CleftGeneDB-Search

Gene: MSX1

Basic information

Tag	Content
Uniprot ID	P28360; A0SZU5; A8K3M1; Q96NY4;
Entrez ID	4487
Genbank protein ID	AAH21285.4; AAA58665.1; AAL17870.1; AAA52683.1; AAH67353.1; ABK81117.1; BAF83325.1;
Genbank nucleotide ID	NM_002448.3
Ensembl protein ID	ENSP00000372170
Ensembl nucleotide ID	ENSG00000163132
Gene name	Homeobox protein MSX-1
Gene symbol	MSX1
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type	CPO,CL/P
Developmental stage
Data sources	Manually collected
Reference	21972896; 20572854; 23580168; 15381719; 14981713; 14755461; 12651933; 21740177; 21689018; 24603642; 16868654; 18177186; 18932005; 26602496; 28232668; 20087401; 20635363; 21866112; 11332647; 17326252; 15354328; 9683588; 12916025; 23903689; 25953455;
Functional description	Acts as a transcriptional repressor. May play a role in limb-pattern formation. Acts in cranofacial development and specifically in odontogenesis. Expression in the developing nail bed mesenchyme is important for nail plate thickness and integrity.
Sequence	MAPAADMTSL PLGVKVEDSA FGKPAGGGAG QAPSAAAATA AAMGADEEGA KPKVSPSLLP 60 FSVEALMADH RKPGAKESAL APSEGVQAAG GSAQPLGVPP GSLGAPDAPS SPRPLGHFSV 120 GGLLKLPEDA LVKAESPEKP ERTPWMQSPR FSPPPARRLS PPACTLRKHK TNRKPRTPFT 180 TAQLLALERK FRQKQYLSIA ERAEFSSSLS LTETQVKIWF QNRRAKAKRL QEAELEKLKM 240 AAKPMLPPAA FGLSFPLGGP AAVAAAAGAS LYGASGPFQR AALPVAPVGL YTAHVGYSMY 300 HLT 303

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Developmental stage	Species	Evidence	Details
1:1 ortholog	MSX1	102190677	A0A452EK01			Capra hircus	Prediction	More>>
1:1 ortholog	MSX1	4487	P28360	CPO,CL/P		Homo sapiens	Publication	More>>
1:1 ortholog	Msx1	17701	P13297	CPO,CLP	E11.5, E13.0, E12.5, E14.0, E13.5, E14.5, E15.0, E15.5, E16.0	Mus musculus	Publication	More>>
1:1 ortholog	MSX1	461092	Q2VL88			Pan troglodytes	Prediction	More>>
1:1 ortholog	MSX1		F1S5G6			Sus scrofa	Prediction	More>>
1:1 ortholog	Msx1		G3V6U7			Rattus norvegicus	Prediction	More>>
1:1 ortholog	msx1a		B3DG59			Danio rerio	Prediction	More>>

Identified variants/mutations related to cleft phenotype

Gene symbol	Significant Variants/SNPS	Methods	PubMed ID
MSX1	rs12532-AA	Sequence analysis	24603642
MSX1	rs11726039	PCR	25953455
MSX1	169 bp allele	PCR; TDT	23903689
MSX1	rs3821949	TDT; conditional logistic regression models	23580168
MSX1	c.799G>T	PCR; restriction enzyme digestion	21972896
MSX1	p.P147Q	PCR-RFLP	21689018
MSX1	c.68C>G; p.A34G	GWAS; direct sequencing	21740177
MSX1	rs12532-A	TDT	20635363
MSX1	c.1170G>A	Genotyping; sequencing; TDT	17326252
MSX1	c.101C>G; p.A34G	Genotyping	16868654
MSX1	c.799G>T;p.G267C	Genotyping	16868654
MSX1	c.832C>T; p.P278S	Genotyping	16868654
MSX1	c.440C>A; p.P147Q	Direct sequencing; TDT	15354328
MSX1	p.G98E	Direct sequencing; TDT	15354328
MSX1	c.101C>G; p.A34G	Genotyping; direct sequencing	21866112
MSX1	c.330C>T; p.G110G	Genotyping; direct sequencing	21866112
MSX1	c.440C>A; p.P147Q	Genotyping; direct sequencing	21866112
MSX1	c.109A>C; p.M37L	Genotyping; direct sequencing	21866112
MSX1	c.800G>C; p.G267A	Genotyping; direct sequencing	21866112
MSX1	c.768C>T; p.Gly110Gly (X1.3 )	Genotyping; sequencing; TDT	9683588
MSX1	rs34246903A>C	GWAS	28232668
MSX1	rs1907989G>A	GWAS	28232668
MSX1	rs6446693C>T	Genotyping	21462296
MSX1	rs868257C>G	Genotyping	21462296
MSX1	rs2034461G>A	Genotyping	21462296
MSX1	rs11726039T>C	Genotyping	20572854
MSX1	rs868257C>G	Genotyping	20572854
MSX1	rs6446693C>T	Genotyping	20572854
MSX1	rs1907998A>G	Genotyping	20572854
MSX1	rs6832405G>T	Genotyping	20572854
MSX1	rs34165410; c.348C>T; p.G111G	Sequencing; SSCP; PCR-RFLP	29738289
MSX1	rs3775261*A	Genotyping	26602496

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1413209274	p.Ala2Thr	missense variant	-	NC_000004.12:g.4859903G>A	TOPMed
rs976201663	p.Ala2Val	missense variant	-	NC_000004.12:g.4859904C>T	TOPMed,gnomAD
rs761452131	p.Pro3Leu	missense variant	-	NC_000004.12:g.4859907C>T	ExAC,TOPMed,gnomAD
rs868309417	p.Pro3Thr	missense variant	-	NC_000004.12:g.4859906C>A	gnomAD
rs923026617	p.Ala4Asp	missense variant	-	NC_000004.12:g.4859910C>A	TOPMed,gnomAD
rs923026617	p.Ala4Gly	missense variant	-	NC_000004.12:g.4859910C>G	TOPMed,gnomAD
rs1202846198	p.Ala4Thr	missense variant	-	NC_000004.12:g.4859909G>A	TOPMed
rs1266003330	p.Ala5Ser	missense variant	-	NC_000004.12:g.4859912G>T	TOPMed
rs978852634	p.Asp6Asn	missense variant	-	NC_000004.12:g.4859915G>A	TOPMed
rs1456398408	p.Met7Lys	missense variant	-	NC_000004.12:g.4859919T>A	gnomAD
rs767362471	p.Leu10Ser	missense variant	-	NC_000004.12:g.4859928T>C	ExAC,TOPMed,gnomAD
rs1448405080	p.Gly13Val	missense variant	-	NC_000004.12:g.4859937G>T	TOPMed,gnomAD
rs1448405080	p.Gly13Ala	missense variant	-	NC_000004.12:g.4859937G>C	TOPMed,gnomAD
rs955681045	p.Gly13Ser	missense variant	-	NC_000004.12:g.4859936G>A	gnomAD
rs955681045	p.Gly13Arg	missense variant	-	NC_000004.12:g.4859936G>C	gnomAD
rs750342298	p.Val14Phe	missense variant	-	NC_000004.12:g.4859939G>T	ExAC,gnomAD
rs750342298	p.Val14Ile	missense variant	-	NC_000004.12:g.4859939G>A	ExAC,gnomAD
rs1376968278	p.Val14Asp	missense variant	-	NC_000004.12:g.4859940T>A	gnomAD
rs1286830821	p.Lys15Glu	missense variant	-	NC_000004.12:g.4859942A>G	TOPMed
rs1409658284	p.Val16Gly	missense variant	-	NC_000004.12:g.4859946T>G	TOPMed
rs753951764	p.Ala20Gly	missense variant	-	NC_000004.12:g.4859958C>G	ExAC,TOPMed,gnomAD
rs753951764	p.Ala20Val	missense variant	-	NC_000004.12:g.4859958C>T	ExAC,TOPMed,gnomAD
rs766466650	p.Ala20Thr	missense variant	-	NC_000004.12:g.4859957G>A	ExAC,TOPMed,gnomAD
rs755151662	p.Gly22Asp	missense variant	-	NC_000004.12:g.4859964G>A	ExAC,TOPMed,gnomAD
rs1039605872	p.Gly22Arg	missense variant	-	NC_000004.12:g.4859963G>C	TOPMed
rs778933360	p.Ala25Glu	missense variant	-	NC_000004.12:g.4859973C>A	ExAC,TOPMed
rs567549350	p.Gly26Ala	missense variant	-	NC_000004.12:g.4859976G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs567549350	p.Gly26Glu	missense variant	-	NC_000004.12:g.4859976G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs567549350	p.Gly26Val	missense variant	-	NC_000004.12:g.4859976G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs752978243	p.Gly26Trp	missense variant	-	NC_000004.12:g.4859975G>T	ExAC,TOPMed,gnomAD
rs752978243	p.Gly26Arg	missense variant	-	NC_000004.12:g.4859975G>C	ExAC,TOPMed,gnomAD
rs778232428	p.Gly27Ter	stop gained	-	NC_000004.12:g.4859978G>T	ExAC,gnomAD
rs1412105867	p.Gly27Glu	missense variant	-	NC_000004.12:g.4859979G>A	TOPMed,gnomAD
rs1412105867	p.Gly27Val	missense variant	-	NC_000004.12:g.4859979G>T	TOPMed,gnomAD
rs778232428	p.Gly27Arg	missense variant	-	NC_000004.12:g.4859978G>A	ExAC,gnomAD
RCV000016016	p.Gly28Ter	frameshift	Selective tooth agenesis 1 (STHAG1)	NC_000004.12:g.4859980dup	ClinVar
RCV000537833	p.Ala29Val	missense variant	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4859985C>T	ClinVar
rs530217423	p.Ala29Val	missense variant	-	NC_000004.12:g.4859985C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1456183219	p.Ala29Ser	missense variant	-	NC_000004.12:g.4859984G>T	gnomAD
rs1414674827	p.Gly30Val	missense variant	-	NC_000004.12:g.4859988G>T	gnomAD
rs1414674827	p.Gly30Ala	missense variant	-	NC_000004.12:g.4859988G>C	gnomAD
rs1208866578	p.Gly30Ser	missense variant	-	NC_000004.12:g.4859987G>A	TOPMed
rs1414674827	p.Gly30Asp	missense variant	-	NC_000004.12:g.4859988G>A	gnomAD
RCV000550347	p.Gly30Ala	missense variant	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4859988G>C	ClinVar
rs1306079473	p.Ala32Ser	missense variant	-	NC_000004.12:g.4859993G>T	TOPMed,gnomAD
rs771408025	p.Ala32Val	missense variant	-	NC_000004.12:g.4859994C>T	ExAC,TOPMed,gnomAD
rs1005731232	p.Pro33Ala	missense variant	-	NC_000004.12:g.4859996C>G	TOPMed,gnomAD
rs1226714798	p.Ala35Thr	missense variant	-	NC_000004.12:g.4860002G>A	gnomAD
rs1346030752	p.Ala36Thr	missense variant	-	NC_000004.12:g.4860005G>A	gnomAD
rs748795757	p.Ala37Val	missense variant	-	NC_000004.12:g.4860009C>T	ExAC,TOPMed,gnomAD
rs748795757	p.Ala37Glu	missense variant	-	NC_000004.12:g.4860009C>A	ExAC,TOPMed,gnomAD
rs1276975452	p.Ala37Thr	missense variant	-	NC_000004.12:g.4860008G>A	gnomAD
rs1016654970	p.Thr39Met	missense variant	-	NC_000004.12:g.4860015C>T	TOPMed
rs567075790	p.Ala40Thr	missense variant	-	NC_000004.12:g.4860017G>A	1000Genomes,gnomAD
rs36059701	p.Ala40Gly	missense variant	-	NC_000004.12:g.4860018C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1179469740	p.Ala41Thr	missense variant	-	NC_000004.12:g.4860020G>A	gnomAD
RCV000529113	p.Met43Leu	missense variant	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4860026A>C	ClinVar
rs565664559	p.Met43Leu	missense variant	-	NC_000004.12:g.4860026A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1422809378	p.Met43Ile	missense variant	-	NC_000004.12:g.4860028G>A	gnomAD
rs1158644438	p.Met43Thr	missense variant	-	NC_000004.12:g.4860027T>C	TOPMed
rs761553379	p.Ala45Glu	missense variant	-	NC_000004.12:g.4860033C>A	ExAC,TOPMed,gnomAD
rs1308395755	p.Ala45Thr	missense variant	-	NC_000004.12:g.4860032G>A	gnomAD
rs1305088382	p.Glu48Gly	missense variant	-	NC_000004.12:g.4860042A>G	gnomAD
rs1331701440	p.Gly49Arg	missense variant	-	NC_000004.12:g.4860044G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Ala50GlyPheSerTerUnkUnkUnk	frameshift	-	NC_000004.12:g.4860042_4860043insG	NCI-TCGA
rs960310824	p.Lys51Thr	missense variant	-	NC_000004.12:g.4860051A>C	TOPMed
rs994158401	p.Lys51Glu	missense variant	-	NC_000004.12:g.4860050A>G	TOPMed,gnomAD
rs1048451887	p.Lys53Glu	missense variant	-	NC_000004.12:g.4860056A>G	gnomAD
rs1048451887	p.Lys53Gln	missense variant	-	NC_000004.12:g.4860056A>C	gnomAD
rs1341926891	p.Ser55Phe	missense variant	-	NC_000004.12:g.4860063C>T	gnomAD
rs1229676200	p.Ser57Ter	stop gained	-	NC_000004.12:g.4860069C>A	gnomAD
rs1274360141	p.Leu59Gln	missense variant	-	NC_000004.12:g.4860075T>A	gnomAD
rs1482382463	p.Pro60Leu	missense variant	-	NC_000004.12:g.4860078C>T	gnomAD
rs1265724633	p.Phe61Val	missense variant	-	NC_000004.12:g.4860080T>G	TOPMed
rs1225310033	p.Ser62Arg	missense variant	-	NC_000004.12:g.4860085C>A	gnomAD
rs1268885452	p.Val63Leu	missense variant	-	NC_000004.12:g.4860086G>T	gnomAD
rs1451616951	p.Glu64Gly	missense variant	-	NC_000004.12:g.4860090A>G	gnomAD
rs1207652549	p.Ala65Glu	missense variant	-	NC_000004.12:g.4860093C>A	TOPMed
rs1197745096	p.Ala65Thr	missense variant	-	NC_000004.12:g.4860092G>A	gnomAD
rs1450940679	p.Leu66Ile	missense variant	-	NC_000004.12:g.4860095C>A	TOPMed,gnomAD
RCV000016015	p.Met67Lys	missense variant	Selective tooth agenesis 1 (STHAG1)	NC_000004.12:g.4860099T>A	ClinVar
rs1427761384	p.Met67Ile	missense variant	-	NC_000004.12:g.4860100G>T	gnomAD
rs121913130	p.Met67Lys	missense variant	-	NC_000004.12:g.4860099T>A	gnomAD
rs121913130	p.Met67Lys	missense variant	Tooth agenesis, selective, 1 (STHAG1)	NC_000004.12:g.4860099T>A	UniProt,dbSNP
VAR_015712	p.Met67Lys	missense variant	Tooth agenesis, selective, 1 (STHAG1)	NC_000004.12:g.4860099T>A	UniProt
rs121913130	p.Met67Thr	missense variant	-	NC_000004.12:g.4860099T>C	gnomAD
rs1165348573	p.Ala68Gly	missense variant	-	NC_000004.12:g.4860102C>G	gnomAD
rs1372768199	p.Asp69Glu	missense variant	-	NC_000004.12:g.4860106C>A	gnomAD
rs201156596	p.Pro73Leu	missense variant	-	NC_000004.12:g.4860117C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs537984383	p.Ala75Pro	missense variant	-	NC_000004.12:g.4860122G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs537984383	p.Ala75Thr	missense variant	-	NC_000004.12:g.4860122G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1328486263	p.Glu77Asp	missense variant	-	NC_000004.12:g.4860130G>C	TOPMed,gnomAD
NCI-TCGA novel	p.Ala79ArgPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.4860132_4860156GCGCCCTGGCGCCCTCCGAGGGCGT>-	NCI-TCGA
rs967551252	p.Ala79Val	missense variant	-	NC_000004.12:g.4860135C>T	TOPMed
rs964861174	p.Ala81Val	missense variant	-	NC_000004.12:g.4860141C>T	TOPMed,gnomAD
rs964861174	p.Ala81Glu	missense variant	-	NC_000004.12:g.4860141C>A	TOPMed,gnomAD
rs1248813501	p.Pro82Leu	missense variant	-	NC_000004.12:g.4860144C>T	gnomAD
RCV000016012	p.Glu84Val	missense variant	Orofacial cleft 5 (OFC5)	NC_000004.12:g.4860150A>T	ClinVar
rs28928890	p.Glu84Gly	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860150A>G	TOPMed,gnomAD
rs1464389153	p.Glu84Gln	missense variant	-	NC_000004.12:g.4860149G>C	TOPMed
rs28928890	p.Glu84Val	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4860150A>T	UniProt,dbSNP
VAR_018391	p.Glu84Val	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4860150A>T	UniProt
rs28928890	p.Glu84Val	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860150A>T	TOPMed,gnomAD
NCI-TCGA novel	p.Gly85Ser	missense variant	-	NC_000004.12:g.4860152G>A	NCI-TCGA
rs997321662	p.Val86Leu	missense variant	-	NC_000004.12:g.4860155G>C	TOPMed,gnomAD
rs997321662	p.Val86Met	missense variant	-	NC_000004.12:g.4860155G>A	TOPMed,gnomAD
rs759475915	p.Gln87Arg	missense variant	-	NC_000004.12:g.4860159A>G	ExAC,TOPMed,gnomAD
rs1318544738	p.Ala88Gly	missense variant	-	NC_000004.12:g.4860162C>G	TOPMed,gnomAD
rs1318544738	p.Ala88Glu	missense variant	-	NC_000004.12:g.4860162C>A	TOPMed,gnomAD
rs1030007862	p.Gly90Ser	missense variant	-	NC_000004.12:g.4860167G>A	TOPMed,gnomAD
rs1369045142	p.Ser92Leu	missense variant	-	NC_000004.12:g.4860174C>T	TOPMed,gnomAD
rs1161574243	p.Pro95Leu	missense variant	-	NC_000004.12:g.4860183C>T	gnomAD
rs758616631	p.Leu96Arg	missense variant	-	NC_000004.12:g.4860186T>G	ExAC,TOPMed,gnomAD
rs975425740	p.Leu96Met	missense variant	-	NC_000004.12:g.4860185C>A	TOPMed,gnomAD
rs1275816812	p.Gly97Val	missense variant	-	NC_000004.12:g.4860189G>T	TOPMed
VAR_018392	p.Gly97Asp	Missense	Non-syndromic orofacial cleft 5 (OFC5) [MIM:608874]	-	UniProt
rs933932046	p.Gly101Ala	missense variant	-	NC_000004.12:g.4860201G>C	TOPMed,gnomAD
rs781615134	p.Ser102Leu	missense variant	-	NC_000004.12:g.4860204C>T	ExAC,gnomAD
rs768005654	p.Gly104Arg	missense variant	-	NC_000004.12:g.4860209G>C	ExAC,TOPMed,gnomAD
rs1304998337	p.Gly104Glu	missense variant	-	NC_000004.12:g.4860210G>A	gnomAD
rs778451461	p.Ala105Asp	missense variant	-	NC_000004.12:g.4860213C>A	ExAC,TOPMed,gnomAD
rs747656115	p.Pro106Ser	missense variant	-	NC_000004.12:g.4860215C>T	ExAC,gnomAD
rs927588357	p.Asp107Asn	missense variant	-	NC_000004.12:g.4860218G>A	gnomAD
rs771740327	p.Ala108Thr	missense variant	-	NC_000004.12:g.4860221G>A	ExAC,TOPMed,gnomAD
rs1487038870	p.Pro109His	missense variant	-	NC_000004.12:g.4860225C>A	TOPMed,gnomAD
rs866357914	p.Ser110Pro	missense variant	-	NC_000004.12:g.4860227T>C	gnomAD
rs760478775	p.Ser110Phe	missense variant	-	NC_000004.12:g.4860228C>T	ExAC,gnomAD
rs866357914	p.Ser110Ala	missense variant	-	NC_000004.12:g.4860227T>G	gnomAD
rs770861750	p.Ser111Pro	missense variant	-	NC_000004.12:g.4860230T>C	ExAC,gnomAD
rs104893852	p.Ser111Ter	stop gained	-	NC_000004.12:g.4860231C>A	-
RCV000016009	p.Ser111Ter	nonsense	Selective tooth agenesis 1 (STHAG1)	NC_000004.12:g.4860231C>A	ClinVar
rs1158505442	p.Arg113Trp	missense variant	-	NC_000004.12:g.4860236C>T	gnomAD
rs930081770	p.His117Arg	missense variant	-	NC_000004.12:g.4860249A>G	TOPMed,gnomAD
rs1207807140	p.His117Tyr	missense variant	-	NC_000004.12:g.4860248C>T	TOPMed
rs930081770	p.His117Leu	missense variant	-	NC_000004.12:g.4860249A>T	TOPMed,gnomAD
rs1351809242	p.Ser119Leu	missense variant	-	NC_000004.12:g.4860255C>T	gnomAD
rs759548721	p.Val120Gly	missense variant	-	NC_000004.12:g.4860258T>G	ExAC,TOPMed,gnomAD
rs759548721	p.Val120Gly	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4860258T>G	UniProt,dbSNP
VAR_018393	p.Val120Gly	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4860258T>G	UniProt
rs765128034	p.Gly121Trp	missense variant	-	NC_000004.12:g.4860260G>T	ExAC,TOPMed,gnomAD
RCV000016013	p.Gly122Glu	missense variant	Orofacial cleft 5 (OFC5)	NC_000004.12:g.4860264G>A	ClinVar
rs28933081	p.Gly122Glu	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4860264G>A	UniProt,dbSNP
VAR_018394	p.Gly122Glu	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4860264G>A	UniProt
rs28933081	p.Gly122Glu	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860264G>A	ESP,ExAC,TOPMed,gnomAD
rs775617431	p.Gly122Arg	missense variant	-	NC_000004.12:g.4860263G>A	ExAC,gnomAD
rs28933081	p.Gly122Val	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860264G>T	ESP,ExAC,TOPMed,gnomAD
RCV000560292	p.Gly122Val	missense variant	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4860264G>T	ClinVar
rs764296833	p.Leu124His	missense variant	-	NC_000004.12:g.4860270T>A	ExAC,TOPMed,gnomAD
rs576748377	p.Leu126Gln	missense variant	-	NC_000004.12:g.4860276T>A	ExAC,gnomAD
rs750858899	p.Pro127Thr	missense variant	-	NC_000004.12:g.4860278C>A	ExAC,TOPMed,gnomAD
rs1435154475	p.Asp129Asn	missense variant	-	NC_000004.12:g.4860284G>A	gnomAD
rs1177012243	p.Ala130Thr	missense variant	-	NC_000004.12:g.4860287G>A	gnomAD
rs747687057	p.Leu131Phe	missense variant	-	NC_000004.12:g.4860290C>T	ExAC,gnomAD
rs1371782876	p.Val132Leu	missense variant	-	NC_000004.12:g.4860293G>C	gnomAD
rs1392177805	p.Ala134Ser	missense variant	-	NC_000004.12:g.4860299G>T	TOPMed
rs1370476101	p.Glu135Asp	missense variant	-	NC_000004.12:g.4860304G>C	TOPMed,gnomAD
rs770808822	p.Glu135Lys	missense variant	-	NC_000004.12:g.4860302G>A	ExAC,gnomAD
rs1301468375	p.Ser136Arg	missense variant	-	NC_000004.12:g.4860307C>A	gnomAD
rs1220626727	p.Ser136Gly	missense variant	-	NC_000004.12:g.4860305A>G	gnomAD
rs1412315816	p.Glu138Gln	missense variant	-	NC_000004.12:g.4860311G>C	TOPMed
rs745700109	p.Pro140Ser	missense variant	-	NC_000004.12:g.4860317C>T	ExAC,gnomAD
rs1342849180	p.Glu141Ala	missense variant	-	NC_000004.12:g.4860321A>C	gnomAD
rs769759615	p.Arg142Met	missense variant	-	NC_000004.12:g.4860324G>T	ExAC,TOPMed,gnomAD
rs1249758312	p.Arg142Ser	missense variant	-	NC_000004.12:g.4860325G>T	gnomAD
rs769759615	p.Arg142Lys	missense variant	-	NC_000004.12:g.4860324G>A	ExAC,TOPMed,gnomAD
rs369625915	p.Thr143Ser	missense variant	-	NC_000004.12:g.4860326A>T	ESP,ExAC,TOPMed,gnomAD
rs764174177	p.Pro144Leu	missense variant	-	NC_000004.12:g.4860330C>T	ExAC,gnomAD
NCI-TCGA novel	p.Met146Val	missense variant	-	NC_000004.12:g.4860335A>G	NCI-TCGA
rs774512352	p.Met146Ile	missense variant	-	NC_000004.12:g.4860337G>A	ExAC,TOPMed,gnomAD
rs1431648315	p.Met146Thr	missense variant	-	NC_000004.12:g.4860336T>C	TOPMed,gnomAD
rs1431648315	p.Met146Arg	missense variant	-	NC_000004.12:g.4860336T>G	TOPMed,gnomAD
rs774512352	p.Met146Ile	missense variant	-	NC_000004.12:g.4860337G>T	ExAC,TOPMed,gnomAD
rs767772329	p.Gln147His	missense variant	-	NC_000004.12:g.4860340G>C	ExAC,TOPMed,gnomAD
rs756500556	p.Ser148Ile	missense variant	-	NC_000004.12:g.4860342G>T	ExAC,gnomAD
rs766839374	p.Ser148Arg	missense variant	-	NC_000004.12:g.4860343C>G	ExAC,TOPMed,gnomAD
rs756500556	p.Ser148Asn	missense variant	-	NC_000004.12:g.4860342G>A	ExAC,gnomAD
rs1352277615	p.Pro149Leu	missense variant	-	NC_000004.12:g.4860345C>T	gnomAD
NCI-TCGA novel	p.Arg150Cys	missense variant	-	NC_000004.12:g.4860347C>T	NCI-TCGA
NCI-TCGA novel	p.Ser152Cys	missense variant	-	NC_000004.12:g.4860354C>G	NCI-TCGA
rs104893854	p.Pro153Arg	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860357C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs104893854	p.Pro153Gln	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860357C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs104893854	p.Pro153Leu	missense variant	Orofacial cleft 5 (ofc5)	NC_000004.12:g.4860357C>T	1000Genomes,ExAC,TOPMed,gnomAD
RCV000016014	p.Pro153Gln	missense variant	Orofacial cleft 5 (OFC5)	NC_000004.12:g.4860357C>A	ClinVar
rs545651715	p.Pro154Arg	missense variant	-	NC_000004.12:g.4860360C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs545651715	p.Pro154Leu	missense variant	-	NC_000004.12:g.4860360C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs780766124	p.Pro154Ala	missense variant	-	NC_000004.12:g.4860359C>G	ExAC,TOPMed,gnomAD
rs780766124	p.Pro154Ser	missense variant	-	NC_000004.12:g.4860359C>T	ExAC,TOPMed,gnomAD
rs1437103928	p.Pro155Leu	missense variant	-	NC_000004.12:g.4860363C>T	TOPMed
rs1222485244	p.Ala156Asp	missense variant	-	NC_000004.12:g.4860366C>A	gnomAD
rs1323415097	p.Ala156Ser	missense variant	-	NC_000004.12:g.4860365G>T	TOPMed,gnomAD
rs150284621	p.Arg157Ser	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4862702G>T	UniProt,dbSNP
VAR_018395	p.Arg157Ser	missense variant	Non-syndromic orofacial cleft 5 (OFC5)	NC_000004.12:g.4862702G>T	UniProt
rs150284621	p.Arg157Ser	missense variant	-	NC_000004.12:g.4862702G>T	1000Genomes,ExAC,TOPMed,gnomAD
RCV000490415	p.Arg157Ser	missense variant	Orofacial cleft 5 (OFC5)	NC_000004.12:g.4862702G>T	ClinVar
rs1264902390	p.Arg157Trp	missense variant	-	NC_000004.12:g.4860368A>T	TOPMed,gnomAD
NCI-TCGA novel	p.Arg158Leu	missense variant	-	NC_000004.12:g.4862704G>T	NCI-TCGA
rs781507762	p.Arg158Trp	missense variant	-	NC_000004.12:g.4862703C>T	ExAC,TOPMed,gnomAD
rs746116954	p.Arg158Gln	missense variant	-	NC_000004.12:g.4862704G>A	ExAC,gnomAD
COSM3825940	p.Ser160Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862710G>A	NCI-TCGA Cosmic
rs1398311504	p.Pro161Leu	missense variant	-	NC_000004.12:g.4862713C>T	gnomAD
rs770246625	p.Pro162Ala	missense variant	-	NC_000004.12:g.4862715C>G	ExAC,TOPMed,gnomAD
rs1374050033	p.Pro162Leu	missense variant	-	NC_000004.12:g.4862716C>T	TOPMed
rs762477502	p.Pro162GlnPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.4862711C>-	NCI-TCGA,NCI-TCGA Cosmic
rs770246625	p.Pro162Thr	missense variant	-	NC_000004.12:g.4862715C>A	ExAC,TOPMed,gnomAD
rs528951725	p.Ala163Ser	missense variant	-	NC_000004.12:g.4862718G>T	1000Genomes,ExAC,gnomAD
rs1032988132	p.His169Tyr	missense variant	-	NC_000004.12:g.4862736C>T	gnomAD
rs1023858128	p.Lys170Arg	missense variant	-	NC_000004.12:g.4862740A>G	TOPMed,gnomAD
rs765893159	p.Lys170Glu	missense variant	-	NC_000004.12:g.4862739A>G	ExAC,gnomAD
rs776223079	p.Thr171Met	missense variant	-	NC_000004.12:g.4862743C>T	ExAC,TOPMed,gnomAD
rs776223079	p.Thr171Lys	missense variant	-	NC_000004.12:g.4862743C>A	ExAC,TOPMed,gnomAD
rs1256847116	p.Asn172Lys	missense variant	-	NC_000004.12:g.4862747C>A	gnomAD
NCI-TCGA novel	p.Arg173His	missense variant	-	NC_000004.12:g.4862749G>A	NCI-TCGA
rs1485301859	p.Arg173Cys	missense variant	-	NC_000004.12:g.4862748C>T	TOPMed,gnomAD
rs569734431	p.Arg173Pro	missense variant	-	NC_000004.12:g.4862749G>C	gnomAD
COSM3825941	p.Arg176Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862758G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr177Ala	missense variant	-	NC_000004.12:g.4862760A>G	NCI-TCGA
COSM119835	p.Phe179Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862767T>G	NCI-TCGA Cosmic
rs1417006531	p.Thr180Asn	missense variant	-	NC_000004.12:g.4862770C>A	gnomAD
rs549162057	p.Ala182Thr	missense variant	-	NC_000004.12:g.4862775G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs549162057	p.Ala182Ser	missense variant	-	NC_000004.12:g.4862775G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs370243708	p.Ala182Val	missense variant	-	NC_000004.12:g.4862776C>T	ESP,ExAC,TOPMed,gnomAD
rs781456258	p.Leu185Pro	missense variant	-	NC_000004.12:g.4862785T>C	ExAC,gnomAD
rs756385553	p.Arg189Leu	missense variant	-	NC_000004.12:g.4862797G>T	ExAC
rs1391615384	p.Arg189Gly	missense variant	-	NC_000004.12:g.4862796C>G	gnomAD
COSM4846336	p.Arg189His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862797G>A	NCI-TCGA Cosmic
rs760914206	p.Arg192His	missense variant	-	NC_000004.12:g.4862806G>A	TOPMed
COSM3974930	p.Arg192Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862805C>T	NCI-TCGA Cosmic
rs1235225331	p.Gln193His	missense variant	-	NC_000004.12:g.4862810G>T	gnomAD
rs104893850	p.Gln193Ter	stop gained	-	NC_000004.12:g.4862808C>T	-
COSM6100355	p.Gln193Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862808C>A	NCI-TCGA Cosmic
rs1235225331	p.Gln193His	missense variant	-	NC_000004.12:g.4862810G>C	gnomAD
RCV000016010	p.Gln193Ter	nonsense	Selective tooth agenesis 1 (STHAG1)	NC_000004.12:g.4862808C>T	ClinVar
rs149092063	p.Lys194Arg	missense variant	-	NC_000004.12:g.4862812A>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu197Met	missense variant	-	NC_000004.12:g.4862820C>A	NCI-TCGA
rs1254077152	p.Ile199Val	missense variant	-	NC_000004.12:g.4862826A>G	gnomAD
COSM3604315	p.Ala200Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862830C>A	NCI-TCGA Cosmic
rs1346748006	p.Ala200Val	missense variant	-	NC_000004.12:g.4862830C>T	TOPMed
RCV000016008	p.Arg202Pro	missense variant	Selective tooth agenesis 1 (STHAG1)	NC_000004.12:g.4862836G>C	ClinVar
rs551697430	p.Arg202Gly	missense variant	-	NC_000004.12:g.4862835C>G	1000Genomes,ExAC,gnomAD
rs121913129	p.Arg202Pro	missense variant	-	NC_000004.12:g.4862836G>C	-
rs121913129	p.Arg202Pro	missense variant	Tooth agenesis, selective, 1 (STHAG1)	NC_000004.12:g.4862836G>C	UniProt,dbSNP
VAR_003754	p.Arg202Pro	missense variant	Tooth agenesis, selective, 1 (STHAG1)	NC_000004.12:g.4862836G>C	UniProt
NCI-TCGA novel	p.Ala203Thr	missense variant	-	NC_000004.12:g.4862838G>A	NCI-TCGA
rs776095213	p.Ala203Ser	missense variant	-	NC_000004.12:g.4862838G>T	ExAC,gnomAD
NCI-TCGA novel	p.Glu204Ter	stop gained	-	NC_000004.12:g.4862841G>T	NCI-TCGA
rs759104204	p.Phe205Leu	missense variant	-	NC_000004.12:g.4862844T>C	ExAC,gnomAD
rs775213895	p.Ser206Cys	missense variant	-	NC_000004.12:g.4862848C>G	ExAC
COSM1055858	p.Ser208Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862854C>T	NCI-TCGA Cosmic
rs104893853	p.Ser208Trp	missense variant	-	NC_000004.12:g.4862854C>G	ExAC,gnomAD
rs104893853	p.Ser208Ter	stop gained	-	NC_000004.12:g.4862854C>A	ExAC,gnomAD
RCV000016011	p.Ser208Ter	nonsense	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4862854C>A	ClinVar
rs143068777	p.Ser210Asn	missense variant	-	NC_000004.12:g.4862860G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs919065116	p.Thr212Ser	missense variant	-	NC_000004.12:g.4862865A>T	TOPMed
rs756333968	p.Thr214Met	missense variant	-	NC_000004.12:g.4862872C>T	ExAC,TOPMed,gnomAD
rs1303920433	p.Gln215Arg	missense variant	-	NC_000004.12:g.4862875A>G	gnomAD
rs1369887581	p.Val216Glu	missense variant	-	NC_000004.12:g.4862878T>A	gnomAD
COSM1055859	p.Ile218Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862884T>A	NCI-TCGA Cosmic
RCV000544581	p.Gln221Ter	nonsense	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4862892C>T	ClinVar
rs1553878162	p.Gln221Ter	stop gained	-	NC_000004.12:g.4862892C>T	-
rs1232010260	p.Asn222Thr	missense variant	-	NC_000004.12:g.4862896A>C	gnomAD
NCI-TCGA novel	p.Arg224His	missense variant	-	NC_000004.12:g.4862902G>A	NCI-TCGA
rs1342784720	p.Arg224Cys	missense variant	-	NC_000004.12:g.4862901C>T	gnomAD
rs755255042	p.Ala225Val	missense variant	-	NC_000004.12:g.4862905C>T	ExAC,gnomAD
rs754108948	p.Ala225Pro	missense variant	-	NC_000004.12:g.4862904G>C	ExAC,gnomAD
rs1172241272	p.Ala227Pro	missense variant	-	NC_000004.12:g.4862910G>C	TOPMed
NCI-TCGA novel	p.Glu232Lys	missense variant	-	NC_000004.12:g.4862925G>A	NCI-TCGA
NCI-TCGA novel	p.Glu234SerPheSerTerUnk	frameshift	-	NC_000004.12:g.4862931G>-	NCI-TCGA
NCI-TCGA novel	p.Leu238Pro	missense variant	-	NC_000004.12:g.4862944T>C	NCI-TCGA
rs745317876	p.Lys239Arg	missense variant	-	NC_000004.12:g.4862947A>G	ExAC,TOPMed,gnomAD
COSM420575	p.Lys239Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862948G>C	NCI-TCGA Cosmic
COSM3696669	p.Ala241Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4862953C>A	NCI-TCGA Cosmic
rs902284125	p.Ala242Thr	missense variant	-	NC_000004.12:g.4862955G>A	gnomAD
rs902284125	p.Ala242Ser	missense variant	-	NC_000004.12:g.4862955G>T	gnomAD
rs1352210643	p.Pro244Ser	missense variant	-	NC_000004.12:g.4862961C>T	gnomAD
rs201781025	p.Met245Lys	missense variant	-	NC_000004.12:g.4862965T>A	1000Genomes,ExAC,gnomAD
rs201781025	p.Met245Thr	missense variant	-	NC_000004.12:g.4862965T>C	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Leu246ProPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.4862965_4862977TGCTGCCACCGGC>-	NCI-TCGA
rs762705708	p.Leu246Arg	missense variant	-	NC_000004.12:g.4862968T>G	ExAC
rs761710147	p.Pro247Ser	missense variant	-	NC_000004.12:g.4862970C>T	ExAC,TOPMed,gnomAD
rs1313821191	p.Pro248Leu	missense variant	-	NC_000004.12:g.4862974C>T	TOPMed,gnomAD
rs1210922456	p.Ala249Thr	missense variant	-	NC_000004.12:g.4862976G>A	TOPMed
rs1213873487	p.Ala250Thr	missense variant	-	NC_000004.12:g.4862979G>A	gnomAD
RCV000556981	p.Phe251Ter	nonsense	Hypoplastic enamel-onycholysis-hypohidrosis syndrome (TNS)	NC_000004.12:g.4862983_4862984delinsAA	ClinVar
rs1553878166	p.Phe251Ter	stop gained	-	NC_000004.12:g.4862983_4862984delinsAA	-
rs140231550	p.Gly252Arg	missense variant	-	NC_000004.12:g.4862985G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs140231550	p.Gly252Ser	missense variant	-	NC_000004.12:g.4862985G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs140231550	p.Gly252Cys	missense variant	-	NC_000004.12:g.4862985G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1218292784	p.Gly252Ala	missense variant	-	NC_000004.12:g.4862986G>C	TOPMed
rs1340481655	p.Leu253Pro	missense variant	-	NC_000004.12:g.4862989T>C	TOPMed
rs1467307012	p.Pro256Arg	missense variant	-	NC_000004.12:g.4862998C>G	gnomAD
rs753897888	p.Pro256Ser	missense variant	-	NC_000004.12:g.4862997C>T	ExAC,TOPMed,gnomAD
rs753897888	p.Pro256Ala	missense variant	-	NC_000004.12:g.4862997C>G	ExAC,TOPMed,gnomAD
rs1211011383	p.Leu257Phe	missense variant	-	NC_000004.12:g.4863000C>T	gnomAD
rs1185222483	p.Gly259Ser	missense variant	-	NC_000004.12:g.4863006G>A	TOPMed,gnomAD
rs1185222483	p.Gly259Cys	missense variant	-	NC_000004.12:g.4863006G>T	TOPMed,gnomAD
rs535538923	p.Pro260Ser	missense variant	-	NC_000004.12:g.4863009C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs535538923	p.Pro260Thr	missense variant	-	NC_000004.12:g.4863009C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1459531026	p.Ala261Gly	missense variant	-	NC_000004.12:g.4863013C>G	TOPMed,gnomAD
rs1023910105	p.Ala261Thr	missense variant	-	NC_000004.12:g.4863012G>A	gnomAD
rs1322330821	p.Ala262Gly	missense variant	-	NC_000004.12:g.4863016C>G	gnomAD
rs747563297	p.Val263Ile	missense variant	-	NC_000004.12:g.4863018G>A	ExAC,gnomAD
rs1429940476	p.Ala264Val	missense variant	-	NC_000004.12:g.4863022C>T	TOPMed,gnomAD
rs376516578	p.Ala266Thr	missense variant	-	NC_000004.12:g.4863027G>A	ESP,ExAC,TOPMed,gnomAD
rs371178224	p.Ala266Val	missense variant	-	NC_000004.12:g.4863028C>T	ESP,ExAC,TOPMed,gnomAD
rs376516578	p.Ala266Ser	missense variant	-	NC_000004.12:g.4863027G>T	ESP,ExAC,TOPMed,gnomAD
rs371178224	p.Ala266Glu	missense variant	-	NC_000004.12:g.4863028C>A	ESP,ExAC,TOPMed,gnomAD
rs747948603	p.Ala267Val	missense variant	-	NC_000004.12:g.4863031C>T	ExAC,TOPMed,gnomAD
COSM3604316	p.Gly268Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4863033G>A	NCI-TCGA Cosmic
rs1295509625	p.Gly268Asp	missense variant	-	NC_000004.12:g.4863034G>A	gnomAD
rs760652663	p.Ala269Thr	missense variant	-	NC_000004.12:g.4863036G>A	ExAC,TOPMed,gnomAD
rs766251853	p.Ser270Pro	missense variant	-	NC_000004.12:g.4863039T>C	ExAC,TOPMed,gnomAD
rs766251853	p.Ser270Thr	missense variant	-	NC_000004.12:g.4863039T>A	ExAC,TOPMed,gnomAD
COSM3696670	p.Ser270Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4863040C>T	NCI-TCGA Cosmic
rs1239790825	p.Ser270Trp	missense variant	-	NC_000004.12:g.4863040C>G	gnomAD
rs1188111757	p.Tyr272His	missense variant	-	NC_000004.12:g.4863045T>C	gnomAD
COSM6100354	p.Tyr272Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.4863047C>A	NCI-TCGA Cosmic
rs1377042881	p.Tyr272Cys	missense variant	-	NC_000004.12:g.4863046A>G	TOPMed
rs375828884	p.Tyr272Ter	stop gained	-	NC_000004.12:g.4863047C>G	ESP,TOPMed,gnomAD
rs184700656	p.Gly273Arg	missense variant	-	NC_000004.12:g.4863048G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs184700656	p.Gly273Cys	missense variant	-	NC_000004.12:g.4863048G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs184700656	p.Gly273Ser	missense variant	-	NC_000004.12:g.4863048G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs62636562	p.Ala274Val	missense variant	-	NC_000004.12:g.4863052C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs752974918	p.Ala274Thr	missense variant	-	NC_000004.12:g.4863051G>A	ExAC,TOPMed,gnomAD
rs752974918	p.Ala274Ser	missense variant	-	NC_000004.12:g.4863051G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser275Tyr	missense variant	-	NC_000004.12:g.4863055C>A	NCI-TCGA
rs367573135	p.Pro277His	missense variant	-	NC_000004.12:g.4863061C>A	ESP,ExAC,TOPMed,gnomAD
COSM3604317	p.Pro277Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4863061C>T	NCI-TCGA Cosmic
rs1360864388	p.Phe278Ser	missense variant	-	NC_000004.12:g.4863064T>C	gnomAD
rs1312374869	p.Arg280Cys	missense variant	-	NC_000004.12:g.4863069C>T	gnomAD
COSM6100353	p.Ala281Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4863072G>A	NCI-TCGA Cosmic
rs1280418300	p.Ala282Thr	missense variant	-	NC_000004.12:g.4863075G>A	gnomAD
rs1222467199	p.Leu283Val	missense variant	-	NC_000004.12:g.4863078C>G	TOPMed,gnomAD
rs771885867	p.Pro284Ser	missense variant	-	NC_000004.12:g.4863081C>T	ExAC,TOPMed,gnomAD
rs1210750959	p.Val285Leu	missense variant	-	NC_000004.12:g.4863084G>T	gnomAD
rs1210750959	p.Val285Met	missense variant	-	NC_000004.12:g.4863084G>A	gnomAD
rs1425150458	p.Ala286Val	missense variant	-	NC_000004.12:g.4863088C>T	TOPMed,gnomAD
rs1279003369	p.Pro287Thr	missense variant	-	NC_000004.12:g.4863090C>A	gnomAD
rs1183331676	p.Val288Met	missense variant	-	NC_000004.12:g.4863093G>A	gnomAD
rs1183331676	p.Val288Leu	missense variant	-	NC_000004.12:g.4863093G>C	gnomAD
rs1233165001	p.Gly289Glu	missense variant	-	NC_000004.12:g.4863097G>A	TOPMed,gnomAD
rs1233165001	p.Gly289Val	missense variant	-	NC_000004.12:g.4863097G>T	TOPMed,gnomAD
rs1469278626	p.Leu290Ile	missense variant	-	NC_000004.12:g.4863099C>A	gnomAD
rs1426946585	p.Tyr291His	missense variant	-	NC_000004.12:g.4863102T>C	gnomAD
rs1446398363	p.Thr292Met	missense variant	-	NC_000004.12:g.4863106C>T	TOPMed
rs1435298307	p.Thr292Ala	missense variant	-	NC_000004.12:g.4863105A>G	TOPMed,gnomAD
rs1373544643	p.Ala293Thr	missense variant	-	NC_000004.12:g.4863108G>A	gnomAD
rs1335451480	p.Gly296Asp	missense variant	-	NC_000004.12:g.4863118G>A	gnomAD
rs1440233845	p.Tyr297His	missense variant	-	NC_000004.12:g.4863120T>C	gnomAD
rs1277008553	p.Ser298Ile	missense variant	-	NC_000004.12:g.4863124G>T	gnomAD
COSM4125003	p.Ser298Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.4863124G>A	NCI-TCGA Cosmic
rs1372103566	p.Met299Ile	missense variant	-	NC_000004.12:g.4863128G>C	gnomAD
rs770836856	p.Tyr300Cys	missense variant	-	NC_000004.12:g.4863130A>G	ExAC,TOPMed,gnomAD
rs776499548	p.His301Arg	missense variant	-	NC_000004.12:g.4863133A>G	ExAC,gnomAD
rs759648978	p.Leu302Met	missense variant	-	NC_000004.12:g.4863135C>A	ExAC,gnomAD
rs1348000016	p.Thr303Ala	missense variant	-	NC_000004.12:g.4863138A>G	TOPMed
RCV000157079	p.Ter304Tyr	stop lost	Selective tooth agenesis 1 (STHAG1)	NC_000004.12:g.4863141_4863142dup	ClinVar

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0000846	Agenesis	disease	BEFREE
C0003516	Aortopulmonary Septal Defect	disease	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0007847	Malignant tumor of cervix	disease	BEFREE
C0008924	Cleft upper lip	disease	BEFREE;HPO;LHGDN;ORPHANET
C0008925	Cleft Palate	disease	BEFREE;CTD_human;LHGDN
C0009402	Colorectal Carcinoma	disease	BEFREE
C0010417	Cryptorchidism	disease	RGD
C0013903	Ellis-Van Creveld Syndrome	disease	BEFREE
C0017075	Ganglioneuroma	disease	BEFREE
C0017636	Glioblastoma	disease	BEFREE
C0018798	Congenital Heart Defects	group	BEFREE
C0018817	Atrial Septal Defects	group	BEFREE
C0019829	Hodgkin Disease	disease	BEFREE
C0020179	Huntington Disease	disease	BEFREE;LHGDN
C0020608	Hypodontia	disease	BEFREE;CTD_human;HPO;ORPHANET
C0023418	leukemia	disease	BEFREE
C0023452	Childhood Acute Lymphoblastic Leukemia	disease	BEFREE
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE
C0024299	Lymphoma	group	BEFREE
C0024623	Malignant neoplasm of stomach	disease	CTD_human
C0025990	Micrognathism	disease	HPO
C0026764	Multiple Myeloma	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027708	Nephroblastoma	disease	BEFREE
C0027819	Neuroblastoma	group	BEFREE
C0029408	Degenerative polyarthritis	disease	BEFREE
C0030567	Parkinson Disease	disease	BEFREE
C0038356	Stomach Neoplasms	group	CTD_human
C0040427	Tooth Abnormalities	group	CTD_human
C0080233	Tooth Loss	phenotype	BEFREE
C0150993	Pitting of nails	phenotype	HPO
C0152021	Congenital heart disease	group	BEFREE
C0158646	Cleft palate with cleft lip	disease	BEFREE;ORPHANET
C0221261	Koilonychia	phenotype	HPO
C0239174	Late tooth eruption	phenotype	HPO
C0240310	Hypoplasia of the maxilla	disease	HPO
C0240340	Microdontia (disorder)	disease	HPO
C0263523	Micronychia (disorder)	phenotype	HPO
C0266037	Peg-shaped teeth	disease	HPO
C0302592	Cervix carcinoma	disease	BEFREE
C0334634	Malignant lymphoma, lymphocytic, intermediate differentiation, diffuse	disease	BEFREE
C0344724	Ostium secundum atrial septal defect	disease	BEFREE
C0346629	Malignant neoplasm of large intestine	disease	BEFREE
C0376634	Craniofacial Abnormalities	group	BEFREE;CTD_human
C0392006	Unilateral cleft lip	disease	BEFREE
C0399352	Developmental absence of tooth	disease	BEFREE;CTD_human;MGD
C0406716	Hypodontia and nail dysgenesis	disease	ORPHANET
C0406735	Hypoplastic enamel-onycholysis-hypohidrosis syndrome	disease	BEFREE;CLINVAR;CTD_human;ORPHANET
C0423820	Ridged nails	phenotype	HPO
C0423867	Fine hair	phenotype	HPO
C0426980	Motor symptoms	phenotype	BEFREE
C0457756	Tooth absent	phenotype	HPO
C0524730	Odontome	disease	CTD_human
C0596263	Carcinogenesis	phenotype	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0700095	Central neuroblastoma	disease	BEFREE
C0796117	Pitt-Rogers-Danks Syndrome	disease	CTD_human
C0810364	Cleft Lip with or without Cleft Palate	disease	BEFREE
C1290511	Anodontia of Permanent Dentition	disease	HPO
C1290514	Familial hypodontia	disease	BEFREE
C1298692	Cleft lip and alveolus	disease	ORPHANET
C1510586	Autism Spectrum Disorders	disease	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1708349	Hereditary Diffuse Gastric Cancer	disease	CTD_human
C1833369	OROFACIAL CLEFT 3	disease	MGD
C1833563	Cleft Lip, Congenital Healed	disease	MGD
C1835894	Orofacial Cleft 9	disease	MGD
C1837210	OROFACIAL CLEFT 5	disease	CLINVAR;CTD_human;MGD;UNIPROT
C1837218	Cleft palate, isolated	disease	BEFREE;CTD_human
C1837279	Hypoplastic toenails	phenotype	HPO
C1837770	Sparse hair	phenotype	HPO
C1842143	Orofacial Cleft 4	disease	MGD
C1849392	Ridged fingernail	phenotype	HPO
C1853246	Everted lower lip vermilion	phenotype	HPO
C1855694	Hypoplasia of the primary teeth	phenotype	HPO
C1855794	Bamforth syndrome	disease	BEFREE
C1856203	Microdontia of primary teeth	phenotype	HPO
C1856786	Hypoplastic fingernail	phenotype	HPO
C1856963	Fragile nails	phenotype	HPO
C1857130	Hypoplastic mandible condyle	phenotype	HPO
C1860844	Thin, sparse hair	phenotype	HPO
C1861537	OROFACIAL CLEFT 1	disease	MGD
C1864323	OROFACIAL CLEFT 2	disease	MGD
C1866070	OROFACIAL CLEFT 10	disease	MGD
C1866234	Protruding lower lip	phenotype	HPO
C1956097	Wolf-Hirschhorn Syndrome	disease	BEFREE;CTD_human
C1961099	Precursor T-Cell Lymphoblastic Leukemia-Lymphoma	disease	BEFREE
C1970117	Tooth Agenesis, Selective, With Orofacial Cleft	disease	UNIPROT
C1970118	Hypodontia Oligodontia with Orofacial Cleft	disease	UNIPROT
C2677434	OROFACIAL CLEFT 11	disease	MGD
C2748505	Orofacial Cleft 12	disease	MGD
C2981150	Uranostaphyloschisis	disease	BEFREE;HPO
C2986536	Bisphosphonate-associated osteonecrosis	disease	BEFREE
C3151222	OROFACIAL CLEFT 13	disease	MGD
C3489529	Tooth Agenesis, Familial	disease	CLINVAR;CTD_human;UNIPROT
C3554113	Thin toenail	phenotype	HPO
C3711374	Nonsyndromic Deafness	disease	CTD_human
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND
C4012359	Pointed tooth	phenotype	HPO
C4014596	OROFACIAL CLEFT 14	disease	MGD
C4021813	Oral cleft	disease	BEFREE
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4048328	cervical cancer	disease	BEFREE
C4082243	Maxillary retrognathia	phenotype	HPO
C4082304	Oligodontia	disease	BEFREE;HPO;ORPHANET
C4280611	Decreased size of teeth	phenotype	HPO
C4280612	Decreased width of tooth	phenotype	HPO
C4280619	Missing more than six teeth	phenotype	HPO
C4280640	Retrusion of upper jaw bones	phenotype	HPO
C4280641	Hypotrophic maxilla	phenotype	HPO
C4280642	Deficiency of upper jaw bones	phenotype	HPO
C4280643	Decreased projection of maxilla	phenotype	HPO
C4476523	Decreased projection of lower jaw	phenotype	HPO
C4476524	Decreased projection of mandible	phenotype	HPO
C4476525	Retrusion of lower jaw	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000977	RNA polymerase II regulatory region sequence-specific DNA binding	IBA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	IBA
GO:0001227	DNA-binding transcription repressor activity, RNA polymerase II-specific	IEA
GO:0001228	DNA-binding transcription activator activity, RNA polymerase II-specific	IEA
GO:0002039	p53 binding	IPI
GO:0035326	cis-regulatory region binding	IEA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0000122	negative regulation of transcription by RNA polymerase II	IEA
GO:0000902	cell morphogenesis	IDA
GO:0001701	in utero embryonic development	IEA
GO:0003198	epithelial to mesenchymal transition involved in endocardial cushion formation	IEA
GO:0007517	muscle organ development	IEA
GO:0008285	negative regulation of cell population proliferation	IEA
GO:0009952	anterior/posterior pattern specification	IEA
GO:0010463	mesenchymal cell proliferation	IEA
GO:0021983	pituitary gland development	IEA
GO:0023019	signal transduction involved in regulation of gene expression	IEA
GO:0030308	negative regulation of cell growth	IDA
GO:0030513	positive regulation of BMP signaling pathway	IEA
GO:0030901	midbrain development	IEA
GO:0034504	protein localization to nucleus	IDA
GO:0035115	embryonic forelimb morphogenesis	IEA
GO:0035116	embryonic hindlimb morphogenesis	IEA
GO:0035880	embryonic nail plate morphogenesis	IMP
GO:0042474	middle ear morphogenesis	IEA
GO:0042475	odontogenesis of dentin-containing tooth	IMP
GO:0042481	regulation of odontogenesis	IEA
GO:0043066	negative regulation of apoptotic process	IEA
GO:0043517	positive regulation of DNA damage response, signal transduction by p53 class mediator	IC
GO:0045944	positive regulation of transcription by RNA polymerase II	IEA
GO:0048598	embryonic morphogenesis	IBA
GO:0048863	stem cell differentiation	IEA
GO:0050821	protein stabilization	IDA
GO:0051154	negative regulation of striated muscle cell differentiation	IEA
GO:0060021	roof of mouth development	IEA
GO:0060325	face morphogenesis	IMP
GO:0060349	bone morphogenesis	IEA
GO:0060536	cartilage morphogenesis	IEA
GO:0061180	mammary gland epithelium development	IEA
GO:0061312	BMP signaling pathway involved in heart development	IEA
GO:0071316	cellular response to nicotine	IEA
GO:0090427	activation of meiosis	IEA
GO:1902255	positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator	IDA
GO:2000678	negative regulation of transcription regulatory region DNA binding	IEA
GO:2001055	positive regulation of mesenchymal cell apoptotic process	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000790	nuclear chromatin	ISA
GO:0005634	nucleus	IDA
GO:0005634	nucleus	IBA
GO:0005654	nucleoplasm	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence

Drugs and compounds information

ID	Drug Name	Action	PubMed
C111118	2',3,3',4',5-pentachloro-4-hydroxybiphenyl	2',3,3',4',5-pentachloro-4-hydroxybiphenyl results in decreased expression of MSX1 mRNA	19114083
C006551	2-amino-2-methyl-1-propanol	2-amino-2-methyl-1-propanol results in decreased expression of MSX1 mRNA	25088246
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C496492	abrine	abrine results in increased expression of MSX1 mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in increased expression of MSX1 mRNA	21420995; 29067470;
D016604	Aflatoxin B1	Aflatoxin B1 affects the expression of MSX1 protein	20106945
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of MSX1 mRNA	16483693
D018501	Antirheumatic Agents	Antirheumatic Agents results in increased expression of MSX1 mRNA	24449571
D001151	Arsenic	Arsenic results in increased methylation of MSX1 promoter	21291286
C015001	arsenite	arsenite results in increased methylation of MSX1 promoter	23974009
C487081	belinostat	belinostat results in increased expression of MSX1 mRNA	26272509
C487081	belinostat	[NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of MSX1 mRNA	30659931
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of MSX1 mRNA	30951980
C006780	bisphenol A	bisphenol A affects the methylation of MSX1 promoter	27334623
C006780	bisphenol A	bisphenol A results in increased expression of MSX1 mRNA	30951980
C006780	bisphenol A	bisphenol A results in decreased expression of MSX1 mRNA	30816183
C006780	bisphenol A	bisphenol A results in increased expression of MSX1 mRNA	25181051
C000611646	bisphenol F	bisphenol F results in increased expression of MSX1 mRNA	30951980
D002104	Cadmium	Cadmium results in decreased expression of MSX1 mRNA	23256528
D002220	Carbamazepine	Carbamazepine affects the expression of MSX1 mRNA	25979313
C084597	chlorcyclizine	chlorcyclizine results in increased expression of MSX1 mRNA	21058326
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of MSX1 gene	20938992
C007076	citral	citral results in decreased expression of MSX1 mRNA	15581867
D003300	Copper	Copper results in increased expression of MSX1 mRNA	30556269
D019327	Copper Sulfate	Copper Sulfate results in increased expression of MSX1 mRNA	19549813
D003471	Cuprizone	Cuprizone results in increased expression of MSX1 mRNA	26577399
D016572	Cyclosporine	Cyclosporine results in increased expression of MSX1 mRNA	20106945
C093628	cyproconazole	cyproconazole results in decreased expression of MSX1 mRNA	22045034
D003561	Cytarabine	Cytarabine results in decreased expression of MSX1 mRNA	21198554
D003634	DDT	DDT results in decreased expression of MSX1 mRNA	19797855
D000077209	Decitabine	Decitabine results in increased expression of MSX1 mRNA	16367923
D003907	Dexamethasone	Dexamethasone results in decreased expression of MSX1 mRNA	28453788
C036042	dicyclohexyl phthalate	dicyclohexyl phthalate results in decreased expression of MSX1 mRNA	26924002
D004040	Dietary Carbohydrates	Dietary Carbohydrates results in increased expression of MSX1 mRNA	17490981
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in decreased expression of MSX1 mRNA	31163220
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of MSX1 mRNA	28412506
C472511	dimethylarsinous acid	dimethylarsinous acid results in decreased expression of MSX1 protein	26024302
C024629	dimethyl phthalate	dimethyl phthalate results in decreased expression of MSX1 mRNA	26924002
D004237	Diuron	Diuron results in decreased expression of MSX1 mRNA	25152437
C516138	dorsomorphin	[NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D004317	Doxorubicin	Doxorubicin results in decreased expression of MSX1 mRNA	29803840
C118739	entinostat	entinostat results in increased expression of MSX1 mRNA	26272509
D000431	Ethanol	Ethanol results in decreased expression of MSX1 mRNA	28919490
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of MSX1 mRNA	23129252
D005419	Flavonoids	Flavonoids results in increased expression of MSX1 mRNA	18035473
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of MSX1 gene	20938992
D005557	Formaldehyde	Formaldehyde results in increased expression of MSX1 mRNA	20655997
C039281	furan	furan results in decreased expression of MSX1 mRNA	25539665
C004312	glycidol	glycidol results in increased expression of MSX1 mRNA	24395379
C409722	hexaconazole	hexaconazole results in decreased expression of MSX1 mRNA	22045034
C042720	mercuric bromide	mercuric bromide results in increased expression of MSX1 mRNA	26272509
C042720	mercuric bromide	[NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of MSX1 gene	20938992
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased expression of MSX1 mRNA	21664453
C000622638	MLN7243	MLN7243 results in increased sumoylation of MSX1 protein	31285264
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in decreased expression of MSX1 mRNA]	19615344
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate results in decreased expression of MSX1 mRNA	19615344
C406082	monomethylarsonous acid	monomethylarsonous acid results in decreased expression of MSX1 mRNA	26024302
C406082	monomethylarsonous acid	monomethylarsonous acid results in decreased expression of MSX1 protein	26024302
C517284	monomethyl phthalate	monomethyl phthalate results in decreased expression of MSX1 mRNA	26924002
D009538	Nicotine	Nicotine results in increased expression of MSX1 mRNA	20339300
D000077767	Panobinostat	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D000077767	Panobinostat	Panobinostat results in increased expression of MSX1 mRNA	26272509
D020245	p-Chloromercuribenzoic Acid	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D020245	p-Chloromercuribenzoic Acid	p-Chloromercuribenzoic Acid results in increased expression of MSX1 mRNA	26272509
C568608	PCI 5002	[PCI 5002 co-treated with Zinc] results in increased expression of MSX1 mRNA	18593933
D010634	Phenobarbital	Phenobarbital affects the expression of MSX1 mRNA	19159669
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in increased expression of MSX1 mRNA	26272509
D010938	Plant Oils	Plant Oils results in increased expression of MSX1 mRNA	23370395
D011374	Progesterone	Progesterone results in decreased expression of MSX1 mRNA	23018184
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of MSX1 mRNA	25825206
C513428	pyrachlostrobin	pyrachlostrobin results in increased expression of MSX1 mRNA	27029645
D011794	Quercetin	Quercetin results in decreased expression of MSX1 mRNA	21632981
D011794	Quercetin	Quercetin results in decreased expression of MSX1 protein	28431985
C009166	retinol acetate	retinol acetate results in increased expression of MSX1 mRNA	16772331
C115461	SC 560	SC 560 results in decreased expression of MSX1 mRNA	14633654
C115461	SC 560	SC 560 results in decreased expression of MSX1 protein	14633654
D012834	Silver	Silver results in increased expression of MSX1 mRNA	26551752
D012834	Silver	Silver results in increased expression of MSX1 mRNA	27131904
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in decreased expression of MSX1 mRNA]	19615344
C017947	sodium arsenite	sodium arsenite results in decreased expression of MSX1 mRNA	19615344
C017947	sodium arsenite	sodium arsenite results in decreased expression of MSX1 mRNA	26024302
C017947	sodium arsenite	sodium arsenite results in decreased expression of MSX1 protein	26024302
C025462	sulindac sulfide	sulindac sulfide results in decreased expression of MSX1 mRNA	12734198
C025462	sulindac sulfide	sulindac sulfide results in decreased expression of MSX1 protein	12734198
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of MSX1 mRNA	24058054
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin promotes the reaction [tributyltin results in decreased expression of MSX1 mRNA]	22749964
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of MSX1 mRNA	16922920; 17586704; 24035824;
D014212	Tretinoin	Tretinoin results in increased expression of MSX1 mRNA	17138961; 21934132;
D014212	Tretinoin	Tretinoin results in increased expression of MSX1 mRNA	16604517
C011559	tributyltin	Tetrachlorodibenzodioxin promotes the reaction [tributyltin results in decreased expression of MSX1 mRNA]	22749964
C011559	tributyltin	tributyltin results in decreased expression of MSX1 mRNA	22749964
C012589	trichostatin A	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
C012589	trichostatin A	trichostatin A results in increased expression of MSX1 mRNA	24935251; 26272509;
C015559	trimellitic anhydride	trimellitic anhydride results in decreased expression of MSX1 mRNA	19042947
D000077288	Troglitazone	Troglitazone results in increased expression of MSX1 mRNA	19140230
D014520	Urethane	Urethane results in increased expression of MSX1 mRNA	28818685
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of MSX1 mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in decreased expression of MSX1 mRNA	28001369
D014635	Valproic Acid	Valproic Acid results in increased expression of MSX1 mRNA	23179753; 24383497; 24935251; 26272509; 27188386; 29154799;
D014635	Valproic Acid	Valproic Acid results in decreased expression of MSX1 mRNA	19136453; 22045034;
D001335	Vehicle Emissions	Vehicle Emissions affects the methylation of MSX1 gene	25560391
D000077337	Vorinostat	[NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MSX1 mRNA	27188386
D000077337	Vorinostat	Vorinostat results in increased expression of MSX1 mRNA	26272509
D015032	Zinc	[PCI 5002 co-treated with Zinc] results in increased expression of MSX1 mRNA	18593933

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0217	Developmental protein
KW-0225	Disease mutation
KW-0238	DNA-binding
KW-0038	Ectodermal dysplasia
KW-0371	Homeobox
KW-1017	Isopeptide bond
KW-0539	Nucleus
KW-1185	Reference proteome
KW-0678	Repressor
KW-0804	Transcription
KW-0805	Transcription regulation
KW-0832	Ubl conjugation

Interpro

InterPro ID	InterPro Term
IPR009057	Homeobox-like_sf
IPR017970	Homeobox_CS
IPR001356	Homeobox_dom
IPR020479	Homeobox_metazoa

PROSITE

PROSITE ID	PROSITE Term
PS00027	HOMEOBOX_1
PS50071	HOMEOBOX_2

Pfam

Pfam ID	Pfam Term
PF00046	Homeodomain

Gene: MSX1

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Identified variants/mutations related to cleft phenotype

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction