mRNA	17404688
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of ITGB6 mRNA	26865667
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of ITGB6 mRNA	17557909
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of ITGB6 mRNA	23129252
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of ITGB6 mRNA	20938992
C039281	furan	furan results in increased expression of ITGB6 mRNA	27387713
C039281	furan	furan results in increased methylation of ITGB6 gene	22079235
C056507	gemcitabine	[ITGB6 co-treated with ITGAV] affects the susceptibility to gemcitabine	20150628
D019833	Genistein	Genistein affects the expression of ITGB6 mRNA	26865667
D019833	Genistein	Genistein results in decreased expression of ITGB6 mRNA	23019147
C071834	glycidamide	glycidamide results in decreased expression of ITGB6 mRNA	17822822
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in decreased expression of ITGB6 mRNA	12419474
C041508	indeno(1,2,3-cd)pyrene	indeno(1,2,3-cd)pyrene results in decreased expression of ITGB6 mRNA	26377693
C016517	indole-3-carbinol	indole-3-carbinol affects the expression of ITGB6 mRNA	21396975
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in decreased expression of ITGB6 mRNA	27392435
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in decreased expression of ITGB6 mRNA	24796395
C000589733	leukadherin-1	FGG protein affects the reaction [leukadherin-1 inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]]	26921287
C000589733	leukadherin-1	leukadherin-1 inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ITGB6 mRNA]	26921287
C025340	manganese chloride	manganese chloride results in decreased methylation of ITGB6 gene	27913844
C025340	manganese chloride	manganese chloride results in increased expression of ITGB6 mRNA	28801915
C025340	manganese chloride	manganese chloride results in increased methylation of ITGB6 gene	28801915
C042720	mercuric bromide	mercuric bromide results in increased expression of ITGB6 mRNA	26272509
C042720	mercuric bromide	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITGB6 mRNA	27188386
D008713	Methimazole	Methimazole results in increased expression of ITGB6 mRNA	22504374
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of ITGB6 mRNA	20938992
C406082	monomethylarsonous acid	monomethylarsonous acid results in decreased expression of ITGB6 mRNA	23876855
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in increased expression of ITGB6 mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of ITGB6 mRNA	25554681
D009532	Nickel	Nickel results in increased expression of ITGB6 mRNA	25583101
D009534	Niclosamide	Niclosamide results in increased expression of ITGB6 mRNA	31398420
D018817	N-Methyl-3,4-methylenedioxyamphetamine	N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of ITGB6 mRNA	26251327
D018817	N-Methyl-3,4-methylenedioxyamphetamine	N-Methyl-3,4-methylenedioxyamphetamine results in increased methylation of ITGB6 promoter	26251327
D017239	Paclitaxel	Paclitaxel results in decreased expression of ITGB6 mRNA	19682730
D010416	Pentachlorophenol	Pentachlorophenol results in increased expression of ITGB6 mRNA	29458080
C101814	perfluoro-n-undecanoic acid	perfluoro-n-undecanoic acid results in increased expression of ITGB6 mRNA	23602845
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITGB6 mRNA	27188386
C006253	pirinixic acid	[pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of ITGB6 mRNA	19710929
D017035	Pravastatin	Pravastatin affects the expression of ITGB6 mRNA	27225895
D011374	Progesterone	[Estradiol co-treated with Progesterone] results in decreased expression of ITGB6 mRNA	20660070
D011374	Progesterone	[Progesterone co-treated with Estradiol] results in decreased expression of ITGB6 mRNA	17404688
D011441	Propylthiouracil	Propylthiouracil results in increased expression of ITGB6 mRNA	22504374
C093642	SB 203580	SB 203580 inhibits the reaction [TGFB1 protein results in increased expression of ITGB6 mRNA]	21303922
D012822	Silicon Dioxide	Silicon Dioxide analog results in decreased expression of ITGB6 mRNA	25895662
C009277	sodium arsenate	sodium arsenate results in decreased expression of ITGB6 mRNA	12727804
C017947	sodium arsenite	sodium arsenite results in decreased expression of ITGB6 mRNA	12727804; 23876855; 25879800;
D053260	Soot	Soot results in increased expression of ITGB6 mRNA	22461453; 26551751;
C075117	squalestatin 1	squalestatin 1 affects the expression of ITGB6 mRNA	27225895
C075117	squalestatin 1	squalestatin 1 results in decreased expression of ITGB6 mRNA	27225895
D013605	T-2 Toxin	T-2 Toxin results in decreased expression of ITGB6 mRNA	31299295
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in decreased expression of ITGB6 mRNA	12419474
D013739	Testosterone	[Testosterone co-treated with Calcitriol] results in increased expression of ITGB6 mRNA	21592394
D013739	Testosterone	Testosterone results in increased expression of ITGB6 mRNA	21592394
D013749	Tetrachlorodibenzodioxin	Cycloheximide inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of ITGB6 mRNA]	11007951
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of ITGB6 mRNA	22298810
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of ITGB6 mRNA	23152189
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of ITGB6 mRNA	11007951
D013755	Tetradecanoylphorbol Acetate	[Zinc co-treated with Tetradecanoylphorbol Acetate] affects the expression of ITGB6 mRNA	16979875
C020809	tetrathiomolybdate	[Copper deficiency co-treated with tetrathiomolybdate] results in decreased expression of ITGB6 mRNA	22276220
D013853	Thioacetamide	Thioacetamide results in increased expression of ITGB6 mRNA	18221819
C009495	titanium dioxide	titanium dioxide results in increased expression of ITGB6 mRNA	19695317
C009495	titanium dioxide	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of ITGB6 mRNA	29950665
C009495	titanium dioxide	titanium dioxide results in increased expression of ITGB6 mRNA	23557971
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of ITGB6 protein	30291989
D014118	Toxins, Biological	Toxins, Biological affects the expression of ITGB6 mRNA	19682533
C012589	trichostatin A	trichostatin A results in increased expression of ITGB6 mRNA	24935251
D017974	Uranium Compounds	Uranium Compounds results in increased expression of ITGB6 mRNA	19654044
D014635	Valproic Acid	Valproic Acid results in increased expression of ITGB6 mRNA	24383497
D014635	Valproic Acid	Valproic Acid results in increased methylation of ITGB6 gene	29154799
D001335	Vehicle Emissions	Vehicle Emissions results in decreased methylation of ITGB6 gene	25560391
C025643	vinclozolin	vinclozolin affects the expression of ITGB6 mRNA	19015723
D015032	Zinc	[Zinc co-treated with Tetradecanoylphorbol Acetate] affects the expression of ITGB6 mRNA	16979875
D015032	Zinc	Zinc results in decreased expression of ITGB6 mRNA	19071009
D015032	Zinc	Zinc results in increased expression of ITGB6 mRNA	16870260
C016837	zinc chloride	zinc chloride results in increased expression of ITGB6 mRNA	16870260

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0025	Alternative splicing
KW-0986	Amelogenesis imperfecta
KW-0130	Cell adhesion
KW-0965	Cell junction
KW-0225	Disease mutation
KW-1015	Disulfide bond
KW-0325	Glycoprotein
KW-1183	Host cell receptor for virus entry
KW-0945	Host-virus interaction
KW-0401	Integrin
KW-0472	Membrane
KW-0621	Polymorphism
KW-0675	Receptor
KW-1185	Reference proteome
KW-0677	Repeat
KW-0732	Signal
KW-0812	Transmembrane
KW-1133	Transmembrane helix

Interpro

InterPro ID	InterPro Term
IPR013111	EGF_extracell
IPR040622	I-EGF_1
IPR033760	Integrin_beta_N
IPR015812	Integrin_bsu
IPR015436	Integrin_bsu-6
IPR014836	Integrin_bsu_cyt_dom
IPR012896	Integrin_bsu_tail
IPR036349	Integrin_bsu_tail_dom_sf
IPR002369	Integrin_bsu_VWA
IPR032695	Integrin_dom_sf
IPR016201	PSI
IPR036465	vWFA_dom_sf

PROSITE

PROSITE ID	PROSITE Term
PS00022	EGF_1
PS01186	EGF_2
PS00243	INTEGRIN_BETA

Pfam

Pfam ID	Pfam Term
PF07974	EGF_2
PF18372	I-EGF_1
PF08725	Integrin_b_cyt
PF07965	Integrin_B_tail
PF00362	Integrin_beta
PF17205	PSI_integrin

Gene: ITGB6

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction