Tag | Content |
---|---|
Uniprot ID | P35222; A8K1L7; Q8NEW9; Q8NI94; Q9H391; |
Entrez ID | 1499 |
Genbank protein ID | AAG35511.1; BAB93475.1; BAF82621.1; CAA61107.1; AAH58926.1; AAR18817.1; EAW64625.1; CAA79497.1; AAL89457.1; |
Genbank nucleotide ID | XM_005264886.2; XM_017005738.1; NM_001904.3; NM_001098209.1; NM_001098210.1; |
Ensembl protein ID | ENSP00000494053; ENSP00000385604; ENSP00000494411; ENSP00000401599; ENSP00000412219; ENSP00000495450; ENSP00000494845; ENSP00000409302; ENSP00000495992; ENSP00000494914; ENSP00000493610; ENSP00000379488; ENSP00000344456; ENSP00000494677; ENSP00000495076; ENSP00000495360; ENSP00000496180; ENSP00000495244; ENSP00000387455; ENSP00000379486; ENSP00000493533; ENSP00000495719; ENSP00000496385; ENSP00000496021; |
Ensembl nucleotide ID | ENSG00000168036 |
Gene name | Catenin beta-1 |
Gene symbol | CTNNB1 |
Organism | Homo sapiens |
NCBI taxa ID | 9606 |
Cleft type | |
Developmental stage | |
Data sources | Homology search |
Reference | |
Functional description | Key downstream component of the canonical Wnt signaling pathway (PubMed:17524503, PubMed:18077326, PubMed:18086858, PubMed:18957423, PubMed:21262353, PubMed:22155184, PubMed:22647378, PubMed:22699938). In the absence of Wnt, forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome (PubMed:17524503, PubMed:18077326, PubMed:18086858, PubMed:18957423, PubMed:21262353, PubMed:22155184, PubMed:22647378, PubMed:22699938). In the presence of Wnt ligand, CTNNB1 is not ubiquitinated and accumulates in the nucleus, where it acts as a coactivator for transcription factors of the TCF/LEF family, leading to activate Wnt responsive genes (PubMed:17524503, PubMed:18077326, PubMed:18086858, PubMed:18957423, PubMed:21262353, PubMed:22155184, PubMed:22647378, PubMed:22699938). Involved in the regulation of cell adhesion, as component of an E-cadherin:catenin adhesion complex (By similarity). Acts as a negative regulator of centrosome cohesion (PubMed:18086858). Involved in the CDK2/PTPN6/CTNNB1/CEACAM1 pathway of insulin internalization (PubMed:21262353). Blocks anoikis of malignant kidney and intestinal epithelial cells and promotes their anchorage-independent growth by down-regulating DAPK2 (PubMed:18957423). Disrupts PML function and PML-NB formation by inhibiting RANBP2-mediated sumoylation of PML (PubMed:22155184). Promotes neurogenesis by maintaining sympathetic neuroblasts within the cell cycle (By similarity). Involved in chondrocyte differentiation via interaction with SOX9: SOX9-binding competes with the binding sites of TCF/LEF within CTNNB1, thereby inhibiting the Wnt signaling (By similarity). |
Sequence | MATQADLMEL DMAMEPDRKA AVSHWQQQSY LDSGIHSGAT TTAPSLSGKG NPEEEDVDTS 60 QVLYEWEQGF SQSFTQEQVA DIDGQYAMTR AQRVRAAMFP ETLDEGMQIP STQFDAAHPT 120 NVQRLAEPSQ MLKHAVVNLI NYQDDAELAT RAIPELTKLL NDEDQVVVNK AAVMVHQLSK 180 KEASRHAIMR SPQMVSAIVR TMQNTNDVET ARCTAGTLHN LSHHREGLLA IFKSGGIPAL 240 VKMLGSPVDS VLFYAITTLH NLLLHQEGAK MAVRLAGGLQ KMVALLNKTN VKFLAITTDC 300 LQILAYGNQE SKLIILASGG PQALVNIMRT YTYEKLLWTT SRVLKVLSVC SSNKPAIVEA 360 GGMQALGLHL TDPSQRLVQN CLWTLRNLSD AATKQEGMEG LLGTLVQLLG SDDINVVTCA 420 AGILSNLTCN NYKNKMMVCQ VGGIEALVRT VLRAGDREDI TEPAICALRH LTSRHQEAEM 480 AQNAVRLHYG LPVVVKLLHP PSHWPLIKAT VGLIRNLALC PANHAPLREQ GAIPRLVQLL 540 VRAHQDTQRR TSMGGTQQQF VEGVRMEEIV EGCTGALHIL ARDVHNRIVI RGLNTIPLFV 600 QLLYSPIENI QRVAAGVLCE LAQDKEAAEA IEAEGATAPL TELLHSRNEG VATYAAAVLF 660 RMSEDKPQDY KKRLSVELTS SLFRTEPMAW NETADLGLDI GAQGEPLGYR QDDPSYRSFH 720 SGGYGQDALG MDPMMEHEMG GHHPGADYPV DGLPDLGHAQ DLMDGLPPGD SNQLAWFDTD 780 L 781 |
Abbreviation :
CLO : cleft lip only. CPO : cleft palate only.
CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.
Relation | Gene symbol | Entrez ID | UniProt ID | Cleft type | Developmental stage | Species | Evidence | Details |
---|---|---|---|---|---|---|---|---|
1:1 ortholog | CTNNB1 | 539003 | Q0VCX4 | Bos taurus | Prediction | More>> | ||
1:1 ortholog | CTNNB1 | 477032 | B6V8E6 | Canis lupus familiaris | Prediction | More>> | ||
1:1 ortholog | CTNNB1 | 102191742 | A0A2Z4FR65 | Capra hircus | Prediction | More>> | ||
1:1 ortholog | CTNNB1 | 100055241 | B1MV73 | Equus caballus | Prediction | More>> | ||
1:1 ortholog | CTNNB1 | 1499 | P35222 | Homo sapiens | Prediction | More>> | ||
1:1 ortholog | Ctnnb1 | 12387 | Q02248 | CPO,CLP | E14.5 | Mus musculus | Publication | More>> |
1:1 ortholog | CTNNB1 | 450183 | A0A2I3SBG5 | Pan troglodytes | Prediction | More>> | ||
1:1 ortholog | Ctnnb1 | 84353 | A0A0G2JT93 | Rattus norvegicus | Prediction | More>> |
ID | Variant | Type | Disease | Chromosome\Coordinate | Evidence |
---|---|---|---|---|---|
rs1310497035 | p.Ala2Gly | missense variant | - | NC_000003.12:g.41224073C>G | TOPMed,gnomAD |
rs1204596334 | p.Ala2Thr | missense variant | - | NC_000003.12:g.41224072G>A | TOPMed |
rs749331498 | p.Thr3Asn | missense variant | - | NC_000003.12:g.41224076C>A | ExAC,gnomAD |
COSM4117539 | p.Thr3Ala | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224075A>G | NCI-TCGA Cosmic |
rs1448779783 | p.Ala5Gly | missense variant | - | NC_000003.12:g.41224526C>G | TOPMed |
NCI-TCGA novel | p.Asp6Ala | missense variant | - | NC_000003.12:g.41224529A>C | NCI-TCGA |
RCV000681492 | p.Met8Thr | missense variant | - | NC_000003.12:g.41224535T>C | ClinVar |
rs121913394 | p.Ala13Thr | missense variant | - | NC_000003.12:g.41224549G>A | - |
RCV000419765 | p.Ala13Thr | missense variant | Cutaneous melanoma | NC_000003.12:g.41224549G>A | ClinVar |
rs752642845 | p.Met14Val | missense variant | - | NC_000003.12:g.41224552A>G | ExAC,gnomAD |
RCV000513017 | p.Met14Val | missense variant | - | NC_000003.12:g.41224552A>G | ClinVar |
rs587778221 | p.Glu15Asp | missense variant | - | NC_000003.12:g.41224557A>C | - |
RCV000120620 | p.Glu15Asp | missense variant | - | NC_000003.12:g.41224557A>C | ClinVar |
rs1290293308 | p.Pro16Thr | missense variant | - | NC_000003.12:g.41224558C>A | gnomAD |
rs1453594408 | p.Pro16Arg | missense variant | - | NC_000003.12:g.41224559C>G | gnomAD |
rs757325337 | p.Ala20Val | missense variant | - | NC_000003.12:g.41224571C>T | ExAC,TOPMed,gnomAD |
rs121913395 | p.Ala21Thr | missense variant | - | NC_000003.12:g.41224573G>A | - |
RCV000430055 | p.Ala21Thr | missense variant | Cutaneous melanoma | NC_000003.12:g.41224573G>A | ClinVar |
rs77064436 | p.Val22Ala | missense variant | - | NC_000003.12:g.41224577T>C | ExAC,gnomAD |
NCI-TCGA novel | p.Val22Asp | missense variant | - | NC_000003.12:g.41224577T>A | NCI-TCGA |
RCV000420898 | p.Val22Ala | missense variant | Cutaneous melanoma | NC_000003.12:g.41224577T>C | ClinVar |
rs77064436 | p.Val22Gly | missense variant | - | NC_000003.12:g.41224577T>G | ExAC,gnomAD |
rs1413975856 | p.Ser23Arg | missense variant | - | NC_000003.12:g.41224579A>C | TOPMed |
rs1413975856 | p.Ser23Arg | missense variant | - | NC_000003.12:g.41224579A>C | UniProt,dbSNP |
VAR_017612 | p.Ser23Arg | missense variant | - | NC_000003.12:g.41224579A>C | UniProt |
COSM274695 | p.Trp25Ter | stop gained | Variant assessed as Somatic; HIGH impact. | NC_000003.12:g.41224587G>A | NCI-TCGA Cosmic |
COSM3593969 | p.Trp25Ter | stop gained | Variant assessed as Somatic; HIGH impact. | NC_000003.12:g.41224586G>A | NCI-TCGA Cosmic |
VAR_017613 | p.Trp25_Ser33del | inframe_deletion | - | - | UniProt |
rs1159520578 | p.Gln26His | missense variant | - | NC_000003.12:g.41224590G>C | TOPMed |
rs1258632801 | p.Gln28His | missense variant | - | NC_000003.12:g.41224596G>T | gnomAD |
NCI-TCGA novel | p.Tyr30Ter | stop gained | - | NC_000003.12:g.41224600_41224601insA | NCI-TCGA |
NCI-TCGA novel | p.Leu31Val | missense variant | - | NC_000003.12:g.41224603C>G | NCI-TCGA |
rs28931588 | p.Asp32Tyr | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224606G>T | UniProt,dbSNP |
VAR_017616 | p.Asp32Tyr | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224606G>T | UniProt |
rs28931588 | p.Asp32Tyr | missense variant | - | NC_000003.12:g.41224606G>T | - |
RCV000019140 | p.Asp32Gly | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224607A>G | ClinVar |
RCV000434746 | p.Asp32Val | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224607A>T | ClinVar |
RCV000433870 | p.Asp32Ala | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224607A>C | ClinVar |
RCV000418872 | p.Asp32Val | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224607A>T | ClinVar |
RCV000429141 | p.Asp32Val | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224607A>T | ClinVar |
RCV000421851 | p.Asp32Ala | missense variant | - | NC_000003.12:g.41224607A>C | ClinVar |
RCV000422753 | p.Asp32Val | missense variant | - | NC_000003.12:g.41224607A>T | ClinVar |
RCV000429157 | p.Asp32His | missense variant | - | NC_000003.12:g.41224606G>C | ClinVar |
RCV000019144 | p.Asp32Tyr | missense variant | Hepatoblastoma | NC_000003.12:g.41224606G>T | ClinVar |
RCV000432187 | p.Asp32Asn | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224606G>A | ClinVar |
RCV000444402 | p.Asp32Asn | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224606G>A | ClinVar |
RCV000422380 | p.Asp32His | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224606G>C | ClinVar |
RCV000432497 | p.Asp32Asn | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224606G>A | ClinVar |
RCV000441401 | p.Asp32Asn | missense variant | Esophageal Squamous Cell Carcinoma | NC_000003.12:g.41224606G>A | ClinVar |
RCV000419510 | p.Asp32His | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224606G>C | ClinVar |
RCV000423474 | p.Asp32Val | missense variant | Endometrial neoplasm | NC_000003.12:g.41224607A>T | ClinVar |
RCV000439506 | p.Asp32Ala | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224607A>C | ClinVar |
RCV000421306 | p.Asp32Asn | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224606G>A | ClinVar |
RCV000438971 | p.Asp32Asn | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224606G>A | ClinVar |
RCV000437131 | p.Asp32His | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224606G>C | ClinVar |
RCV000423696 | p.Asp32Asn | missense variant | - | NC_000003.12:g.41224606G>A | ClinVar |
RCV000425710 | p.Asp32Asn | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224606G>A | ClinVar |
RCV000421744 | p.Asp32His | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224606G>C | ClinVar |
RCV000444118 | p.Asp32Asn | missense variant | Endometrial neoplasm | NC_000003.12:g.41224606G>A | ClinVar |
RCV000430427 | p.Asp32His | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224606G>C | ClinVar |
RCV000128842 | p.Asp32Tyr | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224606G>T | ClinVar |
RCV000440025 | p.Asp32His | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224606G>C | ClinVar |
RCV000431551 | p.Asp32Asn | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224606G>A | ClinVar |
RCV000429774 | p.Asp32His | missense variant | Cutaneous melanoma | NC_000003.12:g.41224606G>C | ClinVar |
RCV000439366 | p.Asp32His | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224606G>C | ClinVar |
RCV000440497 | p.Asp32Val | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224607A>T | ClinVar |
RCV000439390 | p.Asp32Val | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224607A>T | ClinVar |
RCV000421005 | p.Asp32Ala | missense variant | Cutaneous melanoma | NC_000003.12:g.41224607A>C | ClinVar |
RCV000443906 | p.Asp32Ala | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224607A>C | ClinVar |
RCV000422917 | p.Asp32Ala | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224607A>C | ClinVar |
RCV000430242 | p.Asp32Val | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224607A>T | ClinVar |
RCV000436415 | p.Asp32Val | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224607A>T | ClinVar |
RCV000428408 | p.Asp32Ala | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224607A>C | ClinVar |
RCV000429284 | p.Asp32Ala | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224607A>C | ClinVar |
RCV000438648 | p.Asp32Ala | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224607A>C | ClinVar |
rs121913400 | p.Ser33Tyr | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224610C>A | UniProt,dbSNP |
VAR_017619 | p.Ser33Tyr | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224610C>A | UniProt |
rs1057519886 | p.Ser33Thr | missense variant | - | NC_000003.12:g.41224609T>A | - |
rs1057519886 | p.Ser33Ala | missense variant | - | NC_000003.12:g.41224609T>G | - |
rs1057519886 | p.Ser33Pro | missense variant | - | NC_000003.12:g.41224609T>C | - |
RCV000432938 | p.Ser33Thr | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224609T>A | ClinVar |
RCV000418116 | p.Ser33Thr | missense variant | Pancreatic adenocarcinoma | NC_000003.12:g.41224609T>A | ClinVar |
RCV000417825 | p.Ser33Pro | missense variant | Carcinoma of esophagus | NC_000003.12:g.41224609T>C | ClinVar |
RCV000426401 | p.Ser33Pro | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224609T>C | ClinVar |
RCV000418863 | p.Ser33Pro | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224609T>C | ClinVar |
RCV000428518 | p.Ser33Ala | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224609T>G | ClinVar |
RCV000441880 | p.Ser33Thr | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224609T>A | ClinVar |
RCV000420132 | p.Ser33Ala | missense variant | - | NC_000003.12:g.41224609T>G | ClinVar |
RCV000425706 | p.Ser33Thr | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224609T>A | ClinVar |
RCV000435028 | p.Ser33Pro | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224609T>C | ClinVar |
RCV000436119 | p.Ser33Pro | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224609T>C | ClinVar |
RCV000019139 | p.Ser33Tyr | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224610C>A | ClinVar |
RCV000439171 | p.Ser33Ala | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224609T>G | ClinVar |
RCV000431206 | p.Ser33Thr | missense variant | Carcinoma of esophagus | NC_000003.12:g.41224609T>A | ClinVar |
RCV000426101 | p.Ser33Pro | missense variant | - | NC_000003.12:g.41224609T>C | ClinVar |
RCV000424341 | p.Ser33Ala | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224609T>G | ClinVar |
RCV000433600 | p.Ser33Pro | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224609T>C | ClinVar |
RCV000430905 | p.Ser33Ala | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224609T>G | ClinVar |
RCV000425263 | p.Ser33Pro | missense variant | Neoplasm of the large intestine | NC_000003.12:g.41224609T>C | ClinVar |
RCV000434673 | p.Ser33Pro | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224609T>C | ClinVar |
RCV000441600 | p.Ser33Ala | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224609T>G | ClinVar |
RCV000423241 | p.Ser33Ala | missense variant | Neoplasm of the large intestine | NC_000003.12:g.41224609T>G | ClinVar |
RCV000440157 | p.Ser33Thr | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224609T>A | ClinVar |
RCV000433324 | p.Ser33Ala | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224609T>G | ClinVar |
RCV000427045 | p.Ser33Thr | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224609T>A | ClinVar |
RCV000421624 | p.Ser33Cys | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224610C>G | ClinVar |
RCV000019138 | p.Ser33Tyr | missense variant | Carcinoma of colon (CRC) | NC_000003.12:g.41224610C>A | ClinVar |
rs121913400 | p.Ser33Phe | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224610C>T | UniProt,dbSNP |
VAR_017617 | p.Ser33Phe | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224610C>T | UniProt |
RCV000443586 | p.Ser33Ala | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224609T>G | ClinVar |
RCV000435335 | p.Ser33Thr | missense variant | - | NC_000003.12:g.41224609T>A | ClinVar |
RCV000440476 | p.Ser33Ala | missense variant | Carcinoma of esophagus | NC_000003.12:g.41224609T>G | ClinVar |
RCV000424580 | p.Ser33Thr | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224609T>A | ClinVar |
RCV000433966 | p.Ser33Ala | missense variant | Pancreatic adenocarcinoma | NC_000003.12:g.41224609T>G | ClinVar |
RCV000437702 | p.Ser33Thr | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224609T>A | ClinVar |
RCV000019148 | p.Ser33Phe | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224610C>T | ClinVar |
RCV000442478 | p.Ser33Pro | missense variant | Pancreatic adenocarcinoma | NC_000003.12:g.41224609T>C | ClinVar |
RCV000443305 | p.Ser33Pro | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224609T>C | ClinVar |
RCV000420531 | p.Ser33Thr | missense variant | Neoplasm of the large intestine | NC_000003.12:g.41224609T>A | ClinVar |
VAR_017618 | p.Ser33Leu | Missense | - | - | UniProt |
rs28931589 | p.Gly34Glu | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224613G>A | UniProt,dbSNP |
VAR_017620 | p.Gly34Glu | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224613G>A | UniProt |
rs28931589 | p.Gly34Glu | missense variant | - | NC_000003.12:g.41224613G>A | ExAC,gnomAD |
rs28931589 | p.Gly34Val | missense variant | - | NC_000003.12:g.41224613G>T | ExAC,gnomAD |
rs28931589 | p.Gly34Val | missense variant | - | NC_000003.12:g.41224613G>T | UniProt,dbSNP |
VAR_017622 | p.Gly34Val | missense variant | - | NC_000003.12:g.41224613G>T | UniProt |
rs28931589 | p.Gly34Ala | missense variant | - | NC_000003.12:g.41224613G>C | ExAC,gnomAD |
rs121913399 | p.Gly34Arg | missense variant | - | NC_000003.12:g.41224612G>C | - |
rs121913399 | p.Gly34Arg | missense variant | - | NC_000003.12:g.41224612G>A | - |
RCV000444074 | p.Gly34Arg | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224612G>A | ClinVar |
RCV000438776 | p.Gly34Arg | missense variant | Adrenocortical carcinoma | NC_000003.12:g.41224612G>C | ClinVar |
RCV000418083 | p.Gly34Arg | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224612G>C | ClinVar |
RCV000426895 | p.Gly34Arg | missense variant | Craniopharyngioma | NC_000003.12:g.41224612G>A | ClinVar |
RCV000427084 | p.Gly34Ala | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224613G>C | ClinVar |
RCV000443977 | p.Gly34Glu | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224613G>A | ClinVar |
RCV000419447 | p.Gly34Ala | missense variant | Squamous cell carcinoma of the head and neck (HNSCC) | NC_000003.12:g.41224613G>C | ClinVar |
RCV000430713 | p.Gly34Arg | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224612G>C | ClinVar |
RCV000442184 | p.Gly34Ala | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224613G>C | ClinVar |
RCV000427731 | p.Gly34Ala | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224613G>C | ClinVar |
RCV000442160 | p.Gly34Ala | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224613G>C | ClinVar |
RCV000437750 | p.Gly34Ala | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224613G>C | ClinVar |
RCV000436689 | p.Gly34Ala | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224613G>C | ClinVar |
RCV000149120 | p.Gly34Val | missense variant | Malignant tumor of prostate | NC_000003.12:g.41224613G>T | ClinVar |
RCV000430157 | p.Gly34Ala | missense variant | Adrenocortical carcinoma | NC_000003.12:g.41224613G>C | ClinVar |
RCV000420040 | p.Gly34Arg | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224612G>C | ClinVar |
RCV000419419 | p.Gly34Arg | missense variant | Squamous cell carcinoma of the head and neck (HNSCC) | NC_000003.12:g.41224612G>C | ClinVar |
RCV000438599 | p.Gly34Arg | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224612G>C | ClinVar |
RCV000427907 | p.Gly34Arg | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224612G>C | ClinVar |
RCV000438184 | p.Gly34Arg | missense variant | Craniopharyngioma | NC_000003.12:g.41224612G>C | ClinVar |
RCV000427501 | p.Gly34Arg | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224612G>C | ClinVar |
RCV000436663 | p.Gly34Arg | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224612G>C | ClinVar |
NCI-TCGA novel | p.Ile35AsnTyrGlnAspAspAlaGluLeuAlaThrArgAlaIle | insertion | - | NC_000003.12:g.41224613_41224614insGATTAACTATCAAGATGATGCAGAACTTGCCACACGTGC | NCI-TCGA |
COSM5674 | p.Ile35Ser | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224616T>G | NCI-TCGA Cosmic |
VAR_017623 | p.Ile35Ser | Missense | - | - | UniProt |
COSM5678 | p.His36Pro | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224619A>C | NCI-TCGA Cosmic |
rs121913228 | p.Ser37Ala | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224621T>G | UniProt,dbSNP |
VAR_017624 | p.Ser37Ala | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224621T>G | UniProt |
rs121913228 | p.Ser37Ala | missense variant | - | NC_000003.12:g.41224621T>G | - |
rs121913228 | p.Ser37Pro | missense variant | - | NC_000003.12:g.41224621T>C | - |
rs121913403 | p.Ser37Cys | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224622C>G | UniProt,dbSNP |
VAR_017625 | p.Ser37Cys | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224622C>G | UniProt |
RCV000434676 | p.Ser37Pro | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224621T>C | ClinVar |
RCV000443827 | p.Ser37Pro | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224621T>C | ClinVar |
rs121913403 | p.Ser37Tyr | missense variant | - | NC_000003.12:g.41224622C>A | UniProt,dbSNP |
VAR_017627 | p.Ser37Tyr | missense variant | - | NC_000003.12:g.41224622C>A | UniProt |
RCV000440535 | p.Ser37Pro | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224621T>C | ClinVar |
RCV000419658 | p.Ser37Ala | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224621T>G | ClinVar |
RCV000423953 | p.Ser37Pro | missense variant | Neoplasm of stomach | NC_000003.12:g.41224621T>C | ClinVar |
RCV000430984 | p.Ser37Ala | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224621T>G | ClinVar |
RCV000419361 | p.Ser37Tyr | missense variant | Cutaneous melanoma | NC_000003.12:g.41224622C>A | ClinVar |
RCV000430355 | p.Ser37Ala | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224621T>G | ClinVar |
RCV000444520 | p.Ser37Phe | missense variant | Adenocarcinoma of stomach | NC_000003.12:g.41224622C>T | ClinVar |
RCV000420061 | p.Ser37Phe | missense variant | Ovarian Neoplasms | NC_000003.12:g.41224622C>T | ClinVar |
RCV000019141 | p.Ser37Cys | missense variant | Neoplasm of ovary | NC_000003.12:g.41224622C>G | ClinVar |
RCV000433883 | p.Ser37Phe | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224622C>T | ClinVar |
RCV000436705 | p.Ser37Ala | missense variant | Carcinoma of esophagus | NC_000003.12:g.41224621T>G | ClinVar |
RCV000440333 | p.Ser37Pro | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224621T>C | ClinVar |
RCV000419464 | p.Ser37Ala | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224621T>G | ClinVar |
RCV000426018 | p.Ser37Ala | missense variant | - | NC_000003.12:g.41224621T>G | ClinVar |
RCV000426489 | p.Ser37Phe | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224622C>T | ClinVar |
RCV000435198 | p.Ser37Ala | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224621T>G | ClinVar |
RCV000437726 | p.Ser37Phe | missense variant | - | NC_000003.12:g.41224622C>T | ClinVar |
RCV000435831 | p.Ser37Ala | missense variant | Neoplasm of the parathyroid gland | NC_000003.12:g.41224621T>G | ClinVar |
RCV000429643 | p.Ser37Pro | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224621T>C | ClinVar |
RCV000424491 | p.Ser37Ala | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224621T>G | ClinVar |
RCV000445320 | p.Ser37Phe | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224622C>T | ClinVar |
RCV000425340 | p.Ser37Phe | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224622C>T | ClinVar |
RCV000030945 | p.Ser37Cys | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224622C>G | ClinVar |
RCV000444358 | p.Ser37Ala | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224621T>G | ClinVar |
RCV000436738 | p.Ser37Phe | missense variant | Carcinoma of esophagus | NC_000003.12:g.41224622C>T | ClinVar |
RCV000423766 | p.Ser37Pro | missense variant | - | NC_000003.12:g.41224621T>C | ClinVar |
RCV000428583 | p.Ser37Phe | missense variant | Medulloblastoma (MDB) | NC_000003.12:g.41224622C>T | ClinVar |
RCV000444541 | p.Ser37Pro | missense variant | Carcinoma of esophagus | NC_000003.12:g.41224621T>C | ClinVar |
RCV000431861 | p.Ser37Pro | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224621T>C | ClinVar |
RCV000423296 | p.Ser37Pro | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224621T>C | ClinVar |
RCV000427490 | p.Ser37Phe | missense variant | Uterine cervical neoplasms | NC_000003.12:g.41224622C>T | ClinVar |
rs121913403 | p.Ser37Phe | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224622C>T | UniProt,dbSNP |
VAR_017626 | p.Ser37Phe | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224622C>T | UniProt |
VAR_017628 | p.Ser37_Gly38delinsTrp | deletion_insertion | - | - | UniProt |
NCI-TCGA novel | p.Ala39GluPheSerTerUnk | frameshift | - | NC_000003.12:g.41224626_41224648TGCCACTACCACAGCTCCTTCTC>- | NCI-TCGA |
rs1057519836 | p.Thr40Ser | missense variant | - | NC_000003.12:g.41224630A>T | - |
rs1057519836 | p.Thr40Ala | missense variant | - | NC_000003.12:g.41224630A>G | - |
rs1057519837 | p.Thr40Ser | missense variant | - | NC_000003.12:g.41224631C>G | - |
rs1057519837 | p.Thr40Ile | missense variant | - | NC_000003.12:g.41224631C>T | - |
RCV000444185 | p.Thr40Ser | missense variant | Neoplasm | NC_000003.12:g.41224630A>T | ClinVar |
RCV000426279 | p.Thr40Ser | missense variant | Neoplasm | NC_000003.12:g.41224631C>G | ClinVar |
rs1057519836 | p.Thr40Pro | missense variant | - | NC_000003.12:g.41224630A>C | - |
RCV000425513 | p.Thr40Pro | missense variant | Neoplasm | NC_000003.12:g.41224630A>C | ClinVar |
RCV000433725 | p.Thr40Ala | missense variant | Neoplasm of stomach | NC_000003.12:g.41224630A>G | ClinVar |
RCV000436951 | p.Thr40Ile | missense variant | Cutaneous melanoma | NC_000003.12:g.41224631C>T | ClinVar |
rs121913413 | p.Thr41Ile | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224634C>T | UniProt,dbSNP |
VAR_017630 | p.Thr41Ile | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224634C>T | UniProt |
rs121913412 | p.Thr41Ala | missense variant | - | NC_000003.12:g.41224633A>G | UniProt,dbSNP |
VAR_017629 | p.Thr41Ala | missense variant | - | NC_000003.12:g.41224633A>G | UniProt |
RCV000437888 | p.Thr41Asn | missense variant | Pancreatic adenocarcinoma | NC_000003.12:g.41224634C>A | ClinVar |
RCV000428037 | p.Thr41Asn | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224634C>A | ClinVar |
RCV000438649 | p.Thr41Ala | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224633A>G | ClinVar |
RCV000440036 | p.Thr41Asn | missense variant | Neoplasm of the large intestine | NC_000003.12:g.41224634C>A | ClinVar |
RCV000430531 | p.Thr41Asn | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224634C>A | ClinVar |
RCV000421675 | p.Thr41Ala | missense variant | Pancreatic adenocarcinoma | NC_000003.12:g.41224633A>G | ClinVar |
RCV000019152 | p.Thr41Ile | missense variant | Pilomatrixoma (PTR) | NC_000003.12:g.41224634C>T | ClinVar |
RCV000420278 | p.Thr41Asn | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224634C>A | ClinVar |
RCV000417888 | p.Thr41Asn | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224634C>A | ClinVar |
RCV000419429 | p.Thr41Ala | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224633A>G | ClinVar |
RCV000435532 | p.Thr41Asn | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224634C>A | ClinVar |
RCV000421001 | p.Thr41Ala | missense variant | Adrenocortical carcinoma | NC_000003.12:g.41224633A>G | ClinVar |
RCV000440817 | p.Thr41Ala | missense variant | Neoplasm of the large intestine | NC_000003.12:g.41224633A>G | ClinVar |
RCV000430146 | p.Thr41Ala | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224633A>G | ClinVar |
RCV000431914 | p.Thr41Ala | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224633A>G | ClinVar |
RCV000422378 | p.Thr41Asn | missense variant | Adrenocortical carcinoma | NC_000003.12:g.41224634C>A | ClinVar |
RCV000432978 | p.Thr41Ala | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224633A>G | ClinVar |
rs769203968 | p.Thr42Ile | missense variant | - | NC_000003.12:g.41224637C>T | ExAC,gnomAD |
RCV000503885 | p.Thr42Ile | missense variant | - | NC_000003.12:g.41224637C>T | ClinVar |
NCI-TCGA novel | p.Thr42LysPheSerTerUnk | frameshift | - | NC_000003.12:g.41224637C>- | NCI-TCGA |
rs121913407 | p.Ser45Pro | missense variant | - | NC_000003.12:g.41224645T>C | UniProt,dbSNP |
VAR_017632 | p.Ser45Pro | missense variant | - | NC_000003.12:g.41224645T>C | UniProt |
rs121913409 | p.Ser45Phe | missense variant | - | NC_000003.12:g.41224646C>T | UniProt,dbSNP |
VAR_017631 | p.Ser45Phe | missense variant | - | NC_000003.12:g.41224646C>T | UniProt |
rs121913409 | p.Ser45Cys | missense variant | - | NC_000003.12:g.41224646C>G | - |
RCV000422624 | p.Ser45Cys | missense variant | Disease | NC_000003.12:g.41224646C>G | ClinVar |
RCV000422850 | p.Ser45Tyr | missense variant | Cutaneous melanoma | NC_000003.12:g.41224646C>A | ClinVar |
RCV000439152 | p.Ser45Cys | missense variant | Malignant melanoma of skin (CMM) | NC_000003.12:g.41224646C>G | ClinVar |
RCV000019153 | p.Ser45Phe | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224646C>T | ClinVar |
RCV000417615 | p.Ser45Cys | missense variant | Adrenocortical carcinoma | NC_000003.12:g.41224646C>G | ClinVar |
RCV000428521 | p.Ser45Cys | missense variant | Adenocarcinoma of prostate | NC_000003.12:g.41224646C>G | ClinVar |
RCV000019154 | p.Ser45Pro | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224645T>C | ClinVar |
RCV000420360 | p.Ser45Cys | missense variant | Hepatocellular carcinoma (HCC) | NC_000003.12:g.41224646C>G | ClinVar |
RCV000439811 | p.Ser45Cys | missense variant | - | NC_000003.12:g.41224646C>G | ClinVar |
RCV000420592 | p.Ser45Ala | missense variant | Disease | NC_000003.12:g.41224645T>G | ClinVar |
RCV000437569 | p.Ser45Cys | missense variant | Neoplasm of the large intestine | NC_000003.12:g.41224646C>G | ClinVar |
RCV000432444 | p.Ser45Cys | missense variant | Malignant neoplasm of body of uterus | NC_000003.12:g.41224646C>G | ClinVar |
RCV000428312 | p.Ser45Cys | missense variant | Lung adenocarcinoma | NC_000003.12:g.41224646C>G | ClinVar |
RCV000427795 | p.Ser45Ala | missense variant | Neoplasm of brain | NC_000003.12:g.41224645T>G | ClinVar |
VAR_055430 | p.Ser45del | inframe_deletion | - | - | UniProt |
NCI-TCGA novel | p.Lys49Thr | missense variant | - | NC_000003.12:g.41224658A>C | NCI-TCGA |
rs1171472831 | p.Asn51Ser | missense variant | - | NC_000003.12:g.41224664A>G | gnomAD |
rs1031199273 | p.Pro52Leu | missense variant | - | NC_000003.12:g.41224667C>T | TOPMed,gnomAD |
NCI-TCGA novel | p.Glu54Asp | missense variant | - | NC_000003.12:g.41224674A>T | NCI-TCGA |
COSM5990177 | p.Glu54Asp | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224674A>C | NCI-TCGA Cosmic |
COSM5697 | p.Glu55Lys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224675G>A | NCI-TCGA Cosmic |
rs1408694980 | p.Asp56Ala | missense variant | - | NC_000003.12:g.41224679A>C | TOPMed,gnomAD |
rs772550053 | p.Asp58Gly | missense variant | - | NC_000003.12:g.41224685A>G | ExAC,gnomAD |
COSM5700 | p.Ser60Phe | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224691C>T | NCI-TCGA Cosmic |
rs1330746638 | p.Tyr64Cys | missense variant | - | NC_000003.12:g.41224703A>G | TOPMed |
rs886041553 | p.Trp66Ter | stop gained | - | NC_000003.12:g.41224710G>A | - |
RCV000361215 | p.Trp66Ter | nonsense | - | NC_000003.12:g.41224710G>A | ClinVar |
rs1353105537 | p.Glu67Lys | missense variant | - | NC_000003.12:g.41224711G>A | gnomAD |
NCI-TCGA novel | p.Thr75Ile | missense variant | - | NC_000003.12:g.41224736C>T | NCI-TCGA |
rs1269197442 | p.Val79Ile | missense variant | - | NC_000003.12:g.41224747G>A | TOPMed |
NCI-TCGA novel | p.Ala80Thr | missense variant | - | NC_000003.12:g.41224750G>A | NCI-TCGA |
rs1283770769 | p.Ile82Met | missense variant | - | NC_000003.12:g.41224958T>G | TOPMed,gnomAD |
rs773781329 | p.Ile82Val | missense variant | - | NC_000003.12:g.41224956A>G | ExAC,TOPMed,gnomAD |
rs773781329 | p.Ile82Phe | missense variant | - | NC_000003.12:g.41224956A>T | ExAC,TOPMed,gnomAD |
rs748781625 | p.Ile82Thr | missense variant | - | NC_000003.12:g.41224957T>C | ExAC,TOPMed,gnomAD |
COSM4117540 | p.Gly84Arg | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224962G>A | NCI-TCGA Cosmic |
rs770494663 | p.Gln85Pro | missense variant | - | NC_000003.12:g.41224966A>C | ExAC,gnomAD |
rs1223771101 | p.Tyr86Cys | missense variant | - | NC_000003.12:g.41224969A>G | gnomAD |
rs1295048026 | p.Ala87Val | missense variant | - | NC_000003.12:g.41224972C>T | TOPMed |
rs773961563 | p.Met88Val | missense variant | - | NC_000003.12:g.41224974A>G | ExAC,TOPMed,gnomAD |
RCV000760810 | p.Arg90Ter | nonsense | - | NC_000003.12:g.41224980C>T | ClinVar |
rs1369821061 | p.Arg90Ter | stop gained | - | NC_000003.12:g.41224980C>T | TOPMed |
COSM1423031 | p.Arg90Gln | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41224981G>A | NCI-TCGA Cosmic |
RCV000234865 | p.Arg90Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41224980C>T | ClinVar |
NCI-TCGA novel | p.Val94Glu | missense variant | - | NC_000003.12:g.41224993T>A | NCI-TCGA |
RCV000624646 | p.Arg95Ter | nonsense | Inborn genetic diseases | NC_000003.12:g.41224995C>T | ClinVar |
rs1158895192 | p.Arg95Gln | missense variant | - | NC_000003.12:g.41224996G>A | gnomAD |
RCV000256097 | p.Arg95Ter | nonsense | - | NC_000003.12:g.41224995C>T | ClinVar |
RCV000415150 | p.Arg95Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41224995C>T | ClinVar |
RCV000763110 | p.Arg95Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41224995C>T | ClinVar |
rs775104326 | p.Arg95Ter | stop gained | - | NC_000003.12:g.41224995C>T | ExAC,gnomAD |
RCV000493681 | p.Ala96Ter | frameshift | - | NC_000003.12:g.41224997_41225006del | ClinVar |
rs760527240 | p.Met98Val | missense variant | - | NC_000003.12:g.41225004A>G | ExAC,TOPMed,gnomAD |
rs760527240 | p.Met98Leu | missense variant | - | NC_000003.12:g.41225004A>C | ExAC,TOPMed,gnomAD |
NCI-TCGA novel | p.Glu101Asp | missense variant | - | NC_000003.12:g.41225015G>T | NCI-TCGA |
NCI-TCGA novel | p.Leu103PhePheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41225020_41225021insTTATTTAAACTATTATACACTA | NCI-TCGA |
rs753874922 | p.Asp104Glu | missense variant | - | NC_000003.12:g.41225024T>A | ExAC,gnomAD |
rs763882677 | p.Asp104Asn | missense variant | - | NC_000003.12:g.41225022G>A | ExAC,gnomAD |
rs746139399 | p.Gly106Asp | missense variant | - | NC_000003.12:g.41225029G>A | TOPMed |
rs746139399 | p.Gly106Val | missense variant | - | NC_000003.12:g.41225029G>T | TOPMed |
rs1373151037 | p.Met107Arg | missense variant | - | NC_000003.12:g.41225032T>G | TOPMed |
RCV000519540 | p.Gln113Ter | nonsense | - | NC_000003.12:g.41225049C>T | ClinVar |
rs1553630279 | p.Gln113Ter | stop gained | - | NC_000003.12:g.41225049C>T | - |
RCV000678281 | p.Gln113Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41225049C>T | ClinVar |
rs1350450456 | p.Asp115Tyr | missense variant | - | NC_000003.12:g.41225055G>T | gnomAD |
rs770107882 | p.Ala116Val | missense variant | - | NC_000003.12:g.41225059C>T | TOPMed,gnomAD |
rs758551763 | p.Gln123His | missense variant | - | NC_000003.12:g.41225081G>C | ExAC,TOPMed,gnomAD |
rs758551763 | p.Gln123His | missense variant | - | NC_000003.12:g.41225081G>T | ExAC,TOPMed,gnomAD |
rs755204384 | p.Arg124His | missense variant | - | NC_000003.12:g.41225083G>A | ExAC,gnomAD |
rs751808983 | p.Arg124Cys | missense variant | - | NC_000003.12:g.41225082C>T | ExAC,TOPMed,gnomAD |
rs751808983 | p.Arg124Ser | missense variant | - | NC_000003.12:g.41225082C>A | ExAC,TOPMed,gnomAD |
rs752945251 | p.Glu127Asp | missense variant | - | NC_000003.12:g.41225093A>C | ExAC |
rs202217100 | p.Pro128Thr | missense variant | - | NC_000003.12:g.41225094C>A | ExAC |
rs202217100 | p.Pro128Ser | missense variant | - | NC_000003.12:g.41225094C>T | ExAC |
rs1483026554 | p.Met131Ile | missense variant | - | NC_000003.12:g.41225105G>A | TOPMed |
rs775491694 | p.Leu132Val | missense variant | - | NC_000003.12:g.41225106C>G | gnomAD |
COSM4920219 | p.Val136Ala | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225119T>C | NCI-TCGA Cosmic |
rs1468458366 | p.Asn138Asp | missense variant | - | NC_000003.12:g.41225124A>G | gnomAD |
NCI-TCGA novel | p.Ile140Asn | missense variant | - | NC_000003.12:g.41225131T>A | NCI-TCGA |
rs1553630304 | p.GlnAspAspAlaGluLeuAlaThrArgAlaIleProGluLeuThr143GlnAspAspAlaGluLeuAlaThrArgAlaIleProGluLeuThrLysMetMetGlnAsnLeuProHisValGlnSerLeuAsnTerUnk | stop gained | - | NC_000003.12:g.41225139_41225182dup | - |
rs1267755116 | p.Arg151Cys | missense variant | - | NC_000003.12:g.41225163C>T | TOPMed,gnomAD |
rs200968230 | p.Arg151His | missense variant | - | NC_000003.12:g.41225164G>A | ESP,ExAC,TOPMed,gnomAD |
NCI-TCGA novel | p.Arg151ValPheSerTerUnk | frameshift | - | NC_000003.12:g.41225163C>- | NCI-TCGA |
rs1231397985 | p.Ala152Thr | missense variant | - | NC_000003.12:g.41225166G>A | TOPMed |
NCI-TCGA novel | p.Ala152ProPheSerTerUnk | frameshift | - | NC_000003.12:g.41225165_41225169TGCAA>- | NCI-TCGA |
NCI-TCGA novel | p.Ala152Gly | missense variant | - | NC_000003.12:g.41225167C>G | NCI-TCGA |
rs1333019206 | p.Ala152Val | missense variant | - | NC_000003.12:g.41225167C>T | TOPMed |
rs1362923686 | p.Ile153Val | missense variant | - | NC_000003.12:g.41225169A>G | gnomAD |
rs1413932105 | p.Thr157Ile | missense variant | - | NC_000003.12:g.41225182C>T | gnomAD |
NCI-TCGA novel | p.Lys158Glu | missense variant | - | NC_000003.12:g.41225184A>G | NCI-TCGA |
RCV000500221 | p.Leu159MetMetGlnAsnLeuProHisValGlnSerLeuAsnTerLys | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41225139_41225182dup | ClinVar |
NCI-TCGA novel | p.Leu159Pro | missense variant | - | NC_000003.12:g.41225188T>C | NCI-TCGA |
NCI-TCGA novel | p.Asn161Ile | missense variant | - | NC_000003.12:g.41225194A>T | NCI-TCGA |
rs1349803723 | p.Glu163Asp | missense variant | - | NC_000003.12:g.41225201G>C | TOPMed |
COSM730872 | p.Gln165His | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225207G>T | NCI-TCGA Cosmic |
COSM4117546 | p.Val166Gly | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225335T>G | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Val166Met | missense variant | - | NC_000003.12:g.41225334G>A | NCI-TCGA |
rs1457418133 | p.Asn169Ser | missense variant | - | NC_000003.12:g.41225344A>G | gnomAD |
COSM1044590 | p.Lys170Met | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225347A>T | NCI-TCGA Cosmic |
rs764327430 | p.Val173Ile | missense variant | - | NC_000003.12:g.41225355G>A | ExAC,gnomAD |
rs754132704 | p.Met174Thr | missense variant | - | NC_000003.12:g.41225359T>C | ExAC,gnomAD |
rs757629128 | p.Lys180Arg | missense variant | - | NC_000003.12:g.41225377A>G | ExAC,gnomAD |
rs1403906625 | p.Lys181Met | missense variant | - | NC_000003.12:g.41225380A>T | TOPMed |
rs765722646 | p.Lys181Gln | missense variant | - | NC_000003.12:g.41225379A>C | ExAC,gnomAD |
RCV000484374 | p.Lys181Ter | frameshift | - | NC_000003.12:g.41225380del | ClinVar |
COSM4917299 | p.Arg185Gly | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225391A>G | NCI-TCGA Cosmic |
rs963558956 | p.Ala187Thr | missense variant | - | NC_000003.12:g.41225397G>A | TOPMed,gnomAD |
rs757818390 | p.Met189Thr | missense variant | - | NC_000003.12:g.41225404T>C | ExAC,gnomAD |
rs1172941347 | p.Arg190His | missense variant | - | NC_000003.12:g.41225407G>A | TOPMed,gnomAD |
rs147382769 | p.Val195Met | missense variant | - | NC_000003.12:g.41225421G>A | ESP,ExAC,TOPMed,gnomAD |
rs147382769 | p.Val195Leu | missense variant | - | NC_000003.12:g.41225421G>C | ESP,ExAC,TOPMed,gnomAD |
rs147382769 | p.Val195Leu | missense variant | - | NC_000003.12:g.41225421G>T | ESP,ExAC,TOPMed,gnomAD |
NCI-TCGA novel | p.Ala197Ser | missense variant | - | NC_000003.12:g.41225427G>T | NCI-TCGA |
rs982974494 | p.Ile198Val | missense variant | - | NC_000003.12:g.41225430A>G | TOPMed,gnomAD |
rs1361277045 | p.Val199Ile | missense variant | - | NC_000003.12:g.41225433G>A | gnomAD |
rs139085081 | p.Arg200Cys | missense variant | - | NC_000003.12:g.41225436C>T | ESP,TOPMed |
COSM5346998 | p.Arg200His | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225437G>A | NCI-TCGA Cosmic |
rs587778222 | p.Met202Thr | missense variant | - | NC_000003.12:g.41225443T>C | TOPMed,gnomAD |
RCV000120621 | p.Met202Thr | missense variant | - | NC_000003.12:g.41225443T>C | ClinVar |
NCI-TCGA novel | p.Gln203His | missense variant | - | NC_000003.12:g.41225447G>T | NCI-TCGA |
rs780996852 | p.Asn204Ser | missense variant | - | NC_000003.12:g.41225449A>G | ExAC,gnomAD |
NCI-TCGA novel | p.Asn204Ile | missense variant | - | NC_000003.12:g.41225449A>T | NCI-TCGA |
rs769777389 | p.Thr205Ile | missense variant | - | NC_000003.12:g.41225452C>T | ExAC,gnomAD |
rs1463690576 | p.Asn206Asp | missense variant | - | NC_000003.12:g.41225454A>G | TOPMed |
rs975378240 | p.Asp207Glu | missense variant | - | NC_000003.12:g.41225459T>A | gnomAD |
rs1407787738 | p.Thr210Ser | missense variant | - | NC_000003.12:g.41225466A>T | TOPMed,gnomAD |
rs1208316016 | p.Ala211Val | missense variant | - | NC_000003.12:g.41225470C>T | gnomAD |
rs770795614 | p.Arg212Cys | missense variant | - | NC_000003.12:g.41225472C>T | ExAC,gnomAD |
rs200890083 | p.Arg212His | missense variant | - | NC_000003.12:g.41225473G>A | 1000Genomes,ExAC,gnomAD |
COSM6097709 | p.Cys213Phe | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225476G>T | NCI-TCGA Cosmic |
rs1230436040 | p.Thr214Ala | missense variant | - | NC_000003.12:g.41225478A>G | TOPMed,gnomAD |
rs369771822 | p.Ala215Ser | missense variant | - | NC_000003.12:g.41225481G>T | ESP,ExAC,TOPMed,gnomAD |
rs369771822 | p.Ala215Thr | missense variant | - | NC_000003.12:g.41225481G>A | ESP,ExAC,TOPMed,gnomAD |
rs762164590 | p.Ala215Val | missense variant | - | NC_000003.12:g.41225482C>T | ExAC,TOPMed,gnomAD |
rs144087793 | p.Arg225His | missense variant | - | NC_000003.12:g.41225512G>A | ESP,ExAC,gnomAD |
rs144087793 | p.Arg225Leu | missense variant | - | NC_000003.12:g.41225512G>T | ESP,ExAC,gnomAD |
rs144087793 | p.Arg225Pro | missense variant | - | NC_000003.12:g.41225512G>C | ESP,ExAC,gnomAD |
COSM1202590 | p.Arg225Cys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225511C>T | NCI-TCGA Cosmic |
rs757499487 | p.Glu226Asp | missense variant | - | NC_000003.12:g.41225516G>C | ExAC,TOPMed,gnomAD |
rs1453237622 | p.Leu229Met | missense variant | - | NC_000003.12:g.41225523C>A | gnomAD |
rs1287180882 | p.Ala230Asp | missense variant | - | NC_000003.12:g.41225527C>A | gnomAD |
rs1393572968 | p.Phe232Ser | missense variant | - | NC_000003.12:g.41225533T>C | gnomAD |
RCV000119827 | p.Gly236Ter | frameshift | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41225543dup | ClinVar |
rs758889881 | p.Ile237Val | missense variant | - | NC_000003.12:g.41225547A>G | ExAC,gnomAD |
rs373574509 | p.Leu240Val | missense variant | - | NC_000003.12:g.41225556C>G | ESP,gnomAD |
rs936616269 | p.Met243Thr | missense variant | - | NC_000003.12:g.41225566T>C | TOPMed,gnomAD |
rs766827521 | p.Gly245Ser | missense variant | - | NC_000003.12:g.41225571G>A | ExAC,gnomAD |
rs1430995778 | p.Ser250Phe | missense variant | - | NC_000003.12:g.41225674C>T | TOPMed |
rs1349714845 | p.Val251Gly | missense variant | - | NC_000003.12:g.41225677T>G | TOPMed |
COSM3696077 | p.Ile256Met | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225693T>G | NCI-TCGA Cosmic |
COSM1423041 | p.Ile256Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225692T>C | NCI-TCGA Cosmic |
RCV000505560 | p.Thr257Ile | missense variant | Wilms Tumor | NC_000003.12:g.41225695C>T | ClinVar |
rs1553630452 | p.Thr257Ile | missense variant | - | NC_000003.12:g.41225695C>T | - |
rs1427148157 | p.Thr258Asn | missense variant | - | NC_000003.12:g.41225698C>A | TOPMed |
rs1472749661 | p.Leu259Phe | missense variant | - | NC_000003.12:g.41225700C>T | TOPMed,gnomAD |
RCV000598599 | p.Leu259Ter | frameshift | - | NC_000003.12:g.41225699_41225700TC[1] | ClinVar |
NCI-TCGA novel | p.Leu259His | missense variant | - | NC_000003.12:g.41225701T>A | NCI-TCGA |
RCV000481334 | p.Leu264Ter | frameshift | - | NC_000003.12:g.41225716del | ClinVar |
rs1553630472 | p.Gln266Ter | stop gained | - | NC_000003.12:g.41225721C>T | - |
RCV000624180 | p.Gln266Ter | nonsense | Inborn genetic diseases | NC_000003.12:g.41225721C>T | ClinVar |
rs1392093769 | p.Ala269Gly | missense variant | - | NC_000003.12:g.41225731C>G | TOPMed |
rs1390494769 | p.Met271Leu | missense variant | - | NC_000003.12:g.41225736A>C | gnomAD |
NCI-TCGA novel | p.Met271TrpPheSerTerUnk | frameshift | - | NC_000003.12:g.41225733A>- | NCI-TCGA |
rs1304354105 | p.Val273Ala | missense variant | - | NC_000003.12:g.41225743T>C | gnomAD |
rs1183899293 | p.Val273Met | missense variant | - | NC_000003.12:g.41225742G>A | gnomAD |
rs1323014360 | p.Arg274Cys | missense variant | - | NC_000003.12:g.41225745C>T | TOPMed,gnomAD |
rs1233296947 | p.Arg274His | missense variant | - | NC_000003.12:g.41225746G>A | gnomAD |
rs762074528 | p.Gly277Ser | missense variant | - | NC_000003.12:g.41225754G>A | ExAC,gnomAD |
rs1057520556 | p.Lys281Ter | stop gained | - | NC_000003.12:g.41225766A>T | - |
RCV000422243 | p.Lys281Ter | nonsense | - | NC_000003.12:g.41225766A>T | ClinVar |
rs770030043 | p.Met282Thr | missense variant | - | NC_000003.12:g.41225770T>C | ExAC,gnomAD |
rs35288908 | p.Asn287Ser | missense variant | - | NC_000003.12:g.41225785A>G | ESP,ExAC,TOPMed,gnomAD |
rs766853534 | p.Asn287His | missense variant | - | NC_000003.12:g.41225784A>C | ExAC,gnomAD |
RCV000120622 | p.Asn287Ser | missense variant | - | NC_000003.12:g.41225785A>G | ClinVar |
RCV000677414 | p.Thr289Ter | frameshift | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41225790_41225792delinsCC | ClinVar |
rs1292334493 | p.Asn290Asp | missense variant | - | NC_000003.12:g.41225793A>G | TOPMed |
COSM3593970 | p.Lys292Glu | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225799A>G | NCI-TCGA Cosmic |
COSM1423045 | p.Lys292Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225800A>C | NCI-TCGA Cosmic |
rs759085197 | p.Thr297Met | missense variant | - | NC_000003.12:g.41225815C>T | ExAC,TOPMed,gnomAD |
NCI-TCGA novel | p.Leu301HisPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41225827_41225831TTCAA>- | NCI-TCGA |
COSM1202592 | p.Gln302His | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225831A>C | NCI-TCGA Cosmic |
COSM188060 | p.Ile303Met | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41225834T>G | NCI-TCGA Cosmic |
rs376393123 | p.Gln309Glu | missense variant | - | NC_000003.12:g.41225850C>G | ESP,ExAC |
rs376393123 | p.Gln309Ter | stop gained | - | NC_000003.12:g.41225850C>T | ESP,ExAC |
RCV000032860 | p.Gln309Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41225850C>T | ClinVar |
NCI-TCGA novel | p.Glu310Lys | missense variant | - | NC_000003.12:g.41225853G>A | NCI-TCGA |
rs755788748 | p.Ser311Gly | missense variant | - | NC_000003.12:g.41225856A>G | ExAC,gnomAD |
rs1270698911 | p.Leu313Phe | missense variant | - | NC_000003.12:g.41227208C>T | gnomAD |
rs1214328620 | p.Ile315Val | missense variant | - | NC_000003.12:g.41227214A>G | TOPMed |
rs1361178030 | p.Ala317Pro | missense variant | - | NC_000003.12:g.41227220G>C | gnomAD |
rs752184222 | p.Ser318Asn | missense variant | - | NC_000003.12:g.41227224G>A | ExAC,gnomAD |
rs760272296 | p.Ser318Arg | missense variant | - | NC_000003.12:g.41227225T>A | ExAC,gnomAD |
rs1348918944 | p.Gly320Glu | missense variant | - | NC_000003.12:g.41227230G>A | gnomAD |
RCV000627453 | p.Pro321Ter | frameshift | - | NC_000003.12:g.41227230dup | ClinVar |
NCI-TCGA novel | p.Ala323Pro | missense variant | - | NC_000003.12:g.41227238G>C | NCI-TCGA |
rs1319210904 | p.Asn326His | missense variant | - | NC_000003.12:g.41227247A>C | TOPMed |
rs753499163 | p.Ile327Leu | missense variant | - | NC_000003.12:g.41227250A>T | ExAC,gnomAD |
COSM4117548 | p.Ile327Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227251T>C | NCI-TCGA Cosmic |
rs1242107231 | p.Met328Thr | missense variant | - | NC_000003.12:g.41227254T>C | gnomAD |
COSM6164735 | p.Met328Ile | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227255G>T | NCI-TCGA Cosmic |
rs778624338 | p.Tyr333Ter | stop gained | - | NC_000003.12:g.41227270C>A | ExAC,gnomAD |
RCV000522499 | p.Tyr333Ter | nonsense | - | NC_000003.12:g.41227270C>A | ClinVar |
RCV000624466 | p.Tyr333Ter | nonsense | Inborn genetic diseases | NC_000003.12:g.41227270C>A | ClinVar |
RCV000300794 | p.Tyr333Ter | nonsense | - | NC_000003.12:g.41227269dup | ClinVar |
rs886041281 | p.Tyr333Ter | stop gained | - | NC_000003.12:g.41227269dup | - |
COSM3738527 | p.Tyr333Phe | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227269A>T | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Tyr333Asp | insertion | - | NC_000003.12:g.41227268_41227269insACG | NCI-TCGA |
rs1245266458 | p.Glu334Lys | missense variant | - | NC_000003.12:g.41227271G>A | TOPMed |
COSM1423046 | p.Glu334Ala | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227272A>C | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Lys335AsnPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41227272A>- | NCI-TCGA |
COSM17797 | p.Lys335Ile | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227275A>T | NCI-TCGA Cosmic |
COSM1725761 | p.Lys335Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227275A>C | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Leu336Pro | missense variant | - | NC_000003.12:g.41227278T>C | NCI-TCGA |
rs1454068577 | p.Trp338Cys | missense variant | - | NC_000003.12:g.41227285G>T | gnomAD |
rs758291562 | p.Thr339Ile | missense variant | - | NC_000003.12:g.41227287C>T | ExAC,gnomAD |
COSM4117549 | p.Thr339Asn | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227287C>A | NCI-TCGA Cosmic |
COSM4879313 | p.Arg342Lys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227296G>A | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Leu347Ile | missense variant | - | NC_000003.12:g.41227310C>A | NCI-TCGA |
NCI-TCGA novel | p.Leu347ThrPheSerTerUnk | stop gained | - | NC_000003.12:g.41227309_41227310insACAAAATAATCTGCACACGAAACCCCTGTGA | NCI-TCGA |
RCV000338847 | p.Ser348Ter | frameshift | - | NC_000003.12:g.41227314_41227315del | ClinVar |
rs1379671563 | p.Ser351Phe | missense variant | - | NC_000003.12:g.41227323C>T | TOPMed |
NCI-TCGA novel | p.Ser352Asn | missense variant | - | NC_000003.12:g.41227326G>A | NCI-TCGA |
COSM1044596 | p.Lys354Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41227332A>C | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Lys354Gln | missense variant | - | NC_000003.12:g.41227331A>C | NCI-TCGA |
rs769825609 | p.Pro355Leu | missense variant | - | NC_000003.12:g.41227335C>T | ExAC,TOPMed,gnomAD |
rs575671885 | p.Ile357Val | missense variant | - | NC_000003.12:g.41227340A>G | 1000Genomes,ExAC,TOPMed,gnomAD |
rs891968045 | p.Ile357Thr | missense variant | - | NC_000003.12:g.41227341T>C | TOPMed,gnomAD |
rs1423528790 | p.Glu359Lys | missense variant | - | NC_000003.12:g.41227346G>A | TOPMed |
rs1233211339 | p.Ala360Pro | missense variant | - | NC_000003.12:g.41227349G>C | gnomAD |
rs1443251066 | p.Gly361Val | missense variant | - | NC_000003.12:g.41233341G>T | TOPMed,gnomAD |
RCV000760566 | p.Gln364Ter | nonsense | - | NC_000003.12:g.41233349C>T | ClinVar |
rs758207378 | p.Leu366Ser | missense variant | - | NC_000003.12:g.41233356T>C | ExAC,gnomAD |
COSM6097708 | p.Gly367Val | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233359G>T | NCI-TCGA Cosmic |
COSM4911557 | p.Leu368His | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233362T>A | NCI-TCGA Cosmic |
NCI-TCGA novel | p.His369Tyr | missense variant | - | NC_000003.12:g.41233364C>T | NCI-TCGA |
rs751567042 | p.Pro373Ser | missense variant | - | NC_000003.12:g.41233376C>T | ExAC,gnomAD |
COSM327069 | p.Arg376His | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233386G>A | NCI-TCGA Cosmic |
rs1553631770 | p.Asn380Ile | missense variant | - | NC_000003.12:g.41233398A>T | - |
RCV000623772 | p.Asn380Ile | missense variant | Inborn genetic diseases | NC_000003.12:g.41233398A>T | ClinVar |
RCV000478521 | p.Leu382Pro | missense variant | - | NC_000003.12:g.41233404T>C | ClinVar |
rs1275515249 | p.Leu382Val | missense variant | - | NC_000003.12:g.41233403C>G | gnomAD |
rs1064796240 | p.Leu382Pro | missense variant | - | NC_000003.12:g.41233404T>C | - |
COSM1423048 | p.Trp383Arg | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233406T>C | NCI-TCGA Cosmic |
COSM251415 | p.Trp383Cys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233408G>T | NCI-TCGA Cosmic |
COSM290306 | p.Trp383Gly | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233406T>G | NCI-TCGA Cosmic |
COSM4919179 | p.Trp383Cys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233408G>C | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Arg386Gly | missense variant | - | NC_000003.12:g.41233415A>G | NCI-TCGA |
rs868651538 | p.Asn387Lys | missense variant | - | NC_000003.12:g.41233420T>A | - |
COSM188063 | p.Asn387Lys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233420T>G | NCI-TCGA Cosmic |
COSM4916531 | p.Asn387Ile | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233419A>T | NCI-TCGA Cosmic |
COSM4919005 | p.Asn387Tyr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233418A>T | NCI-TCGA Cosmic |
RCV000623816 | p.Asn387Ter | frameshift | Inborn genetic diseases | NC_000003.12:g.41233417del | ClinVar |
RCV000679959 | p.Leu388Pro | missense variant | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41233422T>C | ClinVar |
VAR_072282 | p.Leu388Pro | Missense | Neurodevelopmental disorder with spastic diplegia and visual defects (NEDSDV) [MIM:615075] | - | UniProt |
COSM4399500 | p.Asp390Glu | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233429T>G | NCI-TCGA Cosmic |
NCI-TCGA novel | p.Ala391Ser | missense variant | - | NC_000003.12:g.41233430G>T | NCI-TCGA |
rs1418552051 | p.Lys394Glu | missense variant | - | NC_000003.12:g.41233439A>G | gnomAD |
rs751375496 | p.Glu396Asp | missense variant | - | NC_000003.12:g.41233531A>C | ExAC,gnomAD |
rs1405053019 | p.Met398Thr | missense variant | - | NC_000003.12:g.41233536T>C | TOPMed |
COSM3696078 | p.Glu399Ala | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233539A>C | NCI-TCGA Cosmic |
rs767491256 | p.Leu402Phe | missense variant | - | NC_000003.12:g.41233547C>T | ExAC,gnomAD |
rs753799399 | p.Thr404Ile | missense variant | - | NC_000003.12:g.41233554C>T | ExAC,gnomAD |
COSM2987960 | p.Leu405Phe | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233556C>T | NCI-TCGA Cosmic |
rs1008276020 | p.Leu409Met | missense variant | - | NC_000003.12:g.41233568C>A | TOPMed |
rs757415518 | p.Gly410Ser | missense variant | - | NC_000003.12:g.41233571G>A | ExAC,gnomAD |
rs779273262 | p.Asp412Val | missense variant | - | NC_000003.12:g.41233578A>T | ExAC,gnomAD |
NCI-TCGA novel | p.Asn415His | missense variant | - | NC_000003.12:g.41233586A>C | NCI-TCGA |
NCI-TCGA novel | p.Cys419SerPheSerTerUnk | frameshift | - | NC_000003.12:g.41233597_41233601CTGTG>- | NCI-TCGA |
rs1021045139 | p.Ala421Val | missense variant | - | NC_000003.12:g.41233605C>T | - |
RCV000782021 | p.Ala421Ter | frameshift | - | NC_000003.12:g.41233604del | ClinVar |
NCI-TCGA novel | p.Gly422Glu | missense variant | - | NC_000003.12:g.41233608G>A | NCI-TCGA |
RCV000199502 | p.Leu424Arg | missense variant | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41233614T>G | ClinVar |
rs863224864 | p.Leu424Arg | missense variant | - | NC_000003.12:g.41233614T>G | - |
RCV000032858 | p.Ser425Ter | frameshift | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41233611_41233614TTCT[1] | ClinVar |
NCI-TCGA novel | p.Ser425Cys | missense variant | - | NC_000003.12:g.41233617C>G | NCI-TCGA |
COSM480084 | p.Asn426Asp | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233619A>G | NCI-TCGA Cosmic |
COSM3593971 | p.Cys429Gly | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233628T>G | NCI-TCGA Cosmic |
RCV000678968 | p.Lys433Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41233640A>T | ClinVar |
rs768978318 | p.Met437Val | missense variant | - | NC_000003.12:g.41233652A>G | ExAC,gnomAD |
rs936090981 | p.Val438Gly | missense variant | - | NC_000003.12:g.41233656T>G | TOPMed,gnomAD |
rs936090981 | p.Val438Ala | missense variant | - | NC_000003.12:g.41233656T>C | TOPMed,gnomAD |
rs781731106 | p.Gln440Arg | missense variant | - | NC_000003.12:g.41233662A>G | ExAC,gnomAD |
rs1299004124 | p.Gly442Ser | missense variant | - | NC_000003.12:g.41233667G>A | gnomAD |
rs747602570 | p.Glu445Gln | missense variant | - | NC_000003.12:g.41233676G>C | ExAC,gnomAD |
rs769363745 | p.Leu447Phe | missense variant | - | NC_000003.12:g.41233682C>T | ExAC,TOPMed,gnomAD |
rs769363745 | p.Leu447Val | missense variant | - | NC_000003.12:g.41233682C>G | ExAC,TOPMed,gnomAD |
rs772823421 | p.Val448Leu | missense variant | - | NC_000003.12:g.41233685G>T | ExAC,gnomAD |
rs1198223590 | p.Arg449His | missense variant | - | NC_000003.12:g.41233689G>A | gnomAD |
NCI-TCGA novel | p.Arg449LeuPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41233689G>- | NCI-TCGA |
rs1447487057 | p.Val451Ile | missense variant | - | NC_000003.12:g.41233694G>A | TOPMed,gnomAD |
rs1447487057 | p.Val451Leu | missense variant | - | NC_000003.12:g.41233694G>C | TOPMed,gnomAD |
RCV000598755 | p.Leu452Ter | frameshift | - | NC_000003.12:g.41233697_41233698delinsG | ClinVar |
rs770598744 | p.Arg453Trp | missense variant | - | NC_000003.12:g.41233700C>T | ExAC,TOPMed,gnomAD |
COSM1044599 | p.Arg453Gln | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233701G>A | NCI-TCGA Cosmic |
rs1553631848 | p.Glu458Asp | missense variant | - | NC_000003.12:g.41233717A>C | - |
RCV000505598 | p.Glu458Asp | missense variant | Renal cell carcinoma, papillary, 1 (RCCP1) | NC_000003.12:g.41233717A>C | ClinVar |
NCI-TCGA novel | p.Glu458LysPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41233713G>- | NCI-TCGA |
COSM4117551 | p.Ile460Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233722T>C | NCI-TCGA Cosmic |
rs1297519016 | p.Pro463Thr | missense variant | - | NC_000003.12:g.41233730C>A | TOPMed |
NCI-TCGA novel | p.Ala464Val | missense variant | - | NC_000003.12:g.41233734C>T | NCI-TCGA |
rs1394698950 | p.Ile465Val | missense variant | - | NC_000003.12:g.41233736A>G | TOPMed,gnomAD |
rs1433004172 | p.Leu468Phe | missense variant | - | NC_000003.12:g.41233745C>T | gnomAD |
COSM1582585 | p.Arg469His | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41233749G>A | NCI-TCGA Cosmic |
rs1386360637 | p.Thr472Pro | missense variant | - | NC_000003.12:g.41233757A>C | gnomAD |
rs1553631860 | p.Arg474Ter | stop gained | - | NC_000003.12:g.41233763C>T | - |
RCV000677408 | p.Arg474Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41233763C>T | ClinVar |
NCI-TCGA novel | p.Arg474Gln | missense variant | - | NC_000003.12:g.41233764G>A | NCI-TCGA |
RCV000495846 | p.Glu479Ter | frameshift | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41233777_41233778insC | ClinVar |
RCV000416683 | p.Glu479Ter | frameshift | Exudative vitreoretinopathy 1 (EVR1) | NC_000003.12:g.41233777_41233778insC | ClinVar |
RCV000734961 | p.Gln482Ter | nonsense | - | NC_000003.12:g.41233787C>T | ClinVar |
rs1316791736 | p.Ala484Val | missense variant | - | NC_000003.12:g.41233794C>T | gnomAD |
rs750554859 | p.Arg486His | missense variant | - | NC_000003.12:g.41233800G>A | ExAC,gnomAD |
rs113411271 | p.Arg486Cys | missense variant | - | NC_000003.12:g.41233799C>T | ExAC,TOPMed,gnomAD |
rs113411271 | p.Arg486Ser | missense variant | - | NC_000003.12:g.41233799C>A | ExAC,TOPMed,gnomAD |
NCI-TCGA novel | p.His488ThrPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41233803T>- | NCI-TCGA |
rs780428505 | p.Tyr489Cys | missense variant | - | NC_000003.12:g.41233809A>G | ExAC,TOPMed,gnomAD |
rs1204504884 | p.Val494Ala | missense variant | - | NC_000003.12:g.41233824T>C | gnomAD |
rs1009476273 | p.His499Asn | missense variant | - | NC_000003.12:g.41233838C>A | TOPMed |
RCV000627529 | p.His499Ter | frameshift | - | NC_000003.12:g.41233837dup | ClinVar |
rs751814202 | p.Ser502Pro | missense variant | - | NC_000003.12:g.41233847T>C | ExAC,gnomAD |
NCI-TCGA novel | p.Thr510Pro | missense variant | - | NC_000003.12:g.41234142A>C | NCI-TCGA |
rs397514554 | p.Arg515Ter | stop gained | - | NC_000003.12:g.41234157C>T | - |
COSM256708 | p.Arg515Gln | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41234158G>A | NCI-TCGA Cosmic |
RCV000032859 | p.Arg515Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41234157C>T | ClinVar |
RCV000255163 | p.Arg515Ter | nonsense | - | NC_000003.12:g.41234157C>T | ClinVar |
COSM288377 | p.Leu517Phe | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41234163C>T | NCI-TCGA Cosmic |
rs1465536580 | p.Cys520Ser | missense variant | - | NC_000003.12:g.41234173G>C | TOPMed |
rs774271551 | p.Pro521Ala | missense variant | - | NC_000003.12:g.41234175C>G | gnomAD |
rs774271551 | p.Pro521Ser | missense variant | - | NC_000003.12:g.41234175C>T | gnomAD |
rs1305741896 | p.Pro521Leu | missense variant | - | NC_000003.12:g.41234176C>T | gnomAD |
rs764576683 | p.Ala522Ser | missense variant | - | NC_000003.12:g.41234178G>T | ExAC,TOPMed,gnomAD |
rs764576683 | p.Ala522Thr | missense variant | - | NC_000003.12:g.41234178G>A | ExAC,TOPMed,gnomAD |
rs754382114 | p.Asn523Ser | missense variant | - | NC_000003.12:g.41234182A>G | ExAC,gnomAD |
rs1376864427 | p.His524Arg | missense variant | - | NC_000003.12:g.41234185A>G | TOPMed,gnomAD |
rs1376864427 | p.His524Leu | missense variant | - | NC_000003.12:g.41234185A>T | TOPMed,gnomAD |
rs1057520730 | p.Leu527Ter | stop gained | - | NC_000003.12:g.41234194T>A | - |
RCV000442337 | p.Leu527Ter | nonsense | - | NC_000003.12:g.41234194T>A | ClinVar |
rs756737848 | p.Arg528Cys | missense variant | - | NC_000003.12:g.41234196C>T | ExAC,gnomAD |
RCV000735236 | p.Gln530Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41234202C>T | ClinVar |
NCI-TCGA novel | p.Ala532Val | missense variant | - | NC_000003.12:g.41234209C>T | NCI-TCGA |
rs587778220 | p.Ile533Val | missense variant | - | NC_000003.12:g.41234211A>G | - |
RCV000120619 | p.Ile533Val | missense variant | - | NC_000003.12:g.41234211A>G | ClinVar |
RCV000495849 | p.Arg535Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41234217C>T | ClinVar |
rs886039332 | p.Arg535Ter | stop gained | - | NC_000003.12:g.41234217C>T | - |
COSM1044600 | p.Arg535Gln | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41234218G>A | NCI-TCGA Cosmic |
RCV000255131 | p.Arg535Ter | nonsense | - | NC_000003.12:g.41234217C>T | ClinVar |
NCI-TCGA novel | p.Leu540ValPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41234231_41234232insGTATCAA | NCI-TCGA |
NCI-TCGA novel | p.Val541LysPheSerTerUnkUnk | frameshift | - | NC_000003.12:g.41234233_41234234insAAAAGTAGTTC | NCI-TCGA |
NCI-TCGA novel | p.Val541Ala | missense variant | - | NC_000003.12:g.41234236T>C | NCI-TCGA |
rs551257843 | p.Arg542His | missense variant | - | NC_000003.12:g.41234239G>A | 1000Genomes,ExAC,gnomAD |
COSM3593972 | p.Gln545Ter | stop gained | Variant assessed as Somatic; HIGH impact. | NC_000003.12:g.41234247C>T | NCI-TCGA Cosmic |
rs758002835 | p.Thr547Ser | missense variant | - | NC_000003.12:g.41234253A>T | ExAC,TOPMed,gnomAD |
rs1210247690 | p.Arg549Cys | missense variant | - | NC_000003.12:g.41234259C>T | gnomAD |
rs779588249 | p.Arg550His | missense variant | - | NC_000003.12:g.41234263G>A | ExAC,TOPMed,gnomAD |
rs1187571366 | p.Thr551Ala | missense variant | - | NC_000003.12:g.41234265A>G | gnomAD |
rs1328515384 | p.Met553Thr | missense variant | - | NC_000003.12:g.41234272T>C | TOPMed |
rs199593411 | p.Met553Val | missense variant | - | NC_000003.12:g.41234271A>G | ExAC,TOPMed,gnomAD |
rs748148797 | p.Gly554Cys | missense variant | - | NC_000003.12:g.41234274G>T | ExAC |
rs186068630 | p.Gly555Glu | missense variant | - | NC_000003.12:g.41234278G>A | 1000Genomes |
rs1266504473 | p.Thr556Ala | missense variant | - | NC_000003.12:g.41234280A>G | TOPMed |
RCV000495837 | p.Gln558Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41234286C>T | ClinVar |
rs1131692181 | p.Gln558Ter | stop gained | - | NC_000003.12:g.41234286C>T | - |
VAR_079199 | p.Gln558_Leu781del | inframe_deletion | Neurodevelopmental disorder with spastic diplegia and visual defects (NEDSDV) [MIM:615075] | - | UniProt |
rs745951696 | p.Gly563Glu | missense variant | - | NC_000003.12:g.41235728G>A | ExAC,gnomAD |
rs772081115 | p.Val564Ala | missense variant | - | NC_000003.12:g.41235731T>C | ExAC,gnomAD |
rs760837728 | p.Arg565His | missense variant | - | NC_000003.12:g.41235734G>A | ExAC,TOPMed,gnomAD |
rs775666001 | p.Arg565Cys | missense variant | - | NC_000003.12:g.41235733C>T | ExAC,TOPMed,gnomAD |
COSM1423050 | p.Glu568Lys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41235742G>A | NCI-TCGA Cosmic |
rs1436053000 | p.Ile569Arg | missense variant | - | NC_000003.12:g.41235746T>G | gnomAD |
rs1273240803 | p.Gly572Asp | missense variant | - | NC_000003.12:g.41235755G>A | gnomAD |
rs797044875 | p.Gly575Arg | missense variant | - | NC_000003.12:g.41235763G>A | - |
RCV000190686 | p.Gly575Arg | missense variant | Inborn genetic diseases | NC_000003.12:g.41235763G>A | ClinVar |
NCI-TCGA novel | p.His578Arg | missense variant | - | NC_000003.12:g.41235773A>G | NCI-TCGA |
rs762099762 | p.Ala581Val | missense variant | - | NC_000003.12:g.41235782C>T | ExAC,gnomAD |
rs1215990470 | p.Ala581Thr | missense variant | - | NC_000003.12:g.41235781G>A | gnomAD |
COSM271020 | p.Arg582Gln | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41235785G>A | NCI-TCGA Cosmic |
rs765762800 | p.His585Asp | missense variant | - | NC_000003.12:g.41235793C>G | ExAC,gnomAD |
rs1220395399 | p.His585Pro | missense variant | - | NC_000003.12:g.41235794A>C | gnomAD |
rs1064796453 | p.Arg587Ter | stop gained | - | NC_000003.12:g.41235799C>T | TOPMed |
rs762495207 | p.Arg587Pro | missense variant | - | NC_000003.12:g.41235800G>C | ExAC,gnomAD |
RCV000624883 | p.Arg587Ter | nonsense | Inborn genetic diseases | NC_000003.12:g.41235799C>T | ClinVar |
COSM1044603 | p.Arg587Gln | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41235800G>A | NCI-TCGA Cosmic |
RCV000486133 | p.Arg587Ter | nonsense | - | NC_000003.12:g.41235799C>T | ClinVar |
rs1177261399 | p.Ile588Leu | missense variant | - | NC_000003.12:g.41235802A>C | gnomAD |
rs766038845 | p.Asn594Ser | missense variant | - | NC_000003.12:g.41235821A>G | ExAC,gnomAD |
NCI-TCGA novel | p.Thr595Ile | missense variant | - | NC_000003.12:g.41235824C>T | NCI-TCGA |
rs751139724 | p.Ile596Val | missense variant | - | NC_000003.12:g.41235826A>G | ExAC,gnomAD |
NCI-TCGA novel | p.Pro597Ser | missense variant | - | NC_000003.12:g.41235829C>T | NCI-TCGA |
rs1404476844 | p.Phe599Leu | missense variant | - | NC_000003.12:g.41235837T>G | gnomAD |
rs1410068456 | p.Phe599Leu | missense variant | - | NC_000003.12:g.41235835T>C | gnomAD |
rs759171472 | p.Ser605Phe | missense variant | - | NC_000003.12:g.41236359C>T | ExAC,gnomAD |
rs1306221365 | p.Pro606Leu | missense variant | - | NC_000003.12:g.41236362C>T | TOPMed |
rs1212384026 | p.Ile607Phe | missense variant | - | NC_000003.12:g.41236364A>T | gnomAD |
rs752328115 | p.Asn609Asp | missense variant | - | NC_000003.12:g.41236370A>G | ExAC,gnomAD |
NCI-TCGA novel | p.Val613Leu | missense variant | - | NC_000003.12:g.41236382G>T | NCI-TCGA |
rs1168206875 | p.Val617Ile | missense variant | - | NC_000003.12:g.41236394G>A | gnomAD |
NCI-TCGA novel | p.Cys619Tyr | missense variant | - | NC_000003.12:g.41236401G>A | NCI-TCGA |
rs1436728556 | p.Leu621Phe | missense variant | - | NC_000003.12:g.41236406C>T | gnomAD |
NCI-TCGA novel | p.Ala622Pro | missense variant | - | NC_000003.12:g.41236409G>C | NCI-TCGA |
rs864309577 | p.Gln623Ter | stop gained | - | NC_000003.12:g.41236412C>T | - |
COSM1044605 | p.Gln623Glu | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41236412C>G | NCI-TCGA Cosmic |
RCV000203130 | p.Gln623Ter | nonsense | - | NC_000003.12:g.41236412C>T | ClinVar |
rs1174315329 | p.Lys625Arg | missense variant | - | NC_000003.12:g.41236419A>G | gnomAD |
rs1553632357 | p.Glu626Ter | stop gained | - | NC_000003.12:g.41236421G>T | - |
RCV000626747 | p.Glu626Ter | nonsense | Imperforate anus | NC_000003.12:g.41236421G>T | ClinVar |
rs778834508 | p.Ala630Ser | missense variant | - | NC_000003.12:g.41236433G>T | ExAC,TOPMed,gnomAD |
rs898106111 | p.Ile631Val | missense variant | - | NC_000003.12:g.41236436A>G | TOPMed,gnomAD |
rs1304150324 | p.Pro639Ser | missense variant | - | NC_000003.12:g.41236460C>T | TOPMed |
RCV000624274 | p.Glu642Ter | frameshift | Inborn genetic diseases | NC_000003.12:g.41236468_41236469AG[1] | ClinVar |
RCV000598918 | p.Glu642Ter | frameshift | - | NC_000003.12:g.41236468_41236469AG[1] | ClinVar |
rs755119590 | p.Ser646Cys | missense variant | - | NC_000003.12:g.41236482C>G | ExAC,gnomAD |
rs755119590 | p.Ser646Phe | missense variant | - | NC_000003.12:g.41236482C>T | ExAC,gnomAD |
rs1296486135 | p.Arg647Gly | missense variant | - | NC_000003.12:g.41236484A>G | gnomAD |
rs755534201 | p.Asn648Ser | missense variant | - | NC_000003.12:g.41236488A>G | TOPMed,gnomAD |
NCI-TCGA novel | p.Glu649Gln | missense variant | - | NC_000003.12:g.41236490G>C | NCI-TCGA |
rs1031583127 | p.Ala652Val | missense variant | - | NC_000003.12:g.41236588C>T | gnomAD |
NCI-TCGA novel | p.Thr653Lys | missense variant | - | NC_000003.12:g.41236591C>A | NCI-TCGA |
RCV000329795 | p.Tyr654Ter | nonsense | - | NC_000003.12:g.41236595T>G | ClinVar |
rs750402920 | p.Tyr654Ter | stop gained | - | NC_000003.12:g.41236595T>G | ExAC,TOPMed,gnomAD |
NCI-TCGA novel | p.Ala657Thr | missense variant | - | NC_000003.12:g.41236602G>A | NCI-TCGA |
rs755029715 | p.Val658Phe | missense variant | - | NC_000003.12:g.41236605G>T | ExAC |
rs748294403 | p.Arg661Ter | stop gained | - | NC_000003.12:g.41236614C>T | ExAC |
RCV000494679 | p.Arg661Ter | nonsense | - | NC_000003.12:g.41236614C>T | ClinVar |
RCV000851495 | p.Arg661Ter | nonsense | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41236614C>T | ClinVar |
rs778073244 | p.Met662Leu | missense variant | - | NC_000003.12:g.41236617A>T | ExAC |
rs749661798 | p.Met662Ile | missense variant | - | NC_000003.12:g.41236619G>T | ExAC |
rs771458640 | p.Ser663Cys | missense variant | - | NC_000003.12:g.41236621C>G | ExAC |
rs771458640 | p.Ser663Phe | missense variant | - | NC_000003.12:g.41236621C>T | ExAC |
rs771458640 | p.Ser663Tyr | missense variant | - | NC_000003.12:g.41236621C>A | ExAC |
rs760245475 | p.Glu664Ter | stop gained | - | NC_000003.12:g.41236623G>T | ExAC |
rs763639110 | p.Glu664Gly | missense variant | - | NC_000003.12:g.41236624A>G | ExAC |
COSM5608169 | p.Glu664Asp | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41236625G>T | NCI-TCGA Cosmic |
rs761565235 | p.Asp665His | missense variant | - | NC_000003.12:g.41236626G>C | ExAC,gnomAD |
rs761565235 | p.Asp665Asn | missense variant | - | NC_000003.12:g.41236626G>A | ExAC,gnomAD |
rs77750814 | p.Asp665Glu | missense variant | - | NC_000003.12:g.41236628C>A | ExAC,TOPMed,gnomAD |
rs761565235 | p.Asp665Tyr | missense variant | - | NC_000003.12:g.41236626G>T | ExAC,gnomAD |
rs756281365 | p.Pro667Ser | missense variant | - | NC_000003.12:g.41236632C>T | ExAC,TOPMed |
rs754160678 | p.Gln668Arg | missense variant | - | NC_000003.12:g.41236636A>G | ExAC,gnomAD |
rs1188330297 | p.Arg673Gln | missense variant | - | NC_000003.12:g.41236651G>A | TOPMed |
rs772401455 | p.Ser681Phe | missense variant | - | NC_000003.12:g.41236675C>T | ExAC,gnomAD |
COSM3775011 | p.Phe683Tyr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41236681T>A | NCI-TCGA Cosmic |
rs1308481359 | p.Pro687Ala | missense variant | - | NC_000003.12:g.41236692C>G | gnomAD |
NCI-TCGA novel | p.Pro687Ser | missense variant | - | NC_000003.12:g.41236692C>T | NCI-TCGA |
NCI-TCGA novel | p.Pro687Leu | missense variant | - | NC_000003.12:g.41236693C>T | NCI-TCGA |
rs1227734411 | p.Met688Ile | missense variant | - | NC_000003.12:g.41236697G>T | gnomAD |
rs4135384 | p.Met688Val | missense variant | - | NC_000003.12:g.41236695A>G | ExAC,TOPMed,gnomAD |
rs4135384 | p.Met688Val | missense variant | - | NC_000003.12:g.41236695A>G | UniProt,dbSNP |
VAR_018954 | p.Met688Val | missense variant | - | NC_000003.12:g.41236695A>G | UniProt |
COSM1044607 | p.Met688Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41236696T>C | NCI-TCGA Cosmic |
rs898060604 | p.Ala689Thr | missense variant | - | NC_000003.12:g.41236698G>A | TOPMed,gnomAD |
RCV000627341 | p.Trp690Ter | nonsense | - | NC_000003.12:g.41236702G>A | ClinVar |
rs1553632412 | p.Trp690Ter | stop gained | - | NC_000003.12:g.41236702G>A | - |
RCV000681631 | p.Glu692Asp | missense variant | Mental retardation, autosomal dominant 19 (NEDSDV) | NC_000003.12:g.41236709G>C | ClinVar |
rs769068251 | p.Ala694Val | missense variant | - | NC_000003.12:g.41238020C>T | ExAC,gnomAD |
rs769381974 | p.Leu698Phe | missense variant | - | NC_000003.12:g.41238031C>T | ExAC,gnomAD |
rs769381974 | p.Leu698Ile | missense variant | - | NC_000003.12:g.41238031C>A | ExAC,gnomAD |
NCI-TCGA novel | p.Asp699His | missense variant | - | NC_000003.12:g.41238034G>C | NCI-TCGA |
rs772910638 | p.Ile700Leu | missense variant | - | NC_000003.12:g.41238037A>C | ExAC,gnomAD |
rs1376703203 | p.Ala702Val | missense variant | - | NC_000003.12:g.41238044C>T | gnomAD |
rs1302131125 | p.Ala702Thr | missense variant | - | NC_000003.12:g.41238043G>A | gnomAD |
rs1437006903 | p.Gln703Pro | missense variant | - | NC_000003.12:g.41238047A>C | gnomAD |
rs762655300 | p.Glu705Lys | missense variant | - | NC_000003.12:g.41238052G>A | ExAC,gnomAD |
RCV000782002 | p.Glu705Ter | frameshift | - | NC_000003.12:g.41238051dup | ClinVar |
rs1482609443 | p.Pro706Leu | missense variant | - | NC_000003.12:g.41238056C>T | TOPMed,gnomAD |
rs770804258 | p.Leu707Phe | missense variant | - | NC_000003.12:g.41238058C>T | ExAC,gnomAD |
rs774035744 | p.Gly708Val | missense variant | - | NC_000003.12:g.41238062G>T | ExAC,gnomAD |
rs748653573 | p.Arg710Cys | missense variant | - | NC_000003.12:g.41238067C>T | TOPMed,gnomAD |
rs200308943 | p.Arg710His | missense variant | - | NC_000003.12:g.41238068G>A | 1000Genomes,ESP,ExAC,TOPMed,gnomAD |
RCV000416748 | p.Arg710Cys | missense variant | Exudative vitreoretinopathy 1 (EVR1) | NC_000003.12:g.41238067C>T | ClinVar |
RCV000495850 | p.Arg710Cys | missense variant | EXUDATIVE VITREORETINOPATHY 7 (EVR7) | NC_000003.12:g.41238067C>T | ClinVar |
rs748653573 | p.Arg710Ser | missense variant | - | NC_000003.12:g.41238067C>A | TOPMed,gnomAD |
COSM1044609 | p.Asp712Asn | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41238073G>A | NCI-TCGA Cosmic |
rs1260498461 | p.Pro714Ser | missense variant | - | NC_000003.12:g.41239136C>T | TOPMed |
rs1057519380 | p.ProSerTyrArgSerPhe714ProSerTyrArgSerPheTerLeuSerPhePheUnk | stop gained | - | NC_000003.12:g.41239138_41239153dup | - |
NCI-TCGA novel | p.Pro714Leu | missense variant | - | NC_000003.12:g.41239137C>T | NCI-TCGA |
COSM730866 | p.Pro714Arg | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41239137C>G | NCI-TCGA Cosmic |
rs755359135 | p.Ser715Thr | missense variant | - | NC_000003.12:g.41239140G>C | ExAC,gnomAD |
rs1248210231 | p.Tyr716Phe | missense variant | - | NC_000003.12:g.41239143A>T | TOPMed |
COSM3373175 | p.Tyr716Cys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41239143A>G | NCI-TCGA Cosmic |
rs768012106 | p.Arg717Cys | missense variant | - | NC_000003.12:g.41239145C>T | ExAC,gnomAD |
rs753246841 | p.Arg717His | missense variant | - | NC_000003.12:g.41239146G>A | ExAC,TOPMed,gnomAD |
rs756632297 | p.Ser718Cys | missense variant | - | NC_000003.12:g.41239149C>G | ExAC,gnomAD |
rs1230378066 | p.Phe719Leu | missense variant | - | NC_000003.12:g.41239153T>G | TOPMed,gnomAD |
rs777221523 | p.His720Pro | missense variant | - | NC_000003.12:g.41239155A>C | ExAC,gnomAD |
RCV000416893 | p.His720Ter | nonsense | Exudative vitreoretinopathy 1 (EVR1) | NC_000003.12:g.41239138_41239153dup | ClinVar |
RCV000495836 | p.His720Ter | nonsense | EXUDATIVE VITREORETINOPATHY 7 (EVR7) | NC_000003.12:g.41239138_41239153dup | ClinVar |
rs748749625 | p.Tyr724Cys | missense variant | - | NC_000003.12:g.41239167A>G | ExAC,gnomAD |
rs756875168 | p.Gly725Ser | missense variant | - | NC_000003.12:g.41239169G>A | ExAC,gnomAD |
rs745670329 | p.Ala728Gly | missense variant | - | NC_000003.12:g.41239179C>G | ExAC,gnomAD |
rs797045504 | p.Ala728Pro | missense variant | - | NC_000003.12:g.41239178G>C | - |
RCV000192556 | p.Ala728Pro | missense variant | - | NC_000003.12:g.41239178G>C | ClinVar |
rs1411144383 | p.Leu729Ser | missense variant | - | NC_000003.12:g.41239182T>C | gnomAD |
rs1471514536 | p.Gly730Ser | missense variant | - | NC_000003.12:g.41239184G>A | gnomAD |
rs1293529882 | p.Met731Val | missense variant | - | NC_000003.12:g.41239187A>G | TOPMed |
rs772033082 | p.Asp732Glu | missense variant | - | NC_000003.12:g.41239192C>A | ExAC,gnomAD |
rs1366225605 | p.Met734Ile | missense variant | - | NC_000003.12:g.41239198G>C | TOPMed |
rs1405010887 | p.Met735Val | missense variant | - | NC_000003.12:g.41239199A>G | gnomAD |
rs746895877 | p.His737Arg | missense variant | - | NC_000003.12:g.41239206A>G | ExAC,gnomAD |
COSM1485172 | p.Glu738Lys | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41239208G>A | NCI-TCGA Cosmic |
rs768746130 | p.Met739Ile | missense variant | - | NC_000003.12:g.41239213G>A | ExAC,TOPMed,gnomAD |
rs1438939521 | p.Gly740Asp | missense variant | - | NC_000003.12:g.41239215G>A | TOPMed |
rs773278783 | p.Gly740Arg | missense variant | - | NC_000003.12:g.41239214G>C | ExAC,gnomAD |
rs1308020513 | p.Gly741Ser | missense variant | - | NC_000003.12:g.41239217G>A | gnomAD |
rs759866899 | p.His743Tyr | missense variant | - | NC_000003.12:g.41239223C>T | ExAC,gnomAD |
rs1356035016 | p.Pro744Arg | missense variant | - | NC_000003.12:g.41239227C>G | gnomAD |
NCI-TCGA novel | p.Pro744Ser | missense variant | - | NC_000003.12:g.41239226C>T | NCI-TCGA |
COSM3373176 | p.Pro744Thr | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41239226C>A | NCI-TCGA Cosmic |
rs1458355986 | p.Asp747Val | missense variant | - | NC_000003.12:g.41239236A>T | TOPMed |
rs753089121 | p.Val750Ala | missense variant | - | NC_000003.12:g.41239245T>C | ExAC,gnomAD |
rs1343763001 | p.Asp751Asn | missense variant | - | NC_000003.12:g.41239247G>A | gnomAD |
rs373158451 | p.Gly752Ala | missense variant | - | NC_000003.12:g.41239251G>C | ESP,ExAC,TOPMed,gnomAD |
rs200991012 | p.Asp755Glu | missense variant | - | NC_000003.12:g.41239261T>A | 1000Genomes,ExAC,TOPMed,gnomAD |
rs1167738636 | p.Asp755Gly | missense variant | - | NC_000003.12:g.41239260A>G | TOPMed |
rs980453294 | p.Gln760Glu | missense variant | - | NC_000003.12:g.41239274C>G | TOPMed |
COSM4403057 | p.Leu762Pro | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41239281T>C | NCI-TCGA Cosmic |
rs1189472809 | p.Asp764Asn | missense variant | - | NC_000003.12:g.41239286G>A | gnomAD |
rs1237849101 | p.Leu766Pro | missense variant | - | NC_000003.12:g.41239293T>C | gnomAD |
rs1180402965 | p.Pro767Ser | missense variant | - | NC_000003.12:g.41239295C>T | gnomAD |
rs756782457 | p.Pro767Arg | missense variant | - | NC_000003.12:g.41239296C>G | ExAC,TOPMed,gnomAD |
rs377050808 | p.Pro768Leu | missense variant | - | NC_000003.12:g.41239299C>T | ESP |
rs1430541681 | p.Gly769Val | missense variant | - | NC_000003.12:g.41239302G>T | gnomAD |
rs778596324 | p.Asp770His | missense variant | - | NC_000003.12:g.41239304G>C | ExAC,gnomAD |
rs1480609787 | p.Ser771Thr | missense variant | - | NC_000003.12:g.41239308G>C | TOPMed |
rs1221104083 | p.Ser771Gly | missense variant | - | NC_000003.12:g.41239307A>G | gnomAD |
rs138501547 | p.Asn772Ser | missense variant | - | NC_000003.12:g.41239311A>G | 1000Genomes,ExAC,TOPMed,gnomAD |
rs569666187 | p.Asn772Asp | missense variant | - | NC_000003.12:g.41239310A>G | 1000Genomes,ExAC,gnomAD |
NCI-TCGA novel | p.Asn772Lys | missense variant | - | NC_000003.12:g.41239312T>A | NCI-TCGA |
rs779955747 | p.Gln773Glu | missense variant | - | NC_000003.12:g.41239313C>G | ExAC,gnomAD |
rs1340254110 | p.Gln773His | missense variant | - | NC_000003.12:g.41239315G>T | gnomAD |
rs1312540894 | p.Ala775Ser | missense variant | - | NC_000003.12:g.41239319G>T | gnomAD |
rs1302757202 | p.Ala775Val | missense variant | - | NC_000003.12:g.41239320C>T | TOPMed |
COSM6097707 | p.Phe777Ser | missense variant | Variant assessed as Somatic; MODERATE impact. | NC_000003.12:g.41239326T>C | NCI-TCGA Cosmic |
rs121913409 | p.Ser45Phe | missense variant | - | NC_000003.12:g.41224646C>T | - |
rs28931588 | p.Asp32Asn | missense variant | - | NC_000003.12:g.41224606G>A | - |
rs121913400 | p.Ser33Phe | missense variant | - | NC_000003.12:g.41224610C>T | - |
rs121913407 | p.Ser45Pro | missense variant | - | NC_000003.12:g.41224645T>C | - |
rs28931588 | p.Asp32His | missense variant | - | NC_000003.12:g.41224606G>C | - |
rs121913403 | p.Ser37Tyr | missense variant | - | NC_000003.12:g.41224622C>A | - |
rs121913403 | p.Ser37Cys | missense variant | - | NC_000003.12:g.41224622C>G | - |
rs121913396 | p.Asp32Ala | missense variant | - | NC_000003.12:g.41224607A>C | - |
rs121913403 | p.Ser37Phe | missense variant | - | NC_000003.12:g.41224622C>T | - |
rs121913407 | p.Ser45Ala | missense variant | - | NC_000003.12:g.41224645T>G | - |
rs121913413 | p.Thr41Asn | missense variant | - | NC_000003.12:g.41224634C>A | - |
rs121913396 | p.Asp32Gly | missense variant | - | NC_000003.12:g.41224607A>G | - |
rs121913412 | p.Thr41Ala | missense variant | - | NC_000003.12:g.41224633A>G | - |
rs121913396 | p.Asp32Val | missense variant | - | NC_000003.12:g.41224607A>T | - |
Disease ID | Disease Name | Disease Type | Source |
---|---|---|---|
C0000737 | Abdominal Pain | phenotype | HPO |
C0000768 | Congenital Abnormality | group | BEFREE |
C0000772 | Multiple congenital anomalies | group | CTD_human |
C0001418 | Adenocarcinoma | group | BEFREE;CTD_human;LHGDN |
C0001430 | Adenoma | group | BEFREE;CTD_human;LHGDN |
C0001624 | Adrenal Gland Neoplasms | group | BEFREE;CTD_human |
C0002395 | Alzheimer's Disease | disease | BEFREE;LHGDN;RGD |
C0002448 | Ameloblastoma | disease | BEFREE |
C0004352 | Autistic Disorder | group | MGD |
C0004998 | Benign neoplasm of skin | group | BEFREE |
C0005684 | Malignant neoplasm of urinary bladder | disease | BEFREE;MGD |
C0005695 | Bladder Neoplasm | group | BEFREE;MGD |
C0006118 | Brain Neoplasms | group | CGI;CLINVAR |
C0006142 | Malignant neoplasm of breast | disease | BEFREE;CTD_human |
C0006826 | Malignant Neoplasms | group | CGI |
C0007095 | Carcinoid Tumor | group | BEFREE;LHGDN |
C0007102 | Malignant tumor of colon | disease | BEFREE;CTD_human |
C0007103 | Malignant neoplasm of endometrium | disease | BEFREE;CGI |
C0007112 | Adenocarcinoma of prostate | disease | CLINVAR |
C0007113 | Rectal Carcinoma | disease | BEFREE |
C0007115 | Malignant neoplasm of thyroid | disease | BEFREE |
C0007124 | Noninfiltrating Intraductal Carcinoma | disease | BEFREE |
C0007131 | Non-Small Cell Lung Carcinoma | disease | BEFREE |
C0007134 | Renal Cell Carcinoma | disease | BEFREE;HPO |
C0007137 | Squamous cell carcinoma | disease | BEFREE;LHGDN |
C0007528 | Cecal Neoplasms | group | CTD_human |
C0007570 | Celiac Disease | disease | BEFREE |
C0007789 | Cerebral Palsy | disease | BEFREE |
C0007847 | Malignant tumor of cervix | disease | BEFREE |
C0007873 | Uterine Cervical Neoplasm | disease | BEFREE;CTD_human |
C0008370 | Cholestasis | disease | BEFREE |
C0009324 | Ulcerative Colitis | disease | BEFREE |
C0009375 | Colonic Neoplasms | group | BEFREE;CTD_human;LHGDN |
C0009376 | Colonic Polyps | phenotype | BEFREE |
C0009402 | Colorectal Carcinoma | disease | BEFREE;CTD_human |
C0009404 | Colorectal Neoplasms | group | BEFREE;CLINVAR;CTD_human;LHGDN |
C0009777 | Conn Adenoma | disease | BEFREE |
C0010276 | Craniopharyngioma | disease | BEFREE;CLINVAR;CTD_human;ORPHANET |
C0010606 | Adenoid Cystic Carcinoma | disease | BEFREE;LHGDN |
C0010823 | Cytomegalovirus Infections | group | BEFREE |
C0011847 | Diabetes | disease | BEFREE |
C0011849 | Diabetes Mellitus | group | BEFREE |
C0011881 | Diabetic Nephropathy | disease | BEFREE |
C0012236 | DiGeorge Syndrome | disease | BEFREE |
C0013377 | Dysgerminoma | disease | HPO |
C0014170 | Endometrial Neoplasms | group | CLINVAR;LHGDN |
C0014175 | Endometriosis | disease | BEFREE;LHGDN |
C0014518 | Toxic Epidermal Necrolysis | disease | CTD_human |
C0014859 | Esophageal Neoplasms | group | BEFREE;LHGDN |
C0015672 | Fatigue | phenotype | HPO |
C0016045 | fibroma | disease | LHGDN |
C0016048 | Fibromatosis | disease | BEFREE |
C0016978 | gallbladder neoplasm | disease | LHGDN |
C0017097 | Gardner Syndrome | disease | BEFREE |
C0017185 | Gastrointestinal Neoplasms | group | BEFREE |
C0017636 | Glioblastoma | disease | BEFREE |
C0017638 | Glioma | disease | BEFREE |
C0018206 | granulosa cell tumor | disease | BEFREE;MGD |
C0018681 | Headache | phenotype | HPO |
C0018922 | hemangiopericytoma | disease | BEFREE |
C0018923 | Hemangiosarcoma | disease | CTD_human |
C0018939 | Hematological Disease | group | BEFREE |
C0019158 | Hepatitis | disease | LHGDN |
C0019163 | Hepatitis B | disease | BEFREE;LHGDN |
C0019193 | Hepatitis, Toxic | disease | CTD_human |
C0019196 | Hepatitis C | disease | BEFREE |
C0019207 | Hepatoma, Morris | disease | CTD_human |
C0019208 | Hepatoma, Novikoff | disease | CTD_human |
C0019209 | Hepatomegaly | phenotype | HPO |
C0020502 | Hyperparathyroidism | disease | BEFREE |
C0020514 | Hyperprolactinemia | disease | HPO |
C0021368 | Inflammation | phenotype | LHGDN |
C0021670 | insulinoma | disease | BEFREE |
C0021841 | Intestinal Neoplasms | group | BEFREE;CTD_human |
C0021846 | Intestinal Polyps | phenotype | BEFREE |
C0022572 | keratoacanthoma | disease | LHGDN |
C0022665 | Kidney Neoplasm | disease | BEFREE |
C0023267 | Fibroid Tumor | group | BEFREE |
C0023418 | leukemia | disease | BEFREE;LHGDN |
C0023434 | Chronic Lymphocytic Leukemia | disease | BEFREE |
C0023449 | Acute lymphocytic leukemia | disease | BEFREE |
C0023461 | Leukemia, Mast-Cell | disease | LHGDN |
C0023467 | Leukemia, Myelocytic, Acute | disease | BEFREE |
C0023473 | Myeloid Leukemia, Chronic | disease | BEFREE |
C0023530 | Leukopenia | disease | BEFREE |
C0023882 | Little's Disease | disease | HPO |
C0023890 | Liver Cirrhosis | disease | BEFREE;CTD_human |
C0023895 | Liver diseases | group | BEFREE |
C0023903 | Liver neoplasms | group | BEFREE;CTD_human;LHGDN |
C0023904 | Liver Neoplasms, Experimental | group | CTD_human |
C0024121 | Lung Neoplasms | group | BEFREE;CTD_human;LHGDN |
C0024623 | Malignant neoplasm of stomach | disease | BEFREE |
C0024814 | Marinesco-Sjogren syndrome | disease | BEFREE |
C0025149 | Medulloblastoma | disease | BEFREE;CGI;CLINVAR;CTD_human;HPO;LHGDN;UNIPROT |
C0025202 | melanoma | disease | BEFREE;CGI;CLINVAR;LHGDN |
C0025286 | Meningioma | disease | BEFREE;LHGDN |
C0025362 | Mental Retardation | disease | BEFREE;HPO |
C0025500 | Mesothelioma | disease | BEFREE |
C0025517 | Metabolic Diseases | group | BEFREE |
C0025568 | Metaplasia | phenotype | LHGDN |
C0025958 | Microcephaly | disease | BEFREE |
C0026277 | Mixed Salivary Gland Tumor | disease | BEFREE |
C0026499 | Monosomy | group | BEFREE |
C0026640 | Mouth Neoplasms | group | LHGDN |
C0026764 | Multiple Myeloma | disease | BEFREE |
C0026846 | Muscular Atrophy | phenotype | CTD_human |
C0027022 | Myeloproliferative disease | group | BEFREE |
C0027498 | Nausea and vomiting | phenotype | HPO |
C0027626 | Neoplasm Invasiveness | phenotype | CTD_human |
C0027627 | Neoplasm Metastasis | phenotype | BEFREE;CTD_human;LHGDN |
C0027651 | Neoplasms | group | BEFREE;CLINVAR |
C0027708 | Nephroblastoma | disease | BEFREE;CTD_human;LHGDN |
C0027746 | Nerve Degeneration | phenotype | CTD_human |
C0027819 | Neuroblastoma | group | BEFREE |
C0027947 | Neutropenia | disease | BEFREE |
C0028754 | Obesity | disease | BEFREE;HPO |
C0028880 | Odontogenic Tumors | group | BEFREE |
C0029408 | Degenerative polyarthritis | disease | BEFREE |
C0029417 | Osteoblastoma | disease | BEFREE |
C0029440 | Osteoma | disease | BEFREE |
C0029445 | Bone necrosis | phenotype | LHGDN |
C0029463 | Osteosarcoma | disease | BEFREE |
C0029925 | Ovarian Carcinoma | disease | BEFREE;CGI |
C0030186 | Paget Disease Extramammary | disease | BEFREE |
C0030297 | Pancreatic Neoplasm | disease | BEFREE;CTD_human;LHGDN |
C0030353 | Papilledema | disease | HPO |
C0030521 | Parathyroid Neoplasms | group | BEFREE;CLINVAR;LHGDN |
C0031149 | Peritoneal Neoplasms | group | CTD_human |
C0031269 | Peutz-Jeghers Syndrome | disease | BEFREE |
C0032000 | Pituitary Adenoma | disease | BEFREE |
C0032463 | Polycythemia Vera | disease | LHGDN |
C0032580 | Adenomatous Polyposis Coli | disease | BEFREE;LHGDN |
C0032584 | polyps | phenotype | BEFREE;LHGDN |
C0032927 | Precancerous Conditions | group | BEFREE |
C0033036 | Atrial Premature Complexes | disease | BEFREE |
C0033578 | Prostatic Neoplasms | group | BEFREE;CTD_human;LHGDN;MGD |
C0035305 | Retinal Detachment | disease | BEFREE |
C0035335 | Retinoblastoma | disease | BEFREE |
C0036095 | Salivary Gland Neoplasms | group | CGI |
C0036220 | Kaposi Sarcoma | disease | LHGDN |
C0036341 | Schizophrenia | disease | BEFREE;PSYGENET |
C0036572 | Seizures | phenotype | BEFREE |
C0037286 | Skin Neoplasms | group | BEFREE |
C0037579 | Soft Tissue Neoplasms | group | BEFREE |
C0037822 | Speech Disorders | group | HPO |
C0038325 | Stevens-Johnson Syndrome | disease | CTD_human |
C0038356 | Stomach Neoplasms | group | CLINVAR;HPO;LHGDN |
C0038379 | Strabismus | disease | HPO |
C0039101 | synovial sarcoma | disease | BEFREE |
C0040028 | Thrombocythemia, Essential | disease | LHGDN |
C0040136 | Thyroid Neoplasm | disease | BEFREE;LHGDN |
C0040997 | Trigeminal Neuralgia | disease | BEFREE |
C0041107 | Trisomy | group | BEFREE |
C0042133 | Uterine Fibroids | group | BEFREE |
C0042769 | Virus Diseases | group | BEFREE |
C0042963 | Vomiting | phenotype | HPO |
C0079218 | Fibromatosis, Aggressive | disease | BEFREE;CGI;HPO;LHGDN;ORPHANET |
C0079772 | T-Cell Lymphoma | disease | BEFREE;LHGDN |
C0086404 | Experimental Hepatoma | disease | CTD_human |
C0151779 | Cutaneous Melanoma | disease | BEFREE;CGI;CLINVAR |
C0151798 | Hepatic necrosis | phenotype | HPO |
C0151811 | Subcutaneous nodule | phenotype | HPO |
C0152013 | Adenocarcinoma of lung (disorder) | disease | BEFREE;CGI;CLINVAR |
C0152018 | Esophageal carcinoma | disease | BEFREE;CLINVAR |
C0153381 | Malignant neoplasm of mouth | disease | BEFREE |
C0153437 | Malignant neoplasm of cecum | disease | CTD_human |
C0153574 | Malignant Uterine Corpus Neoplasm | disease | CLINVAR |
C0153633 | Malignant neoplasm of brain | disease | CGI |
C0153676 | Secondary malignant neoplasm of lung | disease | BEFREE |
C0155773 | Portal vein thrombosis | disease | HPO |
C0156369 | Uterine Polyp | disease | BEFREE |
C0158266 | Intervertebral Disc Degeneration | disease | BEFREE |
C0162309 | Adrenoleukodystrophy | disease | BEFREE |
C0175754 | Agenesis of corpus callosum | disease | BEFREE |
C0178874 | Tumor Progression | phenotype | BEFREE |
C0205641 | Adenocarcinoma, Basal Cell | disease | CTD_human |
C0205642 | Adenocarcinoma, Oxyphilic | disease | CTD_human |
C0205643 | Carcinoma, Cribriform | disease | CTD_human |
C0205644 | Carcinoma, Granular Cell | disease | CTD_human |
C0205645 | Adenocarcinoma, Tubular | disease | CTD_human |
C0205646 | Adenoma, Basal Cell | disease | CTD_human |
C0205647 | Follicular adenoma | disease | CTD_human |
C0205648 | Adenoma, Microcystic | disease | BEFREE;CTD_human |
C0205649 | Adenoma, Monomorphic | disease | CTD_human |
C0205650 | Papillary adenoma | disease | CTD_human |
C0205651 | Adenoma, Trabecular | disease | CTD_human |
C0205698 | Undifferentiated carcinoma | phenotype | BEFREE |
C0205833 | Medullomyoblastoma | disease | CTD_human |
C0206624 | Hepatoblastoma | disease | BEFREE;CGI;CLINVAR;CTD_human;LHGDN |
C0206629 | Pulmonary Blastoma | disease | BEFREE |
C0206646 | Fibromatosis, Abdominal | disease | BEFREE |
C0206663 | Neuroectodermal Tumor, Primitive | disease | BEFREE |
C0206667 | Adrenal Cortical Adenoma | disease | BEFREE;CGI |
C0206669 | Hepatocellular Adenoma | disease | BEFREE;CTD_human |
C0206681 | Adenocarcinoma, Clear Cell | disease | BEFREE |
C0206684 | Sebaceous Adenocarcinoma | disease | BEFREE |
C0206685 | Acinar Cell Carcinoma | disease | BEFREE |
C0206686 | Adrenocortical carcinoma | disease | BEFREE;CLINVAR;CTD_human |
C0206687 | Carcinoma, Endometrioid | disease | BEFREE;LHGDN |
C0206694 | Mucoepidermoid Carcinoma | disease | LHGDN |
C0206711 | Pilomatrixoma | disease | BEFREE;CLINVAR;CTD_human;HPO;ORPHANET;UNIPROT |
C0206754 | Neuroendocrine Tumors | group | BEFREE |
C0220620 | Gastrointestinal Carcinoid Tumor | disease | BEFREE |
C0220641 | Lip and Oral Cavity Carcinoma | disease | BEFREE |
C0221002 | Hyperparathyroidism, Primary | disease | BEFREE |
C0221184 | Bitemporal Hemianopia | phenotype | HPO |
C0231528 | Myalgia | phenotype | HPO |
C0232347 | No-Reflow Phenomenon | phenotype | CTD_human |
C0232487 | Abdominal discomfort | phenotype | HPO |
C0232493 | Epigastric pain | phenotype | HPO |
C0235782 | Gallbladder Carcinoma | disease | BEFREE |
C0235874 | Disease Exacerbation | phenotype | CTD_human |
C0235971 | Elevated alpha-fetoprotein | phenotype | HPO |
C0235974 | Pancreatic carcinoma | disease | BEFREE |
C0238196 | Small intestine carcinoma | disease | BEFREE |
C0238461 | Anaplastic thyroid carcinoma | disease | BEFREE |
C0238463 | Papillary thyroid carcinoma | disease | BEFREE |
C0239946 | Fibrosis, Liver | disease | CTD_human;HPO |
C0242379 | Malignant neoplasm of lung | disease | BEFREE;CTD_human |
C0242383 | Age related macular degeneration | disease | BEFREE |
C0260037 | Multiple tumors | phenotype | BEFREE |
C0262587 | Parathyroid Adenoma | disease | BEFREE;CGI |
C0265325 | Turcot syndrome (disorder) | disease | BEFREE |
C0267812 | Micronodular cirrhosis | disease | HPO |
C0269102 | Endometrioma | disease | BEFREE |
C0270685 | Cerebral calcification | phenotype | HPO |
C0270948 | Neurogenic Muscular Atrophy | phenotype | CTD_human |
C0270952 | Muscular Dystrophy, Oculopharyngeal | disease | BEFREE |
C0271623 | Hypogonadotropic hypogonadism | disease | HPO |
C0278510 | Childhood Medulloblastoma | disease | CTD_human |
C0278701 | Gastric Adenocarcinoma | disease | CGI;CLINVAR |
C0278875 | Adult Craniopharyngioma | disease | CTD_human |
C0278876 | Adult Medulloblastoma | disease | CTD_human |
C0279000 | Liver and Intrahepatic Biliary Tract Carcinoma | disease | BEFREE |
C0279606 | Childhood Hepatocellular Carcinoma | disease | ORPHANET |
C0279607 | Adult Hepatocellular Carcinoma | disease | ORPHANET |
C0279626 | Squamous cell carcinoma of esophagus | disease | BEFREE;CGI;CLINVAR |
C0279672 | Cervical Adenocarcinoma | disease | BEFREE |
C0279680 | Transitional cell carcinoma of bladder | disease | CLINVAR;HPO |
C0280255 | stage, endometrial cancer | phenotype | BEFREE |
C0280631 | Leiomyosarcoma of uterus | disease | HPO |
C0281361 | Adenocarcinoma of pancreas | disease | BEFREE;CLINVAR |
C0282160 | Aplasia Cutis Congenita | disease | BEFREE |
C0302592 | Cervix carcinoma | disease | BEFREE |
C0333980 | Focal Nodular Hyperplasia | disease | LHGDN |
C0334092 | Hamartomatous polyp | disease | BEFREE |
C0334357 | Papillary cystic tumor | disease | BEFREE |
C0334401 | Malignant Granulosa Cell Tumor | disease | MGD |
C0334558 | Malignant odontogenic tumor | disease | BEFREE |
C0334634 | Malignant lymphoma, lymphocytic, intermediate differentiation, diffuse | disease | CTD_human;LHGDN |
C0334695 | Endometrial Stromal Tumors | disease | LHGDN |
C0339539 | Familial Exudative Vitreoretinopathy | disease | ORPHANET |
C0341439 | Chronic liver disease | group | BEFREE |
C0342422 | Pituitary gland enlarged | phenotype | HPO |
C0342649 | Vascular calcification | phenotype | CTD_human |
C0344482 | Hypoplasia of corpus callosum | disease | HPO |
C0345904 | Malignant neoplasm of liver | disease | BEFREE;CTD_human |
C0345967 | Malignant mesothelioma | disease | BEFREE;CTD_human |
C0346191 | Carcinoma in situ of endometrium | disease | CGI |
C0346402 | Malignant neoplasm of adrenal cortex | disease | BEFREE |
C0346627 | Intestinal Cancer | group | CTD_human |
C0346647 | Malignant neoplasm of pancreas | disease | BEFREE;CTD_human |
C0349579 | Atypical Endometrial Hyperplasia | disease | BEFREE |
C0349788 | Arrhythmogenic Right Ventricular Dysplasia | disease | BEFREE |
C0376358 | Malignant neoplasm of prostate | disease | BEFREE;CTD_human;MGD |
C0376634 | Craniofacial Abnormalities | group | CTD_human |
C0394005 | Ataxic cerebral palsy | disease | BEFREE |
C0423903 | Low intelligence | phenotype | HPO |
C0424605 | Developmental delay (disorder) | disease | BEFREE |
C0424688 | Small head | phenotype | HPO |
C0431128 | Papillary craniopharyngioma | disease | BEFREE;CTD_human |
C0431129 | Adamantinous Craniopharyngioma | disease | BEFREE;CTD_human |
C0431350 | Primary microcephaly | disease | GENOMICS_ENGLAND |
C0476089 | Endometrial Carcinoma | disease | BEFREE;CGI |
C0476489 | Alpha fetoprotein abnormal | phenotype | HPO |
C0494165 | Secondary malignant neoplasm of liver | disease | BEFREE |
C0496920 | Neoplasm of uncertain or unknown behavior of ovary | disease | CGI |
C0524851 | Neurodegenerative Disorders | group | LHGDN |
C0546837 | Malignant neoplasm of esophagus | disease | BEFREE |
C0549473 | Thyroid carcinoma | disease | BEFREE |
C0557874 | Global developmental delay | disease | BEFREE;HPO |
C0585442 | Osteosarcoma of bone | disease | BEFREE |
C0596263 | Carcinogenesis | phenotype | BEFREE |
C0598766 | Leukemogenesis | disease | BEFREE |
C0600139 | Prostate carcinoma | disease | BEFREE |
C0677886 | Epithelial ovarian cancer | disease | BEFREE;UNIPROT |
C0677898 | invasive cancer | phenotype | BEFREE |
C0678222 | Breast Carcinoma | disease | BEFREE;CTD_human;HPO |
C0684249 | Carcinoma of lung | disease | BEFREE |
C0686619 | Secondary malignant neoplasm of lymph node | disease | BEFREE |
C0687713 | Gastrointestinal pain | phenotype | HPO |
C0687720 | Central Diabetes Insipidus | disease | HPO |
C0694563 | Excessive daytime somnolence | phenotype | HPO |
C0699790 | Colon Carcinoma | disease | BEFREE;CLINVAR;UNIPROT |
C0699791 | Stomach Carcinoma | disease | BEFREE |
C0699885 | Carcinoma of bladder | disease | BEFREE |
C0699893 | Skin carcinoma | disease | BEFREE |
C0700095 | Central neuroblastoma | disease | BEFREE |
C0700636 | Focal nodular hyperplasia of liver | disease | BEFREE |
C0740457 | Malignant neoplasm of kidney | disease | BEFREE |
C0744333 | Gastrointestinal polyps | phenotype | HPO |
C0746926 | Multiple, subcutaneous nodules | disease | HPO |
C0750887 | Adrenal Cancer | disease | CTD_human |
C0750952 | Biliary Tract Cancer | disease | BEFREE |
C0751061 | Craniopharyngioma, Child | disease | CTD_human |
C0751291 | Desmoplastic Medulloblastoma | disease | CTD_human;UNIPROT |
C0751571 | Cancer of Urinary Tract | disease | BEFREE |
C0751958 | Lymphoma, Lymphocytic, Intermediate | disease | CTD_human |
C0854021 | Abnormal visual field test | phenotype | HPO |
C0860207 | Drug-Induced Liver Disease | disease | CTD_human |
C0879615 | Stromal Neoplasm | disease | BEFREE |
C0917816 | Mental deficiency | disease | HPO |
C0919267 | ovarian neoplasm | disease | BEFREE;CGI;CLINVAR;CTD_human;MGD |
C0920184 | Fundic gland polyp | disease | BEFREE |
C0936282 | Blastoma | disease | BEFREE |
C0940937 | precancerous lesions | phenotype | BEFREE |
C0948387 | Secondary Adrenal Insufficiency | disease | HPO |
C0950123 | Genetic Diseases, Inborn | group | CLINVAR |
C1140680 | Malignant neoplasm of ovary | disease | BEFREE;CGI;CTD_human;MGD;UNIPROT |
C1168401 | Squamous cell carcinoma of the head and neck | disease | CLINVAR |
C1257915 | Intestinal Polyposis | disease | HPO |
C1257931 | Mammary Neoplasms, Human | group | CTD_human |
C1261473 | Sarcoma | group | BEFREE |
C1262760 | Hepatitis, Drug-Induced | disease | CTD_human |
C1266119 | Solitary fibrous tumor | disease | LHGDN |
C1274933 | Drug-Induced Stevens Johnson Syndrome | disease | CTD_human |
C1275668 | Melanotic medulloblastoma | disease | CTD_human |
C1275859 | Transitional cell dysplasia | disease | BEFREE |
C1292753 | Primary Effusion Lymphoma | disease | BEFREE;LHGDN |
C1299247 | Primary malignant neoplasm of ovary and other uterine adnexa | disease | MGD |
C1300347 | Atypical polypoid adenomyoma | disease | BEFREE |
C1306460 | Primary malignant neoplasm of lung | disease | BEFREE |
C1319016 | Nephrogenic rest, intralobar | disease | BEFREE |
C1319017 | Nephrogenic rest, perilobar | phenotype | BEFREE |
C1319315 | Adenocarcinoma of large intestine | disease | CGI |
C1320468 | Nephrogenic rest | phenotype | BEFREE |
C1332556 | Biphasic Pulmonary Blastoma | disease | BEFREE |
C1333990 | Hereditary Nonpolyposis Colorectal Cancer | disease | BEFREE |
C1334274 | Invasive Carcinoma | phenotype | BEFREE |
C1334455 | Pulmonary Sclerosing Hemangioma | disease | BEFREE |
C1334699 | Mesenchymal Cell Neoplasm | disease | BEFREE |
C1334970 | Medulloblastoma with extensive nodularity | disease | UNIPROT |
C1368683 | Epithelioma | disease | BEFREE |
C1370419 | Ovarian Granulosa Cell Tumor | disease | BEFREE |
C1378703 | Renal carcinoma | disease | BEFREE |
C1458155 | Mammary Neoplasms | group | BEFREE;CTD_human;LHGDN |
C1512127 | HER2 gene amplification | phenotype | BEFREE |
C1512409 | Hepatocarcinogenesis | disease | BEFREE |
C1512981 | Mammary Tumorigenesis | phenotype | BEFREE |
C1527249 | Colorectal Cancer | disease | BEFREE;CTD_human;UNIPROT |
C1535926 | Neurodevelopmental Disorders | group | CTD_human |
C1535939 | Pneumocystis jiroveci pneumonia | disease | BEFREE |
C1569637 | Adenocarcinoma, Endometrioid | disease | BEFREE |
C1621958 | Glioblastoma Multiforme | disease | BEFREE |
C1623038 | Cirrhosis | disease | BEFREE |
C1708187 | Gardner Fibroma | disease | BEFREE |
C1708349 | Hereditary Diffuse Gastric Cancer | disease | BEFREE |
C1720508 | Retinal pigment epithelial abnormality | phenotype | HPO |
C1834582 | MYELOPROLIFERATIVE SYNDROME, TRANSIENT | disease | BEFREE |
C1837218 | Cleft palate, isolated | disease | BEFREE |
C1843367 | Poor school performance | phenotype | HPO |
C1848934 | SPONDYLOCARPOTARSAL SYNOSTOSIS SYNDROME | disease | BEFREE |
C1851402 | Exudative vitreoretinopathy 1 | disease | CLINVAR;ORPHANET |
C1851841 | ECTRODACTYLY, ECTODERMAL DYSPLASIA, AND CLEFT LIP/PALATE SYNDROME 1 | disease | BEFREE |
C1853141 | Slow decrease in visual acuity | phenotype | HPO |
C1858120 | Generalized hypotonia | phenotype | HPO |
C1861901 | Subacute progressive viral hepatitis | phenotype | HPO |
C1862475 | Abnormality of retinal pigmentation | phenotype | HPO |
C1862761 | Increased hepatocellular carcinoma risk | phenotype | HPO |
C1864897 | Cognitive delay | phenotype | HPO |
C1865014 | Long philtrum | phenotype | HPO |
C1865017 | Thin upper lip vermilion | phenotype | HPO |
C1867955 | Increased incidence of hepatocellular carcinoma | phenotype | HPO |
C1879526 | Aberrant Crypt Foci | phenotype | CTD_human |
C1883486 | Uterine Corpus Cancer | disease | BEFREE |
C2239176 | Liver carcinoma | disease | BEFREE;CGI;CLINVAR;CTD_human;HPO;LHGDN;UNIPROT |
C2239246 | Endometrial stromal sarcoma, high grade | disease | BEFREE |
C2919796 | Glycogen storage disease type Ia | disease | BEFREE |
C2919828 | Chronic ulcerative colitis | disease | BEFREE |
C2930471 | Bilateral Wilms Tumor | disease | CTD_human |
C2945695 | Limb ischemia | disease | BEFREE |
C3164851 | Palisaded myofibroblastoma | disease | BEFREE |
C3278981 | Decreased visual acuity, slowly progressive | phenotype | HPO |
C3489396 | Hypogonadism, Isolated Hypogonadotropic | disease | HPO |
C3495801 | Granulomatosis with polyangiitis | disease | BEFREE |
C3554449 | MENTAL RETARDATION, AUTOSOMAL DOMINANT 19 | disease | CLINVAR;CTD_human;ORPHANET;UNIPROT |
C3658290 | Drug-Induced Acute Liver Injury | disease | CTD_human |
C3658301 | Mycoplasma-Induced Stevens-Johnson Syndrome | disease | CTD_human |
C3658302 | Stevens-Johnson Syndrome Toxic Epidermal Necrolysis Spectrum | disease | CTD_human |
C3665349 | Secondary hypothyroidism | disease | HPO |
C3714514 | Infection | group | LHGDN |
C3714745 | Malabsorption | phenotype | HPO |
C3714756 | Intellectual Disability | group | BEFREE;GENOMICS_ENGLAND;HPO |
C3838965 | Microcystic stromal tumor | disease | BEFREE |
C4020813 | Increased gastric cancer | phenotype | HPO |
C4020875 | Mental and motor retardation | phenotype | HPO |
C4020876 | Dull intelligence | phenotype | HPO |
C4021095 | Abnormal hypothalamus morphology | phenotype | HPO |
C4021250 | Intracranial cystic lesion | phenotype | HPO |
C4021664 | Abnormality of the abdominal wall | phenotype | HPO |
C4021745 | Abnormality of the musculature | phenotype | HPO |
C4021768 | Abnormality of metabolism/homeostasis | group | HPO |
C4023205 | Neoplasm of the anterior pituitary | disease | HPO |
C4024760 | Progressive visual field defects | phenotype | HPO |
C4024979 | Ovarian papillary adenocarcinoma | disease | HPO |
C4024989 | Hereditary nonpolyposis colorectal carcinoma | disease | HPO |
C4048328 | cervical cancer | disease | BEFREE;CTD_human |
C4054251 | Pancreaticobiliary Malunion | disease | BEFREE |
C4277682 | Chemical and Drug Induced Liver Injury | disease | CTD_human |
C4279912 | Chemically-Induced Liver Toxicity | disease | CTD_human |
C4318618 | Peritoneal Surface Malignancy | disease | CTD_human |
C4539767 | EXUDATIVE VITREORETINOPATHY 7 | disease | CLINVAR;UNIPROT |
GO ID | GO Term | Evidence |
---|---|---|
GO:0001085 | RNA polymerase II transcription factor binding | IDA |
GO:0001085 | RNA polymerase II transcription factor binding | IPI |
GO:0001102 | RNA polymerase II activating transcription factor binding | IPI |
GO:0003682 | chromatin binding | ISS |
GO:0003700 | DNA-binding transcription factor activity | IEA |
GO:0003713 | transcription coactivator activity | IDA |
GO:0003713 | transcription coactivator activity | IMP |
GO:0003713 | transcription coactivator activity | IBA |
GO:0005515 | protein binding | IPI |
GO:0008013 | beta-catenin binding | IPI |
GO:0008022 | protein C-terminus binding | IPI |
GO:0008134 | transcription factor binding | IPI |
GO:0008134 | transcription factor binding | TAS |
GO:0019899 | enzyme binding | IPI |
GO:0019900 | kinase binding | IPI |
GO:0019901 | protein kinase binding | IEA |
GO:0019903 | protein phosphatase binding | IPI |
GO:0019903 | protein phosphatase binding | IBA |
GO:0030331 | estrogen receptor binding | IPI |
GO:0035257 | nuclear hormone receptor binding | IPI |
GO:0035257 | nuclear hormone receptor binding | TAS |
GO:0035257 | nuclear hormone receptor binding | IBA |
GO:0044325 | ion channel binding | IPI |
GO:0045294 | alpha-catenin binding | IBA |
GO:0045294 | alpha-catenin binding | IPI |
GO:0045296 | cadherin binding | IPI |
GO:0045296 | cadherin binding | IBA |
GO:0045296 | cadherin binding | HDA |
GO:0046332 | SMAD binding | IPI |
GO:0050681 | androgen receptor binding | NAS |
GO:0070411 | I-SMAD binding | IPI |
GO:0070491 | repressing transcription factor binding | IEA |
GO:0097718 | disordered domain specific binding | IEA |
GO ID | GO Term | Evidence |
---|---|---|
GO:0000122 | negative regulation of transcription by RNA polymerase II | IEA |
GO:0000209 | protein polyubiquitination | IDA |
GO:0000578 | embryonic axis specification | IEA |
GO:0000904 | cell morphogenesis involved in differentiation | IEA |
GO:0001569 | branching involved in blood vessel morphogenesis | IC |
GO:0001658 | branching involved in ureteric bud morphogenesis | IEA |
GO:0001701 | in utero embryonic development | IEA |
GO:0001702 | gastrulation with mouth forming second | IEA |
GO:0001708 | cell fate specification | IEA |
GO:0001711 | endodermal cell fate commitment | IEA |
GO:0001764 | neuron migration | IEA |
GO:0001837 | epithelial to mesenchymal transition | TAS |
GO:0001840 | neural plate development | IEA |
GO:0002052 | positive regulation of neuroblast proliferation | ISS |
GO:0002053 | positive regulation of mesenchymal cell proliferation | IEA |
GO:0002089 | lens morphogenesis in camera-type eye | IEA |
GO:0003266 | regulation of secondary heart field cardioblast proliferation | IEA |
GO:0003338 | metanephros morphogenesis | IEA |
GO:0003340 | negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis | IEA |
GO:0007155 | cell adhesion | IMP |
GO:0007160 | cell-matrix adhesion | IEA |
GO:0007223 | Wnt signaling pathway, calcium modulating pathway | TAS |
GO:0007268 | chemical synaptic transmission | IEA |
GO:0007398 | ectoderm development | IEA |
GO:0007403 | glial cell fate determination | IEA |
GO:0008285 | negative regulation of cell population proliferation | IDA |
GO:0009948 | anterior/posterior axis specification | IEA |
GO:0009950 | dorsal/ventral axis specification | IEA |
GO:0009954 | proximal/distal pattern formation | IEA |
GO:0010718 | positive regulation of epithelial to mesenchymal transition | IGI |
GO:0010909 | positive regulation of heparan sulfate proteoglycan biosynthetic process | IMP |
GO:0016032 | viral process | IEA |
GO:0016055 | Wnt signaling pathway | TAS |
GO:0016525 | negative regulation of angiogenesis | ISS |
GO:0019827 | stem cell population maintenance | TAS |
GO:0021819 | layer formation in cerebral cortex | IEA |
GO:0022009 | central nervous system vasculogenesis | IEA |
GO:0030316 | osteoclast differentiation | IEA |
GO:0030521 | androgen receptor signaling pathway | NAS |
GO:0030539 | male genitalia development | IEA |
GO:0030902 | hindbrain development | IEA |
GO:0030997 | regulation of centriole-centriole cohesion | IDA |
GO:0031016 | pancreas development | IEA |
GO:0031069 | hair follicle morphogenesis | IEA |
GO:0031641 | regulation of myelination | IEA |
GO:0032212 | positive regulation of telomere maintenance via telomerase | IEA |
GO:0032331 | negative regulation of chondrocyte differentiation | IEA |
GO:0032355 | response to estradiol | IDA |
GO:0032481 | positive regulation of type I interferon production | TAS |
GO:0033077 | T cell differentiation in thymus | IEA |
GO:0033234 | negative regulation of protein sumoylation | IDA |
GO:0034333 | adherens junction assembly | IMP |
GO:0034394 | protein localization to cell surface | IMP |
GO:0035050 | embryonic heart tube development | IEA |
GO:0035112 | genitalia morphogenesis | IEA |
GO:0035115 | embryonic forelimb morphogenesis | IEA |
GO:0035116 | embryonic hindlimb morphogenesis | IEA |
GO:0035315 | hair cell differentiation | TAS |
GO:0035635 | entry of bacterium into host cell | TAS |
GO:0036023 | embryonic skeletal limb joint morphogenesis | ISS |
GO:0036520 | astrocyte-dopaminergic neuron signaling | IEA |
GO:0042129 | regulation of T cell proliferation | IEA |
GO:0042475 | odontogenesis of dentin-containing tooth | IEA |
GO:0042493 | response to drug | IEP |
GO:0042733 | embryonic digit morphogenesis | IEA |
GO:0043065 | positive regulation of apoptotic process | IDA |
GO:0043066 | negative regulation of apoptotic process | IMP |
GO:0043123 | positive regulation of I-kappaB kinase/NF-kappaB signaling | IEA |
GO:0043161 | proteasome-mediated ubiquitin-dependent protein catabolic process | IDA |
GO:0043410 | positive regulation of MAPK cascade | IEA |
GO:0043525 | positive regulation of neuron apoptotic process | IDA |
GO:0044334 | canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition | IMP |
GO:0044336 | canonical Wnt signaling pathway involved in negative regulation of apoptotic process | TAS |
GO:0045453 | bone resorption | IEA |
GO:0045603 | positive regulation of endothelial cell differentiation | IEA |
GO:0045669 | positive regulation of osteoblast differentiation | IEA |
GO:0045671 | negative regulation of osteoclast differentiation | IEA |
GO:0045743 | positive regulation of fibroblast growth factor receptor signaling pathway | IEA |
GO:0045765 | regulation of angiogenesis | TAS |
GO:0045892 | negative regulation of transcription, DNA-templated | IMP |
GO:0045893 | positive regulation of transcription, DNA-templated | IMP |
GO:0045893 | positive regulation of transcription, DNA-templated | IDA |
GO:0045944 | positive regulation of transcription by RNA polymerase II | ISS |
GO:0045944 | positive regulation of transcription by RNA polymerase II | IDA |
GO:0045944 | positive regulation of transcription by RNA polymerase II | IMP |
GO:0045944 | positive regulation of transcription by RNA polymerase II | IBA |
GO:0045944 | positive regulation of transcription by RNA polymerase II | TAS |
GO:0045976 | negative regulation of mitotic cell cycle, embryonic | ISS |
GO:0048096 | chromatin-mediated maintenance of transcription | IEA |
GO:0048145 | regulation of fibroblast proliferation | TAS |
GO:0048469 | cell maturation | IEA |
GO:0048489 | synaptic vesicle transport | IEA |
GO:0048538 | thymus development | IEA |
GO:0048599 | oocyte development | IEA |
GO:0048617 | embryonic foregut morphogenesis | IEA |
GO:0048643 | positive regulation of skeletal muscle tissue development | IEA |
GO:0048660 | regulation of smooth muscle cell proliferation | IMP |
GO:0048715 | negative regulation of oligodendrocyte differentiation | IEA |
GO:0050767 | regulation of neurogenesis | TAS |
GO:0050808 | synapse organization | IEA |
GO:0051091 | positive regulation of DNA-binding transcription factor activity | IMP |
GO:0051145 | smooth muscle cell differentiation | IEA |
GO:0051149 | positive regulation of muscle cell differentiation | TAS |
GO:0051571 | positive regulation of histone H3-K4 methylation | IC |
GO:0051884 | regulation of timing of anagen | IEA |
GO:0051973 | positive regulation of telomerase activity | IEA |
GO:0060066 | oviduct development | IEA |
GO:0060070 | canonical Wnt signaling pathway | IDA |
GO:0060070 | canonical Wnt signaling pathway | IMP |
GO:0060440 | trachea formation | IEA |
GO:0060441 | epithelial tube branching involved in lung morphogenesis | IEA |
GO:0060479 | lung cell differentiation | IEA |
GO:0060484 | lung-associated mesenchyme development | IEA |
GO:0060492 | lung induction | IEA |
GO:0060742 | epithelial cell differentiation involved in prostate gland development | IEA |
GO:0060769 | positive regulation of epithelial cell proliferation involved in prostate gland development | IEA |
GO:0060789 | hair follicle placode formation | IEA |
GO:0060828 | regulation of canonical Wnt signaling pathway | TAS |
GO:0060916 | mesenchymal cell proliferation involved in lung development | IEA |
GO:0061154 | endothelial tube morphogenesis | IMP |
GO:0061198 | fungiform papilla formation | IEA |
GO:0061324 | canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation | ISS |
GO:0061549 | sympathetic ganglion development | ISS |
GO:0061550 | cranial ganglion development | IEA |
GO:0070602 | regulation of centromeric sister chromatid cohesion | IMP |
GO:0071363 | cellular response to growth factor stimulus | IMP |
GO:0071681 | cellular response to indole-3-methanol | IDA |
GO:0072033 | renal vesicle formation | IEA |
GO:0072053 | renal inner medulla development | IEA |
GO:0072054 | renal outer medulla development | IEA |
GO:0072079 | nephron tubule formation | IEA |
GO:0072182 | regulation of nephron tubule epithelial cell differentiation | ISS |
GO:0090279 | regulation of calcium ion import | IDA |
GO:0097091 | synaptic vesicle clustering | IEA |
GO:0098609 | cell-cell adhesion | IMP |
GO:1903204 | negative regulation of oxidative stress-induced neuron death | IEA |
GO:1904501 | positive regulation of chromatin-mediated maintenance of transcription | IEA |
GO:1904793 | regulation of euchromatin binding | IEA |
GO:1904798 | positive regulation of core promoter binding | IDA |
GO:1904837 | beta-catenin-TCF complex assembly | TAS |
GO:1904886 | beta-catenin destruction complex disassembly | TAS |
GO:1904888 | cranial skeletal system development | IEA |
GO:1904948 | midbrain dopaminergic neuron differentiation | ISS |
GO:1904954 | canonical Wnt signaling pathway involved in midbrain dopaminergic neuron differentiation | IC |
GO:1990138 | neuron projection extension | IMP |
GO:1990403 | embryonic brain development | IEA |
GO:1990791 | dorsal root ganglion development | IEA |
GO:2000008 | regulation of protein localization to cell surface | IDA |
GO:2000017 | positive regulation of determination of dorsal identity | IEA |
GO:2000144 | positive regulation of DNA-templated transcription, initiation | IC |
GO:2001234 | negative regulation of apoptotic signaling pathway | IEA |
GO ID | GO Term | Evidence |
---|---|---|
GO:0000922 | spindle pole | IEA |
GO:0005623 | cell | IEA |
GO:0005634 | nucleus | IDA |
GO:0005654 | nucleoplasm | TAS |
GO:0005667 | transcription factor complex | IDA |
GO:0005719 | nuclear euchromatin | IDA |
GO:0005737 | cytoplasm | IDA |
GO:0005813 | centrosome | IDA |
GO:0005829 | cytosol | IDA |
GO:0005829 | cytosol | TAS |
GO:0005886 | plasma membrane | IDA |
GO:0005911 | cell-cell junction | IDA |
GO:0005912 | adherens junction | IDA |
GO:0005912 | adherens junction | IBA |
GO:0005916 | fascia adherens | IEA |
GO:0005923 | bicellular tight junction | IEA |
GO:0005925 | focal adhesion | HDA |
GO:0005938 | cell cortex | IDA |
GO:0016020 | membrane | ISS |
GO:0016323 | basolateral plasma membrane | IDA |
GO:0016328 | lateral plasma membrane | IDA |
GO:0016342 | catenin complex | IDA |
GO:0016342 | catenin complex | IBA |
GO:0016600 | flotillin complex | IEA |
GO:0030018 | Z disc | IEA |
GO:0030027 | lamellipodium | IEA |
GO:0030054 | cell junction | TAS |
GO:0030054 | cell junction | IDA |
GO:0030877 | beta-catenin destruction complex | IDA |
GO:0031528 | microvillus membrane | IEA |
GO:0032991 | protein-containing complex | IDA |
GO:0032993 | protein-DNA complex | IDA |
GO:0034750 | Scrib-APC-beta-catenin complex | IEA |
GO:0042734 | presynaptic membrane | IEA |
GO:0045177 | apical part of cell | IEA |
GO:0045202 | synapse | ISS |
GO:0045211 | postsynaptic membrane | IEA |
GO:0048471 | perinuclear region of cytoplasm | IDA |
GO:0070062 | extracellular exosome | HDA |
GO:0070369 | beta-catenin-TCF7L2 complex | IDA |
GO:0071944 | cell periphery | IDA |
GO:0098685 | Schaffer collateral - CA1 synapse | IEA |
GO:0098831 | presynaptic active zone cytoplasmic component | IEA |
GO:0099092 | postsynaptic density, intracellular component | IEA |
GO:1990907 | beta-catenin-TCF complex | IPI |
GO:1990907 | beta-catenin-TCF complex | IDA |
GO:1990909 | Wnt signalosome | NAS |
Reactome ID | Reactome Term | Evidence |
---|---|---|
R-HSA-109581 | Apoptosis | TAS |
R-HSA-111465 | Apoptotic cleavage of cellular proteins | TAS |
R-HSA-1266738 | Developmental Biology | TAS |
R-HSA-1266738 | Developmental Biology | IEA |
R-HSA-1500931 | Cell-Cell communication | TAS |
R-HSA-162582 | Signal Transduction | TAS |
R-HSA-162582 | Signal Transduction | IEA |
R-HSA-1643685 | Disease | TAS |
R-HSA-168249 | Innate Immune System | TAS |
R-HSA-168256 | Immune System | TAS |
R-HSA-1834949 | Cytosolic sensors of pathogen-associated DNA | TAS |
R-HSA-194138 | Signaling by VEGF | TAS |
R-HSA-194315 | Signaling by Rho GTPases | TAS |
R-HSA-195253 | Degradation of beta-catenin by the destruction complex | TAS |
R-HSA-195258 | RHO GTPase Effectors | TAS |
R-HSA-195721 | Signaling by WNT | TAS |
R-HSA-195721 | Signaling by WNT | IEA |
R-HSA-196299 | Beta-catenin phosphorylation cascade | TAS |
R-HSA-201681 | TCF dependent signaling in response to WNT | TAS |
R-HSA-201681 | TCF dependent signaling in response to WNT | IEA |
R-HSA-201722 | Formation of the beta-catenin:TCF transactivating complex | TAS |
R-HSA-201722 | Formation of the beta-catenin:TCF transactivating complex | IEA |
R-HSA-212436 | Generic Transcription Pathway | TAS |
R-HSA-2980736 | Peptide hormone metabolism | TAS |
R-HSA-3134973 | LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production | TAS |
R-HSA-351906 | Apoptotic cleavage of cell adhesion proteins | TAS |
R-HSA-3769402 | Deactivation of the beta-catenin transactivating complex | TAS |
R-HSA-381771 | Synthesis, secretion, and inactivation of Glucagon-like Peptide-1 (GLP-1) | TAS |
R-HSA-3858494 | Beta-catenin independent WNT signaling | TAS |
R-HSA-392499 | Metabolism of proteins | TAS |
R-HSA-400508 | Incretin synthesis, secretion, and inactivation | TAS |
R-HSA-4086398 | Ca2+ pathway | TAS |
R-HSA-418990 | Adherens junctions interactions | TAS |
R-HSA-421270 | Cell-cell junction organization | TAS |
R-HSA-4411364 | Binding of TCF/LEF:CTNNB1 to target gene promoters | TAS |
R-HSA-4420097 | VEGFA-VEGFR2 Pathway | TAS |
R-HSA-446728 | Cell junction organization | TAS |
R-HSA-4641262 | Disassembly of the destruction complex and recruitment of AXIN to the membrane | TAS |
R-HSA-4641262 | Disassembly of the destruction complex and recruitment of AXIN to the membrane | IEA |
R-HSA-4791275 | Signaling by WNT in cancer | TAS |
R-HSA-4839743 | phosphorylation site mutants of CTNNB1 are not targeted to the proteasome by the destruction complex | TAS |
R-HSA-5218920 | VEGFR2 mediated vascular permeability | TAS |
R-HSA-525793 | Myogenesis | TAS |
R-HSA-525793 | Myogenesis | IEA |
R-HSA-5339716 | Misspliced GSK3beta mutants stabilize beta-catenin | TAS |
R-HSA-5357801 | Programmed Cell Death | TAS |
R-HSA-5358747 | S33 mutants of beta-catenin aren't phosphorylated | TAS |
R-HSA-5358749 | S37 mutants of beta-catenin aren't phosphorylated | TAS |
R-HSA-5358751 | S45 mutants of beta-catenin aren't phosphorylated | TAS |
R-HSA-5358752 | T41 mutants of beta-catenin aren't phosphorylated | TAS |
R-HSA-5626467 | RHO GTPases activate IQGAPs | TAS |
R-HSA-5663202 | Diseases of signal transduction | TAS |
R-HSA-5663205 | Infectious disease | TAS |
R-HSA-73857 | RNA Polymerase II Transcription | TAS |
R-HSA-74160 | Gene expression (Transcription) | TAS |
R-HSA-75153 | Apoptotic execution phase | TAS |
R-HSA-8853884 | Transcriptional Regulation by VENTX | TAS |
R-HSA-8876384 | Listeria monocytogenes entry into host cells | TAS |
R-HSA-8876493 | InlA-mediated entry of Listeria monocytogenes into host cells | TAS |
R-HSA-8878159 | Transcriptional regulation by RUNX3 | TAS |
R-HSA-8951430 | RUNX3 regulates WNT signaling | TAS |
R-HSA-9006934 | Signaling by Receptor Tyrosine Kinases | TAS |
ID | Drug Name | Action | PubMed |
---|---|---|---|
C517232 | 1,2-dibromo-4-(1,2-dibromoethyl)cyclohexane | 1,2-dibromo-4-(1,2-dibromoethyl)cyclohexane results in decreased expression of CTNNB1 mRNA | 23958786 |
D019813 | 1,2-Dimethylhydrazine | 1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein | 29031619; 29999212; |
D019813 | 1,2-Dimethylhydrazine | 1,2-Dimethylhydrazine results in increased mutagenesis of CTNNB1 gene | 12628520 |
D019813 | 1,2-Dimethylhydrazine | Artesunate inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein] | 29031619 |
D019813 | 1,2-Dimethylhydrazine | chlorophyllin affects the reaction [1,2-Dimethylhydrazine results in increased mutagenesis of CTNNB1 gene] | 12628520 |
D019813 | 1,2-Dimethylhydrazine | [chlorophyllin affects the reaction [1,2-Dimethylhydrazine results in increased mutagenesis of CTNNB1 gene]] inhibits the reaction [GSK3B protein results in increased phosphorylation of and results in increased ubiquitination of CTNNB1 protein] | 12628520; 12628520; |
D019813 | 1,2-Dimethylhydrazine | epigallocatechin gallate promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein]] | 29999212 |
D019813 | 1,2-Dimethylhydrazine | kaempferol promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein]] | 29999212 |
D019813 | 1,2-Dimethylhydrazine | Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein] | 29999212 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the reaction [CTNNB1 protein affects the expression of GSTM6 mRNA] | 23578392 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of CTNNB1 protein | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of CTNNB1 protein modified form | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of and affects the localization of CTNNB1 protein | 26171734 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of CTNNB1 protein | 21705713; 23684557; |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of CTNNB1 protein modified form | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of BRAF protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of CCNE2 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of CYP2E1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of DUSP1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of EGFR protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of ELK1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of ERBB2 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of GAB1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of GLUL protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of JAK1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MAP2K2 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MAP2K4 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MAP2K7 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MAPK1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MAPK3 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MET protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MKI67 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MTOR protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of MYC protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PAK2 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PDPK1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PPP1CA protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PRKACA protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PTEN protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PTGS2 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PTK2B protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of PTK2 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of RAF1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of RB protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of SOD1 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of STAT3 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form affects the susceptibility to [1,4-bis(2-(3,5-dichloropyridyloxy))benzene affects the expression of TRP53 protein] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form promotes the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of CCNA2 mRNA] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form promotes the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of FOXM1 mRNA] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 gene mutant form promotes the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of PCNA mRNA] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of MAPK1 protein modified form] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of CCNA2 mRNA] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of CYP1A2 mRNA] | 23578392 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of CYP2B10 mRNA] | 23578392 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of FOXM1 mRNA] | 21705713; 23578392; |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of GSTM2 mRNA] | 23578392 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of GSTM3 mRNA] | 23578392 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of PCNA mRNA] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | CTNNB1 protein affects the susceptibility to 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | GAB1 protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of CTNNB1 protein modified form] | 21705713 |
C028474 | 1,4-bis(2-(3,5-dichloropyridyloxy))benzene | GLUL protein affects the reaction [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of CTNNB1 protein modified form] | 21705713 |
C420084 | 1-(4-chlorobenzoyl)-5-methoxy-2-1H-indole-3-acetic acid 3-(nitrooxymethyl)phenyl ester | 1-(4-chlorobenzoyl)-5-methoxy-2-1H-indole-3-acetic acid 3-(nitrooxymethyl)phenyl ester inhibits the reaction [Indomethacin results in increased expression of CTNNB1 protein] | 16818512 |
C074153 | 1,4-phenylenebis(methylene)selenocyanate | 1,4-phenylenebis(methylene)selenocyanate results in decreased expression of CTNNB1 protein | 10753194 |
C072581 | 16-hydroxycleroda-3,13(14)-dien-15,16-olide | 16-hydroxycleroda-3,13(14)-dien-15,16-olide results in decreased expression of CTNNB1 protein | 23628706 |
C103958 | 1-hydroxyvitamin D5 | 1-hydroxyvitamin D5 results in decreased expression of CTNNB1 protein | 16051482 |
D015056 | 1-Methyl-3-isobutylxanthine | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of CTNNB1 mRNA | 28628672 |
D015056 | 1-Methyl-3-isobutylxanthine | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of CTNNB1 mRNA | 28628672 |
D015056 | 1-Methyl-3-isobutylxanthine | boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of CEBPA protein]] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of FABP4 protein]] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of PPARG protein]] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of CEBPA protein]] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of FABP4 protein]] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of PPARG protein]] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein] | 28285642 |
D015056 | 1-Methyl-3-isobutylxanthine | [1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS protein] inhibits the reaction [TGFB1 protein results in increased expression of CTNNB1 protein] | 29535048 |
C552888 | 2-(1,3-dimethyl-2,6-dioxo-1,2,3,6-tetrahydro-7H-purin-7-yl)-N-(4-isopropylphenyl)acetamide | 2-(1,3-dimethyl-2,6-dioxo-1,2,3,6-tetrahydro-7H-purin-7-yl)-N-(4-isopropylphenyl)acetamide inhibits the reaction [Toluene 2,4-Diisocyanate results in increased phosphorylation of and results in increased activity of and affects the localization of CTNNB1 protein] | 30517707 |
C511295 | 2,2',4,4'-tetrabromodiphenyl ether | 2,2',4,4'-tetrabromodiphenyl ether analog results in decreased expression of CTNNB1 mRNA | 25565004 |
C511295 | 2,2',4,4'-tetrabromodiphenyl ether | 2,2',4,4'-tetrabromodiphenyl ether analog results in increased expression of CTNNB1 mRNA | 25565004 |
C093973 | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased expression of CTNNB1 protein | 18710790 |
C093973 | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA]] | 11751460 |
C093973 | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in increased expression of CTNNB1 mRNA | 11751460 |
C019273 | 2,2-bis(4-glycidyloxyphenyl)propane | 2,2-bis(4-glycidyloxyphenyl)propane promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
C120227 | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide inhibits the reaction [hydroxyflutamide results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
C120227 | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide inhibits the reaction [Testosterone results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
C120227 | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide results in increased phosphorylation of CTNNB1 protein | 28163245 |
C094210 | 2,2'-(hydroxynitrosohydrazono)bis-ethanamine | 2,2'-(hydroxynitrosohydrazono)bis-ethanamine results in increased activity of CTNNB1 protein | 19238344 |
C094210 | 2,2'-(hydroxynitrosohydrazono)bis-ethanamine | 2,2'-(hydroxynitrosohydrazono)bis-ethanamine results in increased expression of CTNNB1 mRNA | 16580782 |
C094210 | 2,2'-(hydroxynitrosohydrazono)bis-ethanamine | CDH2 protein affects the reaction [2,2'-(hydroxynitrosohydrazono)bis-ethanamine results in increased expression of CTNNB1 mRNA] | 16580782 |
C094210 | 2,2'-(hydroxynitrosohydrazono)bis-ethanamine | CTNNB1 mutant form inhibits the reaction [2,2'-(hydroxynitrosohydrazono)bis-ethanamine results in increased expression of CCN4 mRNA] | 19238344 |
C038890 | 2,3,4,7,8-pentachlorodibenzofuran | 2,3,4,7,8-pentachlorodibenzofuran results in decreased expression of CTNNB1 mRNA | 21724226 |
C014211 | 2,3,7,8-tetrachlorodibenzofuran | 2,3,7,8-tetrachlorodibenzofuran results in decreased expression of CTNNB1 mRNA | 21724226 |
C061282 | 2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine | 2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine affects the localization of CTNNB1 protein modified form | 27595240 |
C061282 | 2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine | 2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine results in increased expression of and affects the phosphorylation of CTNNB1 protein | 27595240 |
C061282 | 2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine | CTNNB1 protein affects the reaction [2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine results in increased expression of COL3A1 protein] | 27595240 |
C014024 | 2,4,5,2',4',5'-hexachlorobiphenyl | 2,4,5,2',4',5'-hexachlorobiphenyl results in decreased phosphorylation of and results in decreased activity of CTNNB1 protein | 19464575 |
C014024 | 2,4,5,2',4',5'-hexachlorobiphenyl | 2,4,5,2',4',5'-hexachlorobiphenyl results in increased degradation of CTNNB1 protein | 19464575 |
C014024 | 2,4,5,2',4',5'-hexachlorobiphenyl | leupeptin inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl results in increased degradation of CTNNB1 protein] | 19464575 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Cadmium results in increased expression of and results in increased activity of CTNNB1 protein] | 22884995 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [DEFA1 protein results in decreased phosphorylation of and results in increased activity of CTNNB1 protein] | 19814765 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [DEFA2 protein results in decreased phosphorylation of and results in increased activity of CTNNB1 protein] | 19814765 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [sodium arsenite affects the localization of CTNNB1 protein] | 22859221 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [sodium arsenite results in decreased expression of CTNNB1 protein] | 23219847 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | [Tamoxifen co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] affects the localization of CTNNB1 protein | 22046442 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Resveratrol results in increased stability of CTNNB1 protein] | 20542495 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Toluene 2,4-Diisocyanate results in decreased expression of and affects the localization of CTNNB1 protein] | 26089345 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Toluene 2,4-Diisocyanate results in increased phosphorylation of CTNNB1 protein] | 26089345 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [sodium arsenite results in decreased expression of CTNNB1 protein] | 23143138 |
C085911 | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in decreased expression of CTNNB1 protein | 23143138 |
C519132 | 2-(5-benzo(1,3)dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6-methylpyridine hydrochloride | 2-(5-benzo(1,3)dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6-methylpyridine hydrochloride inhibits the reaction [palbociclib results in increased expression of CTNNB1 protein] | 22869556 |
C023514 | 2,6-dinitrotoluene | 2,6-dinitrotoluene results in increased expression of CTNNB1 mRNA | 20406850 |
C023514 | 2,6-dinitrotoluene | 2,6-dinitrotoluene affects the expression of CTNNB1 mRNA | 21346803 |
C488175 | 2-(acetyloxy)benzoic acid 6-(nitrooxymethyl)-2-phenylmethyl ester | 2-(acetyloxy)benzoic acid 6-(nitrooxymethyl)-2-phenylmethyl ester inhibits the reaction [TCF4 protein binds to CTNNB1 protein] | 14566053 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dextran Sulfate] results in increased expression of CTNNB1 protein | 15459021 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dextran Sulfate] results in increased mutagenesis of CTNNB1 gene | 15459021 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased expression of CTNNB1 protein | 21081470 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | CTNNB1 gene mutant form results in increased susceptibility to [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dextran Sulfate] | 27664423 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] affects the localization of CTNNB1 protein | 18616682 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased expression of CTNNB1 mRNA | 18283038; 18616682; |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased expression of CTNNB1 protein | 11756241; 18283038; 18616682; |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased mutagenesis of CTNNB1 gene | 11756241 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased expression of CTNNB1 mRNA | 23466459 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased expression of CTNNB1 protein | 14507667 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased mutagenesis of CTNNB1 gene | 10965019; 14507667; 9515794; |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | Plant Preparations inhibits the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased expression of CTNNB1 mRNA] | 23466459 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA]] | 11751460 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [[2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with [Dexamethasone co-treated with INS protein co-treated with PRL protein]] results in increased activity of STAT5A protein] which results in increased expression of CTNNB1 mRNA | 11751460 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [[2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with [Dexamethasone co-treated with INS protein co-treated with PRL protein]] results in increased expression of STAT5A protein modified form] which results in increased expression of CTNNB1 mRNA | 11751460 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA] | 11751460 |
C049584 | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine | [alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA]] | 11751460 |
C036989 | 2-amino-3,4-dimethylimidazo(4,5-f)quinoline | 2-amino-3,4-dimethylimidazo(4,5-f)quinoline affects the mutagenesis of CTNNB1 exon | 12893427 |
C029216 | 2-amino-3-methylimidazo(4,5-f)quinoline | 2-amino-3-methylimidazo(4,5-f)quinoline results in increased mutagenesis of CTNNB1 gene | 12628520; 9515794; |
C029216 | 2-amino-3-methylimidazo(4,5-f)quinoline | chlorophyllin affects the reaction [2-amino-3-methylimidazo(4,5-f)quinoline results in increased mutagenesis of CTNNB1 gene] | 12628520 |
C029216 | 2-amino-3-methylimidazo(4,5-f)quinoline | [chlorophyllin affects the reaction [2-amino-3-methylimidazo(4,5-f)quinoline results in increased mutagenesis of CTNNB1 gene]] inhibits the reaction [GSK3B protein results in increased phosphorylation of and results in increased ubiquitination of CTNNB1 protein] | 12628520; 12628520; |
C581356 | 2-amino-4-(3,4-(methylenedioxy)benzylamino)-6-(3-methoxyphenyl)pyrimidine | 2-amino-4-(3,4-(methylenedioxy)benzylamino)-6-(3-methoxyphenyl)pyrimidine results in increased expression of CTNNB1 mRNA | 20501703 |
C581356 | 2-amino-4-(3,4-(methylenedioxy)benzylamino)-6-(3-methoxyphenyl)pyrimidine | Dexamethasone inhibits the reaction [2-amino-4-(3,4-(methylenedioxy)benzylamino)-6-(3-methoxyphenyl)pyrimidine results in increased expression of CTNNB1 mRNA] | 20501703 |
C487689 | (2E,4E,6E,10E)-3,7,11,15-tetramethyl-2,4,6,10,14-hexadecapentaenoic acid | (2E,4E,6E,10E)-3,7,11,15-tetramethyl-2,4,6,10,14-hexadecapentaenoic acid results in decreased expression of CTNNB1 mRNA | 17261273 |
C014632 | 2-keto-4-methylthiobutyric acid | 2-keto-4-methylthiobutyric acid results in decreased expression of CTNNB1 protein | 28414304 |
D000077584 | 2-Methoxyestradiol | 2-Methoxyestradiol inhibits the reaction [CTNNB1 protein results in decreased susceptibility to Bortezomib] | 18485479 |
D000077584 | 2-Methoxyestradiol | 2-Methoxyestradiol results in decreased expression of CTNNB1 mRNA | 18485479 |
D000077584 | 2-Methoxyestradiol | 2-Methoxyestradiol results in decreased expression of CTNNB1 protein | 18485479 |
C511621 | 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide | 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide inhibits the reaction [Particulate Matter analog results in decreased expression of CTNNB1 protein] | 27216425 |
C029955 | 2-nitrotoluene | 2-nitrotoluene results in increased mutagenesis of CTNNB1 gene | 13678655 |
C041525 | 3,3',4,5'-tetrahydroxystilbene | 3,3',4,5'-tetrahydroxystilbene results in decreased expression of CTNNB1 protein | 22245592 |
C041525 | 3,3',4,5'-tetrahydroxystilbene | [3,3',4,5'-tetrahydroxystilbene results in increased activity of SIRT1 protein] which results in decreased expression of CTNNB1 protein | 22245592 |
C417520 | 3-(3-chloro-4-hydroxyphenylamino)-4-(4-nitrophenyl)-1H-pyrrole-2,5-dione | [3-(3-chloro-4-hydroxyphenylamino)-4-(4-nitrophenyl)-1H-pyrrole-2,5-dione results in decreased activity of GSK3B protein] which results in increased expression of CTNNB1 protein | 19159680 |
C497286 | 3,4',5-trimethoxystilbene | 3,4',5-trimethoxystilbene promotes the reaction [Tamoxifen results in decreased expression of CTNNB1 protein] | 23921149 |
C497286 | 3,4',5-trimethoxystilbene | 3,4',5-trimethoxystilbene results in decreased expression of and affects the localization of CTNNB1 protein | 23921149 |
C497286 | 3,4',5-trimethoxystilbene | 3,4',5-trimethoxystilbene results in increased phosphorylation of CTNNB1 protein | 23921149 |
C497286 | 3,4',5-trimethoxystilbene | Tamoxifen promotes the reaction [3,4',5-trimethoxystilbene results in decreased expression of CTNNB1 protein] | 23921149 |
C530773 | 3,5-diethoxycarbonyl-1,4-dihydrocollidine | 3,5-diethoxycarbonyl-1,4-dihydrocollidine results in decreased expression of CTNNB1 protein | 23620592 |
C530773 | 3,5-diethoxycarbonyl-1,4-dihydrocollidine | CTNNB1 mutant form inhibits the reaction [3,5-diethoxycarbonyl-1,4-dihydrocollidine affects the localization of FOXO3 protein] | 23620592 |
C530773 | 3,5-diethoxycarbonyl-1,4-dihydrocollidine | CTNNB1 mutant form inhibits the reaction [3,5-diethoxycarbonyl-1,4-dihydrocollidine results in increased expression of SGK1 protein] | 23620592 |
C530773 | 3,5-diethoxycarbonyl-1,4-dihydrocollidine | CTNNB1 protein results in decreased susceptibility to 3,5-diethoxycarbonyl-1,4-dihydrocollidine | 23620592 |
C025160 | 3-aminobenzamide | 3-aminobenzamide results in decreased expression of CTNNB1 mRNA | 15670817 |
C048460 | 3-deazaneplanocin | [3-deazaneplanocin co-treated with trichostatin A] affects the expression of CTNNB1 protein | 18538736 |
C017906 | 3-dinitrobenzene | 3-dinitrobenzene results in increased expression of CTNNB1 mRNA | 24140754 |
C002010 | 4-(2-aminoethyl)benzenesulfonylfluoride | 4-(2-aminoethyl)benzenesulfonylfluoride inhibits the reaction [Nitroglycerin results in decreased localization of CTNNB1 protein] | 17030184 |
C002010 | 4-(2-aminoethyl)benzenesulfonylfluoride | 4-(2-aminoethyl)benzenesulfonylfluoride inhibits the reaction [Nitroglycerin results in increased degradation of and results in decreased activity of CTNNB1 protein] | 17030184 |
C523934 | 4(4-(5-nitro-furan-2-ylmethylene)-3,5-dioxo-pyrazolidin-1-yl)-benzoic acid ethyl ester | 4(4-(5-nitro-furan-2-ylmethylene)-3,5-dioxo-pyrazolidin-1-yl)-benzoic acid ethyl ester results in decreased degradation of and affects the localization of CTNNB1 protein | 29355596 |
C523934 | 4(4-(5-nitro-furan-2-ylmethylene)-3,5-dioxo-pyrazolidin-1-yl)-benzoic acid ethyl ester | CTNNB1 gene mutant form results in decreased susceptibility to 4(4-(5-nitro-furan-2-ylmethylene)-3,5-dioxo-pyrazolidin-1-yl)-benzoic acid ethyl ester | 29355596 |
C009505 | 4,4'-diaminodiphenylmethane | 4,4'-diaminodiphenylmethane results in increased expression of CTNNB1 mRNA | 18648102 |
C459179 | 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
C459179 | 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
C459179 | 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
C555021 | 4-acetylantroquinonol B | 4-acetylantroquinonol B results in decreased expression of CTNNB1 mRNA | 26235807 |
C552996 | 4-aminoethylamino-emodin | [4-aminoethylamino-emodin co-treated with SB 216763] results in decreased expression of CTNNB1 protein modified form | 19228266 |
C552996 | 4-aminoethylamino-emodin | 4-aminoethylamino-emodin results in decreased expression of CTNNB1 protein modified form | 19228266 |
C027576 | 4-hydroxy-2-nonenal | 4-hydroxy-2-nonenal results in decreased expression of CTNNB1 mRNA | 12419474 |
C027576 | 4-hydroxy-2-nonenal | 4-hydroxy-2-nonenal results in decreased expression of CTNNB1 protein | 24825450 |
C000603500 | 4'-methoxy-1-naphthylfenoterol | 4'-methoxy-1-naphthylfenoterol results in decreased expression of CTNNB1 protein | 27423937 |
C120195 | 4-nitroquinolone-1-oxide | [Arecoline co-treated with 4-nitroquinolone-1-oxide] results in increased expression of CTNNB1 protein | 26464283 |
C016583 | 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone | 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of and affects the localization of CTNNB1 protein | 28321046 |
C016583 | 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone | Acetylcysteine inhibits the reaction [4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of and affects the localization of CTNNB1 protein] | 28321046 |
C016583 | 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone | Wortmannin inhibits the reaction [4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of CTNNB1 protein] | 28321046 |
C060298 | 5,7-dimethoxyflavone | 5,7-dimethoxyflavone inhibits the reaction [Diethylnitrosamine affects the localization of CTNNB1 protein modified form] | 21554863 |
C060298 | 5,7-dimethoxyflavone | 5,7-dimethoxyflavone inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 mRNA] | 21554863 |
C439285 | (5-fluoro-2-methyl-1-(4-pyridyl)methylene-3-(N-benzyl)-indene)-acetamide hydrochloride | (5-fluoro-2-methyl-1-(4-pyridyl)methylene-3-(N-benzyl)-indene)-acetamide hydrochloride results in decreased expression of CTNNB1 protein | 12392815 |
C571720 | 5-furan-2yl-isoxazole-3-carboxylic acid (3-imidazol-1yl-propyl)-amide | 5-furan-2yl-isoxazole-3-carboxylic acid (3-imidazol-1yl-propyl)-amide inhibits the reaction [Decitabine affects the localization of CTNNB1 protein] | 30125549 |
C558286 | 6,6'-bis(2,3-dimethoxybenzoyl)-alpha,alpha-trehalose | 6,6'-bis(2,3-dimethoxybenzoyl)-alpha,alpha-trehalose analog results in decreased expression of and affects the localization of CTNNB1 protein | 25148938 |
C483321 | 6-bromoindirubin-3'-oxime | 6-bromoindirubin-3'-oxime affects the localization of CTNNB1 protein | 22975441 |
C483321 | 6-bromoindirubin-3'-oxime | 6-bromoindirubin-3'-oxime results in increased expression of CTNNB1 protein | 22975441 |
C483321 | 6-bromoindirubin-3'-oxime | [6-bromoindirubin-3'-oxime co-treated with DHFR mRNA] affects the expression of CTNNB1 protein | 19727391 |
C483321 | 6-bromoindirubin-3'-oxime | 6-bromoindirubin-3'-oxime results in decreased phosphorylation of CTNNB1 protein | 19727391 |
C483321 | 6-bromoindirubin-3'-oxime | 6-bromoindirubin-3'-oxime results in increased expression of CTNNB1 protein | 18624906; 26259606; |
C483321 | 6-bromoindirubin-3'-oxime | broussochalcone A inhibits the reaction [6-bromoindirubin-3'-oxime results in increased expression of CTNNB1 protein] | 31163223 |
C483321 | 6-bromoindirubin-3'-oxime | Methotrexate promotes the reaction [6-bromoindirubin-3'-oxime results in decreased phosphorylation of CTNNB1 protein] | 19727391 |
C053876 | 6-isopropoxy-9-oxoxanthene-2-carboxylic acid | [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] promotes the reaction [AXIN1 protein binds to CTNNB1 protein] | 19407222 |
C053876 | 6-isopropoxy-9-oxoxanthene-2-carboxylic acid | [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] promotes the reaction [GSK3B protein binds to CTNNB1 protein] | 19407222 |
C053876 | 6-isopropoxy-9-oxoxanthene-2-carboxylic acid | [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] results in increased degradation of CTNNB1 protein | 19407222 |
C473217 | 8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate | 8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in decreased localization of CTNNB1 protein] | 21745194 |
C473217 | 8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate | RAPGEF3 mutant form inhibits the reaction [8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in decreased localization of CTNNB1 protein]] | 21745194 |
D015127 | 9,10-Dimethyl-1,2-benzanthracene | 9,10-Dimethyl-1,2-benzanthracene results in increased expression of and affects the localization of CTNNB1 protein | 29663660 |
D015127 | 9,10-Dimethyl-1,2-benzanthracene | 9,10-Dimethyl-1,2-benzanthracene results in increased expression of CTNNB1 mRNA | 29663660 |
D015127 | 9,10-Dimethyl-1,2-benzanthracene | mithramycin A inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in increased expression of and affects the localization of CTNNB1 protein] | 29663660 |
D015127 | 9,10-Dimethyl-1,2-benzanthracene | SP1 protein affects the reaction [9,10-Dimethyl-1,2-benzanthracene results in increased expression of CTNNB1 protein] | 29663660 |
D000082 | Acetaminophen | Acetaminophen affects the localization of CTNNB1 protein | 30567741 |
D000082 | Acetaminophen | Acetaminophen promotes the reaction [CTNNB1 protein binds to PPP2R5A protein] | 30567741 |
D000082 | Acetaminophen | Acetaminophen results in decreased expression of CTNNB1 mRNA | 27761495 |
D000082 | Acetaminophen | Acetaminophen results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 30567741 |
D000082 | Acetaminophen | Acetaminophen results in increased expression of CTNNB1 mRNA | 21420995 |
D000082 | Acetaminophen | PPP2CA protein affects the reaction [Acetaminophen affects the localization of CTNNB1 protein] | 30567741 |
D000082 | Acetaminophen | PPP2CA protein affects the reaction [Acetaminophen results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
D000082 | Acetaminophen | PPP2R5A protein affects the reaction [Acetaminophen affects the localization of CTNNB1 protein] | 30567741 |
D000082 | Acetaminophen | PPP2R5A protein affects the reaction [Acetaminophen results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
D000082 | Acetaminophen | Acetaminophen affects the expression of CTNNB1 mRNA | 17562736; 19679878; |
D000082 | Acetaminophen | Acetaminophen affects the localization of CTNNB1 protein | 19679878 |
D000082 | Acetaminophen | Acetaminophen results in increased expression of and results in increased activity of CTNNB1 protein | 19679878 |
D000082 | Acetaminophen | CTNNB1 mutant form results in increased susceptibility to Acetaminophen | 19679878 |
C099158 | acetyl-aspartyl-glutamyl-valyl-aspartal | acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Topotecan results in increased cleavage of CTNNB1 protein] | 20457140 |
D000111 | Acetylcysteine | Acetylcysteine inhibits the reaction [4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of and affects the localization of CTNNB1 protein] | 28321046 |
D000111 | Acetylcysteine | Acetylcysteine inhibits the reaction [DDT results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 24968063 |
D000111 | Acetylcysteine | Acetylcysteine inhibits the reaction [NCX 4040 results in increased cleavage of CTNNB1 protein] | 16282376 |
D000111 | Acetylcysteine | Acetylcysteine inhibits the reaction [quinocetone results in decreased expression of CTNNB1 protein] | 28343033 |
D000111 | Acetylcysteine | Acetylcysteine inhibits the reaction [sodium arsenite results in increased expression of CTNNB1 protein] | 24961358 |
D000111 | Acetylcysteine | Acetylcysteine inhibits the reaction [TALDO1 gene mutant form results in decreased phosphorylation of CTNNB1 protein] | 19436114 |
C063261 | acetylleucyl-leucyl-norleucinal | acetylleucyl-leucyl-norleucinal inhibits the reaction [Immunologic Factors results in decreased expression of CTNNB1 protein] | 29974605 |
D000171 | Acrolein | Acrolein results in increased expression of CTNNB1 protein | 20525806 |
D020106 | Acrylamide | Acrylamide results in increased expression of CTNNB1 mRNA | 28959563 |
C042151 | aeroplysinin I | aeroplysinin I results in decreased expression of CTNNB1 protein | 27120392 |
C412373 | AG 1879 | AG 1879 inhibits the reaction [Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein] | 30261222 |
C412373 | AG 1879 | AG 1879 inhibits the reaction [Toluene 2,4-Diisocyanate affects the localization of CTNNB1 protein] | 30261222 |
C046926 | AH 23848 | [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] promotes the reaction [AXIN1 protein binds to CTNNB1 protein] | 19407222 |
C046926 | AH 23848 | [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] promotes the reaction [GSK3B protein binds to CTNNB1 protein] | 19407222 |
C046926 | AH 23848 | [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] results in increased degradation of CTNNB1 protein | 19407222 |
C031143 | AICA ribonucleotide | AICA ribonucleotide inhibits the reaction [[HDAC5 protein binds to MEF2 protein] which binds to CTNNB1 promoter] | 21454484 |
C031143 | AICA ribonucleotide | AICA ribonucleotide results in increased expression of CTNNB1 mRNA | 21454484 |
C031143 | AICA ribonucleotide | AICA ribonucleotide results in increased expression of CTNNB1 protein | 21454484 |
C031143 | AICA ribonucleotide | [AICA ribonucleotide results in increased phosphorylation of HDAC5 protein] which results in increased expression of CTNNB1 mRNA | 21454484 |
C031143 | AICA ribonucleotide | [AICA ribonucleotide results in increased phosphorylation of HDAC5 protein] which results in increased expression of CTNNB1 protein | 21454484 |
C031143 | AICA ribonucleotide | PRKAA2 protein affects the reaction [AICA ribonucleotide results in increased expression of CTNNB1 mRNA] | 21454484 |
C031143 | AICA ribonucleotide | PRKAA2 protein affects the reaction [AICA ribonucleotide results in increased expression of CTNNB1 protein] | 21454484 |
C095512 | alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide | [alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA]] | 11751460 |
C095512 | alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide | [alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA] | 11751460 |
D000077410 | Aluminum Chloride | Aluminum Chloride results in decreased expression of CTNNB1 mRNA | 26474975 |
D000077410 | Aluminum Chloride | Aluminum Chloride results in decreased expression of CTNNB1 protein | 26474975 |
D000602 | Amino Acids, Peptides, and Proteins | Amino Acids, Peptides, and Proteins results in increased expression of CTNNB1 mRNA | 23747718 |
D000641 | Ammonia | CTNNB1 protein affects the metabolism of Ammonia | 16557553 |
D000643 | Ammonium Chloride | Ammonium Chloride affects the expression of CTNNB1 mRNA | 16483693 |
D000643 | Ammonium Chloride | Ammonium Chloride results in increased expression of CTNNB1 protein | 16483693 |
D000661 | Amphetamine | Amphetamine results in decreased expression of CTNNB1 protein | 16144542 |
C553921 | amurensin G | [amurensin G results in decreased activity of SIRT1 protein] inhibits the reaction [Oxygen deficiency results in decreased expression of CTNNB1] | 22245592 |
D000942 | Antigens, Bacterial | [MYD88 gene mutant form affects the susceptibility to [Antigens, Bacterial co-treated with Ovalbumin]] which affects the expression of CTNNB1 mRNA | 29067999 |
C526219 | apple polyphenol extract | apple polyphenol extract results in decreased expression of CTNNB1 protein | 16968061 |
C526219 | apple polyphenol extract | apple polyphenol extract results in decreased phosphorylation of CTNNB1 protein | 16968061 |
D001115 | Arecoline | [Arecoline co-treated with 4-nitroquinolone-1-oxide] results in increased expression of CTNNB1 protein | 26464283 |
C000228 | aristolochic acid I | [aristolochic acid I co-treated with aristolochic acid II] results in decreased expression of CTNNB1 protein | 25663515 |
C000228 | aristolochic acid I | BMP7 protein inhibits the reaction [[aristolochic acid I co-treated with aristolochic acid II] results in increased expression of CTNNB1 protein] | 25663515 |
C042310 | aristolochic acid II | [aristolochic acid I co-treated with aristolochic acid II] results in decreased expression of CTNNB1 protein | 25663515 |
C042310 | aristolochic acid II | BMP7 protein inhibits the reaction [[aristolochic acid I co-treated with aristolochic acid II] results in increased expression of CTNNB1 protein] | 25663515 |
D001151 | Arsenic | Arsenic results in increased expression of and results in increased activity of CTNNB1 protein | 22552367 |
D001151 | Arsenic | Arsenic results in increased expression of CTNNB1 mRNA | 29107899 |
D001151 | Arsenic | CAT protein inhibits the reaction [Arsenic results in increased expression of and results in increased activity of CTNNB1 protein] | 22552367 |
D001151 | Arsenic | polyethylene glycol-superoxide dismutase inhibits the reaction [Arsenic results in increased expression of and results in increased activity of CTNNB1 protein] | 22552367 |
D001151 | Arsenic | Arsenic results in increased expression of CTNNB1 protein | 22552367 |
C050510 | arsenic trichloride | arsenic trichloride results in increased activity of CTNNB1 protein | 21854796 |
C050510 | arsenic trichloride | arsenic trichloride results in increased expression of CTNNB1 protein | 21854796 |
C050510 | arsenic trichloride | CAT protein inhibits the reaction [arsenic trichloride results in increased activity of CTNNB1 protein] | 21854796 |
C050510 | arsenic trichloride | CAT protein inhibits the reaction [arsenic trichloride results in increased expression of CTNNB1 protein] | 21854796 |
D000077237 | Arsenic Trioxide | [Arsenic Trioxide binds to PIN1 protein] affects the reaction [Arsenic Trioxide results in decreased expression of CTNNB1 protein] | 30093655 |
D000077237 | Arsenic Trioxide | Arsenic Trioxide inhibits the reaction [CTNNB1 protein results in decreased susceptibility to Bortezomib] | 18485479 |
D000077237 | Arsenic Trioxide | Arsenic Trioxide inhibits the reaction [Lithium Chloride results in increased expression of CTNNB1 protein] | 28901456 |
D000077237 | Arsenic Trioxide | Arsenic Trioxide promotes the reaction [Tretinoin results in decreased expression of CTNNB1 protein] | 30093655 |
D000077237 | Arsenic Trioxide | Arsenic Trioxide results in decreased expression of CTNNB1 mRNA | 18485479; 28565807; 29059232; |
D000077237 | Arsenic Trioxide | Arsenic Trioxide results in decreased expression of CTNNB1 protein | 17512576; 18485479; 26966376; 28565807; 28901456; 29059232; 30093655; |
D000077237 | Arsenic Trioxide | Arsenic Trioxide results in increased cleavage of CTNNB1 protein | 12181429 |
D000077237 | Arsenic Trioxide | Arsenic Trioxide results in increased expression of CTNNB1 mRNA | 20458559 |
D000077237 | Arsenic Trioxide | CAB39L protein alternative form inhibits the reaction [Arsenic Trioxide results in decreased expression of CTNNB1 mRNA] | 29059232 |
D000077237 | Arsenic Trioxide | CAB39L protein alternative form inhibits the reaction [Arsenic Trioxide results in decreased expression of CTNNB1 protein] | 29059232 |
D000077237 | Arsenic Trioxide | PIN1 protein affects the reaction [Arsenic Trioxide results in decreased expression of CTNNB1 protein] | 30093655 |
D000077237 | Arsenic Trioxide | Tretinoin promotes the reaction [Arsenic Trioxide results in decreased expression of CTNNB1 protein] | 30093655 |
C015001 | arsenite | arsenite affects the localization of CTNNB1 protein | 17400267 |
C015001 | arsenite | arsenite results in decreased phosphorylation of CTNNB1 protein | 17400267 |
C015001 | arsenite | RTKI cpd inhibits the reaction [arsenite affects the localization of CTNNB1 protein] | 17400267 |
C015001 | arsenite | arsenite results in increased expression of CTNNB1 protein | 21344382 |
D000077332 | Artesunate | Artesunate inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein] | 29031619 |
D017638 | Asbestos, Crocidolite | Asbestos, Crocidolite affects the expression of CTNNB1 mRNA | 17331233 |
D017638 | Asbestos, Crocidolite | Asbestos, Crocidolite affects the expression of CTNNB1 protein | 21570478 |
D017638 | Asbestos, Crocidolite | Asbestos, Crocidolite results in increased phosphorylation of and affects the localization of CTNNB1 protein | 24160326 |
D017638 | Asbestos, Crocidolite | TNF protein promotes the reaction [Asbestos, Crocidolite affects the localization of CTNNB1 protein] | 24160326 |
D017632 | Asbestos, Serpentine | Asbestos, Serpentine results in decreased expression of CTNNB1 mRNA | 26685284 |
D017632 | Asbestos, Serpentine | Asbestos, Serpentine results in decreased expression of CTNNB1 protein | 26685284 |
D017632 | Asbestos, Serpentine | Asbestos, Serpentine results in increased phosphorylation of and affects the localization of CTNNB1 protein | 24160326 |
D017632 | Asbestos, Serpentine | TGFB1 protein affects the reaction [Asbestos, Serpentine results in decreased expression of CTNNB1 protein] | 26685284 |
D017632 | Asbestos, Serpentine | TNF protein promotes the reaction [Asbestos, Serpentine affects the localization of CTNNB1 protein] | 24160326 |
D001205 | Ascorbic Acid | [Ascorbic Acid co-treated with Vitamin E] inhibits the reaction [Diethylhexyl Phthalate results in increased expression of and affects the localization of CTNNB1 protein] | 29940330 |
D001205 | Ascorbic Acid | [Ascorbic Acid co-treated with Vitamin E] inhibits the reaction [mono-(2-ethylhexyl)phthalate affects the localization of CTNNB1 protein] | 29940330 |
D001205 | Ascorbic Acid | 2,2-bis(4-glycidyloxyphenyl)propane promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
D001205 | Ascorbic Acid | [beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA | 30481989 |
D001205 | Ascorbic Acid | Troglitazone promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
D001241 | Aspirin | Aspirin results in decreased localization of CTNNB1 protein | 16878161; 17357503; |
D001241 | Aspirin | Aspirin results in increased phosphorylation of CTNNB1 protein | 12813129; 16878161; |
D001241 | Aspirin | Aspirin results in increased ubiquitination of CTNNB1 protein | 16878161 |
D001241 | Aspirin | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Aspirin results in increased ubiquitination of CTNNB1 protein] | 16878161 |
D001241 | Aspirin | CTNNB1 affects the reaction [Aspirin results in decreased expression of CCND1 protein] | 16878161 |
D001241 | Aspirin | CTNNB1 affects the reaction [Aspirin results in decreased expression of CD44 protein alternative form] | 16878161 |
D001241 | Aspirin | CTNNB1 affects the reaction [Aspirin results in decreased expression of CMET protein] | 16878161 |
D001241 | Aspirin | CTNNB1 affects the reaction [Aspirin results in decreased expression of MYC protein] | 16878161 |
D001241 | Aspirin | Lithium Chloride inhibits the reaction [Aspirin results in increased phosphorylation of CTNNB1 protein] | 12813129 |
D001285 | Atropine | Atropine inhibits the reaction [Parathion results in increased expression of CTNNB1 protein] | 17390078 |
D001285 | Atropine | Atropine inhibits the reaction [Parathion results in increased expression of CTNNB1 protein mutant form] | 17390078 |
C105832 | aurapten | aurapten results in decreased expression of CTNNB1 protein mutant form | 16012713 |
D001554 | Benzene | Benzene results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 30567741 |
D001554 | Benzene | PPP2R1A protein affects the reaction [Benzene results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
C038198 | benzenesulfonamide | benzenesulfonamide analog results in decreased expression of CTNNB1 | 22713211 |
D001564 | Benzo(a)pyrene | Benzo(a)pyrene metabolite results in increased expression of CTNNB1 mRNA | 26314263 |
D001564 | Benzo(a)pyrene | Benzo(a)pyrene results in increased expression of CTNNB1 mRNA | 21714911 |
D001564 | Benzo(a)pyrene | Benzo(a)pyrene results in increased expression of CTNNB1 mRNA | 22228805 |
D001564 | Benzo(a)pyrene | Benzo(a)pyrene results in increased expression of CTNNB1 mRNA | 22300585 |
C110772 | benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone | benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [NCX 4040 results in increased cleavage of CTNNB1 protein] | 16282376 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Aspirin results in increased ubiquitination of CTNNB1 protein] | 16878161 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [deguelin results in decreased expression of CTNNB1 protein] | 21472727 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [deguelin results in increased degradation of CTNNB1 protein] | 21472727 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Drugs, Chinese Herbal results in decreased expression of CTNNB1 protein] | 28548306 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [quinocetone results in decreased expression of CTNNB1 protein] | 28343033 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [RASSF5 protein results in decreased expression of CTNNB1 protein] | 25217643 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [sulindac sulfide results in decreased expression of CTNNB1 protein] | 14555707 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [sulindac sulfone results in decreased expression of CTNNB1 protein] | 14555707 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Vitamin A results in decreased expression of CTNNB1 protein] | 17219422 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [Nitroglycerin results in increased degradation of CTNNB1 protein] | 17030184 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased degradation of CTNNB1 protein | 26990689 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of and affects the localization of CTNNB1 protein | 31115591 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde affects the phosphorylation of and affects the localization of CTNNB1 protein | 27693619 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased degradation of and results in increased expression of CTNNB1 protein | 27693619 |
C072553 | benzyloxycarbonylleucyl-leucyl-leucine aldehyde | Phenobarbital inhibits the reaction [benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of CTNNB1 protein] | 27693619 |
D001599 | Berberine | Berberine results in increased expression of CTNNB1 protein | 26478571 |
D001599 | Berberine | CTNNB1 mutant form inhibits the reaction [Berberine results in increased expression of BGLAP protein] | 26478571 |
D001599 | Berberine | CTNNB1 mutant form inhibits the reaction [Berberine results in increased expression of RUNX2 mRNA] | 26478571 |
D001599 | Berberine | CTNNB1 mutant form inhibits the reaction [Berberine results in increased expression of SPP1 protein] | 26478571 |
D001599 | Berberine | DKK1 protein inhibits the reaction [Berberine results in increased expression of CTNNB1 protein] | 26478571 |
C031463 | beta-glycerophosphoric acid | 2,2-bis(4-glycidyloxyphenyl)propane promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
C031463 | beta-glycerophosphoric acid | [beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA | 30481989 |
C031463 | beta-glycerophosphoric acid | Troglitazone promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
D019324 | beta-Naphthoflavone | CTNNB1 gene mutant form affects the reaction [beta-Naphthoflavone results in increased expression of CYP1A1 mRNA] | 25174530 |
D019324 | beta-Naphthoflavone | CTNNB1 gene mutant form inhibits the reaction [beta-Naphthoflavone results in increased expression of CYP1A2 mRNA] | 25174530 |
C002070 | betulinic acid | [betulinic acid co-treated with Erlotinib Hydrochloride] results in decreased expression of CTNNB1 protein | 30136359 |
C002070 | betulinic acid | betulinic acid results in decreased expression of CTNNB1 protein | 30136359 |
C543008 | bis(4-hydroxyphenyl)sulfone | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of CTNNB1 mRNA | 28628672 |
C006780 | bisphenol A | bisphenol A affects the expression of CTNNB1 mRNA | 21786754 |
C006780 | bisphenol A | bisphenol A results in decreased expression of CTNNB1 protein | 30639874 |
C006780 | bisphenol A | bisphenol A affects the expression of CTNNB1 mRNA | 30903817 |
C006780 | bisphenol A | bisphenol A results in decreased expression of and affects the localization of CTNNB1 protein | 24532171 |
C006780 | bisphenol A | bisphenol A results in decreased expression of CTNNB1 protein | 26922907; 30303745; |
C006780 | bisphenol A | Decitabine inhibits the reaction [bisphenol A results in decreased expression of CTNNB1 protein] | 30303745 |
C006780 | bisphenol A | bisphenol A affects the localization of CTNNB1 protein | 26063408 |
C006780 | bisphenol A | bisphenol A results in decreased expression of CTNNB1 mRNA | 23900028; 26063408; 30303745; |
C006780 | bisphenol A | bisphenol A results in decreased expression of CTNNB1 protein | 30303745 |
C006780 | bisphenol A | bisphenol A results in decreased methylation of CTNNB1 promoter | 27312807 |
C006780 | bisphenol A | bisphenol A affects the localization of CTNNB1 protein | 25381574 |
C006780 | bisphenol A | bisphenol A results in decreased expression of and results in increased phosphorylation of CTNNB1 protein | 25381574 |
C006780 | bisphenol A | bisphenol A results in decreased expression of CTNNB1 mRNA | 25381574; 25963729; 27174447; |
C006780 | bisphenol A | bisphenol A results in decreased expression of CTNNB1 protein | 19497385 |
C006780 | bisphenol A | bisphenol A results in increased phosphorylation of and affects the localization of CTNNB1 protein | 25963729 |
C006780 | bisphenol A | Curcumin inhibits the reaction [bisphenol A results in decreased expression of CTNNB1 mRNA] | 25963729 |
C006780 | bisphenol A | [Estradiol co-treated with bisphenol A] results in decreased expression of CTNNB1 mRNA | 27174447 |
C006780 | bisphenol A | WNT3A protein affects the reaction [bisphenol A results in decreased expression of and results in increased phosphorylation of CTNNB1 protein] | 25381574 |
C000611646 | bisphenol F | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of CTNNB1 mRNA | 28628672 |
C005961 | bis(tri-n-butyltin)oxide | bis(tri-n-butyltin)oxide results in increased expression of CTNNB1 mRNA | 26314263 |
C032688 | boric acid | boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein] | 28285642 |
C032688 | boric acid | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of CEBPA protein]] | 28285642 |
C032688 | boric acid | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of FABP4 protein]] | 28285642 |
C032688 | boric acid | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of PPARG protein]] | 28285642 |
D000069286 | Bortezomib | 2-Methoxyestradiol inhibits the reaction [CTNNB1 protein results in decreased susceptibility to Bortezomib] | 18485479 |
D000069286 | Bortezomib | Arsenic Trioxide inhibits the reaction [CTNNB1 protein results in decreased susceptibility to Bortezomib] | 18485479 |
D000069286 | Bortezomib | Bortezomib results in increased expression of CTNNB1 protein | 18485479; 19100720; |
D000069286 | Bortezomib | CTNNB1 protein results in decreased susceptibility to Bortezomib | 18485479 |
D000069286 | Bortezomib | TNFSF10 protein inhibits the reaction [Bortezomib results in increased expression of CTNNB1 protein] | 19100720 |
C471992 | bosutinib | bosutinib affects the localization of CTNNB1 protein | 16489032 |
C471992 | bosutinib | bosutinib inhibits the reaction [CTNNB1 protein binds to TCF4 protein] | 16489032 |
C471992 | bosutinib | bosutinib inhibits the reaction [SRC protein results in increased phosphorylation of CTNNB1 protein] | 16489032 |
C471992 | bosutinib | bosutinib promotes the reaction [CTNNB1 protein binds to CDH1 protein] | 16489032 |
C471992 | bosutinib | bosutinib results in decreased phosphorylation of CTNNB1 protein | 16489032 |
C471992 | bosutinib | CTNNB1 protein promotes the reaction [bosutinib results in increased stability of CDH1 protein] | 16489032 |
C050295 | brazilein | brazilein results in decreased expression of CTNNB1 protein | 23948132 |
D001971 | Bromocriptine | [Bromocriptine co-treated with Estradiol] results in decreased expression of CTNNB1 protein | 11786374 |
C106525 | broussochalcone A | broussochalcone A inhibits the reaction [6-bromoindirubin-3'-oxime results in increased expression of CTNNB1 protein] | 31163223 |
C106525 | broussochalcone A | broussochalcone A results in decreased expression of CTNNB1 protein | 31163223 |
D003994 | Bucladesine | Bucladesine results in increased phosphorylation of CTNNB1 protein | 26964897 |
D002083 | Butylated Hydroxyanisole | CTNNB1 gene mutant form inhibits the reaction [Butylated Hydroxyanisole results in increased expression of CYP1A1 mRNA] | 25174530 |
D002083 | Butylated Hydroxyanisole | CTNNB1 gene mutant form inhibits the reaction [Butylated Hydroxyanisole results in increased expression of CYP1A2 mRNA] | 25174530 |
D002084 | Butylated Hydroxytoluene | [Butylated Hydroxytoluene co-treated with Oxygen] affects the localization of CTNNB1 protein | 16272459 |
D002084 | Butylated Hydroxytoluene | [Butylated Hydroxytoluene co-treated with Oxygen] results in increased expression of CTNNB1 protein | 16272459 |
C027561 | butylbenzyl phthalate | butylbenzyl phthalate affects the localization of CTNNB1 protein | 22552774 |
C027561 | butylbenzyl phthalate | HDAC6 mutant form inhibits the reaction [butylbenzyl phthalate affects the localization of CTNNB1 protein] | 22552774 |
C027561 | butylbenzyl phthalate | trichostatin A inhibits the reaction [butylbenzyl phthalate affects the localization of CTNNB1 protein] | 22552774 |
C027561 | butylbenzyl phthalate | butylbenzyl phthalate results in increased acetylation of CTNNB1 protein | 27923775 |
D002087 | Butyrates | Butyrates results in decreased expression of CTNNB1 protein | 15177505 |
D002087 | Butyrates | [estradiol dipropionate co-treated with Butyrates] results in decreased expression of CTNNB1 protein | 15930180 |
D002104 | Cadmium | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Cadmium results in increased expression of and results in increased activity of CTNNB1 protein] | 22884995 |
D002104 | Cadmium | Cadmium affects the localization of CTNNB1 protein | 24798214 |
D002104 | Cadmium | [Cadmium affects the localization of CTNNB1 protein] promotes the reaction [CTNNB1 protein binds to TCF4 protein] | 24798214 |
D002104 | Cadmium | Cadmium results in increased activity of CTNNB1 protein | 22884995 |
D002104 | Cadmium | Cadmium results in increased expression of and results in increased activity of CTNNB1 protein | 22884995 |
D002104 | Cadmium | FH535 inhibits the reaction [Cadmium results in increased expression of and results in increased activity of CTNNB1 protein] | 22884995 |
D002104 | Cadmium | SB 216763 promotes the reaction [Cadmium results in increased expression of and results in increased activity of CTNNB1 protein] | 22884995 |
D002104 | Cadmium | Cadmium affects the localization of CTNNB1 protein | 23080431 |
D019256 | Cadmium Chloride | Cadmium Chloride affects the localization of CTNNB1 protein | 24532171 |
D019256 | Cadmium Chloride | Cadmium Chloride results in increased expression of CTNNB1 mRNA | 26472689 |
D019256 | Cadmium Chloride | Cadmium Chloride results in increased expression of CTNNB1 protein | 28527916 |
D019256 | Cadmium Chloride | Cadmium Chloride affects the expression of CTNNB1 mRNA | 18974090 |
D019256 | Cadmium Chloride | Cadmium Chloride results in decreased activity of CTNNB1 protein | 19818801 |
D019256 | Cadmium Chloride | Cadmium Chloride results in increased phosphorylation of and affects the localization of CTNNB1 protein | 19818801 |
D019256 | Cadmium Chloride | Cadmium Chloride affects the localization of CTNNB1 protein | 20459685 |
D019256 | Cadmium Chloride | Cadmium Chloride inhibits the reaction [CTNNB1 protein binds to CDH1 protein binds to CTNNA1 protein] | 20459685 |
D019256 | Cadmium Chloride | Cadmium Chloride promotes the reaction [TCF4 protein binds to CTNNB1 protein] | 20459685 |
D019256 | Cadmium Chloride | Cadmium Chloride results in decreased expression of CTNNB1 protein | 15618353 |
D019256 | Cadmium Chloride | Cadmium Chloride results in increased expression of and affects the localization of CTNNB1 protein | 19615436 |
D019256 | Cadmium Chloride | CDH1 inhibits the reaction [Cadmium Chloride affects the localization of CTNNB1 protein] | 20459685 |
D019256 | Cadmium Chloride | N(6),N(6)-dimethyladenine promotes the reaction [Cadmium Chloride results in decreased expression of CTNNB1 protein] | 15618353 |
C055494 | caffeic acid phenethyl ester | caffeic acid phenethyl ester results in decreased expression of CTNNB1 protein | 10783313 |
D002110 | Caffeine | Caffeine inhibits the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D002110 | Caffeine | Caffeine results in increased mutagenesis of CTNNB1 gene | 18283038 |
D002117 | Calcitriol | [Calcitriol binds to VDR protein] which results in decreased activity of CTNNB1 mRNA | 20043299 |
D002117 | Calcitriol | Calcitriol inhibits the reaction [CTNNB1 protein results in increased expression of DKK4 mRNA] | 20043299 |
D002117 | Calcitriol | Calcitriol promotes the reaction [CTNNB1 protein binds to VDR protein] | 16051482 |
D002117 | Calcitriol | Calcitriol results in decreased activity of CTNNB1 protein | 16051482 |
D002118 | Calcium | Calcium results in increased expression of CTNNB1 mRNA | 24658506 |
D002118 | Calcium | Calcium results in increased expression of CTNNB1 protein | 24658506 |
D002118 | Calcium | CTNNB1 mutant form inhibits the reaction [Calcium results in increased expression of KRT1 mRNA] | 24658506 |
D002118 | Calcium | CTNNB1 mutant form inhibits the reaction [Calcium results in increased expression of KRT1 protein] | 24658506 |
D002118 | Calcium | CTNNB1 mutant form inhibits the reaction [Calcium results in increased expression of LORICRIN mRNA] | 24658506 |
D002118 | Calcium | CTNNB1 mutant form inhibits the reaction [Calcium results in increased expression of LORICRIN protein] | 24658506 |
C059041 | calyculin A | calyculin A results in increased phosphorylation of CTNNB1 protein | 12813129; 16878161; |
D002211 | Capsaicin | Capsaicin results in increased expression of CTNNB1 protein | 22150557 |
D002211 | Capsaicin | [Naproxen co-treated with Sumatriptan] inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
D002211 | Capsaicin | Naproxen inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
D002211 | Capsaicin | Sumatriptan inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
D002220 | Carbamazepine | Carbamazepine affects the expression of CTNNB1 mRNA | 24752500 |
D002251 | Carbon Tetrachloride | Carbon Tetrachloride results in increased expression of CTNNB1 protein | 27477297; 29535048; |
D002251 | Carbon Tetrachloride | NFE2L2 protein promotes the reaction [tetramethylpyrazine inhibits the reaction [Carbon Tetrachloride results in increased expression of CTNNB1 protein]] | 27477297 |
D002251 | Carbon Tetrachloride | tetramethylpyrazine inhibits the reaction [Carbon Tetrachloride results in increased expression of CTNNB1 protein] | 27477297 |
D000077261 | Carvedilol | Carvedilol results in decreased expression of CTNNB1 mRNA | 16824628 |
D000077261 | Carvedilol | Carvedilol results in increased expression of CTNNB1 protein | 16824628 |
D000068579 | Celecoxib | Celecoxib affects the localization of CTNNB1 protein | 19682443 |
D000068579 | Celecoxib | Celecoxib analog affects the localization of CTNNB1 protein | 19682443 |
C095591 | chan su | chan su results in increased degradation of CTNNB1 protein | 16012733 |
C473711 | Chir 99021 | Chir 99021 inhibits the reaction [Particulate Matter analog results in decreased expression of CTNNB1 protein] | 27216425 |
C473711 | Chir 99021 | Chir 99021 results in increased expression of CTNNB1 protein | 26259606 |
D048271 | Chitosan | [Cromolyn Sodium co-treated with Chitosan] inhibits the reaction [Dimethylhydrazines results in increased expression of CTNNB1 protein] | 28732690 |
D007631 | Chlordecone | Chlordecone results in decreased expression of CTNNB1 protein | 11695219 |
D020111 | Chlorodiphenyl (54% Chlorine) | Chlorodiphenyl (54% Chlorine) results in decreased expression of CTNNB1 mRNA | 23650126 |
C007020 | chlorophyllin | chlorophyllin affects the reaction [1,2-Dimethylhydrazine results in increased mutagenesis of CTNNB1 gene] | 12628520 |
C007020 | chlorophyllin | [chlorophyllin affects the reaction [1,2-Dimethylhydrazine results in increased mutagenesis of CTNNB1 gene]] inhibits the reaction [GSK3B protein results in increased phosphorylation of and results in increased ubiquitination of CTNNB1 protein] | 12628520; 12628520; |
C007020 | chlorophyllin | chlorophyllin affects the reaction [2-amino-3-methylimidazo(4,5-f)quinoline results in increased mutagenesis of CTNNB1 gene] | 12628520 |
C007020 | chlorophyllin | [chlorophyllin affects the reaction [2-amino-3-methylimidazo(4,5-f)quinoline results in increased mutagenesis of CTNNB1 gene]] inhibits the reaction [GSK3B protein results in increased phosphorylation of and results in increased ubiquitination of CTNNB1 protein] | 12628520; 12628520; |
D002738 | Chloroquine | Chloroquine inhibits the reaction [Dibutyl Phthalate results in increased expression of CTNNB1 mRNA] | 30053495 |
D004390 | Chlorpyrifos | Chlorpyrifos results in increased expression of CTNNB1 mRNA | 20691718 |
D002762 | Cholecalciferol | BMP2 protein promotes the reaction [Cholecalciferol results in increased expression of CTNNB1 mRNA] | 17170073 |
D002762 | Cholecalciferol | [Cholecalciferol co-treated with Tretinoin] affects the localization of CTNNB1 protein | 17170073 |
D002762 | Cholecalciferol | Cholecalciferol results in increased expression of CTNNB1 mRNA | 17170073 |
D002762 | Cholecalciferol | Tretinoin inhibits the reaction [Cholecalciferol results in increased expression of CTNNB1 mRNA] | 17170073 |
C074702 | chromium hexavalent ion | CAT protein inhibits the reaction [chromium hexavalent ion results in increased expression of and results in increased activity of CTNNB1 protein] | 22552367 |
C074702 | chromium hexavalent ion | chromium hexavalent ion promotes the reaction [[CTNNB1 protein co-treated with TCF4 protein] binds to MYC promoter] | 27323401 |
C074702 | chromium hexavalent ion | chromium hexavalent ion promotes the reaction [[CTNNB1 protein co-treated with TCF4 protein] binds to PLAUR promoter] | 27323401 |
C074702 | chromium hexavalent ion | chromium hexavalent ion results in decreased expression of CTNNB1 protein | 23518002 |
C074702 | chromium hexavalent ion | chromium hexavalent ion results in increased activity of CTNNB1 protein | 27323401 |
C074702 | chromium hexavalent ion | chromium hexavalent ion results in increased expression of and results in increased activity of CTNNB1 protein | 22552367 |
C074702 | chromium hexavalent ion | polyethylene glycol-superoxide dismutase inhibits the reaction [chromium hexavalent ion results in increased expression of and results in increased activity of CTNNB1 protein] | 22552367 |
C074702 | chromium hexavalent ion | chromium hexavalent ion results in increased expression of CTNNB1 protein | 22552367 |
C043561 | chrysin | chrysin inhibits the reaction [Topotecan results in increased cleavage of CTNNB1 protein] | 20457140 |
D002945 | Cisplatin | Cisplatin results in increased expression of CTNNB1 protein | 20074550 |
D002945 | Cisplatin | CTNNB1 results in decreased susceptibility to Cisplatin | 22000491 |
D002945 | Cisplatin | [NEAT1 protein affects the susceptibility to Cisplatin] which affects the expression of and affects the phosphorylation of CTNNB1 protein | 30291867 |
D002945 | Cisplatin | 8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in decreased localization of CTNNB1 protein] | 21745194 |
D002945 | Cisplatin | Cisplatin results in decreased expression of CTNNB1 mRNA | 29148169 |
D002945 | Cisplatin | Cisplatin results in decreased expression of CTNNB1 protein | 23628706 |
D002945 | Cisplatin | Cisplatin results in decreased localization of CTNNB1 protein | 21745194 |
D002945 | Cisplatin | Cisplatin results in increased phosphorylation of CTNNB1 protein | 24560772 |
D002945 | Cisplatin | CTNNB1 mutant form inhibits the reaction [SB 216763 inhibits the reaction [Cisplatin results in increased expression of IL6 mRNA]] | 24560772 |
D002945 | Cisplatin | CTNNB1 mutant form inhibits the reaction [SB 216763 inhibits the reaction [Cisplatin results in increased expression of TNF mRNA]] | 24560772 |
D002945 | Cisplatin | CTNNB1 protein results in decreased susceptibility to Cisplatin | 24560772 |
D002945 | Cisplatin | RAPGEF3 mutant form inhibits the reaction [8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in decreased localization of CTNNB1 protein]] | 21745194 |
D002945 | Cisplatin | SB 216763 inhibits the reaction [Cisplatin results in increased phosphorylation of CTNNB1 protein] | 24560772 |
D002945 | Cisplatin | Cisplatin results in increased expression of CTNNB1 protein | 31103702 |
D002945 | Cisplatin | wogonin inhibits the reaction [Cisplatin results in increased expression of CTNNB1 protein] | 31103702 |
D002994 | Clofibrate | Clofibrate results in decreased expression of CTNNB1 mRNA | 16081524 |
D002995 | Clofibric Acid | Clofibric Acid affects the expression of CTNNB1 mRNA | 17602206 |
D003024 | Clozapine | Clozapine results in increased expression of CTNNB1 protein | 16144542 |
D003024 | Clozapine | DRD2 protein affects the reaction [Clozapine results in increased expression of CTNNB1 protein] | 16144542 |
C007095 | cobaltiprotoporphyrin | cobaltiprotoporphyrin affects the expression of CTNNB1 protein | 23497794 |
C018021 | cobaltous chloride | cobaltous chloride results in decreased expression of CTNNB1 mRNA | 19320972 |
C018021 | cobaltous chloride | cobaltous chloride results in increased expression of CTNNB1 mRNA | 17553155; 26314263; |
D003042 | Cocaine | Cocaine results in increased expression of CTNNB1 mRNA | 11299316 |
D003042 | Cocaine | Cocaine results in increased expression of CTNNB1 protein | 11299316 |
D003042 | Cocaine | Cocaine affects the expression of CTNNB1 mRNA | 20187946 |
D003042 | Cocaine | Cocaine deficiency promotes the reaction [SMARCA4 protein binds to CTNNB1 promoter] | 27422367 |
C113861 | corosolic acid | corosolic acid results in increased degradation of CTNNB1 protein | 24566423 |
D003345 | Corticosterone | [Corticosterone results in increased phosphorylation of NDRG1 protein] promotes the reaction [NDRG1 protein binds to CTNNB1 protein] | 21655274 |
D003345 | Corticosterone | [Corticosterone results in increased phosphorylation of NDRG1 protein] which results in increased expression of and results in increased localization of CTNNB1 protein | 21655274 |
D003407 | Creosote | Creosote affects the localization of CTNNB1 protein | 12604173 |
D004205 | Cromolyn Sodium | [Cromolyn Sodium co-treated with Chitosan] inhibits the reaction [Dimethylhydrazines results in increased expression of CTNNB1 protein] | 28732690 |
C037886 | cryptotanshinone | cryptotanshinone inhibits the reaction [Dinoprostone results in increased expression of CTNNB1 protein] | 30208247 |
D003471 | Cuprizone | Cuprizone results in increased expression of CTNNB1 mRNA | 26577399 |
D003474 | Curcumin | Curcumin analog results in decreased expression of CTNNB1 mRNA | 17041101 |
D003474 | Curcumin | Curcumin analog results in increased degradation of CTNNB1 protein | 17041101 |
D003474 | Curcumin | Curcumin inhibits the reaction [CTNNB1 protein binds to TCF7L2 protein] | 19294764 |
D003474 | Curcumin | Curcumin inhibits the reaction [IL1B protein results in increased expression of CTNNB1 protein] | 27645308 |
D003474 | Curcumin | Curcumin results in decreased activity of [CTNNB1 protein binds to TCF7L2 protein] | 19294764 |
D003474 | Curcumin | Curcumin results in decreased expression of CTNNB1 mRNA | 17041101; 27645308; |
D003474 | Curcumin | Curcumin results in decreased expression of CTNNB1 protein | 19573523; 27645308; 30935902; |
D003474 | Curcumin | Curcumin results in increased degradation of CTNNB1 protein | 17041101 |
D003474 | Curcumin | [piperine co-treated with Curcumin] results in decreased expression of CTNNB1 protein | 30935902 |
D003474 | Curcumin | Vitamin E inhibits the reaction [Curcumin results in decreased expression of CTNNB1 protein] | 30935902 |
D003474 | Curcumin | Curcumin results in decreased expression of CTNNB1 protein | 10783313 |
D003474 | Curcumin | Curcumin inhibits the reaction [bisphenol A results in decreased expression of CTNNB1 mRNA] | 25963729 |
D003474 | Curcumin | Curcumin results in decreased phosphorylation of and affects the localization of CTNNB1 protein | 25963729 |
D003474 | Curcumin | Curcumin results in decreased phosphorylation of CTNNB1 protein | 25963729 |
D003474 | Curcumin | Curcumin results in increased expression of CTNNB1 mRNA | 25963729 |
D003474 | Curcumin | Curcumin results in decreased expression of CTNNB1 | 18462866 |
C057862 | cyanoginosin LR | cyanoginosin LR results in increased ubiquitination of CTNNB1 protein | 20421190 |
D003513 | Cycloheximide | Cycloheximide results in decreased expression of CTNNB1 protein | 27693619 |
D003513 | Cycloheximide | Phenobarbital affects the reaction [Cycloheximide results in decreased expression of CTNNB1 protein] | 27693619 |
C552889 | cyclohexyl-(2-(3,5-dimethylpyrazol-1-yl)-6-methylpyrimidin-4-yl)amine | cyclohexyl-(2-(3,5-dimethylpyrazol-1-yl)-6-methylpyrimidin-4-yl)amine affects the localization of CTNNB1 protein | 30597128 |
C552889 | cyclohexyl-(2-(3,5-dimethylpyrazol-1-yl)-6-methylpyrimidin-4-yl)amine | cyclohexyl-(2-(3,5-dimethylpyrazol-1-yl)-6-methylpyrimidin-4-yl)amine results in decreased expression of and results in increased phosphorylation of CTNNB1 protein | 30597128 |
D016572 | Cyclosporine | Cyclosporine results in decreased expression of CTNNB1 mRNA | 20106945; 25562108; |
D016572 | Cyclosporine | Cyclosporine results in decreased expression of CTNNB1 protein | 22416070 |
D003634 | DDT | Acetylcysteine inhibits the reaction [DDT results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 24968063 |
D003634 | DDT | DDT affects the localization of CTNNB1 protein | 24968063 |
D003634 | DDT | DDT inhibits the reaction [CDH1 protein binds to CTNNB1 protein] | 22902829 |
D003634 | DDT | DDT results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 24968063 |
D003634 | DDT | DDT results in increased expression of CTNNB1 protein | 22902829 |
D000077209 | Decitabine | 5-furan-2yl-isoxazole-3-carboxylic acid (3-imidazol-1yl-propyl)-amide inhibits the reaction [Decitabine affects the localization of CTNNB1 protein] | 30125549 |
D000077209 | Decitabine | CTNNB1 protein results in decreased susceptibility to Decitabine | 19234609 |
D000077209 | Decitabine | Decitabine affects the localization of CTNNB1 protein | 19387464; 30125549; |
D000077209 | Decitabine | Decitabine inhibits the reaction [bisphenol A results in decreased expression of CTNNB1 protein] | 30303745 |
D000077209 | Decitabine | Decitabine results in decreased localization of CTNNB1 protein | 21515334 |
D000077209 | Decitabine | Decitabine results in increased expression of CTNNB1 protein | 19234609 |
D000077209 | Decitabine | Decitabine results in decreased expression of CTNNB1 mRNA | 19222872 |
D003676 | Deferoxamine | Deferoxamine inhibits the reaction [ferumoxides results in increased activity of CTNNB1 protein] | 20338187 |
C107676 | deguelin | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [deguelin results in decreased expression of CTNNB1 protein] | 21472727 |
C107676 | deguelin | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [deguelin results in increased degradation of CTNNB1 protein] | 21472727 |
C107676 | deguelin | deguelin promotes the reaction [CTNNB1 protein binds to CDH1 protein] | 22986522 |
C107676 | deguelin | deguelin results in decreased expression of CTNNB1 protein | 21472727 |
C107676 | deguelin | deguelin results in increased degradation of CTNNB1 protein | 21472727 |
C107676 | deguelin | [deguelin results in increased degradation of CTNNB1 protein] which results in decreased expression of CCND1 protein | 21472727 |
C107676 | deguelin | [deguelin results in increased degradation of CTNNB1 protein] which results in decreased expression of MYC protein | 21472727 |
C573784 | dehydroeffusol | dehydroeffusol results in decreased expression of CTNNB1 mRNA | 25982451 |
C573784 | dehydroeffusol | dehydroeffusol results in decreased expression of CTNNB1 protein | 25982451 |
D003703 | Demecolcine | Demecolcine results in increased expression of CTNNB1 mRNA | 23649840 |
C007262 | deoxynivalenol | deoxynivalenol affects the phosphorylation of CTNNB1 protein | 23811945 |
C007262 | deoxynivalenol | deoxynivalenol results in decreased expression of CTNNB1 protein | 30690062 |
C040424 | destruxin B | destruxin B affects the localization of CTNNB1 protein | 22465936 |
C040424 | destruxin B | destruxin B results in decreased activity of [TCF4 protein co-treated with CTNNB1 protein] | 22465936 |
C040424 | destruxin B | destruxin B results in decreased expression of CTNNB1 protein | 22465936; 24434019; |
C040424 | destruxin B | destruxin B results in decreased expression of CTNNB1 protein modified form | 22465936 |
C040424 | destruxin B | Sorafenib promotes the reaction [destruxin B results in decreased expression of CTNNB1 protein] | 24434019 |
D003907 | Dexamethasone | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of CTNNB1 mRNA | 28628672 |
D003907 | Dexamethasone | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of CTNNB1 mRNA | 28628672 |
D003907 | Dexamethasone | boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein] | 28285642 |
D003907 | Dexamethasone | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of CEBPA protein]] | 28285642 |
D003907 | Dexamethasone | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of FABP4 protein]] | 28285642 |
D003907 | Dexamethasone | CTNNB1 protein promotes the reaction [boric acid inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of PPARG protein]] | 28285642 |
D003907 | Dexamethasone | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of CEBPA protein]] | 28285642 |
D003907 | Dexamethasone | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of FABP4 protein]] | 28285642 |
D003907 | Dexamethasone | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of PPARG protein]] | 28285642 |
D003907 | Dexamethasone | [Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein | 28285642 |
D003907 | Dexamethasone | Dexamethasone results in decreased expression of CTNNB1 protein | 20578217 |
D003907 | Dexamethasone | sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein] | 28285642 |
D003907 | Dexamethasone | [1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS protein] inhibits the reaction [TGFB1 protein results in increased expression of CTNNB1 protein] | 29535048 |
D003907 | Dexamethasone | Dexamethasone affects the localization of CTNNB1 protein | 20501703 |
D003907 | Dexamethasone | Dexamethasone inhibits the reaction [2-amino-4-(3,4-(methylenedioxy)benzylamino)-6-(3-methoxyphenyl)pyrimidine results in increased expression of CTNNB1 mRNA] | 20501703 |
D003907 | Dexamethasone | Dexamethasone results in decreased expression of and results in increased phosphorylation of CTNNB1 protein | 20501703 |
D003907 | Dexamethasone | Dexamethasone results in decreased expression of CTNNB1 mRNA | 20501703 |
D003907 | Dexamethasone | Dexamethasone results in decreased expression of CTNNB1 protein | 18467435 |
D003907 | Dexamethasone | Quercetin promotes the reaction [Dexamethasone results in decreased expression of CTNNB1 mRNA] | 20501703 |
D003907 | Dexamethasone | Quercetin promotes the reaction [Dexamethasone results in decreased expression of CTNNB1 protein] | 20501703 |
D003907 | Dexamethasone | 2,2-bis(4-glycidyloxyphenyl)propane promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
D003907 | Dexamethasone | [beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA | 30481989 |
D003907 | Dexamethasone | Troglitazone promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
D003907 | Dexamethasone | 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA]] | 11751460 |
D003907 | Dexamethasone | [[2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with [Dexamethasone co-treated with INS protein co-treated with PRL protein]] results in increased activity of STAT5A protein] which results in increased expression of CTNNB1 mRNA | 11751460 |
D003907 | Dexamethasone | [[2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with [Dexamethasone co-treated with INS protein co-treated with PRL protein]] results in increased expression of STAT5A protein modified form] which results in increased expression of CTNNB1 mRNA | 11751460 |
D003907 | Dexamethasone | 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA] | 11751460 |
D003907 | Dexamethasone | [alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine promotes the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA]] | 11751460 |
D003907 | Dexamethasone | [alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA] | 11751460 |
D003907 | Dexamethasone | [Dexamethasone co-treated with INS protein co-treated with PRL protein] results in increased expression of CTNNB1 mRNA | 11751460 |
D016264 | Dextran Sulfate | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dextran Sulfate] results in increased expression of CTNNB1 protein | 15459021 |
D016264 | Dextran Sulfate | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dextran Sulfate] results in increased mutagenesis of CTNNB1 gene | 15459021 |
D016264 | Dextran Sulfate | CTNNB1 gene mutant form results in increased susceptibility to [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dextran Sulfate] | 27664423 |
D016264 | Dextran Sulfate | Dextran Sulfate results in increased expression of CTNNB1 protein | 16049979 |
C028009 | diallyl disulfide | diallyl disulfide results in decreased phosphorylation of CTNNB1 protein | 23663050 |
C028009 | diallyl disulfide | diallyl disulfide results in increased expression of CTNNB1 mRNA | 20600798 |
C028009 | diallyl disulfide | diallyl disulfide results in increased expression of CTNNB1 protein | 20600798 |
C042577 | diallyl trisulfide | diallyl trisulfide inhibits the reaction [CTNNB1 protein results in decreased expression of CDKN1A protein] | 29626521 |
C042577 | diallyl trisulfide | diallyl trisulfide inhibits the reaction [CTNNB1 protein results in increased expression of ALDH1A1 protein] | 29626521 |
C042577 | diallyl trisulfide | diallyl trisulfide inhibits the reaction [CTNNB1 protein results in increased expression of NANOG protein] | 29626521 |
C042577 | diallyl trisulfide | diallyl trisulfide inhibits the reaction [CTNNB1 protein results in increased expression of PCNA protein] | 29626521 |
C042577 | diallyl trisulfide | diallyl trisulfide inhibits the reaction [CTNNB1 protein results in increased expression of PROM1 protein] | 29626521 |
C042577 | diallyl trisulfide | diallyl trisulfide results in decreased expression of CTNNB1 protein | 29626521 |
C042577 | diallyl trisulfide | diallyl trisulfide results in decreased phosphorylation of CTNNB1 protein | 23663050 |
C042577 | diallyl trisulfide | diallyl trisulfide results in increased cleavage of CTNNB1 protein | 22578287 |
C492519 | diarylpropionitrile | diarylpropionitrile inhibits the reaction [Estrogens deficiency results in decreased expression of CTNNB1 mRNA] | 30565903 |
D003981 | Diazoxide | Diazoxide inhibits the reaction [CTNNB1 protein results in increased activity of CCND1 promoter] | 19052819 |
D003981 | Diazoxide | Diazoxide results in decreased expression of CTNNB1 protein | 19052819 |
D003993 | Dibutyl Phthalate | Dibutyl Phthalate affects the localization of CTNNB1 protein | 22975441 |
D003993 | Dibutyl Phthalate | Dibutyl Phthalate results in increased expression of CTNNB1 protein | 22975441 |
D003993 | Dibutyl Phthalate | Dibutyl Phthalate affects the localization of CTNNB1 protein | 22552774 |
D003993 | Dibutyl Phthalate | HDAC6 mutant form inhibits the reaction [Dibutyl Phthalate affects the localization of CTNNB1 protein] | 22552774 |
D003993 | Dibutyl Phthalate | trichostatin A inhibits the reaction [Dibutyl Phthalate affects the localization of CTNNB1 protein] | 22552774 |
D003993 | Dibutyl Phthalate | Chloroquine inhibits the reaction [Dibutyl Phthalate results in increased expression of CTNNB1 mRNA] | 30053495 |
D003993 | Dibutyl Phthalate | Dibutyl Phthalate results in increased expression of CTNNB1 mRNA | 30053495 |
D003993 | Dibutyl Phthalate | Dibutyl Phthalate results in increased expression of CTNNB1 protein | 30053495 |
D003993 | Dibutyl Phthalate | Sirolimus promotes the reaction [Dibutyl Phthalate results in increased expression of CTNNB1 mRNA] | 30053495 |
D003633 | Dichlorodiphenyl Dichloroethylene | CTNNB1 affects the reaction [Dichlorodiphenyl Dichloroethylene results in increased expression of CCND1 protein] | 25386960 |
D003633 | Dichlorodiphenyl Dichloroethylene | CTNNB1 affects the reaction [Dichlorodiphenyl Dichloroethylene results in increased expression of MYC protein] | 25386960 |
D003633 | Dichlorodiphenyl Dichloroethylene | Dichlorodiphenyl Dichloroethylene affects the activity of CTNNB1 protein | 25386960 |
D003633 | Dichlorodiphenyl Dichloroethylene | Dichlorodiphenyl Dichloroethylene results in increased activity of CTNNB1 protein | 27589886 |
D004008 | Diclofenac | Diclofenac affects the expression of CTNNB1 mRNA | 24752500 |
C000944 | dicrotophos | dicrotophos results in decreased expression of CTNNB1 mRNA | 28302478 |
C036042 | dicyclohexyl phthalate | dicyclohexyl phthalate affects the expression of CTNNB1 mRNA | 26924002 |
D004041 | Dietary Fats | Dietary Fats results in increased expression of CTNNB1 mRNA | 19030233 |
D004041 | Dietary Fats | [Diethylnitrosamine co-treated with Dietary Fats] results in increased expression of and results in increased phosphorylation of CTNNB1 protein | 30826251 |
D004041 | Dietary Fats | [Diethylnitrosamine promotes the reaction [TGFB1 protein affects the susceptibility to Dietary Fats]] which results in increased expression of CTNNB1 protein | 30826251 |
D004041 | Dietary Fats | [TGFB1 protein affects the susceptibility to Dietary Fats] which results in increased expression of CTNNB1 protein | 30826251 |
D004041 | Dietary Fats | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] affects the localization of CTNNB1 protein | 18616682 |
D004041 | Dietary Fats | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased expression of CTNNB1 mRNA | 18283038; 18616682; |
D004041 | Dietary Fats | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased expression of CTNNB1 protein | 11756241; 18283038; 18616682; |
D004041 | Dietary Fats | [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased mutagenesis of CTNNB1 gene | 11756241 |
D004051 | Diethylhexyl Phthalate | Diethylhexyl Phthalate results in increased expression of CTNNB1 protein | 30944277 |
D004051 | Diethylhexyl Phthalate | Diethylhexyl Phthalate affects the localization of CTNNB1 protein | 20307648 |
D004051 | Diethylhexyl Phthalate | Diethylhexyl Phthalate results in increased expression of CTNNB1 mRNA | 26219507; 27495896; |
D004051 | Diethylhexyl Phthalate | [Ascorbic Acid co-treated with Vitamin E] inhibits the reaction [Diethylhexyl Phthalate results in increased expression of and affects the localization of CTNNB1 protein] | 29940330 |
D004051 | Diethylhexyl Phthalate | Diethylhexyl Phthalate results in increased expression of and affects the localization of CTNNB1 protein | 29940330 |
D004052 | Diethylnitrosamine | Diethylnitrosamine results in increased expression of CTNNB1 protein | 18978308 |
D004052 | Diethylnitrosamine | CTNNB1 protein inhibits the reaction [Diethylnitrosamine results in increased expression of MYC protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein inhibits the reaction [Diethylnitrosamine results in increased expression of PTGS2 protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein inhibits the reaction [Diethylnitrosamine results in increased phosphorylation of AKT1 protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein inhibits the reaction [Diethylnitrosamine results in increased phosphorylation of GSK3B protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein inhibits the reaction [Diethylnitrosamine results in increased phosphorylation of PDK1 protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in decreased expression of EGFR protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in decreased expression of HGFAC protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in decreased expression of HGF protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in decreased expression of MET protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in increased expression of CCND1 protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in increased expression of FAS protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in increased expression of NFKB1 protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in increased expression of NFKBIA protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in increased expression of RELA protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein promotes the reaction [Diethylnitrosamine results in increased expression of TRAF1 protein] | 20583210 |
D004052 | Diethylnitrosamine | CTNNB1 protein results in decreased susceptibility to Diethylnitrosamine | 20583210 |
D004052 | Diethylnitrosamine | [Diethylnitrosamine co-treated with Dietary Fats] results in increased expression of and results in increased phosphorylation of CTNNB1 protein | 30826251 |
D004052 | Diethylnitrosamine | [Diethylnitrosamine co-treated with Phenobarbital] results in increased mutagenesis of CTNNB1 gene | 24535843 |
D004052 | Diethylnitrosamine | [Diethylnitrosamine promotes the reaction [TGFB1 protein affects the susceptibility to Dietary Fats]] which results in increased expression of CTNNB1 protein | 30826251 |
D004052 | Diethylnitrosamine | Diethylnitrosamine results in increased expression of CTNNB1 mRNA | 27058323 |
D004052 | Diethylnitrosamine | Diethylnitrosamine results in increased expression of CTNNB1 protein | 20583210; 27058323; |
D004052 | Diethylnitrosamine | epigallocatechin gallate inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 mRNA] | 27058323 |
D004052 | Diethylnitrosamine | epigallocatechin gallate inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 protein] | 27058323 |
D004052 | Diethylnitrosamine | [Phenobarbital co-treated with Diethylnitrosamine] results in increased mutagenesis of CTNNB1 gene | 21047994 |
D004052 | Diethylnitrosamine | theaflavin inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 mRNA] | 27058323 |
D004052 | Diethylnitrosamine | theaflavin inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 protein] | 27058323 |
D004052 | Diethylnitrosamine | 5,7-dimethoxyflavone inhibits the reaction [Diethylnitrosamine affects the localization of CTNNB1 protein modified form] | 21554863 |
D004052 | Diethylnitrosamine | 5,7-dimethoxyflavone inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 mRNA] | 21554863 |
D004052 | Diethylnitrosamine | Diethylnitrosamine affects the localization of CTNNB1 protein modified form | 21554863 |
D004052 | Diethylnitrosamine | Diethylnitrosamine results in increased expression of CTNNB1 mRNA | 21554863 |
D004052 | Diethylnitrosamine | Diethylnitrosamine results in increased mutagenesis of CTNNB1 | 10463579 |
D004054 | Diethylstilbestrol | Diethylstilbestrol results in increased expression of CTNNB1 protein | 16439099 |
D004054 | Diethylstilbestrol | Diethylstilbestrol results in increased expression of CTNNB1 mRNA | 14648872 |
D004054 | Diethylstilbestrol | Diethylstilbestrol results in decreased expression of CTNNB1 protein | 26911934 |
D004127 | Dimethylhydrazines | [Cromolyn Sodium co-treated with Chitosan] inhibits the reaction [Dimethylhydrazines results in increased expression of CTNNB1 protein] | 28732690 |
D004127 | Dimethylhydrazines | Dimethylhydrazines results in increased expression of CTNNB1 protein | 28732690 |
D004128 | Dimethylnitrosamine | Dimethylnitrosamine results in increased expression of CTNNB1 mRNA | 23197195 |
C024629 | dimethyl phthalate | dimethyl phthalate affects the expression of CTNNB1 mRNA | 26924002 |
D004121 | Dimethyl Sulfoxide | Dimethyl Sulfoxide results in increased expression of CTNNB1 protein | 20091315 |
D015232 | Dinoprostone | cryptotanshinone inhibits the reaction [Dinoprostone results in increased expression of CTNNB1 protein] | 30208247 |
D015232 | Dinoprostone | Dinoprostone results in increased expression of CTNNB1 protein | 30208247 |
D015232 | Dinoprostone | Dinoprostone results in increased localization of CTNNB1 protein | 18395713 |
C019357 | dioscin | dioscin results in increased expression of CTNNB1 protein | 24742230 |
C019357 | dioscin | dioscin results in increased expression of CTNNB1 mRNA | 24742230 |
C019357 | dioscin | Fulvestrant inhibits the reaction [dioscin results in increased expression of CTNNB1 mRNA] | 24742230 |
D004144 | Diosgenin | Diosgenin results in decreased expression of CTNNB1 mRNA | 26408789 |
D004237 | Diuron | Diuron results in increased expression of CTNNB1 mRNA | 21551480 |
D016291 | Dizocilpine Maleate | Dizocilpine Maleate results in decreased expression of CTNNB1 mRNA | 31563592 |
D016291 | Dizocilpine Maleate | Famotidine inhibits the reaction [Dizocilpine Maleate results in decreased expression of CTNNB1 mRNA] | 31563592 |
D016291 | Dizocilpine Maleate | Olanzapine inhibits the reaction [Dizocilpine Maleate results in decreased expression of CTNNB1 mRNA] | 31563592 |
C516138 | dorsomorphin | [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
C516138 | dorsomorphin | [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
C516138 | dorsomorphin | [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
D004317 | Doxorubicin | Doxorubicin results in decreased phosphorylation of CTNNB1 protein | 23956100 |
D004317 | Doxorubicin | Doxorubicin results in increased expression of CTNNB1 mRNA | 29803840 |
D004317 | Doxorubicin | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Doxorubicin | 19047049 |
D004317 | Doxorubicin | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein] | 19047049 |
D004317 | Doxorubicin | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein] | 19047049 |
D004317 | Doxorubicin | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Doxorubicin] | 19047049 |
D004317 | Doxorubicin | CTNNB1 gene mutant form results in decreased susceptibility to Doxorubicin | 20237062 |
D004317 | Doxorubicin | Doxorubicin results in increased expression of CTNNB1 protein | 20237062 |
D004317 | Doxorubicin | Caffeine inhibits the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D004317 | Doxorubicin | Doxorubicin results in decreased expression of CTNNB1 protein | 30377735 |
D004317 | Doxorubicin | Heparin promotes the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D004317 | Doxorubicin | Lithium Chloride inhibits the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D004317 | Doxorubicin | Lithium Chloride inhibits the reaction [Heparin promotes the reaction [Doxorubicin results in decreased expression of CTNNB1 protein]] | 30377735 |
D004317 | Doxorubicin | SFRP1 protein affects the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D060766 | Drinking Water | Drinking Water results in decreased expression of CTNNB1 mRNA | 19444861 |
D004365 | Drugs, Chinese Herbal | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Drugs, Chinese Herbal results in decreased expression of CTNNB1 protein] | 28548306 |
D004365 | Drugs, Chinese Herbal | Drugs, Chinese Herbal results in decreased expression of CTNNB1 protein | 28548306 |
D004365 | Drugs, Chinese Herbal | PPP2CA protein affects the reaction [Drugs, Chinese Herbal results in decreased expression of CTNNB1 protein] | 28548306 |
D004365 | Drugs, Chinese Herbal | Drugs, Chinese Herbal affects the cleavage of CTNNB1 protein | 23262642 |
D004365 | Drugs, Chinese Herbal | Drugs, Chinese Herbal results in decreased expression of CTNNB1 mRNA | 29148169 |
D004365 | Drugs, Chinese Herbal | Drugs, Chinese Herbal results in increased mutagenesis of CTNNB1 gene | 23262642 |
C060311 | eckol | eckol results in decreased expression of CTNNB1 protein | 21514314 |
D004726 | Endosulfan | Endosulfan inhibits the reaction [CDH1 protein binds to CTNNB1 protein] | 22902829 |
D004726 | Endosulfan | Endosulfan results in decreased expression of CTNNB1 protein | 28108160 |
D004726 | Endosulfan | Endosulfan results in increased expression of and affects the localization of CTNNB1 protein | 22677888 |
D004726 | Endosulfan | Endosulfan affects the expression of CTNNB1 protein | 26911934 |
C045651 | epigallocatechin gallate | epigallocatechin gallate results in decreased expression of CTNNB1 mRNA | 16968065 |
C045651 | epigallocatechin gallate | epigallocatechin gallate results in decreased expression of CTNNB1 protein | 16968065 |
C045651 | epigallocatechin gallate | epigallocatechin gallate results in decreased localization of CTNNB1 protein | 16968065 |
C045651 | epigallocatechin gallate | epigallocatechin gallate results in decreased phosphorylation of CTNNB1 protein | 16968065 |
C045651 | epigallocatechin gallate | epigallocatechin gallate inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 mRNA] | 27058323 |
C045651 | epigallocatechin gallate | epigallocatechin gallate inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 protein] | 27058323 |
C045651 | epigallocatechin gallate | epigallocatechin gallate results in decreased expression of CTNNB1 protein | 12351151 |
C045651 | epigallocatechin gallate | epigallocatechin gallate promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein]] | 29999212 |
D004837 | Epinephrine | Epinephrine results in increased phosphorylation of CTNNB1 protein | 26964897 |
D004837 | Epinephrine | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Epinephrine results in increased phosphorylation of CTNNB1 protein] | 26964897 |
D004837 | Epinephrine | Niclosamide inhibits the reaction [Epinephrine results in increased phosphorylation of CTNNB1 protein] | 26964897 |
D000069347 | Erlotinib Hydrochloride | [betulinic acid co-treated with Erlotinib Hydrochloride] results in decreased expression of CTNNB1 protein | 30136359 |
D000069347 | Erlotinib Hydrochloride | Erlotinib Hydrochloride results in decreased expression of CTNNB1 protein | 30136359 |
D004958 | Estradiol | Estradiol inhibits the reaction [ESR1 protein promotes the reaction [BTRC protein binds to CTNNB1 protein]] | 26990689 |
D004958 | Estradiol | Estradiol promotes the reaction [CTNNB1 protein binds to ESR1 protein] | 27156127 |
D004958 | Estradiol | Estradiol promotes the reaction [ESR1 protein binds to CTNNB1 promoter] | 26990689 |
D004958 | Estradiol | Estradiol results in increased expression of and affects the localization of CTNNB1 protein | 16053526 |
D004958 | Estradiol | Melatonin inhibits the reaction [Estradiol promotes the reaction [ESR1 protein binds to CTNNB1 promoter]] | 26990689 |
D004958 | Estradiol | [Bromocriptine co-treated with Estradiol] results in decreased expression of CTNNB1 protein | 11786374 |
D004958 | Estradiol | Estradiol results in increased expression of and affects the localization of CTNNB1 protein | 23684557 |
D004958 | Estradiol | Estradiol results in increased expression of CTNNB1 mRNA | 14648872 |
D004958 | Estradiol | Estradiol affects the localization of CTNNB1 protein | 17170212 |
D004958 | Estradiol | [Estradiol co-treated with bisphenol A] results in decreased expression of CTNNB1 mRNA | 27174447 |
D004958 | Estradiol | Estradiol inhibits the reaction [Estrogens deficiency results in increased expression of CTNNB1 protein alternative form] | 30565903 |
D004958 | Estradiol | Estradiol promotes the reaction [CTNNB1 protein binds to LEF1 protein] | 17170212 |
C023482 | estradiol dipropionate | [estradiol dipropionate co-treated with Butyrates] results in decreased expression of CTNNB1 protein | 15930180 |
C023482 | estradiol dipropionate | [estradiol dipropionate co-treated with trichostatin A] results in decreased expression of CTNNB1 protein | 15930180 |
D004967 | Estrogens | diarylpropionitrile inhibits the reaction [Estrogens deficiency results in decreased expression of CTNNB1 mRNA] | 30565903 |
D004967 | Estrogens | Estradiol inhibits the reaction [Estrogens deficiency results in increased expression of CTNNB1 protein alternative form] | 30565903 |
D004967 | Estrogens | Estrogens deficiency results in decreased expression of CTNNB1 mRNA | 30565903 |
D000431 | Ethanol | CTNNB1 gene mutant form affects the susceptibility to Ethanol | 25822088 |
D000431 | Ethanol | Ethanol affects the localization of CTNNB1 protein | 30567741 |
D000431 | Ethanol | Ethanol results in increased expression of and affects the localization of CTNNB1 protein | 26014148 |
D000431 | Ethanol | Ethanol results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 30567741 |
D000431 | Ethanol | PPP2CA protein affects the reaction [Ethanol affects the localization of CTNNB1 protein] | 30567741 |
D000431 | Ethanol | PPP2CA protein affects the reaction [Ethanol results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
D000431 | Ethanol | PPP2R5A protein affects the reaction [Ethanol affects the localization of CTNNB1 protein] | 30567741 |
D000431 | Ethanol | PPP2R5A protein affects the reaction [Ethanol results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
D000431 | Ethanol | Ethanol affects the expression of and affects the splicing of CTNNB1 mRNA | 30319688 |
D004997 | Ethinyl Estradiol | [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CTNNB1 mRNA | 17942748 |
D004997 | Ethinyl Estradiol | Ethinyl Estradiol results in increased expression of CTNNB1 mRNA | 23129252 |
D005013 | Ethosuximide | DKK1 protein inhibits the reaction [Ethosuximide results in decreased phosphorylation of CTNNB1 protein] | 26420483 |
D005013 | Ethosuximide | Ethosuximide inhibits the reaction [APP protein modified form results in decreased expression of CTNNB1 mRNA] | 26420483 |
D005013 | Ethosuximide | Ethosuximide results in decreased phosphorylation of CTNNB1 protein | 26420483 |
D005013 | Ethosuximide | Ethosuximide results in increased expression of CTNNB1 mRNA | 26420483 |
D005047 | Etoposide | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Etoposide | 19047049 |
D005047 | Etoposide | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein] | 19047049 |
D005047 | Etoposide | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein] | 19047049 |
D005047 | Etoposide | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Etoposide] | 19047049 |
D018683 | Excitatory Amino Acid Agents | CTNNB1 protein promotes the reaction [Resveratrol results in decreased susceptibility to Excitatory Amino Acid Agents] | 20542495 |
D018683 | Excitatory Amino Acid Agents | [Resveratrol co-treated with Excitatory Amino Acid Agents] results in increased stability of CTNNB1 protein | 20542495 |
D015738 | Famotidine | Famotidine inhibits the reaction [Dizocilpine Maleate results in decreased expression of CTNNB1 mRNA] | 31563592 |
D015738 | Famotidine | Famotidine results in increased expression of CTNNB1 mRNA | 31563592 |
C065507 | ferumoxides | Deferoxamine inhibits the reaction [ferumoxides results in increased activity of CTNNB1 protein] | 20338187 |
C065507 | ferumoxides | ferumoxides results in increased activity of CTNNB1 protein | 20338187 |
C575430 | FH535 | FH535 inhibits the reaction [Cadmium results in increased expression of and results in increased activity of CTNNB1 protein] | 22884995 |
C017875 | fisetin | fisetin results in decreased expression of CTNNB1 protein | 30802432 |
D005411 | Flame Retardants | Flame Retardants inhibits the reaction [CTNNB1 protein modified form binds to CDH1 protein] | 28903489 |
D005411 | Flame Retardants | Flame Retardants results in decreased expression of CTNNB1 protein | 31241157 |
D005411 | Flame Retardants | Flame Retardants results in decreased phosphorylation of CTNNB1 protein | 28903489 |
D005419 | Flavonoids | DKK1 protein inhibits the reaction [Flavonoids results in increased expression of CTNNB1 mRNA] | 23238999 |
D005419 | Flavonoids | Flavonoids results in increased expression of CTNNB1 mRNA | 23238999 |
C492470 | fluor-edenite | fluor-edenite results in decreased expression of CTNNB1 protein | 17695086 |
C041509 | fluorene | fluorene affects the localization of CTNNB1 protein | 22975441 |
C041509 | fluorene | fluorene results in increased expression of CTNNB1 protein | 22975441 |
D005473 | Fluoxetine | [Fluoxetine co-treated with Ketanserin] results in increased expression of CTNNB1 mRNA | 21627639 |
D005473 | Fluoxetine | Fluoxetine inhibits the reaction [Monocrotaline results in decreased expression of CTNNB1 protein] | 21619414 |
D005485 | Flutamide | Flutamide analog affects the localization of CTNNB1 protein | 21111724 |
D005492 | Folic Acid | Folic Acid affects the expression of CTNNB1 mRNA | 16361273 |
D005492 | Folic Acid | [Folic Acid co-treated with sodium arsenite] results in increased methylation of CTNNB1 mRNA | 22959928 |
D005557 | Formaldehyde | Formaldehyde results in decreased expression of CTNNB1 mRNA | 23649840 |
C572629 | FPS-ZM1 | FPS-ZM1 inhibits the reaction [Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein] | 30261222 |
C572629 | FPS-ZM1 | FPS-ZM1 inhibits the reaction [Toluene 2,4-Diisocyanate affects the localization of CTNNB1 protein] | 30261222 |
C069837 | fullerene C60 | fullerene C60 results in increased expression of CTNNB1 mRNA | 19167457 |
D000077267 | Fulvestrant | Fulvestrant inhibits the reaction [dioscin results in increased expression of CTNNB1 mRNA] | 24742230 |
C056933 | fumonisin B1 | fumonisin B1 results in increased expression of CTNNB1 mRNA | 16221962 |
C001277 | geldanamycin | geldanamycin promotes the reaction [CDH1 protein binds to CTNNB1 protein] | 17024233 |
C001277 | geldanamycin | IL24 protein promotes the reaction [geldanamycin promotes the reaction [CDH1 protein binds to CTNNB1 protein]] | 17024233 |
C056507 | gemcitabine | gemcitabine results in increased expression of CTNNB1 mRNA | 25605917 |
D019833 | Genistein | [Genistein co-treated with Methoxychlor] results in increased expression of CTNNB1 protein | 16443925 |
D005839 | Gentamicins | Gentamicins results in increased expression of CTNNB1 mRNA | 22061828 |
C007836 | geraniol | geraniol inhibits the reaction [Methylnitronitrosoguanidine results in increased expression of CTNNB1 mRNA] | 28428697 |
C007836 | geraniol | geraniol inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 mRNA] | 26165751 |
C007836 | geraniol | geraniol inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 protein] | 26165751 |
C102521 | GGTI 298 | GGTI 298 inhibits the reaction [Hydrocortisone results in increased localization of CTNNB1 protein] | 25763180 |
C007845 | gingerol | gingerol affects the localization of CTNNB1 protein | 18058799 |
C007845 | gingerol | gingerol promotes the reaction [IL1B protein results in increased expression of CTNNB1 protein] | 27645308 |
C007845 | gingerol | gingerol results in increased expression of and affects the localization of CTNNB1 protein | 26498061 |
C007845 | gingerol | gingerol results in increased expression of CTNNB1 mRNA | 26498061 |
D005947 | Glucose | DKK1 protein inhibits the reaction [Glucose results in increased expression of CTNNB1 mRNA] | 29163160 |
D005947 | Glucose | DKK1 protein inhibits the reaction [Glucose results in increased expression of CTNNB1 protein] | 29163160 |
D005947 | Glucose | Glucose results in increased expression of CTNNB1 mRNA | 29163160 |
D005947 | Glucose | Glucose results in increased expression of CTNNB1 protein | 29163160 |
D005947 | Glucose | Glucose results in decreased expression of CTNNB1 mRNA | 21818840 |
D005947 | Glucose | Glucose results in decreased expression of CTNNB1 protein | 18004065 |
D005947 | Glucose | Simvastatin inhibits the reaction [Glucose results in decreased expression of CTNNB1 protein] | 18004065 |
D005947 | Glucose | [INS protein co-treated with Glucose] results in decreased expression of CTNNB1 mRNA | 22634610 |
C010974 | glyphosate | glyphosate results in increased expression of CTNNB1 protein | 28780397 |
C000628859 | GSK2193874 | GSK2193874 inhibits the reaction [Toluene 2,4-Diisocyanate results in increased phosphorylation of and results in increased activity of and affects the localization of CTNNB1 protein] | 30517707 |
D006220 | Haloperidol | Haloperidol results in decreased expression of CTNNB1 mRNA | 18797397 |
D006220 | Haloperidol | DRD2 protein affects the reaction [Haloperidol results in increased expression of CTNNB1 protein] | 16144542 |
D006220 | Haloperidol | Haloperidol results in increased expression of CTNNB1 protein | 16144542 |
D006493 | Heparin | Heparin promotes the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D006493 | Heparin | Lithium Chloride inhibits the reaction [Heparin promotes the reaction [Doxorubicin results in decreased expression of CTNNB1 protein]] | 30377735 |
D006533 | Heptachlor | Heptachlor inhibits the reaction [CDH1 protein binds to CTNNB1 protein] | 22902829 |
D006533 | Heptachlor | Heptachlor results in increased expression of CTNNB1 protein | 22902829 |
D006575 | Heterocyclic Compounds, 3-Ring | Heterocyclic Compounds, 3-Ring inhibits the reaction [EP300 protein binds to CTNNB1 protein] | 26833564 |
D006582 | Hexachlorophene | Hexachlorophene inhibits the reaction [Lithium Chloride results in increased expression of CTNNB1 protein] | 16735606 |
D006582 | Hexachlorophene | Hexachlorophene inhibits the reaction [WNT3A protein results in increased expression of CTNNB1 protein] | 16735606 |
D006582 | Hexachlorophene | Hexachlorophene results in increased degradation of CTNNB1 protein | 16735606 |
D006582 | Hexachlorophene | SIAH1 protein promotes the reaction [Hexachlorophene results in increased degradation of CTNNB1 protein] | 16735606 |
D006820 | Hyaluronic Acid | [[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein | 19047049 |
D006820 | Hyaluronic Acid | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Doxorubicin | 19047049 |
D006820 | Hyaluronic Acid | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Etoposide | 19047049 |
D006820 | Hyaluronic Acid | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 mRNA | 19047049 |
D006820 | Hyaluronic Acid | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein | 19047049 |
D006820 | Hyaluronic Acid | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein] | 19047049 |
D006820 | Hyaluronic Acid | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein] | 19047049 |
D006820 | Hyaluronic Acid | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 mRNA | 19047049 |
D006820 | Hyaluronic Acid | [[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein | 19047049 |
D006820 | Hyaluronic Acid | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein] | 19047049 |
D006820 | Hyaluronic Acid | [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein] | 19047049 |
D006820 | Hyaluronic Acid | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Doxorubicin] | 19047049 |
D006820 | Hyaluronic Acid | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Etoposide] | 19047049 |
D006820 | Hyaluronic Acid | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 mRNA] | 19047049 |
D006820 | Hyaluronic Acid | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] | 19047049 |
D006820 | Hyaluronic Acid | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 mRNA] | 19047049 |
D006820 | Hyaluronic Acid | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] | 19047049 |
D006843 | Hydrocarbons, Chlorinated | Hydrocarbons, Chlorinated analog results in increased expression of CTNNB1 protein | 24355586 |
D006854 | Hydrocortisone | GGTI 298 inhibits the reaction [Hydrocortisone results in increased localization of CTNNB1 protein] | 25763180 |
D006854 | Hydrocortisone | Hydrocortisone results in increased localization of CTNNB1 protein | 25763180 |
D006861 | Hydrogen Peroxide | Hydrogen Peroxide inhibits the reaction [CDH5 protein binds to CTNNB1 protein] | 24211779 |
D006861 | Hydrogen Peroxide | Hydrogen Peroxide results in decreased expression of CTNNB1 mRNA | 12419474 |
D006861 | Hydrogen Peroxide | Hydrogen Peroxide results in decreased expression of CTNNB1 protein | 26482937 |
D006861 | Hydrogen Peroxide | naringin inhibits the reaction [Hydrogen Peroxide results in decreased expression of CTNNB1 protein] | 26482937 |
D006861 | Hydrogen Peroxide | Hydrogen Peroxide results in decreased expression of CTNNB1 protein | 16204253 |
D006861 | Hydrogen Peroxide | pirinixic acid inhibits the reaction [Hydrogen Peroxide results in decreased expression of CTNNB1 protein] | 16204253 |
D006861 | Hydrogen Peroxide | pirinixic acid inhibits the reaction [Hydrogen Peroxide results in decreased stability of CTNNB1 protein] | 16204253 |
C031927 | hydroquinone | hydroquinone affects the localization of CTNNB1 protein | 30567741 |
C031927 | hydroquinone | hydroquinone inhibits the reaction [CTNNB1 protein binds to LEF1 protein] | 28886972 |
C031927 | hydroquinone | hydroquinone results in decreased expression of CTNNB1 protein | 28886972 |
C031927 | hydroquinone | hydroquinone results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 30567741 |
C031927 | hydroquinone | IGF1 protein inhibits the reaction [hydroquinone results in decreased expression of CTNNB1 protein] | 28886972 |
C031927 | hydroquinone | Lithium Chloride inhibits the reaction [hydroquinone results in decreased expression of CTNNB1 protein] | 28886972 |
C031927 | hydroquinone | PPP2CA protein affects the reaction [hydroquinone affects the localization of CTNNB1 protein] | 30567741 |
C031927 | hydroquinone | PPP2CA protein affects the reaction [hydroquinone results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
C031927 | hydroquinone | PPP2R5A protein affects the reaction [hydroquinone affects the localization of CTNNB1 protein] | 30567741 |
C031927 | hydroquinone | PPP2R5A protein affects the reaction [hydroquinone results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30567741 |
C014290 | hydroxyflutamide | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide inhibits the reaction [hydroxyflutamide results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
C014290 | hydroxyflutamide | hydroxyflutamide results in decreased phosphorylation of CTNNB1 protein | 28163245 |
C014290 | hydroxyflutamide | Wortmannin inhibits the reaction [hydroxyflutamide results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
C499403 | icaritin | icaritin inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in decreased expression of and affects the localization of CTNNB1 protein] | 30731080 |
C499403 | icaritin | icaritin inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in decreased expression of CTNNB1 mRNA] | 30731080 |
C499403 | icaritin | icaritin results in increased expression of CTNNB1 mRNA | 30731080 |
C499403 | icaritin | icaritin results in increased expression of CTNNB1 protein | 30731080 |
C492448 | ICG 001 | ICG 001 inhibits the reaction [AGT protein affects the localization of CTNNB1 protein] | 28578904 |
C492448 | ICG 001 | ICG 001 inhibits the reaction [AGT protein results in increased expression of and results in increased activity of CTNNB1 protein] | 28578904 |
C492448 | ICG 001 | ICG 001 inhibits the reaction [AGT protein results in increased expression of CTNNB1 mRNA] | 28578904 |
D000068877 | Imatinib Mesylate | Imatinib Mesylate promotes the reaction [Niclosamide results in decreased expression of CTNNB1 protein] | 27492973 |
D000068877 | Imatinib Mesylate | Imatinib Mesylate results in decreased expression of CTNNB1 protein | 27492973 |
D000068877 | Imatinib Mesylate | Niclosamide promotes the reaction [Imatinib Mesylate results in decreased expression of CTNNB1 protein] | 27492973 |
C082359 | imidacloprid | imidacloprid results in decreased expression of CTNNB1 mRNA | 27792329 |
D007155 | Immunologic Factors | acetylleucyl-leucyl-norleucinal inhibits the reaction [Immunologic Factors results in decreased expression of CTNNB1 protein] | 29974605 |
D007155 | Immunologic Factors | CTNNB1 protein inhibits the reaction [Immunologic Factors results in increased expression of CASP7 protein modified form] | 29974605 |
D007155 | Immunologic Factors | Immunologic Factors results in decreased expression of CTNNB1 protein | 29974605 |
D007155 | Immunologic Factors | SB 216763 inhibits the reaction [Immunologic Factors results in decreased expression of CTNNB1 protein] | 29974605 |
D007213 | Indomethacin | Indomethacin affects the localization of CTNNB1 protein | 15963497 |
D007213 | Indomethacin | Indomethacin inhibits the reaction [[CTNNB1 protein binds to TCF7L2 protein] which binds to CCND1 promoter] | 11756231 |
D007213 | Indomethacin | Indomethacin results in decreased expression of CTNNB1 mRNA | 11756231 |
D007213 | Indomethacin | Indomethacin results in decreased expression of CTNNB1 protein | 11756231; 15188006; |
D007213 | Indomethacin | Indomethacin results in increased phosphorylation of CTNNB1 protein | 12813129 |
D007213 | Indomethacin | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of CTNNB1 mRNA | 28628672 |
D007213 | Indomethacin | [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of CTNNB1 mRNA | 28628672 |
D007213 | Indomethacin | lactacystin inhibits the reaction [Indomethacin results in decreased expression of CTNNB1 protein] | 11756231 |
D007213 | Indomethacin | Lithium Chloride inhibits the reaction [Indomethacin results in increased phosphorylation of CTNNB1 protein] | 12813129 |
D007213 | Indomethacin | 1-(4-chlorobenzoyl)-5-methoxy-2-1H-indole-3-acetic acid 3-(nitrooxymethyl)phenyl ester inhibits the reaction [Indomethacin results in increased expression of CTNNB1 protein] | 16818512 |
D007213 | Indomethacin | Indomethacin results in increased expression of CTNNB1 protein | 16818512 |
D007213 | Indomethacin | nitroaspirin inhibits the reaction [Indomethacin results in increased expression of CTNNB1 protein] | 16818512 |
C016527 | isoquercitrin | isoquercitrin affects the expression of CTNNB1 mRNA | 30597948 |
C585534 | IWR-1 compound | IWR-1 compound results in decreased activity of CTNNB1 protein | 27477297 |
C585534 | IWR-1 compound | [IWR-1 compound results in decreased activity of CTNNB1 protein] which results in decreased expression of ACTA2 mRNA | 27477297 |
C585534 | IWR-1 compound | [IWR-1 compound results in decreased activity of CTNNB1 protein] which results in decreased expression of ACTA2 protein | 27477297 |
C585534 | IWR-1 compound | [IWR-1 compound results in decreased activity of CTNNB1 protein] which results in decreased expression of COL1A1 mRNA | 27477297 |
C585534 | IWR-1 compound | [IWR-1 compound results in decreased activity of CTNNB1 protein] which results in decreased expression of COL1A1 protein | 27477297 |
C585534 | IWR-1 compound | [IWR-1 compound results in decreased activity of CTNNB1 protein] which results in decreased expression of FN1 mRNA | 27477297 |
C585534 | IWR-1 compound | [IWR-1 compound results in decreased activity of CTNNB1 protein] which results in decreased expression of FN1 protein | 27477297 |
C561695 | (+)-JQ1 compound | (+)-JQ1 compound results in decreased expression of CTNNB1 mRNA | 25961927 |
C561695 | (+)-JQ1 compound | (+)-JQ1 compound results in increased expression of CTNNB1 mRNA | 26830473 |
C006552 | kaempferol | kaempferol promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein]] | 29999212 |
C119620 | kenpaullone | kenpaullone affects the localization of CTNNB1 protein | 22975441 |
C119620 | kenpaullone | kenpaullone results in increased expression of CTNNB1 mRNA | 25711857 |
C119620 | kenpaullone | kenpaullone results in increased expression of CTNNB1 protein | 22975441 |
C119620 | kenpaullone | kenpaullone analog affects the localization of CTNNB1 protein | 21111724 |
D007650 | Ketanserin | [Fluoxetine co-treated with Ketanserin] results in increased expression of CTNNB1 mRNA | 21627639 |
C067713 | lactacystin | lactacystin inhibits the reaction [Indomethacin results in decreased expression of CTNNB1 protein] | 11756231 |
C067713 | lactacystin | lactacystin inhibits the reaction [Resveratrol results in increased degradation of CTNNB1 protein] | 26040106 |
D019344 | Lactic Acid | Lactic Acid results in increased expression of CTNNB1 mRNA | 30851411 |
D007854 | Lead | icaritin inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in decreased expression of and affects the localization of CTNNB1 protein] | 30731080 |
D007854 | Lead | icaritin inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in decreased expression of CTNNB1 mRNA] | 30731080 |
D007854 | Lead | [lead nitrate results in increased abundance of Lead] which results in decreased expression of and affects the localization of CTNNB1 protein | 30731080 |
D007854 | Lead | [lead nitrate results in increased abundance of Lead] which results in decreased expression of CTNNB1 mRNA | 30731080 |
D007854 | Lead | Lead results in decreased expression of CTNNB1 mRNA | 23086611 |
D007854 | Lead | Lead results in decreased expression of CTNNB1 protein | 26518054 |
D007854 | Lead | Lead results in decreased expression of CTNNB1 protein | 23086611 |
C008261 | lead acetate | WNT7A protein inhibits the reaction [lead acetate results in increased phosphorylation of CTNNB1 protein] | 24999626 |
C008261 | lead acetate | lead acetate results in increased phosphorylation of CTNNB1 protein | 24999626 |
C017461 | lead nitrate | icaritin inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in decreased expression of and affects the localization of CTNNB1 protein] | 30731080 |
C017461 | lead nitrate | icaritin inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in decreased expression of CTNNB1 mRNA] | 30731080 |
C017461 | lead nitrate | [lead nitrate results in increased abundance of Lead] which results in decreased expression of and affects the localization of CTNNB1 protein | 30731080 |
C017461 | lead nitrate | [lead nitrate results in increased abundance of Lead] which results in decreased expression of CTNNB1 mRNA | 30731080 |
D002955 | Leucovorin | [Methotrexate co-treated with Leucovorin] results in increased expression of CTNNB1 protein | 25187349 |
C032854 | leupeptin | leupeptin inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl results in increased degradation of CTNNB1 protein] | 19464575 |
C586458 | LGK974 | LGK974 inhibits the reaction [Paraquat affects the localization of CTNNB1 protein] | 30205152 |
C586458 | LGK974 | LGK974 inhibits the reaction [Paraquat results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30205152 |
C482199 | lipopolysaccharide, E coli O55-B5 | lipopolysaccharide, E coli O55-B5 results in increased expression of CTNNB1 mRNA | 24972896 |
D008070 | Lipopolysaccharides | Lipopolysaccharides results in increased expression of CTNNB1 protein | 11739494 |
D008094 | Lithium | Lithium results in increased expression of CTNNB1 protein | 19621015 |
D008094 | Lithium | Lithium affects the localization of CTNNB1 protein | 18296634 |
D008094 | Lithium | Lithium inhibits the reaction [Methamphetamine results in increased expression of CTNNB1 mRNA] | 19149911 |
D008094 | Lithium | Lithium results in decreased expression of CTNNB1 mRNA | 12942141 |
D008094 | Lithium | Lithium results in increased expression of and affects the localization of CTNNB1 protein | 16288908 |
D008094 | Lithium | Lithium results in increased expression of CTNNB1 protein | 12942141; 18296634; |
D018021 | Lithium Chloride | Lithium Chloride affects the localization of CTNNB1 protein | 22975441 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of CTNNB1 protein | 22975441 |
D018021 | Lithium Chloride | Arsenic Trioxide inhibits the reaction [Lithium Chloride results in increased expression of CTNNB1 protein] | 28901456 |
D018021 | Lithium Chloride | CTNNB1 protein affects the reaction [[Lithium Chloride results in decreased activity of GSK3B protein] which results in decreased expression of CDH11 protein] | 19274078 |
D018021 | Lithium Chloride | CTNNB1 protein promotes the reaction [Lithium Chloride results in increased expression of POU5F1 mRNA] | 20074550 |
D018021 | Lithium Chloride | CTNNB1 protein promotes the reaction [Lithium Chloride results in increased expression of POU5F1 protein] | 20074550 |
D018021 | Lithium Chloride | Hexachlorophene inhibits the reaction [Lithium Chloride results in increased expression of CTNNB1 protein] | 16735606 |
D018021 | Lithium Chloride | Lithium Chloride affects the localization of CTNNB1 protein | 22493441; 24244343; 24534281; |
D018021 | Lithium Chloride | Lithium Chloride affects the localization of CTNNB1 protein modified form | 22493441 |
D018021 | Lithium Chloride | [Lithium Chloride co-treated with ESR1 protein] results in increased expression of CTNNB1 protein | 26990689 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Aspirin results in increased phosphorylation of CTNNB1 protein] | 12813129 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [hydroquinone results in decreased expression of CTNNB1 protein] | 28886972 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Indomethacin results in increased phosphorylation of CTNNB1 protein] | 12813129 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [quinocetone results in decreased expression of CTNNB1 protein] | 28343033 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Tetrachlorodibenzodioxin results in decreased expression of CTNNB1 protein] | 22134133 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [wogonin results in decreased expression of CTNNB1 protein] | 23872260 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [CTNNB1 protein binds to FGF16 promoter] | 24253043 |
D018021 | Lithium Chloride | [Lithium Chloride results in decreased activity of and results in increased phosphorylation of GSK3B protein] which results in increased expression of and results in increased phosphorylation of CTNNB1 protein | 22493441 |
D018021 | Lithium Chloride | Lithium Chloride results in decreased phosphorylation of CTNNB1 protein | 16076840 |
D018021 | Lithium Chloride | Lithium Chloride results in increased activity of [TCF4 protein co-treated with CTNNB1 protein] | 22935447 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 19228266 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of and results in increased localization of CTNNB1 protein | 19679347; 20074550; |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of and results in increased phosphorylation of CTNNB1 protein | 22493441 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of CTNNB1 mRNA | 20069066 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of CTNNB1 protein | 16053526; 16735606; 20069066; 28886972; 28901456; |
D018021 | Lithium Chloride | Lithium Chloride results in increased localization of and results in increased activity of CTNNB1 protein | 20696143 |
D018021 | Lithium Chloride | MALAT1 protein affects the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24244343 |
D018021 | Lithium Chloride | MALAT1 protein affects the reaction [Resveratrol inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein]] | 24244343 |
D018021 | Lithium Chloride | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 22493441 |
D018021 | Lithium Chloride | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein modified form] | 22493441 |
D018021 | Lithium Chloride | Niclosamide inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24534281 |
D018021 | Lithium Chloride | Resveratrol inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24244343 |
D018021 | Lithium Chloride | Resveratrol inhibits the reaction [Lithium Chloride results in increased activity of [TCF4 protein co-treated with CTNNB1 protein]] | 22935447 |
D018021 | Lithium Chloride | SFRP2 protein affects the reaction [Lithium Chloride results in increased expression of CTNNB1 mRNA] | 20069066 |
D018021 | Lithium Chloride | XAV939 inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24534281 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Paraquat results in decreased expression of CTNNB1 protein] | 30171970 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [perfluorooctane sulfonic acid results in decreased expression of CTNNB1 protein] | 27018151 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [CTNNB1 protein binds to GCG promoter] | 19582394 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [CTNNB1 protein binds to GIP promoter] | 19582394 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [[LEF1 protein co-treated with CTNNB1 protein] binds to GCG promoter] | 19582394 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [[LEF1 protein co-treated with CTNNB1 protein] binds to GIP promoter] | 19582394 |
D018021 | Lithium Chloride | Lithium Chloride results in increased activity of CTNNB1 protein | 19582394; 20118494; |
D018021 | Lithium Chloride | [Lithium Chloride results in increased activity of CTNNB1 protein] which results in increased expression of GSTM3 mRNA | 20118494 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of and affects the localization of CTNNB1 protein | 15364539 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of CTNNB1 mRNA | 27226553 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of CTNNB1 protein | 22935447; 27018151; |
D018021 | Lithium Chloride | Lithium Chloride results in increased localization of CTNNB1 protein | 19442631 |
D018021 | Lithium Chloride | [Lithium Chloride results in increased phosphorylation of and results in decreased activity of GSK3B protein] which results in increased localization of CTNNB1 protein | 19582394 |
D018021 | Lithium Chloride | [[Lithium Chloride results in increased phosphorylation of and results in decreased activity of GSK3B protein] which results in increased localization of CTNNB1 protein] which results in increased expression of GIP mRNA | 19582394 |
D018021 | Lithium Chloride | Lithium Chloride results in increased stability of CTNNB1 protein | 23326414 |
D018021 | Lithium Chloride | CTNNB1 protein affects the reaction [Lithium Chloride results in increased expression of NR4A2 mRNA] | 27045591 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Doxorubicin results in decreased expression of CTNNB1 protein] | 30377735 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Heparin promotes the reaction [Doxorubicin results in decreased expression of CTNNB1 protein]] | 30377735 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [manganese chloride results in decreased expression of CTNNB1 protein] | 24464479 |
D018021 | Lithium Chloride | Lithium Chloride inhibits the reaction [Rotenone results in decreased expression of and results in decreased phosphorylation of CTNNB1 protein] | 27045591 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [CTNNB1 protein binds to NR4A2 promoter] | 27045591 |
D018021 | Lithium Chloride | Lithium Chloride promotes the reaction [CTNNB1 protein binds to NR4A2 protein] | 27045591 |
D018021 | Lithium Chloride | [Lithium Chloride results in decreased activity of GSK3B protein] which results in increased expression of CTNNB1 protein | 18972237 |
D018021 | Lithium Chloride | [[Lithium Chloride results in decreased activity of GSK3B protein] which results in increased expression of CTNNB1 protein] which affects the expression of GJA1 protein | 18972237 |
D018021 | Lithium Chloride | Lithium Chloride results in increased activity of CTNNB1 protein | 20694829 |
D018021 | Lithium Chloride | Lithium Chloride results in increased expression of CTNNB1 mRNA | 27045591 |
D018021 | Lithium Chloride | Lithium Chloride results in decreased expression of CTNNB1 mRNA | 17506889 |
D018021 | Lithium Chloride | [Lithium Chloride results in decreased activity of GSK3B protein] which results in increased expression of CTNNB1 | 23872260 |
D008095 | Lithocholic Acid | [Lithocholic Acid binds to VDR protein] which results in decreased activity of CTNNB1 mRNA | 20043299 |
D019808 | Losartan | Losartan inhibits the reaction [AGT protein affects the localization of CTNNB1 protein] | 28578904 |
D019808 | Losartan | Losartan inhibits the reaction [AGT protein results in increased expression of and results in increased activity of CTNNB1 protein] | 28578904 |
D019808 | Losartan | Losartan inhibits the reaction [AGT protein results in increased expression of CTNNB1 mRNA] | 28578904 |
D019808 | Losartan | Losartan inhibits the reaction [AGT protein results in increased expression of CTNNB1 protein] | 28578904 |
D008148 | Lovastatin | Lovastatin affects the localization of and results in increased expression of CTNNB1 protein | 17234346 |
D008148 | Lovastatin | Lovastatin results in increased expression of CTNNB1 mRNA | 24742230 |
D008148 | Lovastatin | Lovastatin results in decreased degradation of CTNNB1 protein | 19741129 |
C010480 | lupeol | lupeol results in decreased localization of and results in decreased activity of CTNNB1 protein | 20732907 |
C010480 | lupeol | lupeol results in decreased expression of CTNNB1 protein | 20979057 |
C557799 | LY-2157299 | [ABCB4 protein affects the susceptibility to LY-2157299] which affects the expression of CTNNB1 protein | 29808285 |
D008345 | Manganese | Manganese results in decreased expression of CTNNB1 mRNA | 17175027 |
C025340 | manganese chloride | manganese chloride results in decreased expression of CTNNB1 mRNA | 17175027 |
C025340 | manganese chloride | Lithium Chloride inhibits the reaction [manganese chloride results in decreased expression of CTNNB1 protein] | 24464479 |
C025340 | manganese chloride | manganese chloride results in decreased expression of CTNNB1 protein | 24464479 |
C431023 | manganese (III) meso-tetrakis(N-ethylpyridinium-2-yl)porphyrin | manganese (III) meso-tetrakis(N-ethylpyridinium-2-yl)porphyrin results in increased expression of CTNNB1 protein | 20584581 |
C013592 | mangiferin | CTNNB1 protein results in decreased susceptibility to mangiferin | 23707762 |
C034244 | matrine | matrine results in decreased expression of CTNNB1 protein | 31112718 |
D008550 | Melatonin | Melatonin inhibits the reaction [Estradiol promotes the reaction [ESR1 protein binds to CTNNB1 promoter]] | 26990689 |
D008610 | Menthol | Menthol results in decreased expression of CTNNB1 mRNA | 26760959 |
D008694 | Methamphetamine | Methamphetamine results in decreased expression of CTNNB1 mRNA | 29802913 |
D008694 | Methamphetamine | Lithium inhibits the reaction [Methamphetamine results in increased expression of CTNNB1 mRNA] | 19149911 |
D008694 | Methamphetamine | Methamphetamine results in increased expression of CTNNB1 mRNA | 19149911 |
D008727 | Methotrexate | Methotrexate promotes the reaction [6-bromoindirubin-3'-oxime results in decreased phosphorylation of CTNNB1 protein] | 19727391 |
D008727 | Methotrexate | [Methotrexate co-treated with Leucovorin] results in increased expression of CTNNB1 protein | 25187349 |
D008727 | Methotrexate | Methotrexate results in decreased expression of CTNNB1 protein | 25187349 |
D008731 | Methoxychlor | [Genistein co-treated with Methoxychlor] results in increased expression of CTNNB1 protein | 16443925 |
D008748 | Methylcholanthrene | CTNNB1 gene mutant form affects the reaction [Methylcholanthrene results in increased expression of CYP1A1 mRNA] | 25174530 |
D008748 | Methylcholanthrene | CTNNB1 gene mutant form affects the reaction [Methylcholanthrene results in increased expression of CYP1A2 mRNA] | 25174530 |
D008748 | Methylcholanthrene | CTNNB1 protein affects the reaction [[Methylcholanthrene binds to and results in increased activity of AHR protein] which results in increased expression of CYP1A1 mRNA] | 21498875 |
D008748 | Methylcholanthrene | CTNNB1 protein affects the susceptibility to Methylcholanthrene | 21498875 |
D008748 | Methylcholanthrene | CTNNB1 protein results in increased susceptibility to Methylcholanthrene | 25174530 |
D008752 | Methylene Chloride | Methylene Chloride results in increased mutagenesis of CTNNB1 gene | 10467420 |
C005223 | methyleugenol | methyleugenol results in increased mutagenesis of CTNNB1 gene | 10467420 |
C004925 | methylmercuric chloride | methylmercuric chloride results in decreased expression of CTNNB1 mRNA | 29581082 |
C004925 | methylmercuric chloride | methylmercuric chloride results in increased expression of CTNNB1 mRNA | 23179753 |
C004925 | methylmercuric chloride | methylmercuric chloride results in decreased expression of CTNNB1 protein | 28526320 |
D008767 | Methylmercury Compounds | Methylmercury Compounds results in increased expression of CTNNB1 mRNA | 27544571 |
C030957 | methylmercury II | methylmercury II results in increased expression of CTNNB1 mRNA | 26314263 |
D008741 | Methyl Methanesulfonate | Methyl Methanesulfonate results in decreased expression of CTNNB1 mRNA | 23649840 |
D008769 | Methylnitronitrosoguanidine | geraniol inhibits the reaction [Methylnitronitrosoguanidine results in increased expression of CTNNB1 mRNA] | 28428697 |
D008769 | Methylnitronitrosoguanidine | Methylnitronitrosoguanidine results in increased expression of CTNNB1 mRNA | 28428697 |
D008770 | Methylnitrosourea | Methylnitrosourea results in increased expression of CTNNB1 protein | 12096346 |
D015741 | Metribolone | Metribolone promotes the reaction [NDRG1 protein binds to CTNNB1 protein] | 17220478 |
C423917 | MG 262 | MG 262 inhibits the reaction [Vitamin A results in decreased expression of CTNNB1 protein] | 17219422 |
D015735 | Mifepristone | Mifepristone results in increased expression of CTNNB1 mRNA | 17584828 |
D015735 | Mifepristone | Mifepristone inhibits the reaction [Progesterone results in decreased expression of CTNNB1 mRNA] | 17478549 |
D015735 | Mifepristone | Mifepristone inhibits the reaction [Progesterone results in decreased expression of CTNNB1 protein] | 17478549 |
C066851 | mithramycin A | mithramycin A inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in increased expression of and affects the localization of CTNNB1 protein] | 29663660 |
C060893 | MK-886 | [MK-886 binds to and results in decreased activity of PPARA protein] inhibits the reaction [perfluorooctanoic acid results in decreased expression of CTNNB1 protein] | 23978332 |
C070571 | ML 7 | ML 7 affects the localization of CTNNB1 protein | 18710790 |
C070571 | ML 7 | ML 7 results in decreased expression of CTNNB1 protein | 18710790 |
C016599 | mono-(2-ethylhexyl)phthalate | mono-(2-ethylhexyl)phthalate results in increased expression of CTNNB1 mRNA | 22321834 |
C016599 | mono-(2-ethylhexyl)phthalate | [Ascorbic Acid co-treated with Vitamin E] inhibits the reaction [mono-(2-ethylhexyl)phthalate affects the localization of CTNNB1 protein] | 29940330 |
C016599 | mono-(2-ethylhexyl)phthalate | mono-(2-ethylhexyl)phthalate results in increased expression of and affects the localization of CTNNB1 protein | 29940330 |
C028577 | monobutyl phthalate | monobutyl phthalate affects the expression of CTNNB1 mRNA | 20864626 |
D016686 | Monocrotaline | Fluoxetine inhibits the reaction [Monocrotaline results in decreased expression of CTNNB1 protein] | 21619414 |
D016686 | Monocrotaline | Monocrotaline results in decreased expression of CTNNB1 protein | 21619414 |
C517284 | monomethyl phthalate | monomethyl phthalate affects the expression of CTNNB1 mRNA | 26924002 |
C040015 | myricetin | myricetin results in decreased expression of CTNNB1 protein | 22245592 |
C040015 | myricetin | [myricetin results in increased activity of SIRT1 protein] which results in decreased expression of CTNNB1 protein | 22245592 |
C063509 | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 22493441 |
C063509 | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein modified form] | 22493441 |
C063509 | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Epinephrine results in increased phosphorylation of CTNNB1 protein] | 26964897 |
C063509 | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide | N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [GCG protein results in increased phosphorylation of CTNNB1 protein] | 26964897 |
C001020 | N(6),N(6)-dimethyladenine | N(6),N(6)-dimethyladenine promotes the reaction [Cadmium Chloride results in decreased expression of CTNNB1 protein] | 15618353 |
C488176 | N-acetyl-S-(alpha-methyl-4-(2-methylpropyl)benzeneacetyl)cysteine 4-(nitrooxy)butyl ester | N-acetyl-S-(alpha-methyl-4-(2-methylpropyl)benzeneacetyl)cysteine 4-(nitrooxy)butyl ester results in increased cleavage of CTNNB1 protein | 21097689 |
C000621033 | napabucasin | napabucasin results in decreased expression of CTNNB1 mRNA | 25605917; 26899963; |
C000621033 | napabucasin | napabucasin results in decreased expression of CTNNB1 protein | 25605917; 26899963; |
C542131 | naphthalenediimide | naphthalenediimide analog results in decreased expression of CTNNB1 mRNA | 30840857 |
D009288 | Naproxen | [Naproxen co-treated with Sumatriptan] inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
D009288 | Naproxen | Naproxen inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
C005274 | naringin | naringin inhibits the reaction [Hydrogen Peroxide results in decreased expression of CTNNB1 protein] | 26482937 |
C005274 | naringin | naringin results in increased expression of CTNNB1 mRNA | 24915843 |
C498045 | NCX 4040 | Acetylcysteine inhibits the reaction [NCX 4040 results in increased cleavage of CTNNB1 protein] | 16282376 |
C498045 | NCX 4040 | benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [NCX 4040 results in increased cleavage of CTNNB1 protein] | 16282376 |
C498045 | NCX 4040 | NCX 4040 inhibits the reaction [TCF4 protein binds to CTNNB1 protein] | 14566053 |
C498045 | NCX 4040 | NCX 4040 results in decreased expression of CTNNB1 protein | 19576865 |
C498045 | NCX 4040 | NCX 4040 results in increased cleavage of and results in increased localization of CTNNB1 protein | 16282376 |
C498045 | NCX 4040 | NCX 4040 results in increased cleavage of CTNNB1 protein | 15567157 |
C028007 | nickel monoxide | nickel monoxide results in increased expression of CTNNB1 mRNA | 19167457 |
D009534 | Niclosamide | Niclosamide results in decreased expression of CTNNB1 mRNA | 31398420 |
D009534 | Niclosamide | Imatinib Mesylate promotes the reaction [Niclosamide results in decreased expression of CTNNB1 protein] | 27492973 |
D009534 | Niclosamide | Niclosamide analog results in decreased expression of CTNNB1 protein | 28284560 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [CTNNB1 protein binds to CTNNBIP1 protein] | 24534281 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24534281 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [TNF protein affects the localization of CTNNB1 protein] | 27492973 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [WNT3A protein affects the localization of CTNNB1 protein] | 27492973 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [WNT3A protein results in increased stability of CTNNB1 protein] | 19772353 |
D009534 | Niclosamide | Niclosamide promotes the reaction [Imatinib Mesylate results in decreased expression of CTNNB1 protein] | 27492973 |
D009534 | Niclosamide | Niclosamide results in decreased activity of CTNNB1 protein | 25174399 |
D009534 | Niclosamide | Niclosamide results in decreased expression of CTNNB1 protein | 21531761; 24552774; 24736023; 27492973; 28284560; |
D009534 | Niclosamide | Niclosamide results in increased expression of CTNNB1 mRNA | 22576131 |
D009534 | Niclosamide | Niclosamide results in increased ubiquitination of CTNNB1 protein | 27492973 |
D009534 | Niclosamide | Niclosamide results in decreased expression of CTNNB1 mRNA | 27226553 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [Epinephrine results in increased phosphorylation of CTNNB1 protein] | 26964897 |
D009534 | Niclosamide | Niclosamide inhibits the reaction [GCG protein results in increased phosphorylation of CTNNB1 protein] | 26964897 |
C012655 | nimesulide | nimesulide affects the localization of CTNNB1 protein | 16331303 |
C012655 | nimesulide | nimesulide results in decreased expression of CTNNB1 | 15892897 |
C102148 | nitroaspirin | nitroaspirin affects the reaction [TCF4 protein binds to CTNNB1 protein] | 14566053 |
C102148 | nitroaspirin | nitroaspirin inhibits the reaction [Indomethacin results in increased expression of CTNNB1 protein] | 16818512 |
D005996 | Nitroglycerin | 4-(2-aminoethyl)benzenesulfonylfluoride inhibits the reaction [Nitroglycerin results in decreased localization of CTNNB1 protein] | 17030184 |
D005996 | Nitroglycerin | 4-(2-aminoethyl)benzenesulfonylfluoride inhibits the reaction [Nitroglycerin results in increased degradation of and results in decreased activity of CTNNB1 protein] | 17030184 |
D005996 | Nitroglycerin | benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [Nitroglycerin results in increased degradation of CTNNB1 protein] | 17030184 |
D005996 | Nitroglycerin | Nitroglycerin inhibits the reaction [CTNNB1 protein binds to TCF4 protein] | 17030184 |
D005996 | Nitroglycerin | Nitroglycerin results in decreased localization of CTNNB1 protein | 17030184 |
D005996 | Nitroglycerin | Nitroglycerin results in decreased phosphorylation of and results in increased nitrosation of and results in increased degradation of and results in decreased activity of CTNNB1 protein | 17030184 |
D005996 | Nitroglycerin | Tosylphenylalanyl Chloromethyl Ketone inhibits the reaction [Nitroglycerin inhibits the reaction [CTNNB1 protein binds to TCF4 protein]] | 17030184 |
D005996 | Nitroglycerin | Tosylphenylalanyl Chloromethyl Ketone inhibits the reaction [Nitroglycerin results in decreased localization of CTNNB1 protein] | 17030184 |
D005996 | Nitroglycerin | Tosylphenylalanyl Chloromethyl Ketone inhibits the reaction [Nitroglycerin results in increased degradation of and results in decreased activity of CTNNB1 protein] | 17030184 |
D018817 | N-Methyl-3,4-methylenedioxyamphetamine | N-Methyl-3,4-methylenedioxyamphetamine results in increased expression of CTNNB1 mRNA | 20188158 |
C047330 | N-methylisoindigotin | N-methylisoindigotin results in decreased expression of CTNNB1 protein | 26887594 |
C044387 | N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine | [IFNG protein co-treated with TNF protein co-treated with N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine] results in increased cleavage of CTNNB1 protein | 16844947 |
C044387 | N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine | Zinc inhibits the reaction [[IFNG protein co-treated with TNF protein co-treated with N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine] results in increased cleavage of CTNNB1 protein] | 16844947 |
C522862 | NT020 formula | NT020 formula results in increased localization of CTNNB1 protein | 26376629 |
C025589 | ochratoxin A | ochratoxin A metabolite results in increased expression of CTNNB1 mRNA | 26314263 |
C025589 | ochratoxin A | ochratoxin A results in increased expression of CTNNB1 mRNA | 26314263 |
D019319 | Okadaic Acid | Okadaic Acid promotes the reaction [CTNNB1 protein binds to CDH1 protein] | 31115591 |
D019319 | Okadaic Acid | Okadaic Acid promotes the reaction [CTNNB1 protein binds to CTNNBIP1 protein] | 31115591 |
D019319 | Okadaic Acid | Okadaic Acid promotes the reaction [CTNNB1 protein binds to TCF4 protein] | 31115591 |
D019319 | Okadaic Acid | Okadaic Acid results in increased activity of and results in decreased phosphorylation of CTNNB1 protein | 31115591 |
D019319 | Okadaic Acid | Okadaic Acid results in increased expression of and affects the localization of CTNNB1 protein | 31115591 |
D019319 | Okadaic Acid | Okadaic Acid results in increased expression of CTNNB1 mRNA | 31115591 |
D019319 | Okadaic Acid | Okadaic Acid results in increased phosphorylation of CTNNB1 protein | 16878161 |
D000077152 | Olanzapine | Olanzapine inhibits the reaction [Dizocilpine Maleate results in decreased expression of CTNNB1 mRNA] | 31563592 |
D000077152 | Olanzapine | Olanzapine results in increased expression of CTNNB1 mRNA | 31563592 |
D000077152 | Olanzapine | Olanzapine results in decreased expression of CTNNB1 mRNA | 18797397 |
C507134 | ON 01910 | ON 01910 results in decreased phosphorylation of CTNNB1 protein | 25472472 |
D010047 | Ovalbumin | [MYD88 gene mutant form affects the susceptibility to [Antigens, Bacterial co-treated with Ovalbumin]] which affects the expression of CTNNB1 mRNA | 29067999 |
D010076 | Oxazepam | Oxazepam results in increased mutagenesis of CTNNB1 gene | 10467420 |
D010100 | Oxygen | [amurensin G results in decreased activity of SIRT1 protein] inhibits the reaction [Oxygen deficiency results in decreased expression of CTNNB1] | 22245592 |
D010100 | Oxygen | Oxygen deficiency affects the localization of CTNNB1 protein | 25297617 |
D010100 | Oxygen | Oxygen deficiency results in decreased acetylation of CTNNB1 protein | 22245592 |
D010100 | Oxygen | Oxygen deficiency results in decreased expression of CTNNB1 mRNA | 17175027 |
D010100 | Oxygen | Resveratrol inhibits the reaction [Oxygen deficiency affects the localization of CTNNB1 protein] | 25297617 |
D010100 | Oxygen | SIRT1 protein affects the reaction [Oxygen deficiency results in decreased expression of CTNNB1 protein] | 22245592 |
D010100 | Oxygen | [Butylated Hydroxytoluene co-treated with Oxygen] affects the localization of CTNNB1 protein | 16272459 |
D010100 | Oxygen | [Butylated Hydroxytoluene co-treated with Oxygen] results in increased expression of CTNNB1 protein | 16272459 |
D017239 | Paclitaxel | CTNNB1 results in decreased susceptibility to Paclitaxel | 22000491 |
D017239 | Paclitaxel | Paclitaxel results in decreased phosphorylation of CTNNB1 protein | 23956100 |
C500026 | palbociclib | 2-(5-benzo(1,3)dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6-methylpyridine hydrochloride inhibits the reaction [palbociclib results in increased expression of CTNNB1 protein] | 22869556 |
C500026 | palbociclib | palbociclib results in increased expression of CTNNB1 protein | 22869556 |
D010269 | Paraquat | LGK974 inhibits the reaction [Paraquat affects the localization of CTNNB1 protein] | 30205152 |
D010269 | Paraquat | LGK974 inhibits the reaction [Paraquat results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 30205152 |
D010269 | Paraquat | Paraquat affects the localization of CTNNB1 protein | 30205152 |
D010269 | Paraquat | Paraquat results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 30205152 |
D010269 | Paraquat | WNT1 protein inhibits the reaction [Paraquat results in decreased expression of CTNNB1 mRNA] | 30171970 |
D010269 | Paraquat | WNT1 protein inhibits the reaction [Paraquat results in decreased expression of CTNNB1 protein] | 30171970 |
D010269 | Paraquat | CTNNB1 protein inhibits the reaction [Paraquat results in increased abundance of Reactive Oxygen Species] | 23620592 |
D010269 | Paraquat | CTNNB1 protein results in decreased susceptibility to Paraquat | 23620592 |
D010269 | Paraquat | Lithium Chloride inhibits the reaction [Paraquat results in decreased expression of CTNNB1 protein] | 30171970 |
D010269 | Paraquat | Paraquat inhibits the reaction [CTNNB1 protein binds to MPZ promoter] | 27788593 |
D010269 | Paraquat | Paraquat inhibits the reaction [CTNNB1 protein binds to PMP22 promoter] | 27788593 |
D010269 | Paraquat | Paraquat results in decreased expression of CTNNB1 mRNA | 30171970 |
D010269 | Paraquat | Paraquat results in decreased expression of CTNNB1 protein | 27788593; 30171970; |
D010269 | Paraquat | Paraquat results in decreased expression of CTNNB1 mRNA | 26887261 |
D010278 | Parathion | Atropine inhibits the reaction [Parathion results in increased expression of CTNNB1 protein] | 17390078 |
D010278 | Parathion | Atropine inhibits the reaction [Parathion results in increased expression of CTNNB1 protein mutant form] | 17390078 |
D010278 | Parathion | Parathion results in increased expression of CTNNB1 protein | 17390078 |
D052638 | Particulate Matter | 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide inhibits the reaction [Particulate Matter analog results in decreased expression of CTNNB1 protein] | 27216425 |
D052638 | Particulate Matter | Chir 99021 inhibits the reaction [Particulate Matter analog results in decreased expression of CTNNB1 protein] | 27216425 |
D052638 | Particulate Matter | Particulate Matter analog results in decreased expression of CTNNB1 protein | 27216425 |
C480521 | peonidin 3-glucoside | peonidin 3-glucoside results in decreased expression of CTNNB1 mRNA | 30597948 |
C076994 | perfluorooctane sulfonic acid | perfluorooctane sulfonic acid affects the expression of CTNNB1 mRNA | 30738844 |
C076994 | perfluorooctane sulfonic acid | Lithium Chloride inhibits the reaction [perfluorooctane sulfonic acid results in decreased expression of CTNNB1 protein] | 27018151 |
C076994 | perfluorooctane sulfonic acid | perfluorooctane sulfonic acid results in decreased expression of CTNNB1 protein | 27018151 |
C023036 | perfluorooctanoic acid | [MK-886 binds to and results in decreased activity of PPARA protein] inhibits the reaction [perfluorooctanoic acid results in decreased expression of CTNNB1 protein] | 23978332 |
C023036 | perfluorooctanoic acid | perfluorooctanoic acid results in decreased expression of CTNNB1 protein | 23978332 |
C023036 | perfluorooctanoic acid | perfluorooctanoic acid results in decreased expression of CTNNB1 protein | 25743374 |
C023036 | perfluorooctanoic acid | WNT3A protein inhibits the reaction [perfluorooctanoic acid results in decreased expression of CTNNB1 protein] | 23978332 |
D010578 | Petroleum | Petroleum results in decreased expression of CTNNB1 mRNA | 25208076 |
C539933 | pevonedistat | pevonedistat results in increased abundance of CTNNB1 protein | 22110742 |
C031181 | phenanthrene | phenanthrene affects the localization of CTNNB1 protein | 22975441 |
C031181 | phenanthrene | phenanthrene results in increased expression of CTNNB1 protein | 22975441 |
C031181 | phenanthrene | phenanthrene affects the localization of CTNNB1 protein | 12604173 |
D010634 | Phenobarbital | CTNNB1 protein affects the reaction [Phenobarbital results in increased expression of MEG3 mRNA] | 23091169 |
D010634 | Phenobarbital | CTNNB1 protein affects the reaction [Phenobarbital results in increased expression of RIAN mRNA] | 23091169 |
D010634 | Phenobarbital | CTNNB1 protein affects the susceptibility to Phenobarbital | 21705713 |
D010634 | Phenobarbital | [Diethylnitrosamine co-treated with Phenobarbital] results in increased mutagenesis of CTNNB1 gene | 24535843 |
D010634 | Phenobarbital | Phenobarbital affects the reaction [Cycloheximide results in decreased expression of CTNNB1 protein] | 27693619 |
D010634 | Phenobarbital | [Phenobarbital co-treated with CTNNB1 protein mutant form] results in increased expression of GSTM2 mRNA | 20118494 |
D010634 | Phenobarbital | [Phenobarbital co-treated with CTNNB1 protein mutant form] results in increased expression of GSTM3 mRNA | 20118494 |
D010634 | Phenobarbital | [Phenobarbital co-treated with CTNNB1 protein mutant form] results in increased expression of GSTM6 mRNA | 20118494 |
D010634 | Phenobarbital | [Phenobarbital co-treated with CTNNB1 protein mutant form] results in increased expression of NR1I3 mRNA | 20118494 |
D010634 | Phenobarbital | [Phenobarbital co-treated with Diethylnitrosamine] results in increased mutagenesis of CTNNB1 gene | 21047994 |
D010634 | Phenobarbital | Phenobarbital inhibits the reaction [benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of CTNNB1 protein] | 27693619 |
D010634 | Phenobarbital | Phenobarbital results in increased mutagenesis of CTNNB1 gene | 12384525 |
D010634 | Phenobarbital | [Phenobarbital results in increased mutagenesis of CTNNB1 gene] which results in increased expression of GLUL mRNA | 12384525 |
D010634 | Phenobarbital | [Phenobarbital results in increased mutagenesis of CTNNB1 gene] which results in increased expression of GLUL protein | 12384525 |
D010634 | Phenobarbital | Phenobarbital results in increased mutagenesis of CTNNB1 protein | 11753661 |
D010656 | Phenylephrine | Phenylephrine promotes the reaction [CTNNB1 protein binds to NPPA promoter] | 19799869 |
D010662 | Phenylmercuric Acetate | [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
D010662 | Phenylmercuric Acetate | Phenylmercuric Acetate results in increased expression of CTNNB1 mRNA | 26272509 |
D010667 | Phenylpyruvic Acids | Phenylpyruvic Acids results in decreased expression of CTNNB1 protein | 28414304 |
D064209 | Phytochemicals | Phytochemicals results in increased expression of CTNNB1 protein | 22685690 |
D010862 | Pilocarpine | Pilocarpine results in increased expression of CTNNB1 protein | 12387456 |
C049032 | pinosylvin | pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein | 23333577 |
C049032 | pinosylvin | [pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of BIRC5 mRNA | 23333577 |
C049032 | pinosylvin | [pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of BMP4 mRNA | 23333577 |
C049032 | pinosylvin | [pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of CCND1 mRNA | 23333577 |
C049032 | pinosylvin | [pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of ID2 mRNA | 23333577 |
C049032 | pinosylvin | [pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of MMP7 mRNA | 23333577 |
C049032 | pinosylvin | [pinosylvin affects the localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of MYC mRNA | 23333577 |
D000077205 | Pioglitazone | [Pioglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of CTNNB1 mRNA | 20847119 |
C008922 | piperine | [piperine co-treated with Curcumin] results in decreased expression of CTNNB1 protein | 30935902 |
C006253 | pirinixic acid | pirinixic acid results in decreased expression of CTNNB1 mRNA | 18445702 |
C006253 | pirinixic acid | pirinixic acid inhibits the reaction [APP protein results in decreased expression of CTNNB1 protein] | 16204253 |
C006253 | pirinixic acid | pirinixic acid inhibits the reaction [Hydrogen Peroxide results in decreased expression of CTNNB1 protein] | 16204253 |
C006253 | pirinixic acid | pirinixic acid inhibits the reaction [Hydrogen Peroxide results in decreased stability of CTNNB1 protein] | 16204253 |
D010936 | Plant Extracts | Plant Extracts results in decreased expression of CTNNB1 mRNA | 30597948 |
D010936 | Plant Extracts | Plant Extracts results in increased expression of CTNNB1 protein | 22685690 |
D010936 | Plant Extracts | Plant Extracts affects the cleavage of CTNNB1 protein | 23262642 |
D010936 | Plant Extracts | Plant Extracts results in increased mutagenesis of CTNNB1 gene | 23262642 |
D010936 | Plant Extracts | [Sulindac co-treated with Plant Extracts] results in decreased expression of CTNNB1 protein | 12351151 |
D028321 | Plant Preparations | Plant Preparations inhibits the reaction [2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased expression of CTNNB1 mRNA] | 23466459 |
C108953 | platycodin D | CTNNB1 affects the reaction [platycodin D results in decreased expression of CEBPA protein] | 21798269 |
C108953 | platycodin D | CTNNB1 affects the reaction [platycodin D results in decreased expression of FABP4 protein] | 21798269 |
C108953 | platycodin D | CTNNB1 affects the reaction [platycodin D results in increased expression of CCND1 mRNA] | 21798269 |
C108953 | platycodin D | CTNNB1 affects the reaction [platycodin D results in increased expression of PPARG mRNA] | 21798269 |
C108953 | platycodin D | platycodin D results in increased expression of and results in increased localization of CTNNB1 protein | 21798269 |
C063471 | polyethylene glycol-superoxide dismutase | polyethylene glycol-superoxide dismutase inhibits the reaction [Arsenic results in increased expression of and results in increased activity of CTNNB1 protein] | 22552367 |
C063471 | polyethylene glycol-superoxide dismutase | polyethylene glycol-superoxide dismutase inhibits the reaction [chromium hexavalent ion results in increased expression of and results in increased activity of CTNNB1 protein] | 22552367 |
C060540 | polyhexamethyleneguanidine | polyhexamethyleneguanidine results in increased activity of CTNNB1 protein | 31348943 |
D059808 | Polyphenols | Polyphenols results in decreased expression of CTNNB1 mRNA | 16293270 |
C556217 | polyphyllin I | polyphyllin I results in decreased expression of and affects the localization of CTNNB1 protein | 26821882 |
C556217 | polyphyllin I | polyphyllin I results in decreased expression of CTNNB1 mRNA | 26821882 |
D017035 | Pravastatin | Pravastatin affects the localization of CTNNB1 protein | 17188708 |
D017035 | Pravastatin | [Resveratrol co-treated with Pravastatin] affects the localization of CTNNB1 protein | 17188708 |
D011374 | Progesterone | CTNNB1 protein results in decreased abundance of Progesterone | 20610534 |
D011374 | Progesterone | CTNNB1 protein results in increased susceptibility to Progesterone | 22958837 |
D011374 | Progesterone | Mifepristone inhibits the reaction [Progesterone results in decreased expression of CTNNB1 mRNA] | 17478549 |
D011374 | Progesterone | Mifepristone inhibits the reaction [Progesterone results in decreased expression of CTNNB1 protein] | 17478549 |
D011374 | Progesterone | Progesterone results in decreased expression of CTNNB1 mRNA | 17478549 |
D011374 | Progesterone | Progesterone results in decreased expression of CTNNB1 protein | 17478549 |
D011374 | Progesterone | Progesterone results in increased expression of CTNNB1 protein | 17170212 |
D011441 | Propylthiouracil | Propylthiouracil results in increased expression of CTNNB1 mRNA | 24780913 |
D011691 | Puromycin | Puromycin affects the localization of CTNNB1 protein | 15673299 |
D011692 | Puromycin Aminonucleoside | Puromycin Aminonucleoside results in decreased expression of CTNNB1 protein | 12065681 |
D011710 | Pyocyanine | Pyocyanine results in increased expression of CTNNB1 mRNA | 31078726 |
C014175 | pyrazolo(3,4-d)pyrimidine | pyrazolo(3,4-d)pyrimidine analog affects the expression of CTNNB1 mRNA | 21152443 |
C008704 | pyrithione | [Zinc co-treated with pyrithione] results in increased cleavage of CTNNB1 protein | 17098228 |
C528580 | qishen yiqi | qishen yiqi inhibits the reaction [TGFB1 protein results in increased expression of and affects the localization of CTNNB1 protein] | 27636716 |
D011794 | Quercetin | Quercetin affects the expression of CTNNB1 protein | 15670774 |
D011794 | Quercetin | Quercetin inhibits the reaction [CTNNB1 protein binds to TCF4 protein] | 15670774 |
D011794 | Quercetin | Quercetin inhibits the reaction [DEFA1 protein results in decreased phosphorylation of and results in increased activity of CTNNB1 protein] | 19814765 |
D011794 | Quercetin | Quercetin inhibits the reaction [DEFA2 protein results in decreased phosphorylation of and results in increased activity of CTNNB1 protein] | 19814765 |
D011794 | Quercetin | Quercetin inhibits the reaction [PLAUR protein results in increased expression of and results in decreased phosphorylation of CTNNB1 protein] | 22511755 |
D011794 | Quercetin | Quercetin results in decreased activity of CTNNB1 protein | 15670774; 19440933; |
D011794 | Quercetin | Quercetin results in decreased expression of CTNNB1 mRNA | 20596804 |
D011794 | Quercetin | Quercetin results in decreased expression of CTNNB1 protein | 21308698; 22245592; |
D011794 | Quercetin | [Quercetin results in increased activity of SIRT1 protein] which results in decreased expression of CTNNB1 protein | 22245592 |
D011794 | Quercetin | Quercetin inhibits the reaction [Warfarin results in increased expression of and affects the localization of CTNNB1 protein] | 23117658 |
D011794 | Quercetin | Quercetin promotes the reaction [Dexamethasone results in decreased expression of CTNNB1 mRNA] | 20501703 |
D011794 | Quercetin | Quercetin promotes the reaction [Dexamethasone results in decreased expression of CTNNB1 protein] | 20501703 |
D011794 | Quercetin | Quercetin results in decreased expression of CTNNB1 mRNA | 20501703 |
D011794 | Quercetin | Quercetin results in decreased expression of CTNNB1 protein | 20501703 |
D011794 | Quercetin | Quercetin results in decreased activity of CTNNB1 protein | 18624906 |
D011796 | Quinacrine | GSK3B protein affects the reaction [Quinacrine results in decreased expression of CTNNB1 protein] | 28720477 |
D011796 | Quinacrine | Quinacrine results in decreased expression of CTNNB1 protein | 28720477 |
C502851 | quinocetone | Acetylcysteine inhibits the reaction [quinocetone results in decreased expression of CTNNB1 protein] | 28343033 |
C502851 | quinocetone | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [quinocetone results in decreased expression of CTNNB1 protein] | 28343033 |
C502851 | quinocetone | Lithium Chloride inhibits the reaction [quinocetone results in decreased expression of CTNNB1 protein] | 28343033 |
C502851 | quinocetone | quinocetone results in decreased expression of CTNNB1 protein | 28343033 |
C502851 | quinocetone | quinocetone results in increased expression of CTNNB1 mRNA | 28343033 |
D020891 | Raclopride | DRD2 protein affects the reaction [Raclopride results in increased expression of CTNNB1 protein] | 16144542 |
D020891 | Raclopride | Raclopride results in increased expression of CTNNB1 protein | 16144542 |
D017382 | Reactive Oxygen Species | CTNNB1 protein inhibits the reaction [Paraquat results in increased abundance of Reactive Oxygen Species] | 23620592 |
D000077185 | Resveratrol | CTNNB1 protein promotes the reaction [Resveratrol results in increased expression of VEGFA protein] | 20696143 |
D000077185 | Resveratrol | lactacystin inhibits the reaction [Resveratrol results in increased degradation of CTNNB1 protein] | 26040106 |
D000077185 | Resveratrol | MALAT1 protein affects the reaction [Resveratrol inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein]] | 24244343 |
D000077185 | Resveratrol | MALAT1 protein inhibits the reaction [Resveratrol affects the localization of CTNNB1 protein] | 24244343 |
D000077185 | Resveratrol | Resveratrol affects the localization of CTNNB1 protein | 22314268; 24244343; 25297617; 25896424; |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Doxorubicin] | 19047049 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in decreased susceptibility to Etoposide] | 19047049 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 mRNA] | 19047049 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] | 19047049 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 mRNA] | 19047049 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] | 19047049 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24244343 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [Lithium Chloride results in increased activity of [TCF4 protein co-treated with CTNNB1 protein]] | 22935447 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [Oxygen deficiency affects the localization of CTNNB1 protein] | 25297617 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [TCF4 protein binds to CTNNB1 protein] | 22935447 |
D000077185 | Resveratrol | Resveratrol promotes the reaction [CASP3 protein results in increased degradation of CTNNB1 protein] | 26040106 |
D000077185 | Resveratrol | Resveratrol results in decreased activity of [TCF4 protein co-treated with CTNNB1 protein] | 22935447 |
D000077185 | Resveratrol | Resveratrol results in decreased expression of and affects the localization of CTNNB1 protein | 25280562 |
D000077185 | Resveratrol | Resveratrol results in decreased expression of CTNNB1 mRNA | 18347188; 25061499; |
D000077185 | Resveratrol | Resveratrol results in decreased expression of CTNNB1 protein | 11895924; 18347188; 22245592; 25061499; |
D000077185 | Resveratrol | [Resveratrol results in decreased phosphorylation of and results in decreased activity of GSK3B protein] which results in increased phosphorylation of and results in decreased localization of CTNNB1 protein | 20696143 |
D000077185 | Resveratrol | [[Resveratrol results in increased activity of SIRT1 protein] promotes the reaction [SIRT1 protein binds to and results in decreased activity of EP300 protein]] which results in decreased acetylation of and results in decreased activity of CTNNB1 protein | 19047049 |
D000077185 | Resveratrol | [Resveratrol results in increased activity of SIRT1 protein] which results in decreased expression of CTNNB1 protein | 22245592 |
D000077185 | Resveratrol | Resveratrol results in increased degradation of CTNNB1 protein | 26040106 |
D000077185 | Resveratrol | Resveratrol results in increased localization of and results in increased activity of CTNNB1 protein | 20696143 |
D000077185 | Resveratrol | [Resveratrol results in increased localization of and results in increased activity of CTNNB1 protein] which results in increased expression of VEGFA mRNA | 20696143 |
D000077185 | Resveratrol | [Resveratrol results in increased phosphorylation of and results in increased activity of GSK3B protein] which results in decreased phosphorylation of and results in increased localization of CTNNB1 protein | 20696143 |
D000077185 | Resveratrol | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Resveratrol results in increased stability of CTNNB1 protein] | 20542495 |
D000077185 | Resveratrol | CTNNB1 protein promotes the reaction [Resveratrol results in decreased susceptibility to Excitatory Amino Acid Agents] | 20542495 |
D000077185 | Resveratrol | CTNNB1 protein promotes the reaction [Resveratrol results in increased expression of SOD2 protein] | 20542495 |
D000077185 | Resveratrol | Resveratrol affects the localization of CTNNB1 protein | 19665018 |
D000077185 | Resveratrol | [Resveratrol co-treated with Excitatory Amino Acid Agents] results in increased stability of CTNNB1 protein | 20542495 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [WNT3A protein promotes the reaction [TCF4 protein binds to CTNNB1 protein]] | 22935447 |
D000077185 | Resveratrol | Resveratrol results in increased activity of CTNNB1 protein | 19665018 |
D000077185 | Resveratrol | Resveratrol results in increased stability of CTNNB1 protein | 19665018; 20542495; |
D000077185 | Resveratrol | Resveratrol affects the localization of CTNNB1 protein | 17188708 |
D000077185 | Resveratrol | [Resveratrol co-treated with Pravastatin] affects the localization of CTNNB1 protein | 17188708 |
D000077185 | Resveratrol | Resveratrol results in increased expression of CTNNB1 mRNA | 23848300 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [DKK1 protein inhibits the reaction [WNT3A protein results in increased expression of CTNNB1]] | 19665018 |
D000077185 | Resveratrol | Resveratrol inhibits the reaction [VEGFA protein results in increased phosphorylation of CTNNB1 protein] | 14573751 |
D012256 | Riboflavin | Riboflavin analog results in increased expression of CTNNB1 protein | 20688149 |
D018967 | Risperidone | DRD2 protein affects the reaction [Risperidone results in increased expression of CTNNB1 protein] | 16144542 |
D018967 | Risperidone | Risperidone results in increased expression of CTNNB1 protein | 16144542 |
D000077154 | Rosiglitazone | [Rosiglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of CTNNB1 mRNA | 20847119 |
D000077154 | Rosiglitazone | Rosiglitazone inhibits the reaction [tert-Butylhydroperoxide results in increased expression of CTNNB1 mRNA] | 20847119 |
D000077154 | Rosiglitazone | Rosiglitazone results in increased expression of CTNNB1 protein | 19621015 |
D012402 | Rotenone | Lithium Chloride inhibits the reaction [Rotenone results in decreased expression of and results in decreased phosphorylation of CTNNB1 protein] | 27045591 |
D012402 | Rotenone | Rotenone results in decreased expression of and results in decreased phosphorylation of CTNNB1 protein | 27045591 |
C101044 | RTKI cpd | RTKI cpd inhibits the reaction [arsenite affects the localization of CTNNB1 protein] | 17400267 |
C101044 | RTKI cpd | RTKI cpd results in decreased expression of CTNNB1 protein | 29974605 |
C025759 | saikosaponin | saikosaponin results in increased phosphorylation of and results in decreased expression of CTNNB1 protein | 31175886 |
C025759 | saikosaponin | SB 216763 inhibits the reaction [saikosaponin results in increased phosphorylation of and results in decreased expression of CTNNB1 protein] | 31175886 |
C010327 | salinomycin | salinomycin inhibits the reaction [TGFB1 protein results in increased expression of and results in increased activity of CTNNB1 mRNA] | 26896736 |
D012503 | Saponins | Saponins results in decreased expression of CTNNB1 mRNA | 29148169 |
C093642 | SB 203580 | SB 203580 inhibits the reaction [DEFA1 protein results in decreased phosphorylation of and results in increased activity of CTNNB1 protein] | 19814765 |
C093642 | SB 203580 | SB 203580 inhibits the reaction [DEFA2 protein results in decreased phosphorylation of and results in increased activity of CTNNB1 protein] | 19814765 |
C417521 | SB 216763 | SB 216763 inhibits the reaction [Immunologic Factors results in decreased expression of CTNNB1 protein] | 29974605 |
C417521 | SB 216763 | SB 216763 promotes the reaction [Cadmium results in increased expression of and results in increased activity of CTNNB1 protein] | 22884995 |
C417521 | SB 216763 | SB 216763 results in decreased phosphorylation of CTNNB1 protein | 16968061; 16968065; |
C417521 | SB 216763 | SB 216763 results in increased expression of and results in decreased phosphorylation of CTNNB1 protein | 19228266 |
C417521 | SB 216763 | SB 216763 results in increased expression of CTNNB1 protein | 16968061; 16968065; 29974605; |
C417521 | SB 216763 | SB 216763 results in increased localization of CTNNB1 protein | 16968065 |
C417521 | SB 216763 | [4-aminoethylamino-emodin co-treated with SB 216763] results in decreased expression of CTNNB1 protein modified form | 19228266 |
C417521 | SB 216763 | CTNNB1 mutant form inhibits the reaction [SB 216763 inhibits the reaction [Cisplatin results in increased expression of IL6 mRNA]] | 24560772 |
C417521 | SB 216763 | CTNNB1 mutant form inhibits the reaction [SB 216763 inhibits the reaction [Cisplatin results in increased expression of TNF mRNA]] | 24560772 |
C417521 | SB 216763 | SB 216763 inhibits the reaction [Cisplatin results in increased phosphorylation of CTNNB1 protein] | 24560772 |
C417521 | SB 216763 | SB 216763 inhibits the reaction [saikosaponin results in increased phosphorylation of and results in decreased expression of CTNNB1 protein] | 31175886 |
C417521 | SB 216763 | [SB 216763 results in decreased activity of GSK3B protein] which results in increased expression of CTNNB1 protein | 19159680 |
C417521 | SB 216763 | SB 216763 results in decreased expression of CTNNB1 protein modified form | 19228266 |
C417521 | SB 216763 | SB 216763 results in decreased phosphorylation of CTNNB1 protein | 19448134 |
C417521 | SB 216763 | SB 216763 results in increased expression of and affects the localization of CTNNB1 protein | 24560772 |
C417521 | SB 216763 | CTNNB1 protein affects the reaction [SB 216763 results in increased expression of NR4A2 mRNA] | 27045591 |
C417521 | SB 216763 | SB 216763 promotes the reaction [CTNNB1 protein binds to NR4A2 promoter] | 27045591 |
C417521 | SB 216763 | SB 216763 promotes the reaction [CTNNB1 protein binds to NR4A2 protein] | 27045591 |
C417521 | SB 216763 | SB 216763 results in increased expression of and affects the localization of CTNNB1 protein | 16288908 |
C417521 | SB 216763 | SB 216763 results in increased expression of CTNNB1 mRNA | 27045591 |
C410733 | scriptaid | scriptaid affects the expression of CTNNB1 mRNA | 18813790 |
C410733 | scriptaid | [scriptaid results in decreased activity of HDAC5 protein] which results in increased expression of CTNNB1 mRNA | 21454484 |
C040115 | shogaol | shogaol results in decreased expression of CTNNB1 mRNA | 27645308 |
C040115 | shogaol | shogaol results in decreased expression of CTNNB1 protein | 27645308 |
D012822 | Silicon Dioxide | Silicon Dioxide results in increased expression of CTNNB1 mRNA | 29203145 |
D012834 | Silver | Silver results in increased expression of CTNNB1 protein | 29283201 |
D019821 | Simvastatin | CTNNB1 mutant form inhibits the reaction [Simvastatin results in increased expression of BGLAP protein] | 22058016 |
D019821 | Simvastatin | CTNNB1 mutant form inhibits the reaction [Simvastatin results in increased expression of SP7 protein] | 22058016 |
D019821 | Simvastatin | Simvastatin results in increased expression of CTNNB1 protein | 22058016 |
D019821 | Simvastatin | Simvastatin inhibits the reaction [Glucose results in decreased expression of CTNNB1 protein] | 18004065 |
D019821 | Simvastatin | Simvastatin results in increased expression of CTNNB1 protein | 18004065 |
D020123 | Sirolimus | Sirolimus promotes the reaction [Dibutyl Phthalate results in increased expression of CTNNB1 mRNA] | 30053495 |
D012906 | Smoke | Smoke analog results in decreased expression of CTNNB1 protein | 25680692 |
C009277 | sodium arsenate | sodium arsenate results in decreased expression of CTNNB1 mRNA | 14713550 |
C009277 | sodium arsenate | sodium arsenate results in decreased expression of CTNNB1 protein | 14713550 |
C017947 | sodium arsenite | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [sodium arsenite affects the localization of CTNNB1 protein] | 22859221 |
C017947 | sodium arsenite | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [sodium arsenite results in decreased expression of CTNNB1 protein] | 23219847 |
C017947 | sodium arsenite | Acetylcysteine inhibits the reaction [sodium arsenite results in increased expression of CTNNB1 protein] | 24961358 |
C017947 | sodium arsenite | sodium arsenite affects the localization of CTNNB1 protein | 22859221 |
C017947 | sodium arsenite | sodium arsenite results in decreased expression of CTNNB1 protein | 23219847; 25879800; |
C017947 | sodium arsenite | sodium arsenite results in increased expression of CTNNB1 protein | 16054901; 22859221; 24961358; 29107899; 31120745; |
C017947 | sodium arsenite | tetramethylpyrazine inhibits the reaction [sodium arsenite results in increased expression of CTNNB1 protein] | 24961358 |
C017947 | sodium arsenite | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [sodium arsenite results in decreased expression of CTNNB1 protein] | 23143138 |
C017947 | sodium arsenite | [Folic Acid co-treated with sodium arsenite] results in increased methylation of CTNNB1 mRNA | 22959928 |
C017947 | sodium arsenite | sodium arsenite affects the expression of CTNNB1 mRNA | 16507464; 28206643; |
C017947 | sodium arsenite | sodium arsenite results in decreased expression of CTNNB1 mRNA | 27158593 |
C017947 | sodium arsenite | sodium arsenite results in decreased expression of CTNNB1 protein | 23143138 |
C017947 | sodium arsenite | sodium arsenite results in increased expression of CTNNB1 mRNA | 25825268 |
C017947 | sodium arsenite | sodium arsenite results in decreased expression of CTNNB1 mRNA | 23137061 |
D012969 | Sodium Fluoride | PTH protein promotes the reaction [Sodium Fluoride results in increased expression of CTNNB1 mRNA] | 29447955 |
D012969 | Sodium Fluoride | Sodium Fluoride results in decreased expression of CTNNB1 protein | 28918527 |
D012969 | Sodium Fluoride | Sodium Fluoride results in increased expression of CTNNB1 mRNA | 29447955 |
D012969 | Sodium Fluoride | Sodium Fluoride results in increased expression of CTNNB1 protein | 29447955 |
D012969 | Sodium Fluoride | [Sodium Fluoride results in increased susceptibility to PTH protein] which results in increased expression of CTNNB1 mRNA | 29447955 |
D012969 | Sodium Fluoride | Sodium Fluoride results in increased expression of and affects the localization of CTNNB1 protein | 24300170 |
D012969 | Sodium Fluoride | Sodium Fluoride results in increased expression of CTNNB1 mRNA | 24300170 |
C538809 | sodium pentaborate | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of CEBPA protein]] | 28285642 |
C538809 | sodium pentaborate | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of FABP4 protein]] | 28285642 |
C538809 | sodium pentaborate | CTNNB1 protein promotes the reaction [sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in increased expression of PPARG protein]] | 28285642 |
C538809 | sodium pentaborate | sodium pentaborate inhibits the reaction [[Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS protein] results in decreased expression of CTNNB1 protein] | 28285642 |
D000077157 | Sorafenib | Sorafenib promotes the reaction [destruxin B results in decreased expression of CTNNB1 protein] | 24434019 |
C001873 | sporidesmin | sporidesmin affects the localization of CTNNB1 protein | 28193462 |
D019311 | Staurosporine | Staurosporine results in increased phosphorylation of CTNNB1 protein | 19741129 |
C416927 | SU 6656 | SU 6656 affects the localization of CTNNB1 protein | 23527294 |
D012460 | Sulfasalazine | [Sulfasalazine results in decreased activity of SLC7A11 protein] which results in decreased localization of and results in decreased activity of CTNNB1 protein | 19015640 |
D012460 | Sulfasalazine | [[Sulfasalazine results in decreased activity of SLC7A11 protein] which results in decreased localization of and results in decreased activity of CTNNB1 protein] which results in decreased expression of CCND1 mRNA | 19015640 |
D012460 | Sulfasalazine | Sulfasalazine inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 mRNA] | 26165751 |
D012460 | Sulfasalazine | Sulfasalazine inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 protein] | 26165751 |
D013467 | Sulindac | CTNNB1 protein affects the reaction [Sulindac results in decreased expression of CCND1 protein] | 18291362 |
D013467 | Sulindac | CTNNB1 protein affects the reaction [Sulindac results in decreased expression of CDK4 protein] | 18291362 |
D013467 | Sulindac | CTNNB1 protein affects the reaction [Sulindac results in decreased expression of MYC protein] | 18291362 |
D013467 | Sulindac | Sulindac results in decreased activity of [LEF1 protein binds to CTNNB1 protein] | 11751639 |
D013467 | Sulindac | Sulindac results in decreased expression of CTNNB1 protein | 18291362 |
D013467 | Sulindac | [Sulindac co-treated with Plant Extracts] results in decreased expression of CTNNB1 protein | 12351151 |
D013467 | Sulindac | Sulindac results in decreased expression of CTNNB1 protein | 10223192 |
D013467 | Sulindac | epigallocatechin gallate promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein]] | 29999212 |
D013467 | Sulindac | kaempferol promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein]] | 29999212 |
D013467 | Sulindac | Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of CTNNB1 protein] | 29999212 |
C452601 | sulindac derivative IND 12 | sulindac derivative IND 12 promotes the reaction [CDH1 protein binds to CTNNB1 protein] | 11912145 |
C025462 | sulindac sulfide | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [sulindac sulfide results in decreased expression of CTNNB1 protein] | 14555707 |
C025462 | sulindac sulfide | sulindac sulfide affects the localization of and results in decreased expression of CTNNB1 protein | 15188006 |
C025462 | sulindac sulfide | sulindac sulfide inhibits the reaction [CTNNB1 protein results in increased expression of CCND1 protein] | 14710233 |
C025462 | sulindac sulfide | sulindac sulfide inhibits the reaction [CTNNB1 protein results in increased expression of MET protein] | 14710233 |
C025462 | sulindac sulfide | sulindac sulfide results in decreased expression of and results in decreased localization of CTNNB1 protein | 14710233 |
C025462 | sulindac sulfide | sulindac sulfide results in decreased expression of CTNNB1 protein | 14555707 |
C025463 | sulindac sulfone | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [sulindac sulfone results in decreased expression of CTNNB1 protein] | 14555707 |
C025463 | sulindac sulfone | sulindac sulfone results in decreased expression of CTNNB1 protein | 10910034; 12392815; 14555707; |
C025463 | sulindac sulfone | sulindac sulfone results in increased expression of CTNNB1 protein | 11602670 |
D018170 | Sumatriptan | [Naproxen co-treated with Sumatriptan] inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
D018170 | Sumatriptan | Sumatriptan inhibits the reaction [Capsaicin results in increased expression of CTNNB1 protein] | 22150557 |
D000077210 | Sunitinib | Sunitinib results in increased expression of CTNNB1 mRNA | 25605917 |
D013629 | Tamoxifen | 3,4',5-trimethoxystilbene promotes the reaction [Tamoxifen results in decreased expression of CTNNB1 protein] | 23921149 |
D013629 | Tamoxifen | [Tamoxifen co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] affects the localization of CTNNB1 protein | 22046442 |
D013629 | Tamoxifen | Tamoxifen promotes the reaction [3,4',5-trimethoxystilbene results in decreased expression of CTNNB1 protein] | 23921149 |
D013629 | Tamoxifen | Tamoxifen results in decreased expression of CTNNB1 protein | 23921149 |
C021751 | tanshinone | tanshinone results in increased expression of CTNNB1 mRNA | 25186638 |
D020122 | tert-Butylhydroperoxide | [Pioglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of CTNNB1 mRNA | 20847119 |
D020122 | tert-Butylhydroperoxide | [Rosiglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of CTNNB1 mRNA | 20847119 |
D020122 | tert-Butylhydroperoxide | Rosiglitazone inhibits the reaction [tert-Butylhydroperoxide results in increased expression of CTNNB1 mRNA] | 20847119 |
D020122 | tert-Butylhydroperoxide | tert-Butylhydroperoxide results in increased expression of CTNNB1 mRNA | 20847119 |
D020122 | tert-Butylhydroperoxide | [Troglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of CTNNB1 mRNA | 20847119 |
D020122 | tert-Butylhydroperoxide | Troglitazone inhibits the reaction [tert-Butylhydroperoxide results in increased expression of CTNNB1 mRNA] | 20847119 |
D013739 | Testosterone | 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide inhibits the reaction [Testosterone results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
D013739 | Testosterone | Testosterone results in decreased phosphorylation of CTNNB1 protein | 28163245 |
D013739 | Testosterone | Testosterone results in increased expression of CTNNB1 protein | 21468052 |
D013739 | Testosterone | Wortmannin inhibits the reaction [Testosterone results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
D013749 | Tetrachlorodibenzodioxin | Lithium Chloride inhibits the reaction [Tetrachlorodibenzodioxin results in decreased expression of CTNNB1 protein] | 22134133 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin results in decreased expression of CTNNB1 protein | 22134133 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin results in increased expression of CTNNB1 mRNA | 29704546 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin results in increased expression of CTNNB1 protein | 22902829 |
D013749 | Tetrachlorodibenzodioxin | CTNNB1 protein affects the reaction [[Tetrachlorodibenzodioxin results in increased activity of AHR protein] which results in increased expression of CYP1A1 mRNA] | 21498875 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin affects the expression of CTNNB1 mRNA | 21570461; 24058054; |
D013749 | Tetrachlorodibenzodioxin | [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CTNNB1 mRNA | 17942748 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin inhibits the reaction [CTNNB1 protein results in increased expression of LEF1 mRNA] | 24928892 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin results in decreased activity of CTNNB1 protein | 24928892 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin results in increased expression of CTNNB1 mRNA | 17586704 |
D013749 | Tetrachlorodibenzodioxin | WNT3A protein promotes the reaction [[Tetrachlorodibenzodioxin binds to and results in increased activity of AHR protein] which results in decreased expression of CTNNB1 protein] | 21602191 |
D013749 | Tetrachlorodibenzodioxin | WNT3A protein promotes the reaction [[Tetrachlorodibenzodioxin binds to and results in increased activity of AHR protein] which results in decreased expression of CTNNB1 protein modified form] | 21602191 |
D013749 | Tetrachlorodibenzodioxin | [Tetrachlorodibenzodioxin binds to and results in increased activity of AHR protein] which results in decreased expression of CTNNB1 protein | 21602191 |
D013749 | Tetrachlorodibenzodioxin | [Tetrachlorodibenzodioxin binds to and results in increased activity of AHR protein] which results in decreased expression of CTNNB1 protein modified form | 21602191 |
D013749 | Tetrachlorodibenzodioxin | Tetrachlorodibenzodioxin results in increased expression of CTNNB1 protein | 24231000 |
D013749 | Tetrachlorodibenzodioxin | XAV939 inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of CTNNB1 protein] | 24231000 |
D013749 | Tetrachlorodibenzodioxin | CTNNB1 protein results in increased susceptibility to Tetrachlorodibenzodioxin | 25174530 |
D013755 | Tetradecanoylphorbol Acetate | Tetradecanoylphorbol Acetate inhibits the reaction [CDH5 protein binds to CTNNB1 protein] | 24211779 |
C017953 | tetramethylpyrazine | NFE2L2 protein promotes the reaction [tetramethylpyrazine results in decreased expression of CTNNB1 mRNA] | 27477297 |
C017953 | tetramethylpyrazine | NFE2L2 protein promotes the reaction [tetramethylpyrazine results in decreased expression of CTNNB1 protein] | 27477297 |
C017953 | tetramethylpyrazine | tetramethylpyrazine inhibits the reaction [sodium arsenite results in increased expression of CTNNB1 protein] | 24961358 |
C017953 | tetramethylpyrazine | tetramethylpyrazine results in decreased expression of CTNNB1 mRNA | 27477297 |
C017953 | tetramethylpyrazine | tetramethylpyrazine results in decreased expression of CTNNB1 protein | 27477297 |
C017953 | tetramethylpyrazine | NFE2L2 protein promotes the reaction [tetramethylpyrazine inhibits the reaction [Carbon Tetrachloride results in increased expression of CTNNB1 protein]] | 27477297 |
C017953 | tetramethylpyrazine | tetramethylpyrazine inhibits the reaction [Carbon Tetrachloride results in increased expression of CTNNB1 protein] | 27477297 |
C056068 | theaflavin | theaflavin inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 mRNA] | 27058323 |
C056068 | theaflavin | theaflavin inhibits the reaction [Diethylnitrosamine results in increased expression of CTNNB1 protein] | 27058323 |
D013893 | Thiram | Thiram results in decreased expression of CTNNB1 mRNA | 20530235 |
C009495 | titanium dioxide | titanium dioxide affects the expression of CTNNB1 mRNA | 17656681 |
D014028 | Tobacco Smoke Pollution | Tobacco Smoke Pollution results in decreased expression of CTNNB1 protein | 29221954 |
D014028 | Tobacco Smoke Pollution | GSK3B protein inhibits the reaction [Tobacco Smoke Pollution results in increased activity of [CTNNB1 protein binds to TCF4 protein]] | 19429245 |
D014028 | Tobacco Smoke Pollution | Tobacco Smoke Pollution affects the expression of CTNNB1 mRNA | 29505817 |
D014028 | Tobacco Smoke Pollution | Tobacco Smoke Pollution affects the expression of CTNNB1 protein | 30291989 |
D014028 | Tobacco Smoke Pollution | Tobacco Smoke Pollution results in increased activity of [CTNNB1 protein binds to TCF4 protein] | 19429245 |
D014028 | Tobacco Smoke Pollution | Tobacco Smoke Pollution results in increased expression of and affects the localization of CTNNB1 protein | 19429245 |
C082097 | tocotrienol, delta | tocotrienol, delta results in decreased expression of CTNNB1 protein | 21453743 |
D014051 | Toluene 2,4-Diisocyanate | AG 1879 inhibits the reaction [Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein] | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | AGER protein affects the reaction [Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein] | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | CAV1 protein mutant form inhibits the reaction [Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein] | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | FPS-ZM1 inhibits the reaction [Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein] | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | Toluene 2,4-Diisocyanate analog affects the localization of CTNNB1 protein | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | 2-(1,3-dimethyl-2,6-dioxo-1,2,3,6-tetrahydro-7H-purin-7-yl)-N-(4-isopropylphenyl)acetamide inhibits the reaction [Toluene 2,4-Diisocyanate results in increased phosphorylation of and results in increased activity of and affects the localization of CTNNB1 protein] | 30517707 |
D014051 | Toluene 2,4-Diisocyanate | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Toluene 2,4-Diisocyanate results in decreased expression of and affects the localization of CTNNB1 protein] | 26089345 |
D014051 | Toluene 2,4-Diisocyanate | 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Toluene 2,4-Diisocyanate results in increased phosphorylation of CTNNB1 protein] | 26089345 |
D014051 | Toluene 2,4-Diisocyanate | AG 1879 inhibits the reaction [Toluene 2,4-Diisocyanate affects the localization of CTNNB1 protein] | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | FPS-ZM1 inhibits the reaction [Toluene 2,4-Diisocyanate affects the localization of CTNNB1 protein] | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | GSK2193874 inhibits the reaction [Toluene 2,4-Diisocyanate results in increased phosphorylation of and results in increased activity of and affects the localization of CTNNB1 protein] | 30517707 |
D014051 | Toluene 2,4-Diisocyanate | Toluene 2,4-Diisocyanate affects the localization of CTNNB1 protein | 30261222 |
D014051 | Toluene 2,4-Diisocyanate | Toluene 2,4-Diisocyanate results in decreased expression of and affects the localization of CTNNB1 protein | 26089345 |
D014051 | Toluene 2,4-Diisocyanate | Toluene 2,4-Diisocyanate results in increased phosphorylation of and results in increased activity of and affects the localization of CTNNB1 protein | 30517707 |
D014051 | Toluene 2,4-Diisocyanate | Toluene 2,4-Diisocyanate results in increased phosphorylation of CTNNB1 protein | 26089345 |
D019772 | Topotecan | acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Topotecan results in increased cleavage of CTNNB1 protein] | 20457140 |
D019772 | Topotecan | chrysin inhibits the reaction [Topotecan results in increased cleavage of CTNNB1 protein] | 20457140 |
D019772 | Topotecan | Topotecan results in increased cleavage of CTNNB1 protein | 20457140 |
D014108 | Tosylphenylalanyl Chloromethyl Ketone | Tosylphenylalanyl Chloromethyl Ketone inhibits the reaction [Nitroglycerin inhibits the reaction [CTNNB1 protein binds to TCF4 protein]] | 17030184 |
D014108 | Tosylphenylalanyl Chloromethyl Ketone | Tosylphenylalanyl Chloromethyl Ketone inhibits the reaction [Nitroglycerin results in decreased localization of CTNNB1 protein] | 17030184 |
D014108 | Tosylphenylalanyl Chloromethyl Ketone | Tosylphenylalanyl Chloromethyl Ketone inhibits the reaction [Nitroglycerin results in increased degradation of and results in decreased activity of CTNNB1 protein] | 17030184 |
D014112 | Toxaphene | Toxaphene results in decreased expression of CTNNB1 mRNA | 21220043 |
D014118 | Toxins, Biological | Toxins, Biological affects the expression of CTNNB1 mRNA | 19682533 |
C005846 | tremolite | tremolite results in decreased expression of and affects the localization of CTNNB1 protein | 22578742 |
D014212 | Tretinoin | Arsenic Trioxide promotes the reaction [Tretinoin results in decreased expression of CTNNB1 protein] | 30093655 |
D014212 | Tretinoin | Tretinoin promotes the reaction [Arsenic Trioxide results in decreased expression of CTNNB1 protein] | 30093655 |
D014212 | Tretinoin | Tretinoin results in decreased expression of CTNNB1 mRNA | 21924320 |
D014212 | Tretinoin | Tretinoin results in decreased expression of CTNNB1 protein | 30093655 |
D014212 | Tretinoin | Tretinoin results in increased expression of CTNNB1 protein | 17219422 |
D014212 | Tretinoin | [Cholecalciferol co-treated with Tretinoin] affects the localization of CTNNB1 protein | 17170073 |
D014212 | Tretinoin | Tretinoin inhibits the reaction [Cholecalciferol results in increased expression of CTNNB1 mRNA] | 17170073 |
D014212 | Tretinoin | Tretinoin results in decreased expression of CTNNB1 protein | 17064353 |
D014212 | Tretinoin | Tretinoin results in increased expression of CTNNB1 mRNA | 16236135 |
C011559 | tributyltin | tributyltin results in increased expression of CTNNB1 mRNA | 26314263 |
D014241 | Trichloroethylene | Trichloroethylene results in decreased expression of CTNNB1 mRNA | 14565619 |
C012589 | trichostatin A | [3-deazaneplanocin co-treated with trichostatin A] affects the expression of CTNNB1 protein | 18538736 |
C012589 | trichostatin A | [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
C012589 | trichostatin A | trichostatin A inhibits the reaction [butylbenzyl phthalate affects the localization of CTNNB1 protein] | 22552774 |
C012589 | trichostatin A | trichostatin A inhibits the reaction [Dibutyl Phthalate affects the localization of CTNNB1 protein] | 22552774 |
C012589 | trichostatin A | trichostatin A results in increased expression of CTNNB1 mRNA | 24935251; 26272509; |
C012589 | trichostatin A | [estradiol dipropionate co-treated with trichostatin A] results in decreased expression of CTNNB1 protein | 15930180 |
D014302 | Trinitrobenzenesulfonic Acid | geraniol inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 mRNA] | 26165751 |
D014302 | Trinitrobenzenesulfonic Acid | geraniol inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 protein] | 26165751 |
D014302 | Trinitrobenzenesulfonic Acid | Sulfasalazine inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 mRNA] | 26165751 |
D014302 | Trinitrobenzenesulfonic Acid | Sulfasalazine inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 protein] | 26165751 |
D014302 | Trinitrobenzenesulfonic Acid | Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 mRNA | 26165751 |
D014302 | Trinitrobenzenesulfonic Acid | Trinitrobenzenesulfonic Acid results in increased expression of CTNNB1 protein | 26165751 |
C013320 | tris(2-butoxyethyl) phosphate | tris(2-butoxyethyl) phosphate results in increased expression of CTNNB1 mRNA | 26562049 |
C031324 | tris(chloroethyl)phosphate | tris(chloroethyl)phosphate results in increased expression of CTNNB1 mRNA | 27776230 |
D000077288 | Troglitazone | [Troglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of CTNNB1 mRNA | 20847119 |
D000077288 | Troglitazone | Troglitazone inhibits the reaction [tert-Butylhydroperoxide results in increased expression of CTNNB1 mRNA] | 20847119 |
D000077288 | Troglitazone | Troglitazone results in decreased expression of CTNNB1 | 15892897 |
D000077288 | Troglitazone | Troglitazone promotes the reaction [[beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CTNNB1 mRNA] | 30481989 |
D014501 | Uranium | Uranium analog results in decreased expression of CTNNB1 mRNA | 27544493 |
C005466 | ursolic acid | ursolic acid results in increased phosphorylation of and results in increased degradation of CTNNB1 protein | 24566423 |
D014635 | Valproic Acid | [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CTNNB1 mRNA | 27188386 |
D014635 | Valproic Acid | Valproic Acid affects the expression of CTNNB1 mRNA | 23179753 |
D014635 | Valproic Acid | Valproic Acid results in increased expression of CTNNB1 mRNA | 24383497; 24935251; 26272509; |
D014635 | Valproic Acid | Valproic Acid results in increased expression of CTNNB1 protein | 12942141; 20734317; |
D014638 | Vanadates | Vanadates results in increased phosphorylation of CTNNB1 protein | 12626337 |
D001335 | Vehicle Emissions | Vehicle Emissions results in decreased methylation of CTNNB1 gene | 25560391 |
D000069470 | Venlafaxine Hydrochloride | Venlafaxine Hydrochloride results in increased expression of CTNNB1 protein | 18511088 |
C025643 | vinclozolin | vinclozolin results in decreased expression of CTNNB1 mRNA | 21126777 |
C025643 | vinclozolin | vinclozolin affects the expression of CTNNB1 mRNA | 19015723 |
D014750 | Vincristine | CTNNB1 results in decreased susceptibility to Vincristine | 22000491 |
D014750 | Vincristine | Vincristine results in increased expression of CTNNB1 mRNA | 23649840 |
C017963 | vinyl carbamate | vinyl carbamate results in increased mutagenesis of CTNNB1 gene | 10467420 |
D014801 | Vitamin A | benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Vitamin A results in decreased expression of CTNNB1 protein] | 17219422 |
D014801 | Vitamin A | MG 262 inhibits the reaction [Vitamin A results in decreased expression of CTNNB1 protein] | 17219422 |
D014801 | Vitamin A | Vitamin A results in decreased expression of CTNNB1 protein | 17219422 |
D014801 | Vitamin A | Vitamin A results in increased ubiquitination of and results in increased degradation of CTNNB1 protein | 17219422 |
D014810 | Vitamin E | Vitamin E inhibits the reaction [Curcumin results in decreased expression of CTNNB1 protein] | 30935902 |
D014810 | Vitamin E | [Ascorbic Acid co-treated with Vitamin E] inhibits the reaction [Diethylhexyl Phthalate results in increased expression of and affects the localization of CTNNB1 protein] | 29940330 |
D014810 | Vitamin E | [Ascorbic Acid co-treated with Vitamin E] inhibits the reaction [mono-(2-ethylhexyl)phthalate affects the localization of CTNNB1 protein] | 29940330 |
D024483 | Vitamin K 3 | Vitamin K 3 results in decreased expression of CTNNB1 protein | 31238027 |
D000077337 | Vorinostat | Vorinostat results in increased expression of and results in increased activity of CTNNB1 protein | 17417771 |
D014859 | Warfarin | Warfarin results in decreased expression of and affects the localization of CTNNB1 protein | 26206560 |
D014859 | Warfarin | CTNNB1 protein affects the susceptibility to Warfarin | 23223575 |
D014859 | Warfarin | Quercetin inhibits the reaction [Warfarin results in increased expression of and affects the localization of CTNNB1 protein] | 23117658 |
D014859 | Warfarin | Warfarin results in increased expression of and affects the localization of CTNNB1 protein | 23117658 |
D014873 | Water Pollutants | Water Pollutants results in decreased expression of CTNNB1 mRNA | 23591932 |
D014873 | Water Pollutants | Water Pollutants results in decreased expression of CTNNB1 protein | 23591932 |
D014874 | Water Pollutants, Chemical | Water Pollutants, Chemical results in decreased expression of CTNNB1 mRNA | 25208076 |
C085514 | wogonin | Lithium Chloride inhibits the reaction [wogonin results in decreased expression of CTNNB1 protein] | 23872260 |
C085514 | wogonin | wogonin results in decreased expression of CTNNB1 protein | 23872260 |
C085514 | wogonin | wogonin results in increased expression of CTNNB1 protein modified form | 23872260 |
C085514 | wogonin | wogonin inhibits the reaction [Cisplatin results in increased expression of CTNNB1 protein] | 31103702 |
C085514 | wogonin | DKK1 protein promotes the reaction [wogonin results in decreased expression of CTNNB1 protein] | 23872260 |
D000077191 | Wortmannin | Wortmannin inhibits the reaction [4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of CTNNB1 protein] | 28321046 |
D000077191 | Wortmannin | Wortmannin inhibits the reaction [hydroxyflutamide results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
D000077191 | Wortmannin | Wortmannin inhibits the reaction [Testosterone results in decreased phosphorylation of CTNNB1 protein] | 28163245 |
D000077191 | Wortmannin | Wortmannin results in decreased expression of CTNNB1 protein | 11739494 |
D000077191 | Wortmannin | Wortmannin results in increased phosphorylation of CTNNB1 protein | 28163245 |
C544261 | XAV939 | XAV939 inhibits the reaction [CTNNB1 protein binds to CTNNBIP1 protein] | 24534281 |
C544261 | XAV939 | XAV939 inhibits the reaction [Lithium Chloride affects the localization of CTNNB1 protein] | 24534281 |
C544261 | XAV939 | XAV939 results in decreased expression of CTNNB1 protein | 25061499 |
C544261 | XAV939 | XAV939 results in decreased expression of CTNNB1 mRNA | 27226553 |
C544261 | XAV939 | XAV939 inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of CTNNB1 protein] | 24231000 |
C544261 | XAV939 | XAV939 results in decreased expression of CTNNB1 protein | 24231000 |
D015032 | Zinc | Zinc inhibits the reaction [[IFNG protein co-treated with TNF protein co-treated with N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine] results in increased cleavage of CTNNB1 protein] | 16844947 |
D015032 | Zinc | [Zinc co-treated with pyrithione] results in increased cleavage of CTNNB1 protein | 17098228 |
D015032 | Zinc | Zinc deficiency results in decreased activity of and results in decreased expression of CTNNB1 protein | 21893222 |
D019287 | Zinc Sulfate | Zinc Sulfate results in decreased expression of CTNNB1 mRNA | 17506889 |
D015054 | Zymosan | Zymosan results in increased expression of CTNNB1 protein | 11739494 |
Keyword ID | Keyword Term |
---|---|
KW-0002 | 3D-structure |
KW-0007 | Acetylation |
KW-0010 | Activator |
KW-0130 | Cell adhesion |
KW-0965 | Cell junction |
KW-1003 | Cell membrane |
KW-0966 | Cell projection |
KW-0160 | Chromosomal rearrangement |
KW-0963 | Cytoplasm |
KW-0206 | Cytoskeleton |
KW-0225 | Disease mutation |
KW-0325 | Glycoprotein |
KW-0945 | Host-virus interaction |
KW-0472 | Membrane |
KW-0991 | Mental retardation |
KW-0524 | Neurogenesis |
KW-0539 | Nucleus |
KW-0597 | Phosphoprotein |
KW-0621 | Polymorphism |
KW-1185 | Reference proteome |
KW-0677 | Repeat |
KW-0702 | S-nitrosylation |
KW-0770 | Synapse |
KW-0804 | Transcription |
KW-0805 | Transcription regulation |
KW-0832 | Ubl conjugation |
KW-0879 | Wnt signaling pathway |
PROSITE ID | PROSITE Term |
---|---|
PS50176 | ARM_REPEAT |
Pfam ID | Pfam Term |
---|---|
PF00514 | Arm |