CleftGeneDB-Search

Gene: CASP3

Basic information

Tag	Content
Uniprot ID	P42574; A8K5M2; D3DP53; Q96AN1; Q96KP2;
Entrez ID	836
Genbank protein ID	EAX04673.1; AAO25654.1; EAX04675.1; AAB60355.1; AAH16926.1; BAF84026.1; AAA65015.1; EAX04674.1; CAC88866.1; AAA74929.1;
Genbank nucleotide ID	XM_011532301.1; NM_032991.2; NM_004346.3;
Ensembl protein ID	ENSP00000311032; ENSP00000428929;
Ensembl nucleotide ID	ENSG00000164305
Gene name	Caspase-3
Gene symbol	CASP3
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Involved in the activation cascade of caspases responsible for apoptosis execution. At the onset of apoptosis it proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp-\|-Gly-217' bond. Cleaves and activates sterol regulatory element binding proteins (SREBPs) between the basic helix-loop-helix leucine zipper domain and the membrane attachment domain. Cleaves and activates caspase-6, -7 and -9. Involved in the cleavage of huntingtin. Triggers cell adhesion in sympathetic neurons through RET cleavage.
Sequence	MENTENSVDS KSIKNLEPKI IHGSESMDSG ISLDNSYKMD YPEMGLCIII NNKNFHKSTG 60 MTSRSGTDVD AANLRETFRN LKYEVRNKND LTREEIVELM RDVSKEDHSK RSSFVCVLLS 120 HGEEGIIFGT NGPVDLKKIT NFFRGDRCRS LTGKPKLFII QACRGTELDC GIETDSGVDD 180 DMACHKIPVE ADFLYAYSTA PGYYSWRNSK DGSWFIQSLC AMLKQYADKL EFMHILTRVN 240 RKVATEFESF SFDATFHAKK QIPCIVSMLT KELYFYH 277

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1CP3
1GFW
1I3O
1NME
1NMQ
1NMS
1PAU
1QX3
1RE1
1RHJ
1RHK
1RHM
1RHQ
1RHR
1RHU
2C1E
2C2K
2C2M
2C2O
2CDR
2CJX
2CJY
2CNK
2CNL
2CNN
2CNO
2DKO
2H5I
2H5J
2H65
2J30
2J31
2J32
2J33
2XYG
2XYH
2XYP
2XZD
2XZT
2Y0B
3DEH
3DEI
3DEJ
3DEK
3EDQ
3GJQ
3GJR
3GJS
3GJT
3H0E
3ITN
3KJF
3PCX
3PD0
3PD1
4DCJ
4DCO
4DCP
4EHA
4EHD
4EHF
4EHH
4EHK
4EHL
4EHN
4JJE
4JQY
4JQZ
4JR0
4PRY
4PS0
4QTX
4QTY
4QU0
4QU5
4QU8
4QU9
4QUA
4QUB
4QUD
4QUE
4QUG
4QUH
4QUI
4QUJ
4QUL
5I9B
5I9T
5IAB
5IAE
5IAG
5IAJ
5IAK
5IAN
5IAR
5IAS
5IBC
5IBP
5IBR
5IC4
1I3O
1NMS

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	CASP3		F1MB04		Bos taurus	Prediction	More>>
1:1 ortholog	CASP3	102177031	H9B8T7		Capra hircus	Prediction	More>>
1:1 ortholog	CASP3	100034083	F7A730		Equus caballus	Prediction	More>>
1:1 ortholog	CASP3	836	P42574		Homo sapiens	Prediction	More>>
1:1 ortholog	Casp3	12367	P70677	CPO	Mus musculus	Publication	More>>
1:1 ortholog	CASP3	461669	Q5IS54		Pan troglodytes	Prediction	More>>
1:1 ortholog	Casp3	25402	P55213		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs749601817	p.Asn3Lys	missense variant	-	NC_000004.12:g.184638445G>T	ExAC,TOPMed,gnomAD
rs1472060631	p.Thr4Ile	missense variant	-	NC_000004.12:g.184638443G>A	gnomAD
rs1459765876	p.Thr4Pro	missense variant	-	NC_000004.12:g.184638444T>G	TOPMed
rs773595817	p.Glu5Ter	stop gained	-	NC_000004.12:g.184638441C>A	ExAC
rs1325011265	p.Ser7Leu	missense variant	-	NC_000004.12:g.184638434G>A	TOPMed
rs950745993	p.Val8Met	missense variant	-	NC_000004.12:g.184638432C>T	TOPMed
rs950745993	p.Val8Leu	missense variant	-	NC_000004.12:g.184638432C>G	TOPMed
rs1194930579	p.Asp9Glu	missense variant	-	NC_000004.12:g.184638427A>C	gnomAD
rs1436898555	p.Lys11Ile	missense variant	-	NC_000004.12:g.184638422T>A	TOPMed
NCI-TCGA novel	p.Ser12Phe	missense variant	-	NC_000004.12:g.184638419G>A	NCI-TCGA
NCI-TCGA novel	p.Ser12Ala	missense variant	-	NC_000004.12:g.184638420A>C	NCI-TCGA
rs1489468017	p.Ile13Val	missense variant	-	NC_000004.12:g.184638417T>C	gnomAD
rs755080452	p.Pro18Thr	missense variant	-	NC_000004.12:g.184638402G>T	ExAC,TOPMed,gnomAD
rs755080452	p.Pro18Ser	missense variant	-	NC_000004.12:g.184638402G>A	ExAC,TOPMed,gnomAD
rs747108081	p.Pro18Leu	missense variant	-	NC_000004.12:g.184638401G>A	ExAC,gnomAD
rs527460051	p.Lys19Arg	missense variant	-	NC_000004.12:g.184635416T>C	1000Genomes
rs770128758	p.Ile20Met	missense variant	-	NC_000004.12:g.184635412G>C	ExAC,TOPMed,gnomAD
rs1293102297	p.Ile21Leu	missense variant	-	NC_000004.12:g.184635411T>G	gnomAD
rs35578277	p.His22Arg	missense variant	-	NC_000004.12:g.184635407T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs35578277	p.His22Arg	missense variant	-	NC_000004.12:g.184635407T>C	UniProt,dbSNP
VAR_048616	p.His22Arg	missense variant	-	NC_000004.12:g.184635407T>C	UniProt
rs776881401	p.Glu25Lys	missense variant	-	NC_000004.12:g.184635399C>T	ExAC,TOPMed,gnomAD
rs776881401	p.Glu25Lys	missense variant	-	NC_000004.12:g.184635399C>T	NCI-TCGA
rs201867896	p.Met27Val	missense variant	-	NC_000004.12:g.184635393T>C	ESP,ExAC,TOPMed,gnomAD
rs747072648	p.Ser29Phe	missense variant	-	NC_000004.12:g.184635386G>A	ExAC,gnomAD
rs1281685754	p.Ser32Pro	missense variant	-	NC_000004.12:g.184635378A>G	TOPMed
NCI-TCGA novel	p.Asp34Asn	missense variant	-	NC_000004.12:g.184635372C>T	NCI-TCGA
rs368927854	p.Lys38Asn	missense variant	-	NC_000004.12:g.184635358T>G	ESP,ExAC,TOPMed,gnomAD
rs1006886327	p.Met39Ile	missense variant	-	NC_000004.12:g.184635355C>A	TOPMed,gnomAD
rs1170107091	p.Pro42Leu	missense variant	-	NC_000004.12:g.184635347G>A	gnomAD
rs1411451236	p.Glu43Lys	missense variant	-	NC_000004.12:g.184635345C>T	gnomAD
rs548379586	p.Met44Arg	missense variant	-	NC_000004.12:g.184635341A>C	1000Genomes,ExAC
rs749226798	p.Cys47Tyr	missense variant	-	NC_000004.12:g.184635332C>T	ExAC,gnomAD
rs139792606	p.Ile48Val	missense variant	-	NC_000004.12:g.184635330T>C	ESP,ExAC,TOPMed,gnomAD
rs146079573	p.Ile50Leu	missense variant	-	NC_000004.12:g.184635324T>G	ESP,TOPMed
rs752593076	p.Asn51His	missense variant	-	NC_000004.12:g.184635321T>G	ExAC,gnomAD
rs780844343	p.Ser58Asn	missense variant	-	NC_000004.12:g.184635299C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Thr62Ala	missense variant	-	NC_000004.12:g.184632391T>C	NCI-TCGA
rs769869735	p.Arg64Trp	missense variant	-	NC_000004.12:g.184632385G>A	ExAC,TOPMed,gnomAD
rs747930965	p.Arg64Gln	missense variant	-	NC_000004.12:g.184632384C>T	ExAC,gnomAD
rs747930965	p.Arg64Gln	missense variant	-	NC_000004.12:g.184632384C>T	NCI-TCGA,NCI-TCGA Cosmic
rs1446038442	p.Gly66Asp	missense variant	-	NC_000004.12:g.184632378C>T	TOPMed
rs958101906	p.Asp68Asn	missense variant	-	NC_000004.12:g.184632373C>T	TOPMed,gnomAD
rs754598802	p.Val69Ile	missense variant	-	NC_000004.12:g.184632370C>T	ExAC,gnomAD
rs1354854000	p.Val69Ala	missense variant	-	NC_000004.12:g.184632369A>G	gnomAD
rs1333458950	p.Asp70Asn	missense variant	-	NC_000004.12:g.184632367C>T	gnomAD
rs1306969965	p.Ala71Val	missense variant	-	NC_000004.12:g.184632363G>A	gnomAD
NCI-TCGA novel	p.Leu74Ile	missense variant	-	NC_000004.12:g.184632355G>T	NCI-TCGA
rs751157550	p.Glu76Gln	missense variant	-	NC_000004.12:g.184632349C>G	ExAC,TOPMed,gnomAD
rs537053227	p.Phe78Leu	missense variant	-	NC_000004.12:g.184632341G>T	1000Genomes,ExAC,gnomAD
rs757872342	p.Arg79Ser	missense variant	-	NC_000004.12:g.184632338T>A	ExAC,TOPMed,gnomAD
rs199988965	p.Asn80Ser	missense variant	-	NC_000004.12:g.184632336T>C	1000Genomes,gnomAD
rs201901370	p.Asn80Asp	missense variant	-	NC_000004.12:g.184632337T>C	1000Genomes
rs749985298	p.Tyr83Cys	missense variant	-	NC_000004.12:g.184632327T>C	ExAC,gnomAD
rs988311277	p.Val85Ala	missense variant	-	NC_000004.12:g.184632321A>G	TOPMed
rs1363258170	p.Val85Ile	missense variant	-	NC_000004.12:g.184632322C>T	gnomAD
rs1181026854	p.Arg86Gly	missense variant	-	NC_000004.12:g.184632319T>C	gnomAD
rs1424266770	p.Asp90His	missense variant	-	NC_000004.12:g.184632307C>G	gnomAD
COSM279582	p.Asp90Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184632307C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu91Phe	missense variant	-	NC_000004.12:g.184632304G>A	NCI-TCGA
rs1258017334	p.Arg93Cys	missense variant	-	NC_000004.12:g.184632298G>A	TOPMed,gnomAD
rs1185617085	p.Arg93Leu	missense variant	-	NC_000004.12:g.184632297C>A	TOPMed,gnomAD
rs1185617085	p.Arg93His	missense variant	-	NC_000004.12:g.184632297C>T	TOPMed,gnomAD
rs1286350834	p.Glu95Gly	missense variant	-	NC_000004.12:g.184632291T>C	gnomAD
rs139516222	p.Met100Val	missense variant	-	NC_000004.12:g.184632277T>C	ESP,ExAC,TOPMed,gnomAD
rs567223280	p.Arg101Cys	missense variant	-	NC_000004.12:g.184632274G>A	ExAC,TOPMed,gnomAD
rs146285839	p.Arg101His	missense variant	-	NC_000004.12:g.184632273C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs567223280	p.Arg101Cys	missense variant	-	NC_000004.12:g.184632274G>A	NCI-TCGA,NCI-TCGA Cosmic
rs567223280	p.Arg101Gly	missense variant	-	NC_000004.12:g.184632274G>C	ExAC,TOPMed,gnomAD
rs1280426773	p.Lys105Glu	missense variant	-	NC_000004.12:g.184631935T>C	gnomAD
rs776636041	p.Glu106Gln	missense variant	-	NC_000004.12:g.184631932C>G	gnomAD
rs776636041	p.Glu106Lys	missense variant	-	NC_000004.12:g.184631932C>T	gnomAD
rs1326139353	p.Asp107His	missense variant	-	NC_000004.12:g.184631929C>G	gnomAD
rs1289153828	p.Asp107Gly	missense variant	-	NC_000004.12:g.184631928T>C	TOPMed
NCI-TCGA novel	p.His108Asn	missense variant	-	NC_000004.12:g.184631926G>T	NCI-TCGA
rs1487994914	p.Arg111Met	missense variant	-	NC_000004.12:g.184631916C>A	TOPMed
NCI-TCGA novel	p.Arg111Lys	missense variant	-	NC_000004.12:g.184631916C>T	NCI-TCGA
rs758078619	p.Ser112Asn	missense variant	-	NC_000004.12:g.184631913C>T	ExAC,gnomAD
rs758078619	p.Ser112Asn	missense variant	-	NC_000004.12:g.184631913C>T	NCI-TCGA
rs1205494037	p.Phe114Tyr	missense variant	-	NC_000004.12:g.184631907A>T	TOPMed
COSM1053703	p.Phe114Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184631908A>C	NCI-TCGA Cosmic
rs371766825	p.Val115Ile	missense variant	-	NC_000004.12:g.184631905C>T	ESP,ExAC,TOPMed,gnomAD
COSM6166914	p.Val115Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184631905C>A	NCI-TCGA Cosmic
rs778409347	p.Cys116Arg	missense variant	-	NC_000004.12:g.184631902A>G	ExAC
rs367650105	p.Cys116Trp	missense variant	-	NC_000004.12:g.184631900A>C	ESP,TOPMed,gnomAD
COSM4123698	p.Cys116Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184631901C>T	NCI-TCGA Cosmic
rs78678473	p.Val117Gly	missense variant	-	NC_000004.12:g.184631898A>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs78678473	p.Val117Ala	missense variant	-	NC_000004.12:g.184631898A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs754299277	p.Leu118Phe	missense variant	-	NC_000004.12:g.184631896G>A	ExAC,TOPMed,gnomAD
rs754299277	p.Leu118Ile	missense variant	-	NC_000004.12:g.184631896G>T	ExAC,TOPMed,gnomAD
rs1169496054	p.Glu124Val	missense variant	-	NC_000004.12:g.184631877T>A	gnomAD
rs753131848	p.Ile127Leu	missense variant	-	NC_000004.12:g.184631869T>G	ExAC,gnomAD
rs200935460	p.Pro133Ser	missense variant	-	NC_000004.12:g.184631851G>A	1000Genomes
rs763157710	p.Leu136Pro	missense variant	-	NC_000004.12:g.184631841A>G	ExAC,gnomAD
rs776400130	p.Lys137Glu	missense variant	-	NC_000004.12:g.184631839T>C	ExAC,gnomAD
rs1194497709	p.Ile139Leu	missense variant	-	NC_000004.12:g.184631833T>A	gnomAD
rs1194497709	p.Ile139Val	missense variant	-	NC_000004.12:g.184631833T>C	gnomAD
COSM3130250	p.Ile139Ter	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.184631833T>-	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile139AsnPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.184631832_184631833insT	NCI-TCGA
rs768687549	p.Asn141Asp	missense variant	-	NC_000004.12:g.184631827T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe143Ser	missense variant	-	NC_000004.12:g.184631820A>G	NCI-TCGA
rs1368903886	p.Gly145Glu	missense variant	-	NC_000004.12:g.184631814C>T	gnomAD
rs577739464	p.Arg147His	missense variant	-	NC_000004.12:g.184631808C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1457645538	p.Arg147Cys	missense variant	-	NC_000004.12:g.184631809G>A	TOPMed
rs1380983370	p.Cys148Arg	missense variant	-	NC_000004.12:g.184631806A>G	TOPMed
rs771653561	p.Leu151Val	missense variant	-	NC_000004.12:g.184631797G>C	ExAC,gnomAD
rs745505513	p.Thr152Ser	missense variant	-	NC_000004.12:g.184631793G>C	ExAC,gnomAD
NCI-TCGA novel	p.Gly153Glu	missense variant	-	NC_000004.12:g.184631790C>T	NCI-TCGA
rs778601566	p.Lys156Arg	missense variant	-	NC_000004.12:g.184631781T>C	ExAC,gnomAD
rs1026750296	p.Phe158Leu	missense variant	-	NC_000004.12:g.184631776A>G	TOPMed,gnomAD
COSM6099806	p.Gln161Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184631766T>A	NCI-TCGA Cosmic
COSM6099805	p.Gln161Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.184631767G>A	NCI-TCGA Cosmic
rs748702509	p.Ala162Gly	missense variant	-	NC_000004.12:g.184631156G>C	ExAC,gnomAD
rs777345631	p.Cys163Trp	missense variant	-	NC_000004.12:g.184631152G>C	ExAC,TOPMed,gnomAD
rs770145611	p.Arg164Cys	missense variant	-	NC_000004.12:g.184631151G>A	ExAC,TOPMed,gnomAD
rs1217567390	p.Arg164His	missense variant	-	NC_000004.12:g.184631150C>T	gnomAD
NCI-TCGA novel	p.Gly165Asp	missense variant	-	NC_000004.12:g.184631147C>T	NCI-TCGA
rs748655755	p.Asp169Gly	missense variant	-	NC_000004.12:g.184631135T>C	ExAC,gnomAD
NCI-TCGA novel	p.Cys170Arg	missense variant	-	NC_000004.12:g.184631133A>G	NCI-TCGA
rs781782069	p.Gly171Asp	missense variant	-	NC_000004.12:g.184631129C>T	ExAC,gnomAD
rs578008889	p.Ile172Val	missense variant	-	NC_000004.12:g.184631127T>C	1000Genomes,ExAC,gnomAD
rs1284696202	p.Ile172Thr	missense variant	-	NC_000004.12:g.184631126A>G	gnomAD
COSM4847792	p.Glu173Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184631124C>G	NCI-TCGA Cosmic
rs1416442983	p.Thr174Arg	missense variant	-	NC_000004.12:g.184631120G>C	gnomAD
rs1353298938	p.Ser176Gly	missense variant	-	NC_000004.12:g.184631115T>C	gnomAD
rs1400180838	p.Asp179Val	missense variant	-	NC_000004.12:g.184631105T>A	gnomAD
COSM1309927	p.Asp180His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184631103C>G	NCI-TCGA Cosmic
rs1156238121	p.Met182Val	missense variant	-	NC_000004.12:g.184631097T>C	gnomAD
rs1320816017	p.Met182Ile	missense variant	-	NC_000004.12:g.184631095C>T	TOPMed
rs80000647	p.Ala183Val	missense variant	-	NC_000004.12:g.184631093G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs750412530	p.Cys184Tyr	missense variant	-	NC_000004.12:g.184631090C>T	ExAC,gnomAD
rs765345221	p.His185Asn	missense variant	-	NC_000004.12:g.184631088G>T	ExAC,gnomAD
rs1208064959	p.His185Arg	missense variant	-	NC_000004.12:g.184631087T>C	TOPMed
rs1246331686	p.Pro188Gln	missense variant	-	NC_000004.12:g.184631078G>T	gnomAD
rs1247443028	p.Pro188Thr	missense variant	-	NC_000004.12:g.184631079G>T	TOPMed
rs1417526600	p.Val189Met	missense variant	-	NC_000004.12:g.184631076C>T	gnomAD
rs1049210	p.Glu190Asp	missense variant	-	NC_000004.12:g.184631071C>G	TOPMed
rs1049210	p.Glu190Asp	missense variant	-	NC_000004.12:g.184631071C>A	TOPMed
rs761945673	p.Glu190Gly	missense variant	-	NC_000004.12:g.184631072T>C	ExAC,gnomAD
rs752598551	p.Ala191Val	missense variant	-	NC_000004.12:g.184631069G>A	ExAC,gnomAD
rs543443896	p.Asp192Asn	missense variant	-	NC_000004.12:g.184631067C>T	-
NCI-TCGA novel	p.Asp192Glu	missense variant	-	NC_000004.12:g.184631065G>T	NCI-TCGA
rs759274147	p.Leu194Phe	missense variant	-	NC_000004.12:g.184631059C>G	ExAC,gnomAD
rs143138537	p.Thr199Ile	missense variant	-	NC_000004.12:g.184631045G>A	ESP,ExAC,TOPMed,gnomAD
rs1467034287	p.Gly202Asp	missense variant	-	NC_000004.12:g.184629501C>T	gnomAD
rs149499063	p.Arg207Gln	missense variant	-	NC_000004.12:g.184629486C>T	ESP,ExAC,TOPMed,gnomAD
rs757302190	p.Arg207Ter	stop gained	-	NC_000004.12:g.184629487G>A	ExAC,TOPMed,gnomAD
rs1309003064	p.Asp211Asn	missense variant	-	NC_000004.12:g.184629475C>T	gnomAD
rs754910045	p.Gln217His	missense variant	-	NC_000004.12:g.184629455C>A	ExAC,TOPMed,gnomAD
rs371145290	p.Ser218Leu	missense variant	-	NC_000004.12:g.184629453G>A	ESP,ExAC,TOPMed,gnomAD
rs1209850813	p.Met222Thr	missense variant	-	NC_000004.12:g.184629441A>G	TOPMed
rs1438069348	p.Met222Val	missense variant	-	NC_000004.12:g.184629442T>C	gnomAD
rs762726706	p.Gln225Arg	missense variant	-	NC_000004.12:g.184629432T>C	ExAC,gnomAD
NCI-TCGA novel	p.Gln225Pro	missense variant	-	NC_000004.12:g.184629432T>G	NCI-TCGA
rs137982553	p.Tyr226His	missense variant	-	NC_000004.12:g.184629430A>G	ESP,TOPMed,gnomAD
NCI-TCGA novel	p.Tyr226MetPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.184629430A>-	NCI-TCGA
rs772892566	p.Ala227Val	missense variant	-	NC_000004.12:g.184629426G>A	ExAC
rs1021939847	p.Asp228Glu	missense variant	-	NC_000004.12:g.184629422G>C	TOPMed
rs146955836	p.Asp228Asn	missense variant	-	NC_000004.12:g.184629424C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu231Gln	missense variant	-	NC_000004.12:g.184629415C>G	NCI-TCGA
rs1415201058	p.Met233Thr	missense variant	-	NC_000004.12:g.184629408A>G	gnomAD
rs1170037815	p.Met233Val	missense variant	-	NC_000004.12:g.184629409T>C	gnomAD
rs776313562	p.Met233Ile	missense variant	-	NC_000004.12:g.184629407C>T	ExAC,gnomAD
rs964440992	p.His234Gln	missense variant	-	NC_000004.12:g.184629404G>T	TOPMed,gnomAD
rs1036029017	p.Thr237Asn	missense variant	-	NC_000004.12:g.184629396G>T	TOPMed
rs917537082	p.Arg238Trp	missense variant	-	NC_000004.12:g.184629394G>A	TOPMed,gnomAD
rs747505178	p.Arg238Gln	missense variant	-	NC_000004.12:g.184629393C>T	ExAC,TOPMed,gnomAD
rs1429740601	p.Val239Ile	missense variant	-	NC_000004.12:g.184629391C>T	TOPMed,gnomAD
rs746265920	p.Arg241Leu	missense variant	-	NC_000004.12:g.184629384C>A	ExAC,TOPMed,gnomAD
rs370247095	p.Arg241Ter	stop gained	-	NC_000004.12:g.184629385G>A	ESP,ExAC,TOPMed,gnomAD
rs746265920	p.Arg241Gln	missense variant	-	NC_000004.12:g.184629384C>T	ExAC,TOPMed,gnomAD
rs757499609	p.Ala244Val	missense variant	-	NC_000004.12:g.184629375G>A	ExAC,TOPMed,gnomAD
COSM1319356	p.Ala244Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184629376C>T	NCI-TCGA Cosmic
rs749295788	p.Glu246Lys	missense variant	-	NC_000004.12:g.184629370C>T	ExAC,gnomAD
NCI-TCGA novel	p.Ser249Phe	missense variant	-	NC_000004.12:g.184629360G>A	NCI-TCGA
NCI-TCGA novel	p.Phe250Leu	missense variant	-	NC_000004.12:g.184629358A>G	NCI-TCGA
rs1393598499	p.Ala254Thr	missense variant	-	NC_000004.12:g.184629346C>T	TOPMed,gnomAD
rs751514857	p.Thr255Pro	missense variant	-	NC_000004.12:g.184629343T>G	ExAC,gnomAD
NCI-TCGA novel	p.Phe256Leu	missense variant	-	NC_000004.12:g.184629338A>C	NCI-TCGA
NCI-TCGA novel	p.Lys259HisPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.184629307_184629338AAACAATACATGGAATCTGTTTCTTTGCATGA>-	NCI-TCGA
rs761562836	p.Ile262Val	missense variant	-	NC_000004.12:g.184629322T>C	ExAC,gnomAD
rs761562836	p.Ile262Phe	missense variant	-	NC_000004.12:g.184629322T>A	ExAC,gnomAD
rs1380940766	p.Cys264Ser	missense variant	-	NC_000004.12:g.184629316A>T	gnomAD
rs372434595	p.Met268Ile	missense variant	-	NC_000004.12:g.184629302C>T	ESP,ExAC,TOPMed,gnomAD
rs1012893902	p.Glu272Asp	missense variant	-	NC_000004.12:g.184629290T>G	TOPMed
rs1037653105	p.Glu272Ter	stop gained	-	NC_000004.12:g.184629292C>A	TOPMed
rs760142031	p.Tyr274Ter	stop gained	-	NC_000004.12:g.184629284A>C	ExAC,gnomAD
rs369841492	p.Tyr276His	missense variant	-	NC_000004.12:g.184629280A>G	ESP,ExAC,TOPMed,gnomAD
rs147767351	p.His277Tyr	missense variant	-	NC_000004.12:g.184629277G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM6166915	p.His277Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.184629275G>C	NCI-TCGA Cosmic

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001418	Adenocarcinoma	group	BEFREE;LHGDN
C0001430	Adenoma	group	BEFREE
C0002152	Alloxan Diabetes	disease	CTD_human
C0002395	Alzheimer's Disease	disease	BEFREE;CTD_human;LHGDN
C0002726	Amyloidosis	disease	BEFREE
C0002736	Amyotrophic Lateral Sclerosis	disease	BEFREE;LHGDN;RGD
C0002871	Anemia	disease	BEFREE
C0002893	Refractory anemias	disease	BEFREE
C0002895	Anemia, Sickle Cell	disease	BEFREE
C0002940	Aneurysm	phenotype	BEFREE
C0003130	Anoxia	phenotype	LHGDN
C0003850	Arteriosclerosis	disease	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0004114	Astrocytoma	disease	BEFREE
C0004135	Ataxia Telangiectasia	disease	BEFREE
C0004153	Atherosclerosis	disease	BEFREE;LHGDN
C0004238	Atrial Fibrillation	disease	BEFREE
C0004509	Azoospermia	disease	BEFREE
C0005684	Malignant neoplasm of urinary bladder	disease	BEFREE
C0005695	Bladder Neoplasm	group	BEFREE
C0006111	Brain Diseases	group	BEFREE
C0006118	Brain Neoplasms	group	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0006413	Burkitt Lymphoma	disease	BEFREE
C0006625	Cachexia	phenotype	BEFREE
C0006663	Calcinosis	phenotype	CTD_human
C0006826	Malignant Neoplasms	group	BEFREE
C0007102	Malignant tumor of colon	disease	BEFREE
C0007103	Malignant neoplasm of endometrium	disease	BEFREE
C0007112	Adenocarcinoma of prostate	disease	BEFREE
C0007115	Malignant neoplasm of thyroid	disease	BEFREE
C0007131	Non-Small Cell Lung Carcinoma	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE
C0007137	Squamous cell carcinoma	disease	BEFREE;LHGDN
C0007138	Carcinoma, Transitional Cell	disease	BEFREE
C0007193	Cardiomyopathy, Dilated	group	BEFREE
C0007194	Hypertrophic Cardiomyopathy	disease	RGD
C0007758	Cerebellar Ataxia	phenotype	BEFREE
C0007766	Intracranial Aneurysm	disease	LHGDN
C0007785	Cerebral Infarction	disease	BEFREE
C0007786	Brain Ischemia	disease	CTD_human;LHGDN
C0007787	Transient Ischemic Attack	disease	RGD
C0007847	Malignant tumor of cervix	disease	BEFREE
C0008149	Chlamydia Infections	group	BEFREE
C0008479	Chondrosarcoma	disease	BEFREE
C0008626	Congenital chromosomal disease	group	BEFREE
C0009319	Colitis	disease	BEFREE
C0009324	Ulcerative Colitis	disease	BEFREE;CTD_human
C0009375	Colonic Neoplasms	group	LHGDN
C0009402	Colorectal Carcinoma	disease	BEFREE
C0010346	Crohn Disease	disease	BEFREE
C0010417	Cryptorchidism	disease	CTD_human
C0010674	Cystic Fibrosis	disease	BEFREE
C0011195	Dejerine-Sottas Disease (disorder)	disease	BEFREE
C0011265	Presenile dementia	disease	CTD_human
C0011615	Dermatitis, Atopic	disease	LHGDN
C0011847	Diabetes	disease	BEFREE
C0011849	Diabetes Mellitus	group	BEFREE
C0011853	Diabetes Mellitus, Experimental	disease	CTD_human
C0011854	Diabetes Mellitus, Insulin-Dependent	disease	BEFREE;RGD
C0011860	Diabetes Mellitus, Non-Insulin-Dependent	disease	BEFREE;CTD_human
C0011875	Diabetic Angiopathies	disease	CTD_human
C0011882	Diabetic Neuropathies	group	CTD_human;RGD
C0011884	Diabetic Retinopathy	disease	CTD_human;RGD
C0013080	Down Syndrome	disease	BEFREE;LHGDN
C0013264	Muscular Dystrophy, Duchenne	disease	BEFREE
C0013604	Edema	phenotype	CTD_human
C0014038	Encephalitis	disease	BEFREE
C0014070	Encephalomyelitis	disease	BEFREE
C0014476	Eperythrozoonosis	disease	CTD_human
C0014556	Epilepsy, Temporal Lobe	disease	LHGDN
C0014859	Esophageal Neoplasms	group	BEFREE
C0014868	Esophagitis	disease	BEFREE
C0015625	Fanconi Anemia	disease	BEFREE
C0015695	Fatty Liver	disease	BEFREE
C0015923	Fetal Alcohol Syndrome	disease	BEFREE
C0016719	Friedreich Ataxia	disease	BEFREE
C0017097	Gardner Syndrome	disease	BEFREE
C0017601	Glaucoma	disease	LHGDN
C0017636	Glioblastoma	disease	BEFREE;LHGDN
C0017638	Glioma	disease	BEFREE;LHGDN
C0017668	Focal glomerulosclerosis	disease	BEFREE
C0018790	Cardiac Arrest	disease	BEFREE
C0018801	Heart failure	disease	BEFREE
C0018802	Congestive heart failure	disease	BEFREE
C0018824	Heart valve disease	group	CTD_human
C0019158	Hepatitis	disease	BEFREE
C0019159	Hepatitis A	disease	BEFREE
C0019163	Hepatitis B	disease	BEFREE
C0019189	Hepatitis, Chronic	disease	BEFREE;CTD_human
C0019196	Hepatitis C	disease	BEFREE
C0019348	Herpes Simplex Infections	group	BEFREE
C0019693	HIV Infections	group	BEFREE
C0019829	Hodgkin Disease	disease	BEFREE;LHGDN
C0020179	Huntington Disease	disease	BEFREE
C0020456	Hyperglycemia	disease	BEFREE
C0020538	Hypertensive disease	group	RGD
C0021400	Influenza	disease	BEFREE;LHGDN
C0021670	insulinoma	disease	BEFREE
C0021775	Intermittent Claudication	phenotype	RGD
C0021831	Intestinal Diseases	group	RGD
C0021841	Intestinal Neoplasms	group	BEFREE
C0021846	Intestinal Polyps	phenotype	BEFREE
C0022336	Creutzfeldt-Jakob disease	disease	BEFREE
C0022548	Keloid	phenotype	BEFREE
C0023267	Fibroid Tumor	group	BEFREE
C0023418	leukemia	disease	BEFREE;LHGDN
C0023434	Chronic Lymphocytic Leukemia	disease	BEFREE
C0023449	Acute lymphocytic leukemia	disease	BEFREE
C0023452	Childhood Acute Lymphoblastic Leukemia	disease	BEFREE
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE
C0023470	Myeloid Leukemia	disease	BEFREE
C0023473	Myeloid Leukemia, Chronic	disease	BEFREE
C0023487	Acute Promyelocytic Leukemia	disease	BEFREE
C0023492	Leukemia, T-Cell	disease	BEFREE
C0023493	Adult T-Cell Lymphoma/Leukemia	disease	BEFREE
C0023521	Globoid cell leukodystrophy	disease	BEFREE
C0023530	Leukopenia	disease	BEFREE
C0023903	Liver neoplasms	group	BEFREE
C0024117	Chronic Obstructive Airway Disease	disease	BEFREE
C0024121	Lung Neoplasms	group	BEFREE;LHGDN
C0024141	Lupus Erythematosus, Systemic	disease	BEFREE;LHGDN
C0024143	Lupus Nephritis	disease	LHGDN
C0024299	Lymphoma	group	BEFREE;LHGDN
C0024301	Lymphoma, Follicular	disease	BEFREE
C0024302	Reticulosarcoma	disease	BEFREE
C0024305	Lymphoma, Non-Hodgkin	disease	BEFREE;LHGDN
C0024620	Primary Malignant Liver Neoplasm	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0024899	Mastocytosis	disease	BEFREE
C0025007	Measles	disease	BEFREE
C0025202	melanoma	disease	BEFREE;LHGDN
C0025286	Meningioma	disease	BEFREE;LHGDN
C0025295	Meningitis, Pneumococcal	disease	LHGDN
C0025500	Mesothelioma	disease	BEFREE;LHGDN
C0025568	Metaplasia	phenotype	LHGDN
C0025945	Microangiopathy, Diabetic	disease	CTD_human
C0026277	Mixed Salivary Gland Tumor	disease	BEFREE
C0026654	Moyamoya Disease	disease	BEFREE;LHGDN
C0026691	Mucocutaneous Lymph Node Syndrome	disease	BEFREE
C0026764	Multiple Myeloma	disease	BEFREE
C0026896	Myasthenia Gravis	disease	BEFREE
C0026918	Mycobacterium Infections	group	BEFREE
C0026936	Mycoplasma Infections	group	CTD_human
C0027022	Myeloproliferative disease	group	BEFREE
C0027051	Myocardial Infarction	disease	BEFREE;CTD_human
C0027055	Myocardial Reperfusion Injury	phenotype	CTD_human
C0027059	Myocarditis	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027746	Nerve Degeneration	phenotype	CTD_human
C0027765	nervous system disorder	group	BEFREE;CTD_human
C0027819	Neuroblastoma	group	BEFREE
C0027947	Neutropenia	disease	BEFREE
C0028754	Obesity	disease	BEFREE
C0028968	Olivopontocerebellar Atrophies	disease	BEFREE
C0029408	Degenerative polyarthritis	disease	BEFREE
C0029453	Osteopenia	disease	BEFREE
C0029463	Osteosarcoma	disease	BEFREE;LHGDN
C0029925	Ovarian Carcinoma	disease	BEFREE
C0030297	Pancreatic Neoplasm	disease	BEFREE
C0030305	Pancreatitis	disease	RGD
C0030567	Parkinson Disease	disease	BEFREE;LHGDN
C0031099	Periodontitis	disease	BEFREE
C0032000	Pituitary Adenoma	disease	BEFREE
C0032019	Pituitary Neoplasms	group	BEFREE
C0032580	Adenomatous Polyposis Coli	disease	BEFREE
C0032927	Precancerous Conditions	group	BEFREE
C0034067	Pulmonary Emphysema	disease	BEFREE
C0034069	Pulmonary Fibrosis	disease	BEFREE
C0034155	Purpura, Thrombotic Thrombocytopenic	disease	BEFREE
C0034189	Pyemia	phenotype	CTD_human
C0034885	Rectal Neoplasms	group	LHGDN
C0035112	Reoviridae Infections	group	BEFREE
C0035126	Reperfusion Injury	disease	CTD_human
C0035305	Retinal Detachment	disease	CTD_human
C0035309	Retinal Diseases	group	RGD
C0035335	Retinoblastoma	disease	BEFREE;LHGDN
C0035412	Rhabdomyosarcoma	disease	BEFREE
C0036220	Kaposi Sarcoma	disease	BEFREE
C0036341	Schizophrenia	disease	BEFREE;PSYGENET
C0036421	Systemic Scleroderma	disease	LHGDN
C0036572	Seizures	phenotype	BEFREE
C0036646	Age-related cataract	disease	BEFREE
C0036690	Septicemia	disease	CTD_human
C0037116	Silicosis	disease	BEFREE
C0037286	Skin Neoplasms	group	BEFREE
C0037929	Spinal Cord Injuries	group	CTD_human
C0038220	Status Epilepticus	disease	CTD_human;RGD
C0038356	Stomach Neoplasms	group	LHGDN
C0038433	Streptozotocin Diabetes	disease	CTD_human
C0038454	Cerebrovascular accident	group	BEFREE
C0038525	Subarachnoid Hemorrhage	disease	CTD_human
C0039101	synovial sarcoma	disease	BEFREE
C0039445	Hereditary hemorrhagic telangiectasia	disease	BEFREE
C0039585	Androgen-Insensitivity Syndrome	disease	BEFREE
C0041582	Ulcer	disease	BEFREE
C0042133	Uterine Fibroids	group	BEFREE
C0042344	Varicose Ulcer	disease	BEFREE
C0042373	Vascular Diseases	group	BEFREE
C0042721	Viral hepatitis	group	BEFREE
C0042769	Virus Diseases	group	BEFREE
C0042963	Vomiting	phenotype	BEFREE
C0042995	Vulvar Neoplasms	group	LHGDN
C0043194	Wiskott-Aldrich Syndrome	disease	BEFREE
C0079218	Fibromatosis, Aggressive	disease	BEFREE
C0079588	Ichthyosis, X-Linked	disease	BEFREE
C0079731	B-Cell Lymphomas	group	BEFREE
C0079744	Diffuse Large B-Cell Lymphoma	disease	BEFREE;LHGDN
C0079773	Lymphoma, T-Cell, Cutaneous	disease	BEFREE
C0085077	Sweet Syndrome	disease	BEFREE
C0085106	Familial benign pemphigus	disease	BEFREE
C0085110	Severe Combined Immunodeficiency	disease	BEFREE
C0085167	Granular cell tumor	disease	BEFREE
C0085584	Encephalopathies	group	BEFREE
C0086543	Cataract	disease	BEFREE
C0086981	Sicca Syndrome	disease	BEFREE
C0087012	Ataxia, Spinocerebellar	disease	BEFREE
C0149504	Encephalopathy, Toxic	disease	CTD_human
C0149519	Chronic Persistent Hepatitis	disease	CTD_human
C0149678	Epstein-Barr Virus Infections	group	BEFREE
C0149782	Squamous cell carcinoma of lung	disease	BEFREE
C0149925	Small cell carcinoma of lung	disease	BEFREE
C0151546	Oral Cavity Carcinoma	disease	BEFREE
C0151603	Anasarca	phenotype	CTD_human
C0152013	Adenocarcinoma of lung (disorder)	disease	BEFREE
C0152018	Esophageal carcinoma	disease	BEFREE
C0153381	Malignant neoplasm of mouth	disease	BEFREE
C0153676	Secondary malignant neoplasm of lung	disease	BEFREE
C0153690	Secondary malignant neoplasm of bone	disease	BEFREE
C0154659	Toxic Encephalitis	disease	CTD_human
C0155626	Acute myocardial infarction	disease	BEFREE
C0155728	Other specified transient cerebral ischemias	disease	RGD
C0158252	Intervertebral disc disorder	group	BEFREE
C0158266	Intervertebral Disc Degeneration	disease	BEFREE
C0162309	Adrenoleukodystrophy	disease	BEFREE
C0162557	Liver Failure, Acute	disease	BEFREE
C0162810	Cicatrix, Hypertrophic	phenotype	BEFREE
C0175699	Saethre-Chotzen Syndrome	disease	BEFREE
C0178874	Tumor Progression	phenotype	BEFREE
C0202117	Low density lipoprotein cholesterol measurement	phenotype	GWASDB
C0202236	Triglycerides measurement	phenotype	GWASDB
C0206139	Lichen Planus, Oral	disease	LHGDN
C0206180	Ki-1+ Anaplastic Large Cell Lymphoma	disease	BEFREE;LHGDN
C0206634	Liposarcoma, Myxoid	disease	BEFREE
C0206659	Embryonal Carcinoma	disease	BEFREE
C0206692	Carcinoma, Lobular	disease	BEFREE
C0206695	Carcinoma, Neuroendocrine	group	BEFREE
C0206698	Cholangiocarcinoma	disease	BEFREE
C0206733	Strawberry nevus of skin	disease	BEFREE
C0206743	Rhabdoid Tumor	disease	BEFREE
C0220620	Gastrointestinal Carcinoid Tumor	disease	BEFREE
C0220641	Lip and Oral Cavity Carcinoma	disease	BEFREE
C0220668	Congenital contractural arachnodactyly	disease	BEFREE
C0234213	Sensory denervation disorder	phenotype	BEFREE
C0235032	Neurotoxicity Syndromes	group	CTD_human
C0235974	Pancreatic carcinoma	disease	BEFREE
C0236642	Pick Disease of the Brain	disease	BEFREE
C0238461	Anaplastic thyroid carcinoma	disease	BEFREE
C0238462	Medullary carcinoma of thyroid	disease	BEFREE
C0239946	Fibrosis, Liver	disease	BEFREE
C0242350	Erectile dysfunction	disease	RGD
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0242647	Mucosa-Associated Lymphoid Tissue Lymphoma	disease	BEFREE
C0243026	Sepsis	disease	BEFREE;CTD_human
C0262404	Cerebellar degeneration	disease	BEFREE
C0262929	Myxoma of the Endocardium	disease	BEFREE
C0263628	Tumoral calcinosis	disease	CTD_human
C0268281	Infantile neuronal ceroid lipofuscinosis	disease	BEFREE
C0270192	Perinatal Subarachnoid Hemorrhage	phenotype	CTD_human
C0270726	Alexander Disease	disease	BEFREE
C0270814	Spastic syndrome	disease	BEFREE
C0270823	Petit mal status	disease	CTD_human
C0271673	Symmetric Diabetic Proximal Motor Neuropathy	disease	CTD_human
C0271674	Asymmetric Diabetic Proximal Motor Neuropathy	disease	CTD_human
C0271678	Diabetic Mononeuropathy	disease	CTD_human
C0271680	Diabetic Polyneuropathies	group	CTD_human
C0271685	Diabetic Amyotrophy	disease	CTD_human
C0271686	Diabetic Autonomic Neuropathy	disease	CTD_human
C0276496	Familial Alzheimer Disease (FAD)	disease	BEFREE;CTD_human
C0278504	Non-small cell lung cancer stage I	disease	BEFREE
C0278996	Malignant Head and Neck Neoplasm	disease	BEFREE
C0279000	Liver and Intrahepatic Biliary Tract Carcinoma	disease	BEFREE
C0279530	Malignant Bone Neoplasm	disease	BEFREE
C0279626	Squamous cell carcinoma of esophagus	disease	BEFREE
C0279702	Conventional (Clear Cell) Renal Cell Carcinoma	disease	BEFREE
C0280100	Solid Neoplasm	phenotype	BEFREE
C0302592	Cervix carcinoma	disease	BEFREE
C0311335	Grand Mal Status Epilepticus	disease	CTD_human
C0333307	Superficial ulcer	phenotype	BEFREE
C0333463	Senile Plaques	phenotype	BEFREE
C0334590	Anaplastic Oligodendroglioma	disease	BEFREE
C0334634	Malignant lymphoma, lymphocytic, intermediate differentiation, diffuse	disease	BEFREE
C0334663	Histiocytic sarcoma	disease	BEFREE
C0338106	Adenocarcinoma of colon	disease	BEFREE
C0338451	Frontotemporal dementia	disease	BEFREE
C0338656	Impaired cognition	disease	BEFREE
C0339546	Retinal Pigment Epithelial Detachment	disease	CTD_human
C0341177	Gastric erosions	disease	BEFREE
C0342731	Deficiency of mevalonate kinase	disease	BEFREE
C0342782	Depletion of mitochondrial DNA	disease	BEFREE
C0345904	Malignant neoplasm of liver	disease	BEFREE
C0346421	Chronic eosinophilic leukemia	disease	BEFREE
C0346429	Multiple malignancy	phenotype	BEFREE
C0346647	Malignant neoplasm of pancreas	disease	BEFREE
C0349566	Squamous cell carcinoma of tongue	disease	BEFREE
C0349782	Ischemic cardiomyopathy	disease	BEFREE
C0375023	Respiratory syncytial virus (RSV) infection in conditions classified elsewhere and of unspecified site	disease	BEFREE
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0393734	Complex Partial Status Epilepticus	disease	CTD_human
C0393835	Diabetic Asymmetric Polyneuropathy	disease	CTD_human
C0393971	Spinal cord stroke	disease	BEFREE
C0398367	Histiocytic Necrotizing Lymphadenitis	disease	BEFREE
C0410480	Avascular Necrosis of Femur Head	phenotype	BEFREE
C0431406	Asymmetric crying face association	disease	BEFREE
C0431663	Bilateral Cryptorchidism	disease	CTD_human
C0431664	Unilateral Cryptorchidism	disease	CTD_human
C0432412	Chromosome 8, trisomy	disease	BEFREE
C0433895	Spinal Cord Contusion	disease	CTD_human
C0433900	Spinal Cord Laceration	disease	CTD_human
C0433905	Spinal Cord transection injury	disease	CTD_human
C0472383	Subarachnoid Hemorrhage, Spontaneous	phenotype	CTD_human
C0476089	Endometrial Carcinoma	disease	BEFREE
C0494165	Secondary malignant neoplasm of liver	disease	BEFREE
C0494463	Alzheimer Disease, Late Onset	disease	CTD_human
C0520463	Chronic active hepatitis	disease	CTD_human
C0521158	Recurrent tumor	phenotype	BEFREE
C0521174	Microcalcification	phenotype	CTD_human
C0524611	Cryptogenic Chronic Hepatitis	disease	CTD_human
C0524851	Neurodegenerative Disorders	group	BEFREE;LHGDN
C0524910	Hepatitis C, Chronic	disease	BEFREE
C0545074	Myxoid/Round Cell Liposarcoma	disease	BEFREE
C0546126	Acute Confusional Senile Dementia	disease	CTD_human
C0546837	Malignant neoplasm of esophagus	disease	BEFREE
C0549473	Thyroid carcinoma	disease	BEFREE
C0555198	Malignant Glioma	disease	BEFREE
C0564567	Impulsive character (finding)	phenotype	BEFREE
C0566602	Primary sclerosing cholangitis	disease	BEFREE
C0574083	3-Methylglutaconic aciduria type 2	disease	BEFREE
C0584960	Factor V Leiden mutation	disease	BEFREE
C0585442	Osteosarcoma of bone	disease	BEFREE
C0595989	Carcinoma of larynx	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0677886	Epithelial ovarian cancer	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0684249	Carcinoma of lung	disease	BEFREE
C0685938	Malignant neoplasm of gastrointestinal tract	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0699885	Carcinoma of bladder	disease	BEFREE
C0700095	Central neuroblastoma	disease	BEFREE
C0740392	Infarction, Middle Cerebral Artery	disease	RGD
C0740457	Malignant neoplasm of kidney	disease	BEFREE
C0750900	Alzheimer's Disease, Focal Onset	disease	CTD_human
C0750901	Alzheimer Disease, Early Onset	disease	CTD_human
C0751074	Diabetic Neuralgia	disease	CTD_human
C0751515	Post-Traumatic Myelopathy	disease	CTD_human
C0751522	Status Epilepticus, Subclinical	disease	CTD_human
C0751523	Non-Convulsive Status Epilepticus	disease	CTD_human
C0751524	Simple Partial Status Epilepticus	disease	CTD_human
C0751530	Subarachnoid Hemorrhage, Aneurysmal	phenotype	CTD_human
C0751651	Mitochondrial Diseases	group	BEFREE
C0751781	Dentatorubral-Pallidoluysian Atrophy	disease	BEFREE
C0752124	Spinocerebellar Ataxia Type 6 (disorder)	disease	BEFREE
C0752125	Spinocerebellar Ataxia Type 7	disease	BEFREE
C0795688	Subarachnoid Hemorrhage, Intracranial	phenotype	CTD_human
C0796074	MOHR-TRANEBJAERG SYNDROME	disease	BEFREE
C0796126	AICARDI-GOUTIERES SYNDROME 1	disease	BEFREE
C0812413	Malignant Pleural Mesothelioma	disease	BEFREE
C0850572	Adenomatous polyp of colon	disease	BEFREE
C0850666	Infection caused by Helicobacter pylori	disease	BEFREE
C0853105	Penis carcinoma	disease	BEFREE
C0917796	Optic Atrophy, Hereditary, Leber	disease	BEFREE
C0917798	Cerebral Ischemia	disease	BEFREE;CTD_human
C0919267	ovarian neoplasm	disease	LHGDN
C0936223	Metastatic Prostate Carcinoma	disease	BEFREE
C0949658	Cardiomyopathy, Hypertrophic, Familial	disease	RGD
C1096063	Drug Resistant Epilepsy	disease	BEFREE
C1096184	West Nile viral infection	disease	BEFREE
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE
C1176475	Ductal Carcinoma	disease	BEFREE
C1258666	Myxoid cyst	disease	BEFREE
C1261473	Sarcoma	group	BEFREE
C1266025	Traditional Serrated Adenoma	disease	BEFREE
C1270972	Mild cognitive disorder	disease	BEFREE
C1275126	TNF receptor-associated periodic fever syndrome (TRAPS)	disease	BEFREE
C1275685	Avellino corneal dystrophy	disease	BEFREE
C1282496	Metastasis from malignant tumor of prostate	disease	BEFREE
C1292753	Primary Effusion Lymphoma	disease	BEFREE
C1292778	Chronic myeloproliferative disorder	disease	BEFREE
C1306459	Primary malignant neoplasm	group	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1319315	Adenocarcinoma of large intestine	disease	BEFREE
C1328504	Hormone refractory prostate cancer	disease	BEFREE
C1332986	Childhood Osteosarcoma	disease	BEFREE
C1336708	Testicular Germ Cell Tumor	disease	BEFREE
C1367654	Marginal Zone B-Cell Lymphoma	disease	BEFREE
C1368771	Burkitt-like lymphoma	disease	BEFREE
C1378703	Renal carcinoma	disease	BEFREE
C1384583	Congenital absence of germinal epithelium of testes	disease	LHGDN
C1412014	Infiltrating duct carcinoma	disease	BEFREE
C1458155	Mammary Neoplasms	group	BEFREE;LHGDN
C1512409	Hepatocarcinogenesis	disease	BEFREE
C1519670	Tumor Angiogenesis	phenotype	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1527336	Sjogren's Syndrome	disease	BEFREE
C1527390	Neoplasms, Intracranial	group	BEFREE
C1561643	Chronic Kidney Diseases	group	BEFREE
C1563730	Abdominal Cryptorchidism	disease	CTD_human
C1563731	Inguinal Cryptorchidism	phenotype	CTD_human
C1621958	Glioblastoma Multiforme	disease	BEFREE
C1654637	androgen independent prostate cancer	disease	BEFREE
C1704272	Benign Prostatic Hyperplasia	disease	BEFREE
C1719672	Severe Sepsis	disease	CTD_human
C1720189	Episodic Ataxia	disease	BEFREE
C1720416	Episodic ataxia type 2 (disorder)	disease	BEFREE
C1720983	Channelopathies	group	BEFREE
C1762616	Meningioma, benign, no ICD-O subtype	disease	BEFREE
C1800706	Idiopathic Pulmonary Fibrosis	disease	BEFREE
C1848296	DOSAGE-SENSITIVE SEX REVERSAL	disease	BEFREE
C1851841	ECTRODACTYLY, ECTODERMAL DYSPLASIA, AND CLEFT LIP/PALATE SYNDROME 1	disease	BEFREE
C1853578	Neuroferritinopathy	disease	BEFREE
C1853926	NONAKA MYOPATHY	disease	BEFREE
C1856689	FRIEDREICH ATAXIA 1	disease	BEFREE
C1864040	Cerebral Cavernous Malformations 3	disease	BEFREE
C1876165	Copper-Overload Cirrhosis	disease	CTD_human
C1883486	Uterine Corpus Cancer	disease	BEFREE
C1959626	Mevalonic Aciduria	disease	BEFREE
C1959635	Parvovirus B19 (disease)	disease	BEFREE
C1960546	Myxoma of heart	disease	BEFREE
C1961099	Precursor T-Cell Lymphoblastic Leukemia-Lymphoma	disease	BEFREE
C1961102	Precursor Cell Lymphoblastic Leukemia Lymphoma	disease	BEFREE
C1997217	Low grade glioma	disease	BEFREE
C2004493	Leukemia, B-Cell	disease	BEFREE
C2145472	Urothelial Carcinoma	disease	BEFREE
C2239176	Liver carcinoma	disease	BEFREE;LHGDN
C2711227	Steatohepatitis	disease	BEFREE
C2717836	Steroid Sulfatase Deficiency Disease	disease	BEFREE
C2745900	Promyelocytic leukemia	disease	BEFREE
C2751492	AMYLOIDOSIS, HEREDITARY, TRANSTHYRETIN-RELATED	disease	BEFREE
C2931384	Moyamoya disease 1	disease	BEFREE
C2931822	Nasopharyngeal carcinoma	disease	BEFREE
C2931852	Clear-cell metastatic renal cell carcinoma	disease	BEFREE
C2936349	Plaque, Amyloid	phenotype	BEFREE
C2937358	Cerebral Hemorrhage	phenotype	CTD_human
C2945695	Limb ischemia	disease	BEFREE
C3160718	PARKINSON DISEASE, LATE-ONSET	disease	BEFREE
C3241937	Nonalcoholic Steatohepatitis	disease	BEFREE
C3463824	MYELODYSPLASTIC SYNDROME	group	BEFREE;LHGDN
C3469521	FANCONI ANEMIA, COMPLEMENTATION GROUP A (disorder)	disease	BEFREE
C3536893	Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor	disease	BEFREE
C3714514	Infection	group	LHGDN
C3714948	PACHYONYCHIA CONGENITA 3	disease	BEFREE
C3887486	Interstitial lung fibrosis	phenotype	BEFREE
C3887524	Skin Erosion	disease	BEFREE
C3888194	MIXED LINEAGE LEUKEMIA	disease	BEFREE
C4048328	cervical cancer	disease	BEFREE
C4054121	Rat Insulinoma	disease	BEFREE
C4082937	Necrotizing enterocolitis in fetus OR newborn	disease	BEFREE
C4302111	Familial M?ni?re disease	disease	GENOMICS_ENGLAND
C4317089	Infantile hemangioma	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0002020	protease binding	IEA
GO:0004190	aspartic-type endopeptidase activity	IEA
GO:0004197	cysteine-type endopeptidase activity	IDA
GO:0004861	cyclin-dependent protein serine/threonine kinase inhibitor activity	IEA
GO:0005123	death receptor binding	IEA
GO:0005515	protein binding	IPI
GO:0008233	peptidase activity	IDA
GO:0016005	phospholipase A2 activator activity	IEA
GO:0044877	protein-containing complex binding	IEA
GO:0097153	cysteine-type endopeptidase activity involved in apoptotic process	IMP
GO:0097153	cysteine-type endopeptidase activity involved in apoptotic process	IBA
GO:0097153	cysteine-type endopeptidase activity involved in apoptotic process	IDA
GO:0097199	cysteine-type endopeptidase activity involved in apoptotic signaling pathway	IMP
GO:0097200	cysteine-type endopeptidase activity involved in execution phase of apoptosis	IMP

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001554	luteolysis	IEA
GO:0001666	response to hypoxia	IEA
GO:0001782	B cell homeostasis	IEA
GO:0006309	apoptotic DNA fragmentation	TAS
GO:0006508	proteolysis	IDA
GO:0006915	apoptotic process	IMP
GO:0006915	apoptotic process	IBA
GO:0006974	cellular response to DNA damage stimulus	IEA
GO:0007413	axonal fasciculation	IEA
GO:0007507	heart development	IEA
GO:0007605	sensory perception of sound	IEA
GO:0007611	learning or memory	IEA
GO:0008627	intrinsic apoptotic signaling pathway in response to osmotic stress	IEA
GO:0009411	response to UV	IEA
GO:0009749	response to glucose	IEA
GO:0010165	response to X-ray	IEA
GO:0016241	regulation of macroautophagy	TAS
GO:0016485	protein processing	IEA
GO:0019221	cytokine-mediated signaling pathway	TAS
GO:0021766	hippocampus development	IEA
GO:0030182	neuron differentiation	IBA
GO:0030216	keratinocyte differentiation	IBA
GO:0030218	erythrocyte differentiation	IDA
GO:0030218	erythrocyte differentiation	TAS
GO:0030218	erythrocyte differentiation	IBA
GO:0030220	platelet formation	TAS
GO:0030889	negative regulation of B cell proliferation	IEA
GO:0031647	regulation of protein stability	IDA
GO:0032025	response to cobalt ion	IEA
GO:0032355	response to estradiol	IEA
GO:0032496	response to lipopolysaccharide	IEA
GO:0034349	glial cell apoptotic process	IEA
GO:0034612	response to tumor necrosis factor	TAS
GO:0035094	response to nicotine	IEA
GO:0035329	hippo signaling	TAS
GO:0042060	wound healing	IEA
GO:0042542	response to hydrogen peroxide	IEA
GO:0043029	T cell homeostasis	IEA
GO:0043066	negative regulation of apoptotic process	IGI
GO:0043085	positive regulation of catalytic activity	IEA
GO:0043200	response to amino acid	IEA
GO:0043525	positive regulation of neuron apoptotic process	IEA
GO:0045165	cell fate commitment	IEA
GO:0045736	negative regulation of cyclin-dependent protein serine/threonine kinase activity	IEA
GO:0046007	negative regulation of activated T cell proliferation	IEA
GO:0048011	neurotrophin TRK receptor signaling pathway	IDA
GO:0051146	striated muscle cell differentiation	IEA
GO:0051384	response to glucocorticoid	IEA
GO:0051402	neuron apoptotic process	IEA
GO:0061713	anterior neural tube closure	IEA
GO:0071887	leukocyte apoptotic process	IEA
GO:0072734	cellular response to staurosporine	IMP
GO:0097190	apoptotic signaling pathway	TAS
GO:0097192	extrinsic apoptotic signaling pathway in absence of ligand	TAS
GO:0097194	execution phase of apoptosis	IMP
GO:0097194	execution phase of apoptosis	IDA
GO:0097194	execution phase of apoptosis	TAS
GO:1902004	positive regulation of amyloid-beta formation	IDA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005634	nucleus	IDA
GO:0005654	nucleoplasm	TAS
GO:0005737	cytoplasm	IBA
GO:0005829	cytosol	IDA
GO:0005829	cytosol	TAS
GO:0031264	death-inducing signaling complex	IEA
GO:0043025	neuronal cell body	IEA
GO:0045121	membrane raft	IEA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-109581	Apoptosis	TAS
R-HSA-109581	Apoptosis	IEA
R-HSA-109606	Intrinsic Pathway for Apoptosis	TAS
R-HSA-109606	Intrinsic Pathway for Apoptosis	IEA
R-HSA-111459	Activation of caspases through apoptosome-mediated cleavage	TAS
R-HSA-111461	Cytochrome c-mediated apoptotic response	TAS
R-HSA-111463	SMAC (DIABLO) binds to IAPs	IEA
R-HSA-111464	SMAC(DIABLO)-mediated dissociation of IAP:caspase complexes	IEA
R-HSA-111465	Apoptotic cleavage of cellular proteins	TAS
R-HSA-111469	SMAC, XIAP-regulated apoptotic response	TAS
R-HSA-111469	SMAC, XIAP-regulated apoptotic response	IEA
R-HSA-111471	Apoptotic factor-mediated response	TAS
R-HSA-111471	Apoptotic factor-mediated response	IEA
R-HSA-1280215	Cytokine Signaling in Immune system	TAS
R-HSA-140342	Apoptosis induced DNA fragmentation	TAS
R-HSA-1474228	Degradation of the extracellular matrix	IEA
R-HSA-1474244	Extracellular matrix organization	IEA
R-HSA-162582	Signal Transduction	TAS
R-HSA-168256	Immune System	TAS
R-HSA-193704	p75 NTR receptor-mediated signalling	TAS
R-HSA-2028269	Signaling by Hippo	TAS
R-HSA-204998	Cell death signalling via NRAGE, NRIF and NADE	TAS
R-HSA-205025	NADE modulates death signalling	TAS
R-HSA-211736	Stimulation of the cell death response by PAK-2p34	IEA
R-HSA-264870	Caspase-mediated cleavage of cytoskeletal proteins	TAS
R-HSA-351906	Apoptotic cleavage of cell adhesion proteins	TAS
R-HSA-418889	Caspase activation via Dependence Receptors in the absence of ligand	TAS
R-HSA-418889	Caspase activation via Dependence Receptors in the absence of ligand	IEA
R-HSA-449147	Signaling by Interleukins	TAS
R-HSA-449836	Other interleukin signaling	TAS
R-HSA-5357769	Caspase activation via extrinsic apoptotic signalling pathway	TAS
R-HSA-5357769	Caspase activation via extrinsic apoptotic signalling pathway	IEA
R-HSA-5357801	Programmed Cell Death	TAS
R-HSA-5357801	Programmed Cell Death	IEA
R-HSA-73887	Death Receptor Signalling	TAS
R-HSA-75153	Apoptotic execution phase	TAS
R-HSA-75153	Apoptotic execution phase	IEA

Drugs and compounds information

ID	Drug Name	Action	PubMed
C534422	10-(2-pyrazolylethoxy)camptothecin	10-(2-pyrazolylethoxy)camptothecin results in increased activity of CASP3 protein	18708040
C476756	10-(6'-ubiquinonyl)decyltriphenylphosphonium bromide	10-(6'-ubiquinonyl)decyltriphenylphosphonium bromide inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30836114
C476756	10-(6'-ubiquinonyl)decyltriphenylphosphonium bromide	10-(6'-ubiquinonyl)decyltriphenylphosphonium bromide inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	21784090
C067795	10-decarbamoylmitomycin C	10-decarbamoylmitomycin C results in increased activity of CASP3 protein	17530733
C028098	10-hydroxycamptothecin	[10-hydroxycamptothecin co-treated with Fluorouracil co-treated with Leucovorin] results in increased activity of CASP3 protein	12934351
C554291	10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one	10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one inhibits the reaction [XIAP protein binds to CASP3 protein]	20833157
C554291	10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one	10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one results in increased activity of and results in increased cleavage of CASP3 protein	20833157
C554291	10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to 10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one	20833157
C554291	10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one	CASP8 protein affects the susceptibility to [10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one results in increased activity of CASP3 protein]	20833157
C552819	10-(octyloxy)decyl-2-(trimethylammonium)ethyl phosphate	10-(octyloxy)decyl-2-(trimethylammonium)ethyl phosphate results in increased cleavage of and results in increased activity of CASP3 protein	23001822
C418863	10-propargyl-10-deazaaminopterin	[10-propargyl-10-deazaaminopterin co-treated with gemcitabine] results in increased activity of CASP3 protein	16467107
C471674	10'(Z),13'(E),15'(E)-heptadecatrienylhydroquinone	10'(Z),13'(E),15'(E)-heptadecatrienylhydroquinone results in increased activity of CASP3 protein	23088786
C046783	11,12-epoxy-5,8,14-eicosatrienoic acid	11,12-epoxy-5,8,14-eicosatrienoic acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19429816
C449673	1,1,4-tris(acetyloxy)-2-nonene	[GSTA4 gene mutant form results in increased susceptibility to 1,1,4-tris(acetyloxy)-2-nonene] which results in increased cleavage of and results in increased activity of CASP3 protein	24353929
C557705	1-(1-acetyl-piperidine-4-yl)-3-adamantan-1-yl-urea	1-(1-acetyl-piperidine-4-yl)-3-adamantan-1-yl-urea inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	30472438
C552530	1,1-bis(3'-indolyl)-1-(4-hydroxyphenyl)methane	1,1-bis(3'-indolyl)-1-(4-hydroxyphenyl)methane results in increased cleavage of CASP3 protein	20660371; 26035713;
C552530	1,1-bis(3'-indolyl)-1-(4-hydroxyphenyl)methane	NR4A1 protein inhibits the reaction [1,1-bis(3'-indolyl)-1-(4-hydroxyphenyl)methane results in increased cleavage of CASP3 protein]	20660371
C447943	11-keto-boswellic acid	11-keto-boswellic acid analog results in increased activity of CASP3 protein	21056033
C561619	1-(1-methanesulfonylpiperidin-4-yl)-3-(4-trifluoromethoxyphenyl)urea	1-(1-methanesulfonylpiperidin-4-yl)-3-(4-trifluoromethoxyphenyl)urea inhibits the reaction [Thapsigargin results in increased expression of CASP3 protein]	23576437
C435044	1-((1-O-octadecyl-2-O-methylglycero)phospho)-3-deoxy-myo-inositol	1-((1-O-octadecyl-2-O-methylglycero)phospho)-3-deoxy-myo-inositol inhibits the reaction [IL1B protein results in increased cleavage of CASP3 protein]	22936809
C539551	1,2,4,5-benzenetetraamine	1,2,4,5-benzenetetraamine results in increased cleavage of CASP3 protein	22276220
C026486	1,2,5,6-dibenzanthracene	1,2,5,6-dibenzanthracene results in increased activity of CASP3 protein	31368503
C101879	(1,2,5,6-tetrahydropyridin-4-yl)methylphosphinic acid	(1,2,5,6-tetrahydropyridin-4-yl)methylphosphinic acid inhibits the reaction [4-aminocrotonic acid inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]]	14535961
C478160	(1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane	(1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane results in decreased expression of CASP3 protein	15982805
C478160	(1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane	[Sodium Selenite co-treated with (1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane] results in increased cleavage of CASP3 protein	28757135
C025603	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [fisetin results in increased activity of CASP3 protein]	28181380
C025603	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
C025603	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid	[1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid co-treated with Egtazic Acid] inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
C025603	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
C025603	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [GW 7845 results in increased activity of CASP3 protein]	20810541
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Arachidonic Acid results in increased degradation of CASP3 protein alternative form]	19540902
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21544200
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium results in increased cleavage of and results in increased activity of CASP3 protein]	19442655
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	26609140
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Gallic Acid results in increased cleavage of CASP3 protein]	27060209
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [IFNG protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [[TNF protein co-treated with IFNG protein] promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [TNF protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester promotes the reaction [Desipramine results in increased cleavage of and results in increased activity of CASP3 protein]	18606486
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein]	26096086
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	18850067
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	27481217
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Maprotiline results in increased activity of CASP3 protein]	23219590
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15799720
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [ioversol results in increased cleavage of CASP3 protein]	19136047
C070379	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	21544200
C569107	1-(2-chlorobenzyl)-5'-phenyl-3'H-spiro(indoline-3,2'-(1,3,4)thiadiazol)-2-one	1-(2-chlorobenzyl)-5'-phenyl-3'H-spiro(indoline-3,2'-(1,3,4)thiadiazol)-2-one results in increased activity of CASP3 protein	21903591; 23826121;
C569107	1-(2-chlorobenzyl)-5'-phenyl-3'H-spiro(indoline-3,2'-(1,3,4)thiadiazol)-2-one	CCAR1 protein affects the reaction [1-(2-chlorobenzyl)-5'-phenyl-3'H-spiro(indoline-3,2'-(1,3,4)thiadiazol)-2-one results in increased activity of CASP3 protein]	21903591
C472829	1-(2-cyano-3,12-dioxooleana-1,9-dien-28-oyl) imidazole	[Bortezomib co-treated with 1-(2-cyano-3,12-dioxooleana-1,9-dien-28-oyl) imidazole] results in increased activity of CASP3 protein	15070698
C517232	1,2-dibromo-4-(1,2-dibromoethyl)cyclohexane	1,2-dibromo-4-(1,2-dibromoethyl)cyclohexane results in increased expression of CASP3 mRNA	24375616
D014013	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt affects the reaction [Bortezomib results in increased cleavage of CASP3 protein]	15509775
D014013	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
D014013	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
D014013	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [melamine results in increased cleavage of CASP3 protein]	22915474
D014013	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23892647
D014013	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt results in increased cleavage of and results in increased activity of CASP3 protein	23892647
D019813	1,2-Dimethylhydrazine	1,2-Dimethylhydrazine results in decreased expression of CASP3 protein	29108773; 29999212;
D019813	1,2-Dimethylhydrazine	asiatic acid inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]	29108773
D019813	1,2-Dimethylhydrazine	epigallocatechin gallate promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]]	29999212
D019813	1,2-Dimethylhydrazine	kaempferol promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]]	29999212
D019813	1,2-Dimethylhydrazine	Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]	29999212
C519184	1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-methoxy-poly(ethylene glycol 2000)	[1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-methoxy-poly(ethylene glycol 2000) co-treated with Quercetin] results in increased expression of CASP3 protein	23529952
C049325	1,2-dithiol-3-thione	1,2-dithiol-3-thione results in decreased expression of CASP3 mRNA	19162173
C583008	1-(2-thienyl)-2-(methylamino)propane	1-(2-thienyl)-2-(methylamino)propane results in increased cleavage of CASP3 protein	30922767
C583008	1-(2-thienyl)-2-(methylamino)propane	SCH 23390 inhibits the reaction [1-(2-thienyl)-2-(methylamino)propane results in increased cleavage of CASP3 protein]	30922767
C583008	1-(2-thienyl)-2-(methylamino)propane	Sulpiride inhibits the reaction [1-(2-thienyl)-2-(methylamino)propane results in increased cleavage of CASP3 protein]	30922767
C552420	1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane	1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane results in increased activity of and results in increased cleavage of CASP3 protein	20674558
C552420	1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane	Acetylcysteine results in decreased susceptibility to [1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane results in increased cleavage of CASP3 protein]	20674558
C552420	1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to 1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane	20674558
C000603962	1-(3,4-dihydroxyphenyl)-3-(2-methoxyphenyl)prop-2-en-1-one	1-(3,4-dihydroxyphenyl)-3-(2-methoxyphenyl)prop-2-en-1-one inhibits the reaction [tert-Butylhydroperoxide results in increased expression of CASP3 protein modified form]	28063877
C031763	1,3-butadiene	1,3-butadiene results in decreased expression of CASP3 mRNA	21147608
C033489	1,3-dichloro-2-propanol	1,3-dichloro-2-propanol results in increased cleavage of CASP3 protein	29248572
C033489	1,3-dichloro-2-propanol	Acetylcysteine inhibits the reaction [1,3-dichloro-2-propanol results in increased cleavage of CASP3 protein]	29248572
C033489	1,3-dichloro-2-propanol	1,3-dichloro-2-propanol results in increased expression of CASP3 protein	26143167
C038983	1,3-dimethylthiourea	1,3-dimethylthiourea inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	22692000
C037413	1,3-dinitropyrene	1,3-dinitropyrene results in increased cleavage of and results in increased activity of CASP3 protein	17240030
C429685	1,4,5,8-naphthalenetetracarboxylic diimide	1,4,5,8-naphthalenetetracarboxylic diimide analog results in increased cleavage of CASP3 protein	19954251
C416442	1,4-anthraquinone	1,4-anthraquinone analog results in increased activity of CASP3 protein	17912452
C028474	1,4-bis(2-(3,5-dichloropyridyloxy))benzene	1,4-bis(2-(3,5-dichloropyridyloxy))benzene inhibits the reaction [Lithocholic Acid results in increased cleavage of CASP3 protein]	19433268
C035342	1,4-naphthoquinone	1,4-naphthoquinone analog results in increased cleavage of CASP3 protein	30871965
C035342	1,4-naphthoquinone	1,4-naphthoquinone results in decreased activity of CASP3 protein	16699520
C035342	1,4-naphthoquinone	Acetylcysteine inhibits the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C035342	1,4-naphthoquinone	FR 180204 promotes the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C035342	1,4-naphthoquinone	GSK690693 promotes the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C035342	1,4-naphthoquinone	pyrazolanthrone inhibits the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C035342	1,4-naphthoquinone	SB 203580 inhibits the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C074153	1,4-phenylenebis(methylene)selenocyanate	1,4-phenylenebis(methylene)selenocyanate results in increased expression of CASP3 mRNA	12844480
C477941	1,4-phenylenebis(methylene)selenocyanate, glutathione conjugate	1,4-phenylenebis(methylene)selenocyanate, glutathione conjugate results in increased expression of CASP3 mRNA	12844480
C560296	1,5-bis(2,3-dimethoxyphenyl)penta-1,4-dien-3-one	1,5-bis(2,3-dimethoxyphenyl)penta-1,4-dien-3-one results in increased cleavage of CASP3 protein	21504179
C097240	15-deoxy-delta(12,14)-prostaglandin J2	15-deoxy-delta(12,14)-prostaglandin J2 results in increased activity of CASP3 protein	11785780
C097240	15-deoxy-delta(12,14)-prostaglandin J2	15-deoxy-delta(12,14)-prostaglandin J2 results in increased cleavage of and results in increased activity of CASP3 protein	15498850
C097240	15-deoxy-delta(12,14)-prostaglandin J2	15-deoxy-delta(12,14)-prostaglandin J2 results in increased cleavage of CASP3 protein	16299251
C097240	15-deoxy-delta(12,14)-prostaglandin J2	15-deoxy-delta(12,14)-prostaglandin J2 results in increased cleavage of CASP3 protein	23973622
C097240	15-deoxy-delta(12,14)-prostaglandin J2	[delta(12)-prostaglandin J(2) co-treated with 9-deoxy-delta-9-prostaglandin D2 co-treated with 15-deoxy-delta(12,14)-prostaglandin J2] results in increased cleavage of CASP3 protein	23973622
C477819	15-deoxyprostaglandin J2	15-deoxyprostaglandin J2 results in increased activity of CASP3 protein	19167456
C477819	15-deoxyprostaglandin J2	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [15-deoxyprostaglandin J2 results in increased activity of CASP3 protein]	19167456
C477819	15-deoxyprostaglandin J2	RELA inhibits the reaction [15-deoxyprostaglandin J2 results in increased activity of CASP3 protein]	19167456
C477819	15-deoxyprostaglandin J2	15-deoxyprostaglandin J2 promotes the reaction [Camptothecin results in increased activity of CASP3 protein]	21683069
C477819	15-deoxyprostaglandin J2	15-deoxyprostaglandin J2 results in increased activity of CASP3 protein	21683069
C477819	15-deoxyprostaglandin J2	Camptothecin promotes the reaction [15-deoxyprostaglandin J2 results in increased activity of CASP3 protein]	21683069
C477819	15-deoxyprostaglandin J2	15-deoxyprostaglandin J2 affects the activity of CASP3 protein	16912651
D019796	15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic Acid	15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic Acid inhibits the reaction [notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]]	25305180
C060229	1-(6-((3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-2,5-dione	1-(6-((3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-2,5-dione inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
C480140	1,6-Bis(4-(4-amino-3-hydroxyphenoxy)phenyl)diamantane	1,6-Bis(4-(4-amino-3-hydroxyphenoxy)phenyl)diamantane results in increased activity of CASP3 protein	15589971
C072581	16-hydroxycleroda-3,13(14)-dien-15,16-olide	16-hydroxycleroda-3,13(14)-dien-15,16-olide results in increased cleavage of and results in increased activity of CASP3 protein	21530604
C448659	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17085670
C448659	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin	[17-(dimethylaminoethylamino)-17-demethoxygeldanamycin co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
C448659	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	27224288
C448659	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin	Quercetin inhibits the reaction [17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	27224288
C522300	19-epi-okadaic acid	19-epi-okadaic acid results in increased activity of CASP3 protein	23335626
C547088	19-hydroxy-1alpha,6-diacetoxy-6,7-seco-ent-kaur-16-en-15-one-7,20-olide	19-hydroxy-1alpha,6-diacetoxy-6,7-seco-ent-kaur-16-en-15-one-7,20-olide inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]	19765580
C036423	1-aminomethylphosphonic acid	[1-aminomethylphosphonic acid co-treated with methoxyacetic acid] results in increased cleavage of and results in increased activity of CASP3 protein	26006246
C036423	1-aminomethylphosphonic acid	1-aminomethylphosphonic acid results in increased activity of CASP3 protein	23983455
C118559	1-bromopropane	1-bromopropane results in increased cleavage of CASP3 protein	30247689
D020001	1-Butanol	1-Butanol results in increased cleavage of and results in increased activity of CASP3 protein	22564901
D020001	1-Butanol	Y 27632 inhibits the reaction [1-Butanol results in increased activity of and results in increased cleavage of CASP3 protein]	22564901
D017485	1-Deoxynojirimycin	1-Deoxynojirimycin inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	19028522
D017485	1-Deoxynojirimycin	1-Deoxynojirimycin inhibits the reaction [Tunicamycin results in increased activity of CASP3 protein]	19028522
C494582	1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one	1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one inhibits the reaction [Nitric Oxide Donors results in decreased activity of CASP3 protein]	9388267
C494582	1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one	Dithiothreitol inhibits the reaction [1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one inhibits the reaction [[Nitric Oxide Donors results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein]]	9388267
C095284	1H-(1,2,4)oxadiazolo(4,3-a)quinoxalin-1-one	1H-(1,2,4)oxadiazolo(4,3-a)quinoxalin-1-one results in increased activity of CASP3 protein	16288207
C506325	1-hydroxy-1-norresistomycin	1-hydroxy-1-norresistomycin results in increased expression of CASP3 mRNA	29596799
C506325	1-hydroxy-1-norresistomycin	1-hydroxy-1-norresistomycin results in increased expression of CASP3 protein	29596799
C108731	1'-(hydroxymethyl)eugenol	1'-(hydroxymethyl)eugenol results in increased activity of CASP3 protein	28818686
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of CASP3 mRNA	28628672
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased activity of CASP3 protein	20133810
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased cleavage of and results in increased activity of CASP3 protein	23911879
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased cleavage of CASP3 protein	23201480; 24995576;
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 mRNA	15329391
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 protein	23933227
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased cleavage of and results in increased activity of CASP3 protein]	23911879
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	6,7-dihydroxyflavone inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased activity of CASP3 protein]	20133810
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	ACHE protein affects the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased cleavage of CASP3 protein]	23201480
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	[Nicotine co-treated with Polylactic Acid-Polyglycolic Acid Copolymer] inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 protein]	23933227
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	Nicotine inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 protein]	23933227
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium promotes the reaction [LRRK2 gene mutant form results in increased activity of CASP3 protein]	25017139
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in decreased expression of CASP3 protein	17266988
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein	12111836; 12523938; 15948157; 20686228; 20946892; 21497157; 22206971; 24989254; 25017139; 26357513; 27432061; 27957685; 28187263; 28851138; 28958159; 29611404;
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein	23997112
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein	22278385; 25968939; 28484287;
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA	14724376; 25234470;
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein	28481321
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form	20686228; 25469469; 26264181; 27957685; 28185818; 30463061; 31381935;
D015655	1-Methyl-4-phenylpyridinium	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	21497157; 28187263;
D015655	1-Methyl-4-phenylpyridinium	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [amentoflavone inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]]	28185818
D015655	1-Methyl-4-phenylpyridinium	8-phenyl-6a,7,8,9,9a,10-hexahydro-6H-isoindolo(5,6-g)quinoxaline-7,9-dione inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	20946892
D015655	1-Methyl-4-phenylpyridinium	amentoflavone inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	28185818
D015655	1-Methyl-4-phenylpyridinium	astragaloside A inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	22278385
D015655	1-Methyl-4-phenylpyridinium	ATG5 protein promotes the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein]	23997112
D015655	1-Methyl-4-phenylpyridinium	atractylenolide I inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein]	28481321
D015655	1-Methyl-4-phenylpyridinium	BAX protein affects the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	22278385
D015655	1-Methyl-4-phenylpyridinium	Curcumin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	30463061
D015655	1-Methyl-4-phenylpyridinium	echinacoside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27432061
D015655	1-Methyl-4-phenylpyridinium	Flufenamic Acid inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	27957685
D015655	1-Methyl-4-phenylpyridinium	GADD45A inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	25469469
D015655	1-Methyl-4-phenylpyridinium	ginkgetin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	25968939
D015655	1-Methyl-4-phenylpyridinium	GPX1 protein inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
D015655	1-Methyl-4-phenylpyridinium	luteolin-7-O-glucoside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	31381935
D015655	1-Methyl-4-phenylpyridinium	mangostin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	26357513
D015655	1-Methyl-4-phenylpyridinium	MIR135B mRNA inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	28484287
D015655	1-Methyl-4-phenylpyridinium	MIR212 mRNA inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	29611404
D015655	1-Methyl-4-phenylpyridinium	NDFIP1 protein inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	26300475
D015655	1-Methyl-4-phenylpyridinium	Nitroprusside inhibits the reaction [MIR135B mRNA inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]]	28484287
D015655	1-Methyl-4-phenylpyridinium	N,N'-bis(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
D015655	1-Methyl-4-phenylpyridinium	rhodioloside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	28851138
D015655	1-Methyl-4-phenylpyridinium	Rosiglitazone inhibits the reaction [1-Methyl-4-phenylpyridinium results in decreased expression of CASP3 protein]	17266988
D015655	1-Methyl-4-phenylpyridinium	salvianolic acid B inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	20686228
D015655	1-Methyl-4-phenylpyridinium	salvianolic acid B inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	20686228
D015655	1-Methyl-4-phenylpyridinium	Selegiline inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA]	14724376
D015655	1-Methyl-4-phenylpyridinium	sirtinol inhibits the reaction [rhodioloside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]]	28851138
D015655	1-Methyl-4-phenylpyridinium	STAT3 protein promotes the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	28958159
D015655	1-Methyl-4-phenylpyridinium	tetrakis(4-benzoic acid)porphyriniron(III) inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
D015655	1-Methyl-4-phenylpyridinium	TFRC protein promotes the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
D015655	1-Methyl-4-phenylpyridinium	TRPM2 protein promotes the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27957685
D015655	1-Methyl-4-phenylpyridinium	TRPM2 protein promotes the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	27957685
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein	11181820; 20946892; 20966113; 22281204; 23754278; 26300475;
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA	26558463
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein	20079841
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form	28268219
D015655	1-Methyl-4-phenylpyridinium	[CD47 protein binds to SIRPA protein] inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	28268219
D015655	1-Methyl-4-phenylpyridinium	NSC 23766 inhibits the reaction [[CD47 protein binds to SIRPA protein] inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]]	28268219
D015655	1-Methyl-4-phenylpyridinium	PIN1 mutant form inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	23754278
D015655	1-Methyl-4-phenylpyridinium	rosemarinic acid inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	20966113
D015655	1-Methyl-4-phenylpyridinium	[1-Methyl-4-phenylpyridinium results in increased activity of CAPN1 protein] which results in increased activity of CASP3 protein	18496573
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein	12523938; 15033169; 16310184; 18602972; 19135049; 19524685; 24875324; 25174304; 25868679; 27053303; 28442376; 28770951; 31430510;
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein	19466539
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein	20600802; 23201480;
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA	18035349
D015655	1-Methyl-4-phenylpyridinium	ACHE protein affects the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	23201480
D015655	1-Methyl-4-phenylpyridinium	Amitriptyline inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D015655	1-Methyl-4-phenylpyridinium	benserazide, levodopa drug combination inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27053303
D015655	1-Methyl-4-phenylpyridinium	Copper Sulfate inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	28442376
D015655	1-Methyl-4-phenylpyridinium	Cyclosporine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D015655	1-Methyl-4-phenylpyridinium	Deferoxamine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
D015655	1-Methyl-4-phenylpyridinium	Drugs, Chinese Herbal inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19524685
D015655	1-Methyl-4-phenylpyridinium	Fluoxetine promotes the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D015655	1-Methyl-4-phenylpyridinium	Glyburide inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	16310184
D015655	1-Methyl-4-phenylpyridinium	Guanosine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	25174304
D015655	1-Methyl-4-phenylpyridinium	MIR181C mRNA inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	28770951
D015655	1-Methyl-4-phenylpyridinium	Misoprostol inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	18602972
D015655	1-Methyl-4-phenylpyridinium	Oligopeptides inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	25868679
D015655	1-Methyl-4-phenylpyridinium	oridonin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	31430510
D015655	1-Methyl-4-phenylpyridinium	pedicularioside A inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA]	18035349
D015655	1-Methyl-4-phenylpyridinium	peoniflorin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27053303
D015655	1-Methyl-4-phenylpyridinium	Plant Preparations inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	24875324
D015655	1-Methyl-4-phenylpyridinium	Polysaccharides inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	24875324
D015655	1-Methyl-4-phenylpyridinium	Quercetin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein]	19466539
D015655	1-Methyl-4-phenylpyridinium	Resveratrol inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein]	19466539
D015655	1-Methyl-4-phenylpyridinium	Tranylcypromine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein	18191877
C513115	1-(methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-1H-indene-2-carboxylic acid ethyl ester	1-(methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-1H-indene-2-carboxylic acid ethyl ester results in increased activity of CASP3 protein	21769449
C513115	1-(methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-1H-indene-2-carboxylic acid ethyl ester	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [1-(methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-1H-indene-2-carboxylic acid ethyl ester results in increased activity of CASP3 protein]	21769449
C111679	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate results in decreased activity of CASP3 protein	9441900
C111679	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate results in increased metabolism of CASP3 protein	9441900
C111679	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate	Dithiothreitol promotes the reaction [1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate results in increased metabolism of CASP3 protein]	9441900
C111679	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate	1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	9441900
D015058	1-Naphthylisothiocyanate	1-Naphthylisothiocyanate results in increased cleavage of CASP3 protein	26011634
C032668	1-nitropyrene	1-nitropyrene results in increased activity of CASP3 protein	21872649
C032668	1-nitropyrene	1-nitropyrene results in increased cleavage of and results in increased activity of CASP3 protein	17240030
C032668	1-nitropyrene	methyl-beta-cyclodextrin inhibits the reaction [1-nitropyrene results in increased activity of CASP3 protein]	21872649
C067372	1-trichloromethyl-1,2,3,4-tetrahydro-beta-carboline	1-trichloromethyl-1,2,3,4-tetrahydro-beta-carboline results in increased activity of CASP3 protein	15447660
C581572	1-trifluoromethoxyphenyl-3-(1-propionylpiperidine-4-yl)urea	1-trifluoromethoxyphenyl-3-(1-propionylpiperidine-4-yl)urea inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	25827057
C494665	20-hydroxyeicosa-5(Z),14(Z)-dienoic acid	20-hydroxyeicosa-5(Z),14(Z)-dienoic acid inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
C482402	20-O-(beta-D-glucopyranosyl)-20(S)-protopanaxadiol	20-O-(beta-D-glucopyranosyl)-20(S)-protopanaxadiol results in increased activity of CASP3 protein	12963989
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [betulinic acid analog results in increased cleavage of CASP3 protein]	23000516
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	23300809
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine results in increased activity of CASP3 protein	23300809
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine results in increased cleavage of CASP3 protein	19411071; 23318440;
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	CA 074 methyl ester inhibits the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [betulinic acid analog results in increased cleavage of CASP3 protein]]	23000516
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	Dexamethasone promotes the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine results in increased cleavage of CASP3 protein]	23318440
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	Doxorubicin promotes the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine results in increased activity of CASP3 protein]	23300809
C532162	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	[Sorafenib co-treated with 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine] results in increased cleavage of CASP3 protein	23036488
C574037	2-(1-hydroxy-4-oxocyclohexa-2,5-dienyl)pyran-4-one	2-(1-hydroxy-4-oxocyclohexa-2,5-dienyl)pyran-4-one results in decreased expression of CASP3	24300195
C054919	2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene	2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene results in increased activity of CASP3 protein	26563996
C054919	2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene	diazepinylbenzoic acid inhibits the reaction [2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene results in increased activity of CASP3 protein]	26563996
C054919	2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene	RXRA mRNA promotes the reaction [2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene results in increased activity of CASP3 protein]	26563996
C054919	2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene	RXRB mRNA promotes the reaction [2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene results in increased activity of CASP3 protein]	26563996
C530171	2,2,2,-trichloro-1-(3,4-dichlorophenyl)-ethylacetate	2,2,2,-trichloro-1-(3,4-dichlorophenyl)-ethylacetate results in increased activity of CASP3 protein	19166338
C094859	2,2',3,3',4,6'-hexachlorobiphenyl	2,2',3,3',4,6'-hexachlorobiphenyl results in decreased activity of CASP3 protein	17445852
C094859	2,2',3,3',4,6'-hexachlorobiphenyl	2,2',3,3',4,6'-hexachlorobiphenyl results in increased activity of CASP3 protein	17445852
C029790	2,2',3',4,4',5-hexachlorobiphenyl	2,2',3',4,4',5-hexachlorobiphenyl inhibits the reaction [TNF protein results in increased cleavage of CASP3 protein]	29704545
C477694	2,2',4,4',5-brominated diphenyl ether	2,2',4,4',5-brominated diphenyl ether results in increased activity of CASP3 protein	23124135
C477694	2,2',4,4',5-brominated diphenyl ether	2,2',4,4',5-brominated diphenyl ether results in decreased expression of CASP3 protein	19954255
C477694	2,2',4,4',5-brominated diphenyl ether	2,2',4,4',5-brominated diphenyl ether results in increased expression of CASP3 protein	19954255
C500336	2,2',4,4',5-pentachlorobiphenyl	2,2',4,4',5-pentachlorobiphenyl results in increased activity of CASP3 protein	19022367
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in decreased expression of CASP3 protein	27060917
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA	19022289
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 protein	19022289
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,4,5,2',4',5'-hexachlorobiphenyl promotes the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA]	19022289
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,4,5,2',4',5'-hexachlorobiphenyl promotes the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 protein]	19022289
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether metabolite results in increased activity of CASP3 protein	23564643
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of and results in increased activity of CASP3 protein	25639565
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of CASP3 protein	25462306; 25797475;
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA	25462306
C511295	2,2',4,4'-tetrabromodiphenyl ether	epoxomicin inhibits the reaction [troxerutin inhibits the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of and results in increased activity of CASP3 protein]]	25639565
C511295	2,2',4,4'-tetrabromodiphenyl ether	GCLM protein affects the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of CASP3 protein]	25797475
C511295	2,2',4,4'-tetrabromodiphenyl ether	troxerutin inhibits the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of and results in increased activity of CASP3 protein]	25639565
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased degradation of CASP3 protein	19576244
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA	19576244
C511295	2,2',4,4'-tetrabromodiphenyl ether	[2,4,5,2',4',5'-hexachlorobiphenyl co-treated with 2,2',4,4'-tetrabromodiphenyl ether] results in increased degradation of CASP3 protein	19576244
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,4,5,2',4',5'-hexachlorobiphenyl promotes the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA]	19576244
C417207	2,2',4,6,6'-pentachlorobiphenyl	2,2',4,6,6'-pentachlorobiphenyl results in increased cleavage of CASP3 protein	11076690
C501339	2-(2,6-diisopropylphenyl)-5-hydroxy-1H-isoindole-1,3-dione	2-(2,6-diisopropylphenyl)-5-hydroxy-1H-isoindole-1,3-dione results in increased activity of CASP3 protein	18204782
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16013042
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [acetochlor results in increased expression of CASP3 protein modified form]	25291404
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20802529
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Citrinin results in increased activity of CASP3 protein]	19361540
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16843435
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	16014620
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [fisetin results in increased activity of CASP3 protein]	21964635
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [[LM-1685 co-treated with carboxyamido-triazole] results in increased cleavage of CASP3 protein]	15867384
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Luteolin results in increased cleavage of CASP3 protein]	27474067
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Pyrogallol results in increased activity of CASP3 protein]	20191265
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	14688022; 21165570;
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [malvidin results in increased activity of CASP3 protein]	15964118
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [methyl 5-chloro-4,5-didehydrojasmonate results in increased activity of CASP3 protein]	20696234
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of MAP2K1 protein] inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	18594523
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of MAP2K1 protein] inhibits the reaction [SOD2 protein affects the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	18594523
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[bisphenol A co-treated with LEP protein] results in decreased activity of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [bisphenol A results in decreased activity of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [bisphenol A results in decreased expression of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[Estradiol co-treated with LEP protein] results in decreased activity of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [Estradiol results in decreased activity of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [Estradiol results in decreased expression of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[LEP protein co-treated with bisphenol A] results in decreased expression of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[LEP protein co-treated with Estradiol] results in decreased expression of CASP3 protein]	23850738
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole promotes the reaction [2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [TNF protein results in increased cleavage of CASP3 protein]]	11299730
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	24157283
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	24905940
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21549813
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [prostaglandin E2 glyceryl ester results in increased cleavage of and results in increased activity of CASP3 protein]	17539917
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Sodium Fluoride results in increased activity of CASP3 protein]	23578390
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15976193
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in increased cleavage of CASP3 protein	15695173
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Carmustine results in increased activity of and results in increased cleavage of CASP3 protein]	21600974
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18775851; 22155320;
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Hexachlorobenzene results in increased activity of CASP3 protein]	23708402
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	17045724
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [Particulate Matter results in increased cleavage of CASP3 protein]	26472149
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in increased cleavage of CASP3 protein	26472149
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	[Excitatory Amino Acid Agents co-treated with 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one] results in increased activity of CASP3 protein	21858143
C093973	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [[ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate co-treated with BCL2 protein co-treated with esculetin] results in increased activity of CASP3 protein]	19786087
C006183	2-(2-aminoethyl)pyridine	[Copper binds to Isatin binds to 2-(2-aminoethyl)pyridine] which results in increased cleavage of CASP3 protein	17327230
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [1-(methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-1H-indene-2-carboxylic acid ethyl ester results in increased activity of CASP3 protein]	21769449
C019273	2,2-bis(4-glycidyloxyphenyl)propane	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]]	12927354
C451219	2,2-bis(hydroxymethyl)-1-azabicyclo(2,2,2,)octan-3-one	2,2-bis(hydroxymethyl)-1-azabicyclo(2,2,2,)octan-3-one results in increased cleavage of and results in increased activity of CASP3 protein	21109480
C120227	2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide	2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide results in increased cleavage of CASP3 protein	16239399
C120227	2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide	[Sorafenib co-treated with 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide] results in increased cleavage of CASP3 protein	20117835
C044565	2-((((2-chloroethyl)nitrosoamino)carbonyl)amino)propanamide	2-((((2-chloroethyl)nitrosoamino)carbonyl)amino)propanamide results in increased cleavage of CASP3 protein	16142332
C001105	2,2'-dipyridyl disulfide	2,2'-dipyridyl disulfide results in increased activity of CASP3 protein	11331359
C446520	2-(2-hydroxyethylsulfanyl)-3-methyl-1,4-naphthoquinone	2-(2-hydroxyethylsulfanyl)-3-methyl-1,4-naphthoquinone results in increased activity of CASP3 protein	16096431
C070055	2,3',4,4',5-pentachlorobiphenyl	2,3',4,4',5-pentachlorobiphenyl affects the activity of CASP3 protein	19362103
D015647	2,3,4,5-Tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine	2,3,4,5-Tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine results in increased activity of and results in increased cleavage of CASP3 protein	17136323
D015647	2,3,4,5-Tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine	Acetylcysteine inhibits the reaction [2,3,4,5-Tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
C000616873	2-(3-((4-aminobutyl )amino)propyl )-7-(3-((2-methoxybenzyl)amino)propyl)benzo(lmn)(3,8)phenanthroline-1,3,6,8(2H,7H)-tetraone	2-(3-((4-aminobutyl )amino)propyl )-7-(3-((2-methoxybenzyl)amino)propyl)benzo(lmn)(3,8)phenanthroline-1,3,6,8(2H,7H)-tetraone results in increased activity of CASP3 protein	28157593
C093026	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	21497157; 28187263;
C093026	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased cleavage of and results in increased activity of CASP3 protein]	23911879
C093026	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]	19890356
C587734	2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	2,3,5-trichloro-6-phenyl-(1,4)benzoquinone results in increased cleavage of CASP3 protein	25950987; 26451628; 30742880;
C587734	2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	Caspase Inhibitors inhibits the reaction [2,3,5-trichloro-6-phenyl-(1,4)benzoquinone results in increased cleavage of CASP3 protein]	25950987
C587734	2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	pifithrin inhibits the reaction [2,3,5-trichloro-6-phenyl-(1,4)benzoquinone results in decreased cleavage of CASP3 protein]	26451628
C587734	2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	TP53 protein promotes the reaction [2,3,5-trichloro-6-phenyl-(1,4)benzoquinone results in increased cleavage of CASP3 protein]	26451628
C036837	2,3,5-trimethyl-6-(12-hydroxy-5,10-dodecadiynyl)-1,4-benzoquinone	2,3,5-trimethyl-6-(12-hydroxy-5,10-dodecadiynyl)-1,4-benzoquinone inhibits the reaction [PTGS1 gene mutant form promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]]	25432964
C451261	2,3-bis(2-hydroxyethylsulfanyl)-(1,4)naphthoquinone	2,3-bis(2-hydroxyethylsulfanyl)-(1,4)naphthoquinone results in increased activity of CASP3 protein	20150630
C486182	2,3-bis(4-hydroxyphenyl)-propionitrile	2,3-bis(4-hydroxyphenyl)-propionitrile promotes the reaction [Chlorodiphenyl (54% Chlorine) results in increased activity of CASP3 protein]	24216299
C547124	2,3-dibromopropyl-2,4,6-tribromophenyl ether	2,3-dibromopropyl-2,4,6-tribromophenyl ether results in decreased expression of CASP3 mRNA	26318274
C505449	2,3-dimercaptosuccinic acid monocyclohexyl ester	2,3-dimercaptosuccinic acid monocyclohexyl ester inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	18163546; 23376091;
C505449	2,3-dimercaptosuccinic acid monocyclohexyl ester	Succimer promotes the reaction [2,3-dimercaptosuccinic acid monocyclohexyl ester inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	18163546; 23376091;
C063002	2,3-dimethoxy-1,4-naphthoquinone	2,3-dimethoxy-1,4-naphthoquinone results in increased activity of CASP3 protein	20856801
C060262	2,3-dimethoxy-5-methyl-6-decyl-1,4-benzoquinone	2,3-dimethoxy-5-methyl-6-decyl-1,4-benzoquinone inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
C416653	2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone	2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone results in increased cleavage of and results in increased activity of CASP3 protein	23523585
C416653	2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone	2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone results in increased expression of CASP3 mRNA	23523585
C416653	2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone results in increased cleavage of CASP3 protein]	23523585
C066099	2,3-N-octanoylsphingosine	2,3-N-octanoylsphingosine results in increased activity of CASP3 protein	20401667
C066099	2,3-N-octanoylsphingosine	Resveratrol promotes the reaction [2,3-N-octanoylsphingosine results in increased activity of CASP3 protein]	20401667
C541132	2,4,4',5-tetrachlorobiphenyl	2,4,4',5-tetrachlorobiphenyl affects the activity of CASP3 protein	19362103
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl affects the reaction [dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein]	24954032
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	24954032
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl promotes the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA]	19022289
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl promotes the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 protein]	19022289
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl results in increased expression of CASP3 protein	19022289
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	Okadaic Acid inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl results in increased cleavage of CASP3 protein	21291966; 25659934;
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl results in increased expression of CASP3 protein	21291966
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	[2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of CASP3 protein	21291966
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	[2,4,5,2',4',5'-hexachlorobiphenyl co-treated with 2,2',4,4'-tetrabromodiphenyl ether] results in increased degradation of CASP3 protein	19576244
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl promotes the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased expression of CASP3 mRNA]	19576244
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl results in decreased activity of CASP3 protein	24726520
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	2,4,5,2',4',5'-hexachlorobiphenyl results in decreased expression of CASP3 mRNA	24726520
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	Wortmannin inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl results in decreased activity of CASP3 protein]	24726520
C009828	2,4,5,2',5'-pentachlorobiphenyl	[2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of CASP3 protein	21291966
C009828	2,4,5,2',5'-pentachlorobiphenyl	2,4,5,2',5'-pentachlorobiphenyl results in increased cleavage of CASP3 protein	21291966; 25659934;
C009828	2,4,5,2',5'-pentachlorobiphenyl	2,4,5,2',5'-pentachlorobiphenyl results in increased expression of CASP3 protein	21291966
C009828	2,4,5,2',5'-pentachlorobiphenyl	2,4,5,2',5'-pentachlorobiphenyl results in increased activity of CASP3 protein	21504788
C009534	2,4,5-trichlorophenol	2,4,5-trichlorophenol results in increased activity of CASP3 protein	19766705
C562254	2'-(4-chlorophenyl)-3-(4-chlorophenylidene)-5,10-dimethyl-12-methylene-decahydro-1,2-(1',3'-dioxocyclopenta(c))azuleno(4,5-b)furan-4,11-dione	2'-(4-chlorophenyl)-3-(4-chlorophenylidene)-5,10-dimethyl-12-methylene-decahydro-1,2-(1',3'-dioxocyclopenta(c))azuleno(4,5-b)furan-4,11-dione results in increased cleavage of and results in increased activity of CASP3 protein	21741372
C562254	2'-(4-chlorophenyl)-3-(4-chlorophenylidene)-5,10-dimethyl-12-methylene-decahydro-1,2-(1',3'-dioxocyclopenta(c))azuleno(4,5-b)furan-4,11-dione	Acetylcysteine inhibits the reaction [2'-(4-chlorophenyl)-3-(4-chlorophenylidene)-5,10-dimethyl-12-methylene-decahydro-1,2-(1',3'-dioxocyclopenta(c))azuleno(4,5-b)furan-4,11-dione results in increased cleavage of and results in increased activity of CASP3 protein]	21741372
C010914	2,4-diaminotoluene	2,4-diaminotoluene results in increased expression of CASP3 mRNA	20713471
C004762	2,4-dichlorophenol	2,4-dichlorophenol results in increased activity of CASP3 protein	25160872
C561454	2,4-difluoro-N-(2-(methyloxy)-5-(4-(4-pyridazinyl)-6-quinolinyl)-3-pyridinyl)benzenesulfonamide	[GNAQ gene mutant form results in increased susceptibility to [trametinib co-treated with 2,4-difluoro-N-(2-(methyloxy)-5-(4-(4-pyridazinyl)-6-quinolinyl)-3-pyridinyl)benzenesulfonamide]] which results in increased cleavage of CASP3 protein	22733540
C059354	2',4'-dihydroxychalcone	2',4'-dihydroxychalcone results in increased activity of CASP3 protein	20471467
C543150	2-(4-((dimethylamino)methyl)benzylidene)-5,6-dimethoxy-2,3-dihydroinden-1-one	2-(4-((dimethylamino)methyl)benzylidene)-5,6-dimethoxy-2,3-dihydroinden-1-one inhibits the reaction [Hydrogen Peroxide results in decreased expression of CASP3 protein]	19345205
C543150	2-(4-((dimethylamino)methyl)benzylidene)-5,6-dimethoxy-2,3-dihydroinden-1-one	2-(4-((dimethylamino)methyl)benzylidene)-5,6-dimethoxy-2,3-dihydroinden-1-one inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19345205
C016403	2,4-dinitrotoluene	2,4-dinitrotoluene affects the expression of CASP3 mRNA	21346803
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one affects the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	[2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with fludarabine] results in increased cleavage of CASP3 protein	15850772
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	[2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with gemcitabine] affects the activity of CASP3 protein	29782821
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [amentoflavone inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]]	28185818
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [delphinidin inhibits the reaction [TGFB1 results in increased expression of CASP3 protein]]	30365941
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [salvin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]]	26686574
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Carboplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16275998
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased activity of and results in increased localization of CASP3 protein]	20856197
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	20856197
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Emodin results in increased cleavage of CASP3 protein]	27032576
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	19827268
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in increased activity of CASP3 protein	15942663; 19738051;
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in increased cleavage of and results in increased activity of CASP3 protein	16275998
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in increased cleavage of CASP3 protein	14688022
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	BCL2 protein inhibits the reaction [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	Boc-D-FMK inhibits the reaction [[fludarabine co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein]	15850772
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	MAP2K1 protein inhibits the reaction [[2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with fludarabine] results in increased cleavage of CASP3 protein]	15850772
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	pyrazolanthrone inhibits the reaction [[fludarabine co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein]	15850772
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	[TNFSF10 protein co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein	19261616
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	TP53 protein promotes the reaction [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [cadmium sulfate results in increased activity of CASP3 protein]	14687664
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [EPO protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	17928571
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rottlerin inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]]	25895139
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	23143138
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in increased cleavage of CASP3 protein	15695173
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	[Butyrates co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased activity of CASP3 protein	16256798
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [5-aminoisoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	23352507
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [dan-shen root extract inhibits the reaction [IGF2 protein mutant form results in increased cleavage of and results in increased activity of CASP3 protein]]	23419388
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [ginsenoside Rg2 inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]]	28756148
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [NRG1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	19801490
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	17045724
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Resveratrol results in decreased expression of CASP3 protein modified form]	24602480
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rhodioloside inhibits the reaction [Colistin results in increased activity of and results in increased cleavage of CASP3 protein]]	28465020
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [salvianolic acid B inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	23201927
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [APP protein modified form results in increased activity of CASP3 protein]	28756148
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
C085911	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in increased activity of CASP3 protein	16018989; 16487511;
C408604	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole inhibits the reaction [Lapatinib results in increased cleavage of CASP3 protein]	29387217
C408604	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole promotes the reaction [2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [TNF protein results in increased cleavage of CASP3 protein]]	11299730
C408604	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole results in decreased activity of CASP3 protein	19010935
C408604	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole results in decreased cleavage of CASP3 protein	14685156
C081331	24-norursodeoxycholic acid	24-norursodeoxycholic acid results in decreased expression of CASP3 protein	21115542
C450643	(2)-5,6,7,8,4'-pentamethoxyflavanone	(2)-5,6,7,8,4'-pentamethoxyflavanone results in increased cleavage of CASP3 protein	19450678
C117776	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein	26630137
C117776	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone	2-morpholin-4-yl-6-thianthren-1-yl-pyran-4-one inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C117776	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone	Acetylcysteine inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C117776	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone	Dicumarol inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C117776	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone	pifithrin inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C117776	2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone	pyrazolanthrone inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C506698	2,5-dimethylcelecoxib	2,5-dimethylcelecoxib results in increased cleavage of and results in increased activity of CASP3 protein	16123214
C011269	2,5-hexanedione	2,5-hexanedione results in increased expression of CASP3 mRNA	21901545
C011269	2,5-hexanedione	2,5-hexanedione results in increased expression of CASP3 protein alternative form	21901545
C011269	2,5-hexanedione	2,5-hexanedione results in increased expression of CASP3 protein	17492505
C007997	25-hydroxycholesterol	25-hydroxycholesterol results in increased activity of CASP3 protein	25845326
C007997	25-hydroxycholesterol	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C007997	25-hydroxycholesterol	Acetylcysteine inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C007997	25-hydroxycholesterol	BAY 11-7085 inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C007997	25-hydroxycholesterol	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C557882	25-methoxyldammarane-3,12,20-triol	25-methoxyldammarane-3,12,20-triol results in increased cleavage of CASP3 protein	21924252
C015802	2,6-dichloro-4-nitrophenol	2,6-dichloro-4-nitrophenol results in increased activity of CASP3 protein	11227219
C015802	2,6-dichloro-4-nitrophenol	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane analog inhibits the reaction [2,6-dichloro-4-nitrophenol results in increased activity of CASP3 protein]	11227219
C583716	2,6-difluoro-N-(1-(4-hydroxy-2-(trifluoromethyl)benzyl)-1H-pyrazol-3-yl)benzamide	2,6-difluoro-N-(1-(4-hydroxy-2-(trifluoromethyl)benzyl)-1H-pyrazol-3-yl)benzamide inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
C073838	2,6-dimethyl-3,5-bis(2'-propoxyethoxycarbonyl)-4-(2''-difluoromethoxyphenyl)-1,4-dihydropyridine	2,6-dimethyl-3,5-bis(2'-propoxyethoxycarbonyl)-4-(2''-difluoromethoxyphenyl)-1,4-dihydropyridine inhibits the reaction [Zidovudine results in increased expression of CASP3 protein]	18801031
C023514	2,6-dinitrotoluene	2,6-dinitrotoluene affects the expression of CASP3 mRNA	21346803
C062897	28-deoxonimbolide	28-deoxonimbolide results in increased activity of CASP3 protein	21381696
C000599179	28-O-acetylbetulin-3-ylglucopyranoside	28-O-acetylbetulin-3-ylglucopyranoside results in increased activity of CASP3 protein	26772157
C000599179	28-O-acetylbetulin-3-ylglucopyranoside	28-O-acetylbetulin-3-ylglucopyranoside results in increased activity of CASP3 protein	22343715; 26772157;
C000599179	28-O-acetylbetulin-3-ylglucopyranoside	ATG7 mutant form inhibits the reaction [28-O-acetylbetulin-3-ylglucopyranoside results in increased activity of CASP3 protein]	22343715
C000599179	28-O-acetylbetulin-3-ylglucopyranoside	BECN1 mutant form inhibits the reaction [28-O-acetylbetulin-3-ylglucopyranoside results in increased activity of CASP3 protein]	22343715
C000599179	28-O-acetylbetulin-3-ylglucopyranoside	CA 074 methyl ester affects the reaction [28-O-acetylbetulin-3-ylglucopyranoside results in increased activity of CASP3 protein]	22343715
D015073	2-Acetylaminofluorene	2-Acetylaminofluorene inhibits the reaction [[lipopolysaccharide, Escherichia coli O111 B4 co-treated with Galactosamine] results in increased cleavage of CASP3 protein]	12907702
D015073	2-Acetylaminofluorene	2-Acetylaminofluorene results in increased activity of CASP3 protein	23665045
D015073	2-Acetylaminofluorene	2-Acetylaminofluorene results in increased expression of CASP3 protein	26364502
D015073	2-Acetylaminofluorene	Diosmin inhibits the reaction [2-Acetylaminofluorene results in increased activity of CASP3 protein]	23665045
D015073	2-Acetylaminofluorene	geraniol inhibits the reaction [2-Acetylaminofluorene results in increased expression of CASP3 protein]	26364502
C488175	2-(acetyloxy)benzoic acid 6-(nitrooxymethyl)-2-phenylmethyl ester	2-(acetyloxy)benzoic acid 6-(nitrooxymethyl)-2-phenylmethyl ester results in increased expression of CASP3 protein	15201807
C049584	2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine	2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in increased activity of CASP3 protein	20307560
C049584	2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine	[2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline co-treated with 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine] results in increased activity of CASP3 protein	20307560
C049584	2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine	[2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form	18616682
C036990	2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline	[2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline co-treated with 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine] results in increased activity of CASP3 protein	20307560
C036990	2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline	2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline results in increased activity of CASP3 protein	20307560
C000599178	2-amino-3-hydroxy-2-hydroxymethylpropyl 3-acetylbetulinoate	2-amino-3-hydroxy-2-hydroxymethylpropyl 3-acetylbetulinoate analog results in increased activity of CASP3 protein	26772157
C000599178	2-amino-3-hydroxy-2-hydroxymethylpropyl 3-acetylbetulinoate	2-amino-3-hydroxy-2-hydroxymethylpropyl 3-acetylbetulinoate results in increased activity of CASP3 protein	26772157
C035208	2-amino-4,6-dinitrotoluene	2-amino-4,6-dinitrotoluene results in decreased expression of CASP3 mRNA	26251320
C005926	2-amino-4-hydroxy-6-formylpteridine	2-amino-4-hydroxy-6-formylpteridine results in increased activity of CASP3 protein	16019850
C570662	2-amino-8-(4-(2-hydroxyethoxy)cyclohexyl)-6-(6-methoxypyridin-3-yl)-4-methylpyrido(2,3-d)pyrimidin-7(8H)-one	2-amino-8-(4-(2-hydroxyethoxy)cyclohexyl)-6-(6-methoxypyridin-3-yl)-4-methylpyrido(2,3-d)pyrimidin-7(8H)-one results in increased cleavage of and results in increased activity of CASP3 protein	23639247
C499326	2-((aminocarbonyl)amino)-5-(4-fluorophenyl)-3-thiophenecarboxamide	2-((aminocarbonyl)amino)-5-(4-fluorophenyl)-3-thiophenecarboxamide inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	28119452
C014970	2-aminodiphenyl	2-aminodiphenyl results in increased activity of CASP3 protein	23836369
C014970	2-aminodiphenyl	Acetylcysteine inhibits the reaction [2-aminodiphenyl results in increased activity of CASP3 protein]	23836369
C014970	2-aminodiphenyl	pyrazolanthrone inhibits the reaction [2-aminodiphenyl results in increased activity of CASP3 protein]	23836369
C504876	2-aminoethoxydiphenylborane	2-aminoethoxydiphenylborane inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	29883672
C109986	2-aminoethoxydiphenyl borate	2-aminoethoxydiphenyl borate inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	23022152
C109986	2-aminoethoxydiphenyl borate	2-aminoethoxydiphenyl borate inhibits the reaction [[TNF protein co-treated with IFNG protein] promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
C109986	2-aminoethoxydiphenyl borate	2-aminoethoxydiphenyl borate inhibits the reaction [TNF protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
C109986	2-aminoethoxydiphenyl borate	[Verapamil co-treated with Ruthenium Red co-treated with 2-aminoethoxydiphenyl borate] inhibits the reaction [Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein]	19631781
C109986	2-aminoethoxydiphenyl borate	2-aminoethoxydiphenyl borate inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
C538758	2-aminoethyl diphenylborinate	2-aminoethyl diphenylborinate inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
C538758	2-aminoethyl diphenylborinate	2-aminoethyl diphenylborinate inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
C507359	2-aziridin-1-yl-3-((2-((2-(3-aziridin-1-yl-1,4-dioxo-1,4-dihydronaphthalen-2-yl)thio)ethoxy)ethyl)thio)naphthoquinone	2-aziridin-1-yl-3-((2-((2-(3-aziridin-1-yl-1,4-dioxo-1,4-dihydronaphthalen-2-yl)thio)ethoxy)ethyl)thio)naphthoquinone results in increased activity of CASP3 protein	15642166
C484327	2'-benzoyloxycinnamaldehyde	2'-benzoyloxycinnamaldehyde results in increased activity of CASP3 protein	14660655
C484327	2'-benzoyloxycinnamaldehyde	Acetylcysteine inhibits the reaction [2'-benzoyloxycinnamaldehyde results in increased activity of CASP3 protein]	14660655
C484327	2'-benzoyloxycinnamaldehyde	Glutathione inhibits the reaction [2'-benzoyloxycinnamaldehyde results in increased activity of CASP3 protein]	14660655
C012796	2-butenal	2-butenal results in increased activity of CASP3 protein	23535401
C457499	2-chloro-5-nitrobenzanilide	2-chloro-5-nitrobenzanilide inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
C457499	2-chloro-5-nitrobenzanilide	2-chloro-5-nitrobenzanilide inhibits the reaction [Emodin results in increased activity of CASP3 protein]	25448808
C457499	2-chloro-5-nitrobenzanilide	2-chloro-5-nitrobenzanilide inhibits the reaction [PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]]	12927354
C031278	2-chloroethyl ethyl sulfide	2-chloroethyl ethyl sulfide results in increased activity of CASP3 protein	12717745; 12815614;
C031278	2-chloroethyl ethyl sulfide	Acetylcysteine inhibits the reaction [2-chloroethyl ethyl sulfide results in increased activity of CASP3 protein]	12815614
C031278	2-chloroethyl ethyl sulfide	2-chloroethyl ethyl sulfide results in increased activity of CASP3 protein	12208782; 20469912;
C031278	2-chloroethyl ethyl sulfide	2-chloroethyl ethyl sulfide results in increased expression of CASP3 mRNA	12208782
C031278	2-chloroethyl ethyl sulfide	2-chloroethyl ethyl sulfide results in increased expression of CASP3 protein	12208782
C031278	2-chloroethyl ethyl sulfide	2-chloroethyl ethyl sulfide results in increased expression of CASP3 protein modified form	20469912
C031278	2-chloroethyl ethyl sulfide	2-chloroethyl ethyl sulfide results in increased activity of CASP3 protein	20469912
C090034	2-chloro-N(6)-(3-iodobenzyl)adenosine-5'-N-methyluronamide	2-chloro-N(6)-(3-iodobenzyl)adenosine-5'-N-methyluronamide results in increased activity of CASP3 protein	11911839
C090034	2-chloro-N(6)-(3-iodobenzyl)adenosine-5'-N-methyluronamide	2-chloro-N(6)-(3-iodobenzyl)adenosine-5'-N-methyluronamide results in increased activity of CASP3 protein	10854059
C087939	2''-galloylhyperin	2''-galloylhyperin inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	28213291
C576975	2-hydroxy-3',5,5'-trimethoxychalcone	2-hydroxy-3',5,5'-trimethoxychalcone results in increased cleavage of CASP3 protein	30408460
C533410	2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one	2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein	29690507
C533410	2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one	Cisplatin promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]	29690507
C533410	2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one	Oxygen deficiency promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]	29690507
C533410	2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one	Oxygen deficiency promotes the reaction [Cisplatin promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]]	29690507
C044556	2-iodomelatonin	2-iodomelatonin inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]	14962062
C044556	2-iodomelatonin	4-phenyl-2-propionamidotetraline inhibits the reaction [2-iodomelatonin inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]]	14962062
C526437	2-methoxy-3-O-sulfamoyl-17-cyanomethylestra-1,3,5(10)-triene	2-methoxy-3-O-sulfamoyl-17-cyanomethylestra-1,3,5(10)-triene results in increased activity of CASP3 protein	19846905
C049826	2-methoxyacetaldehyde	2-methoxyacetaldehyde results in increased activity of CASP3 protein	12502240
D000077584	2-Methoxyestradiol	2-Methoxyestradiol promotes the reaction [Quercetin results in increased cleavage of CASP3 protein]	26011145
D000077584	2-Methoxyestradiol	2-Methoxyestradiol results in increased cleavage of CASP3 protein	26011145
D000077584	2-Methoxyestradiol	2-Methoxyestradiol results in increased expression of CASP3 protein modified form	23967052
D000077584	2-Methoxyestradiol	Arsenic Trioxide promotes the reaction [2-Methoxyestradiol results in increased expression of CASP3 protein modified form]	23967052
D000077584	2-Methoxyestradiol	Quercetin promotes the reaction [2-Methoxyestradiol results in increased cleavage of CASP3 protein]	26011145
C500344	2-methoxyestradiol-3,17-bis-O,O-sulfamate	2-methoxyestradiol-3,17-bis-O,O-sulfamate results in increased cleavage of and results in increased activity of CASP3 protein	15258464
C526438	2-methoxyestradiol-3,17-O,O-bis(sulfamate)	2-methoxyestradiol-3,17-O,O-bis(sulfamate) results in increased activity of CASP3 protein	19846905
C042889	2-methyl-1,4-benzoquinone	2-methyl-1,4-benzoquinone results in decreased activity of CASP3 protein	17051661
C433771	2-methyl-3-(2-((4-nitrooxybutyloxy)carbonyl)vinyl)phenyl ursodeoxycholic acid ester	2-methyl-3-(2-((4-nitrooxybutyloxy)carbonyl)vinyl)phenyl ursodeoxycholic acid ester results in decreased activity of CASP3 protein	11226294
C433771	2-methyl-3-(2-((4-nitrooxybutyloxy)carbonyl)vinyl)phenyl ursodeoxycholic acid ester	Dithiothreitol inhibits the reaction [2-methyl-3-(2-((4-nitrooxybutyloxy)carbonyl)vinyl)phenyl ursodeoxycholic acid ester results in decreased activity of CASP3 protein]	11226294
C011506	2-methyl-4-isothiazolin-3-one	2-methyl-4-isothiazolin-3-one results in increased expression of CASP3 protein modified form	29110394
C009907	2-methylcyclopentadienyl manganese tricarbonyl	2-methylcyclopentadienyl manganese tricarbonyl results in increased activity of CASP3 protein	11880503; 15681813;
C009907	2-methylcyclopentadienyl manganese tricarbonyl	[acetyl-aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] inhibits the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased cleavage of and results in increased activity of PRKCD protein]	11880503
C009907	2-methylcyclopentadienyl manganese tricarbonyl	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] inhibits the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased cleavage of and results in increased activity of PRKCD protein]	11880503
C009907	2-methylcyclopentadienyl manganese tricarbonyl	CASP3 protein affects the susceptibility to 2-methylcyclopentadienyl manganese tricarbonyl	11880503
C009907	2-methylcyclopentadienyl manganese tricarbonyl	CASP3 protein promotes the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased cleavage of and results in increased activity of PRKCD protein]	11880503
C009907	2-methylcyclopentadienyl manganese tricarbonyl	[CASP3 protein results in increased cleavage of PRKCD protein] which results in increased susceptibility to 2-methylcyclopentadienyl manganese tricarbonyl	11880503
C009907	2-methylcyclopentadienyl manganese tricarbonyl	rottlerin inhibits the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased activity of CASP3 protein]	11880503
C495818	2-morpholin-4-yl-6-thianthren-1-yl-pyran-4-one	2-morpholin-4-yl-6-thianthren-1-yl-pyran-4-one inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C016617	2-nitropropane	2-nitropropane results in increased activity of CASP3 protein	19268524
C016617	2-nitropropane	APEX1 protein inhibits the reaction [2-nitropropane results in increased activity of CASP3 protein]	19268524
C079391	2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide	2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide results in increased activity of CASP3 protein	20576500
C079391	2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide	2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide inhibits the reaction [dihydrolipoic acid results in increased activity of CASP3 protein]	21462292
C545747	2-phenylacetylenesulfonamide	2-phenylacetylenesulfonamide inhibits the reaction [solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
D019840	2-Propanol	2-Propanol results in increased expression of CASP3 mRNA	19815060
C054527	2-tert-butyl-4-methylphenol	2-tert-butyl-4-methylphenol results in decreased activity of CASP3 protein	14981915
C018855	2-tert-butylhydroquinone	2-tert-butylhydroquinone inhibits the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
C018855	2-tert-butylhydroquinone	2-tert-butylhydroquinone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	26878773
C018855	2-tert-butylhydroquinone	solanesol promotes the reaction [2-tert-butylhydroquinone inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
C018855	2-tert-butylhydroquinone	2-tert-butylhydroquinone inhibits the reaction [Etoposide results in increased cleavage of and results in increased activity of CASP3 protein]	22275372
C018855	2-tert-butylhydroquinone	2-tert-butylhydroquinone inhibits the reaction [ferrous sulfate results in increased cleavage of CASP3 protein]	28583816
C556168	3-(2-(3-(1-adamantyl)-4-hydroxyphenyl)-5-pyrimidinyl)-2-propenoic acid	3-(2-(3-(1-adamantyl)-4-hydroxyphenyl)-5-pyrimidinyl)-2-propenoic acid results in increased activity of CASP3 protein	21548569
C054649	3-(2-hydroxy-4-(1,1-dimethylheptyl)phenyl)-4-(3-hydroxypropyl)cyclohexanol	3-(2-hydroxy-4-(1,1-dimethylheptyl)phenyl)-4-(3-hydroxypropyl)cyclohexanol results in increased activity of CASP3 protein	24211273
C514772	3,3',4,4',5,5'-hexahydroxystilbene	3,3',4,4',5,5'-hexahydroxystilbene results in increased activity of CASP3 protein	24398169
C041525	3,3',4,5'-tetrahydroxystilbene	[3,3',4,5'-tetrahydroxystilbene co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	21167276
C041525	3,3',4,5'-tetrahydroxystilbene	3,3',4,5'-tetrahydroxystilbene results in increased activity of and results in increased cleavage of CASP3 protein	21167276
C041525	3,3',4,5'-tetrahydroxystilbene	3,3',4,5'-tetrahydroxystilbene results in increased activity of CASP3 protein	11681415; 16158945;
C041525	3,3',4,5'-tetrahydroxystilbene	3,3',4,5'-tetrahydroxystilbene inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	31323227
C551466	3,3',5,5'-tetrahydroxystilbene	3,3',5,5'-tetrahydroxystilbene results in increased activity of CASP3 protein	20484155
C103788	3-((3,5-bis(trifluoromethyl)phenyl)methyloxy)-2-phenylpiperidine	3-((3,5-bis(trifluoromethyl)phenyl)methyloxy)-2-phenylpiperidine inhibits the reaction [norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]]	29467000
D015101	3,3'-Dichlorobenzidine	3,3'-Dichlorobenzidine results in increased activity of CASP3 protein	24604609
C016392	3,3'-diindolylmethane	3,3'-diindolylmethane results in increased activity of CASP3 protein	21820497
C527590	3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one	3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	30776389
C028451	3,4,3',4'-tetrachlorobiphenyl	3,4,3',4'-tetrachlorobiphenyl results in increased expression of CASP3 protein	20638727
C023035	3,4,5,3',4'-pentachlorobiphenyl	3,4,5,3',4'-pentachlorobiphenyl results in increased activity of CASP3 protein	19022367
C023035	3,4,5,3',4'-pentachlorobiphenyl	3,4,5,3',4'-pentachlorobiphenyl results in increased expression of CASP3 protein	31563530
C482492	3,4,5,4'-tetramethoxystilbene	3,4,5,4'-tetramethoxystilbene results in increased activity of CASP3 protein	24055891
C482492	3,4,5,4'-tetramethoxystilbene	3,4,5,4'-tetramethoxystilbene results in increased expression of CASP3 protein modified form	23770989
C423629	3,4,5,6-tetrachlorocatechol	3,4,5,6-tetrachlorocatechol results in increased activity of CASP3 protein	19766705
C061213	3',4',7-trihydroxyisoflavone	3',4',7-trihydroxyisoflavone promotes the reaction [Epirubicin results in increased expression of CASP3 mRNA]	22914566
C061213	3',4',7-trihydroxyisoflavone	3',4',7-trihydroxyisoflavone results in increased activity of CASP3 protein	22914566
C061213	3',4',7-trihydroxyisoflavone	3',4',7-trihydroxyisoflavone results in increased expression of CASP3 mRNA	22914566
C061213	3',4',7-trihydroxyisoflavone	Epirubicin promotes the reaction [3',4',7-trihydroxyisoflavone results in increased activity of CASP3 protein]	22914566
C061213	3',4',7-trihydroxyisoflavone	Epirubicin promotes the reaction [3',4',7-trihydroxyisoflavone results in increased expression of CASP3 mRNA]	22914566
C504711	3,4-dideoxyglucosone-3-ene	3,4-dideoxyglucosone-3-ene results in increased activity of CASP3 protein	16046310
C108729	3,4-dihydro-5-(4-(1-piperidinyl)butoxy)-1(2H)-isoquinolinone	3,4-dihydro-5-(4-(1-piperidinyl)butoxy)-1(2H)-isoquinolinone inhibits the reaction [[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein]	17237268
C068870	3,4-dihydro-5-methyl-1(2H)-isoquinolinone	3,4-dihydro-5-methyl-1(2H)-isoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
C028288	3',4'-dihydroxyflavone	3',4'-dihydroxyflavone analog inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	16014620
C028288	3',4'-dihydroxyflavone	3',4'-dihydroxyflavone analog inhibits the reaction [kaempferol results in increased cleavage of CASP3 protein]	16014620
C005975	3,4-dihydroxyphenylethanol	3,4-dihydroxyphenylethanol inhibits the reaction [Acrylamide results in increased activity of CASP3 protein]	21777647
C005975	3,4-dihydroxyphenylethanol	3,4-dihydroxyphenylethanol inhibits the reaction [[Xanthine co-treated with XDH protein] results in increased cleavage of CASP3 protein]	26374991
C509288	3',4'-dimethoxyflavone	3',4'-dimethoxyflavone analog results in increased cleavage of CASP3 protein	29630880
C478100	3,4-di-O-caffeoylquinic acid	3,4-di-O-caffeoylquinic acid results in increased activity of CASP3 protein	21872580
C472791	3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid	3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in increased expression of CASP3 mRNA	16788091
C554666	3,4-methylenedioxypyrovalerone	3,4-methylenedioxypyrovalerone results in increased activity of CASP3 protein	27255387
C434003	3-(4-methylphenylsulfonyl)-2-propenenitrile	[3-(4-methylphenylsulfonyl)-2-propenenitrile co-treated with gemcitabine] affects the activity of CASP3 protein	29782821
C434003	3-(4-methylphenylsulfonyl)-2-propenenitrile	[3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [FAM168A results in decreased susceptibility to Cisplatin]] which results in increased cleavage of CASP3 protein	23251525
C523668	3-(5-(2,3-dichlorophenyl)-1H-tetrazol-1-yl)methylpyridine	3-(5-(2,3-dichlorophenyl)-1H-tetrazol-1-yl)methylpyridine inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	25308879
C525762	3,5-dicaffeoylquinic acid methyl ester	3,5-dicaffeoylquinic acid methyl ester inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	25451577
C090937	3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole	3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole promotes the reaction [Camptothecin results in increased activity of CASP3 protein]	19481069
C090937	3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole	3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole results in increased activity of CASP3 protein	19481069
C026423	3,8-dihydroxy-6H-dibenzo(b,d)pyran-6-one	3,8-dihydroxy-6H-dibenzo(b,d)pyran-6-one results in increased activity of CASP3 protein	23811531
C019132	3-amino-1,4-dimethyl-5H-pyrido(4,3-b)indole	3-amino-1,4-dimethyl-5H-pyrido(4,3-b)indole results in increased cleavage of and results in increased activity of CASP3 protein	11999409
C019132	3-amino-1,4-dimethyl-5H-pyrido(4,3-b)indole	Methylcholanthrene inhibits the reaction [3-amino-1,4-dimethyl-5H-pyrido(4,3-b)indole results in increased cleavage of and results in increased activity of CASP3 protein]	11999409
C025160	3-aminobenzamide	3-aminobenzamide inhibits the reaction [[oxyhyponitrite results in increased abundance of nitroxyl] which results in increased activity of CASP3 protein]	11744336
C025160	3-aminobenzamide	3-aminobenzamide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
C025160	3-aminobenzamide	3-aminobenzamide inhibits the reaction [SFRP1 protein promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30377735
C416782	3-bromoacetylamino benzoic acid ethyl ester	3-bromoacetylamino benzoic acid ethyl ester results in increased cleavage of and results in increased activity of CASP3 protein	11077052
C018258	3-deazaadenosine	3-deazaadenosine results in increased activity of CASP3 protein	11190270
C017906	3-dinitrobenzene	3-dinitrobenzene results in increased cleavage of CASP3 protein	19477251
C017906	3-dinitrobenzene	3-dinitrobenzene results in increased cleavage of CASP3 protein	22841810
C505417	3-hydrogenkwadaphnin	[3-hydrogenkwadaphnin co-treated with Hypoxanthine] results in increased activity of CASP3 protein	21396949
C080194	3-hydroxy-4-pentenoic acid	3-hydroxy-4-pentenoic acid promotes the reaction [ganglioside, GD3 results in increased cleavage of and results in increased activity of CASP3 protein]	10783138
D020155	3-Hydroxybutyric Acid	3-Hydroxybutyric Acid inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	16917840
C041477	3-hydroxyflavone	3-hydroxyflavone results in decreased expression of CASP3 protein	21126572
C554289	3-hydroxylup-20(29)-ene-27,28-dioic acid dimethyl ester	3-hydroxylup-20(29)-ene-27,28-dioic acid dimethyl ester results in increased activity of CASP3 protein	20670616
C000588582	3-methoxy-6-(((2,4,6-trimethoxystyryl)sulfonyl)methyl)pyridin-2-amine	3-methoxy-6-(((2,4,6-trimethoxystyryl)sulfonyl)methyl)pyridin-2-amine results in increased activity of CASP3 protein	24471873
C025946	3-methyladenine	[3-methyladenine co-treated with cobaltous chloride co-treated with TP53 gene mutant form] results in increased activity of CASP3 protein	23380477
C025946	3-methyladenine	[3-methyladenine co-treated with fosbretabulin] results in increased cleavage of CASP3 protein	24321340
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	29902662
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	31226464
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Fingolimod Hydrochloride results in increased cleavage of CASP3 protein]	25939952
C025946	3-methyladenine	3-methyladenine inhibits the reaction [perfluorooctane sulfonic acid results in increased activity of CASP3 protein]	27413105
C025946	3-methyladenine	3-methyladenine inhibits the reaction [polyphyllin I results in increased expression of CASP3 protein modified form]	31421117
C025946	3-methyladenine	3-methyladenine inhibits the reaction [tetrandrine results in increased cleavage of CASP3 protein]	25266202
C025946	3-methyladenine	3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
C025946	3-methyladenine	3-methyladenine promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]	20104024
C025946	3-methyladenine	3-methyladenine promotes the reaction [Amiodarone results in increased cleavage of CASP3 protein]	23912912
C025946	3-methyladenine	3-methyladenine promotes the reaction [astin B results in increased cleavage of CASP3 protein]	25219577
C025946	3-methyladenine	3-methyladenine promotes the reaction [Biological Products results in increased expression of and results in increased cleavage of CASP3 protein]	30465897
C025946	3-methyladenine	3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
C025946	3-methyladenine	3-methyladenine promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
C025946	3-methyladenine	3-methyladenine promotes the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]	19139269
C025946	3-methyladenine	3-methyladenine promotes the reaction [embelin results in increased degradation of CASP3 protein]	28722333
C025946	3-methyladenine	3-methyladenine promotes the reaction [Fluorouracil results in increased cleavage of and results in increased activity of CASP3 protein]	19116755
C025946	3-methyladenine	3-methyladenine promotes the reaction [fosbretabulin results in increased cleavage of CASP3 protein]	24321340
C025946	3-methyladenine	3-methyladenine promotes the reaction [MAP3K5 protein results in increased activity of CASP3 protein]	20929985
C025946	3-methyladenine	3-methyladenine promotes the reaction [Paraquat results in increased activity of CASP3 protein]	17341480
C025946	3-methyladenine	3-methyladenine promotes the reaction [tetrandrine results in increased cleavage of CASP3 protein]	26822499
C025946	3-methyladenine	3-methyladenine promotes the reaction [usnic acid results in increased activity of CASP3 protein]	25078063
C025946	3-methyladenine	3-methyladenine results in increased activity of CASP3 protein	18818525; 19139269;
C025946	3-methyladenine	3-methyladenine results in increased cleavage of CASP3 protein	25266202; 28483490;
C025946	3-methyladenine	3-methyladenine results in increased expression of and results in increased cleavage of CASP3 protein	30465897
C025946	3-methyladenine	ATG5 protein affects the reaction [3-methyladenine results in increased activity of CASP3 protein]	18818525
C025946	3-methyladenine	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]]	20104024
C025946	3-methyladenine	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]]	20104024
C025946	3-methyladenine	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [3-methyladenine promotes the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]]	19139269
C025946	3-methyladenine	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [dihydrocapsaicin promotes the reaction [3-methyladenine results in increased activity of CASP3 protein]]	19139269
C025946	3-methyladenine	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [3-methyladenine results in increased activity of CASP3 protein]	18818525
C025946	3-methyladenine	dihydrocapsaicin promotes the reaction [3-methyladenine results in increased activity of CASP3 protein]	19139269
C025946	3-methyladenine	3-methyladenine inhibits the reaction [procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]]	27057282
C025946	3-methyladenine	3-methyladenine results in increased expression of CASP3 mRNA	21681844
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Aminolevulinic Acid analog results in increased activity of CASP3 protein]	20426806
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Oxidopamine results in increased expression of CASP3 protein modified form]	28802652
C025946	3-methyladenine	3-methyladenine inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	25639566
C025946	3-methyladenine	3-methyladenine promotes the reaction [4-nonylphenol results in increased cleavage of CASP3 protein]	26804764
C025946	3-methyladenine	3-methyladenine promotes the reaction [Staurosporine results in increased cleavage of CASP3 protein]	16497721
C025946	3-methyladenine	3-methyladenine promotes the reaction [T-2 Toxin results in increased expression of CASP3 protein modified form]	30629952
C025946	3-methyladenine	3-methyladenine inhibits the reaction [Zinc Sulfate results in increased cleavage of CASP3 protein]	28803810
C025946	3-methyladenine	3-methyladenine promotes the reaction [ochratoxin A results in increased cleavage of CASP3 protein]	30287338
C047368	3-methylquercetin	3-methylquercetin results in decreased expression of CASP3 protein	22992727
C047368	3-methylquercetin	3-methylquercetin results in increased activity of CASP3 protein	12826665
C047368	3-methylquercetin	3-methylquercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19222219
C033643	3-nitrofluoranthene	3-nitrofluoranthene results in increased activity of CASP3 protein	19041363
C015392	3-nitropropionic acid	3-nitropropionic acid results in increased activity of CASP3 protein	15571979; 29753867;
C015392	3-nitropropionic acid	3-nitropropionic acid results in increased cleavage of CASP3 protein	21945202
C015392	3-nitropropionic acid	naringin inhibits the reaction [3-nitropropionic acid results in increased cleavage of CASP3 protein]	21945202
C015392	3-nitropropionic acid	Tacrolimus inhibits the reaction [3-nitropropionic acid results in increased activity of CASP3 protein]	15571979
C015392	3-nitropropionic acid	Topiramate inhibits the reaction [3-nitropropionic acid results in increased activity of CASP3 protein]	29753867
C033901	3'-O-(4-benzoyl)benzoyladenosine 5'-triphosphate	3'-O-(4-benzoyl)benzoyladenosine 5'-triphosphate results in increased activity of CASP3 protein	23727220
C581004	3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile	3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein	24036456
C581004	3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile	Acetylcysteine inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
C581004	3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile	Glutathione inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
C581004	3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile	pyrazolanthrone inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
C581004	3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile	SB 203580 inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
C000614725	3'-oxomethylisoeugenol	3'-oxomethylisoeugenol results in increased activity of CASP3 protein	28818686
C048342	3-(pentadec-10-enyl)catechol	3-(pentadec-10-enyl)catechol results in increased activity of CASP3 protein	19007765
C504089	(3Z)-3-(1H-pyrrol-2-yl)-methyllidene)-1-(1-(piperidylmethyl)-1,3-dihydro-2H-indol-2-one mesylate	(3Z)-3-(1H-pyrrol-2-yl)-methyllidene)-1-(1-(piperidylmethyl)-1,3-dihydro-2H-indol-2-one mesylate affects the expression of CASP3 protein	20495136
C512706	4-(1-benzenesulfonyl-1H-indol-2-yl)-4-hydroxycyclohexa-2,5-dienone	4-(1-benzenesulfonyl-1H-indol-2-yl)-4-hydroxycyclohexa-2,5-dienone results in increased cleavage of CASP3 protein	16756956
C038864	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid results in increased expression of CASP3	16909596
C038864	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid results in increased expression of CASP3 protein	16109544; 16157052;
C471109	4(2'-aminoethyl)amino-1,8-dimethylimidazo(1,2-a)quinoxaline	4(2'-aminoethyl)amino-1,8-dimethylimidazo(1,2-a)quinoxaline promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	23143138
C000602001	4-(3,5-dimethoxystyryl)phenyl acetate	4-(3,5-dimethoxystyryl)phenyl acetate results in increased cleavage of CASP3 protein	26138072
C572961	4-(4-(3-(4-trifluoromethoxy-phenyl)ureido)cyclohexyloxy)benzoic acid	4-(4-(3-(4-trifluoromethoxy-phenyl)ureido)cyclohexyloxy)benzoic acid results in decreased cleavage of CASP3 protein	25377915
C486184	4,4',4''-(4-propyl-((1)H)-pyrazole-1,3,5-triyl) tris-phenol	4,4',4''-(4-propyl-((1)H)-pyrazole-1,3,5-triyl) tris-phenol inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in increased activity of CASP3 protein]	24216299
C121616	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16972258
C008745	4,4'-bisphenol F	4,4'-bisphenol F results in decreased expression of CASP3 mRNA	26186136
C517487	4-(4-bromophenyl)-2,3-dihydro-N,3-bis(3,4,5-trimethoxyphenyl)-2-oxoidmi-dazole-1-carboxamide	4-(4-bromophenyl)-2,3-dihydro-N,3-bis(3,4,5-trimethoxyphenyl)-2-oxoidmi-dazole-1-carboxamide results in increased cleavage of CASP3 protein	16900371
C009505	4,4'-diaminodiphenylmethane	4,4'-diaminodiphenylmethane results in decreased expression of CASP3 mRNA	18648102
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [quinocetone results in increased cleavage of CASP3 protein]	28343033
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	[Carmustine co-treated with 4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid] results in increased activity of CASP3 protein	18590702
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18164246
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	AKT1 protein affects the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D017878	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid	Wortmannin inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
C525246	(4,4-dimethyl-2,2-bipyridine)(acetylacetonate)copper(II)	(4,4-dimethyl-2,2-bipyridine)(acetylacetonate)copper(II) results in decreased activity of CASP3 protein	22540380
C090942	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Oxaliplatin results in increased activity of CASP3 protein]	20708607
C090942	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Phytochemicals results in increased expression of CASP3 protein modified form]	25305377
C090942	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [cadmium sulfate results in increased activity of CASP3 protein]	14687664
C090942	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Resveratrol results in decreased expression of CASP3 protein modified form]	25891866
C090942	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16712891
C119130	4-(5-(4-chlorophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide	4-(5-(4-chlorophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide results in increased cleavage of and results in increased activity of CASP3 protein	12203115
C119130	4-(5-(4-chlorophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide	TNFSF10 protein promotes the reaction [4-(5-(4-chlorophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide results in increased cleavage of and results in increased activity of CASP3 protein]	12203115
C405354	4,5,6,7-tetrabromobenzotriazole	[4,5,6,7-tetrabromobenzotriazole co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	16489027
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide inhibits the reaction [Carbofuran results in increased expression of CASP3 protein modified form]	28982980
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide results in decreased expression of CASP3 protein modified form	28982980
C423630	4,5-dichlorocatechol	4,5-dichlorocatechol results in increased activity of CASP3 protein	19766705
C568862	4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b-3H-cyclopenta(c)quinoline	4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b-3H-cyclopenta(c)quinoline results in increased cleavage of CASP3 protein	24161432
C506606	4-(6-cyclohexylmethoxy-9H-purin-2-ylamino)-N,N-diethylbenzamide	[4-(6-cyclohexylmethoxy-9H-purin-2-ylamino)-N,N-diethylbenzamide co-treated with Paclitaxel] results in increased activity of CASP3 protein	16170024
C523393	4-(6-hydroxy-2-naphthyl)-1,3-benzenediol	4-(6-hydroxy-2-naphthyl)-1,3-benzenediol results in decreased expression of CASP3 protein	20198347
C086538	4-amino-1,8-naphthalimide	4-amino-1,8-naphthalimide promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	25499136
C086538	4-amino-1,8-naphthalimide	4-amino-1,8-naphthalimide promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15456408
C086538	4-amino-1,8-naphthalimide	4-amino-1,8-naphthalimide results in increased activity of CASP3 protein	18695944
C108123	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine inhibits the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15772366
C108123	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
C108123	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine inhibits the reaction [IL1B protein results in increased cleavage of CASP3 protein]	22936809
C055331	4-aminocrotonic acid	(1,2,5,6-tetrahydropyridin-4-yl)methylphosphinic acid inhibits the reaction [4-aminocrotonic acid inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]]	14535961
C055331	4-aminocrotonic acid	4-aminocrotonic acid inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]	14535961
D015761	4-Aminopyridine	4-Aminopyridine results in increased activity of CASP3 protein	24378259
C471867	4-(benzothiazol-2-yl)-4-hydroxy-2,5-cyclohexadien-1-one	4-(benzothiazol-2-yl)-4-hydroxy-2,5-cyclohexadien-1-one results in increased cleavage of CASP3 protein	16756956
C494356	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]	25453207
C494356	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione promotes the reaction [Valproic Acid inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]]	25453207
C514579	(4-benzylpiperazin-1-yl)acetic acid (3-allyl-2-hydroxybenzylidene)hydrazine	(4-benzylpiperazin-1-yl)acetic acid (3-allyl-2-hydroxybenzylidene)hydrazine results in increased activity of and results in increased cleavage of CASP3 protein	27488460
C068515	4-chromone	4-chromone analog results in increased expression of CASP3 protein modified form	30256521
C068515	4-chromone	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [4-chromone analog results in increased expression of CASP3 protein modified form]	30256521
C032538	4-cresol	4-cresol results in increased activity of CASP3 protein	25668154
C045934	4-hydroxy-2-hexenal	4-hydroxy-2-hexenal results in increased activity of CASP3 protein	20619253
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased activity of CASP3 protein	17872449
C027576	4-hydroxy-2-nonenal	sepiapterin inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	17872449
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased activity of CASP3 protein	24525193
C027576	4-hydroxy-2-nonenal	RACK1 mutant form inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	24525193
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased activity of CASP3 protein	11488593; 19326901;
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased cleavage of CASP3 protein	24825450
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased activity of CASP3 protein	17263905
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased cleavage of and results in increased activity of CASP3 protein	16322078
C027576	4-hydroxy-2-nonenal	pyrazolanthrone inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	16322078
C027576	4-hydroxy-2-nonenal	Resveratrol inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	16322078
C027576	4-hydroxy-2-nonenal	4-hydroxy-2-nonenal results in increased activity of CASP3 protein	16337876; 20114059; 21187080; 24291486;
C027576	4-hydroxy-2-nonenal	Acetylcysteine inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	20114059; 24291486;
C015952	4-iodo-2,5-dimethoxyphenylisopropylamine	4-iodo-2,5-dimethoxyphenylisopropylamine results in increased activity of CASP3 protein	22983118
C584368	4'-methoxy licoflavanone	4'-methoxy licoflavanone results in increased cleavage of CASP3 protein	23850732
C584368	4'-methoxy licoflavanone	[4'-methoxy licoflavanone results in increased expression of FAS protein] which results in increased cleavage of CASP3 protein	23850732
C587938	(4-methyl-1-naphthyl)-(1-pentylindol-3-yl)methanone	(4-methyl-1-naphthyl)-(1-pentylindol-3-yl)methanone results in increased activity of CASP3 protein	30796436
C406734	4-methylene-2-octyl-5-oxofuran-3-carboxylic acid	[4-methylene-2-octyl-5-oxofuran-3-carboxylic acid co-treated with Cisplatin] results in increased cleavage of and results in decreased expression of CASP3 protein	21442130
C406734	4-methylene-2-octyl-5-oxofuran-3-carboxylic acid	[4-methylene-2-octyl-5-oxofuran-3-carboxylic acid co-treated with Cisplatin] results in increased cleavage of and results in increased activity of CASP3 protein	21442130
C406734	4-methylene-2-octyl-5-oxofuran-3-carboxylic acid	4-methylene-2-octyl-5-oxofuran-3-carboxylic acid results in increased cleavage of and results in increased activity of CASP3 protein	21442130
C585202	4-methylethcathinone	4-methylethcathinone results in increased activity of CASP3 protein	27255387
C498826	4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide	4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide results in increased activity of CASP3 protein	23707608
C498826	4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide	4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide results in increased cleavage of CASP3 protein	23883479; 26549707;
C498826	4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide results in increased cleavage of CASP3 protein]	26549707
C498826	4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide results in increased cleavage of CASP3 protein]	26549707
C008636	4-nitro-3-cresol	4-nitro-3-cresol results in increased activity of CASP3 protein	29307546
C008636	4-nitro-3-cresol	CASP3 protein promotes the reaction [4-nitro-3-cresol results in increased expression of FASLG mRNA]	29307546
C008636	4-nitro-3-cresol	CASP3 protein promotes the reaction [4-nitro-3-cresol results in increased expression of FASLG protein]	29307546
C008636	4-nitro-3-cresol	CASP3 protein promotes the reaction [4-nitro-3-cresol results in increased expression of FAS mRNA]	29307546
C008636	4-nitro-3-cresol	CASP3 protein promotes the reaction [4-nitro-3-cresol results in increased expression of FAS protein]	29307546
C008636	4-nitro-3-cresol	4-nitro-3-cresol results in increased activity of CASP3 protein	22467373; 29307546;
C008636	4-nitro-3-cresol	Quercetin inhibits the reaction [4-nitro-3-cresol results in increased activity of CASP3 protein]	22467373
C019498	4-nitroaniline	BCL2 protein inhibits the reaction [Resveratrol promotes the reaction [[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline]]	11577002
C019498	4-nitroaniline	Resveratrol promotes the reaction [[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline]	11577002
C019498	4-nitroaniline	[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline	11577002
C024836	4-nitrophenol	4-nitrophenol results in increased activity of CASP3 protein	23997041
C024836	4-nitrophenol	Quercetin inhibits the reaction [4-nitrophenol results in increased activity of CASP3 protein]	23997041
C041594	4-nonylphenol	4-nonylphenol results in increased cleavage of CASP3 protein	22056370
C041594	4-nonylphenol	4-nonylphenol results in increased expression of and results in increased activity of CASP3 protein	29029336
C041594	4-nonylphenol	[Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with 4-nonylphenol co-treated with 4-tert-octylphenol] results in increased expression of and results in increased activity of CASP3 protein	29029336
C041594	4-nonylphenol	3-methyladenine promotes the reaction [4-nonylphenol results in increased cleavage of CASP3 protein]	26804764
C041594	4-nonylphenol	4-nonylphenol affects the expression of CASP3 mRNA	27109770
C041594	4-nonylphenol	4-nonylphenol results in decreased expression of and results in increased phosphorylation of CASP3 protein	27109770
C041594	4-nonylphenol	4-nonylphenol results in increased cleavage of CASP3 protein	26804764
C041594	4-nonylphenol	4-nonylphenol results in increased expression of CASP3 protein modified form	30228064
C041594	4-nonylphenol	Acetylcysteine inhibits the reaction [4-nonylphenol results in increased cleavage of CASP3 protein]	26804764
C041594	4-nonylphenol	[bisphenol A co-treated with 4-nonylphenol] results in increased expression of CASP3 mRNA	30228064
C041594	4-nonylphenol	bisphenol A inhibits the reaction [4-nonylphenol results in increased expression of CASP3 protein modified form]	30228064
C494898	4-oxofenretinide	4-oxofenretinide results in increased activity of CASP3 protein	16540676
C114459	4-phenyl-2-propionamidotetraline	4-phenyl-2-propionamidotetraline inhibits the reaction [2-iodomelatonin inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]]	14962062
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [Sertraline results in increased activity of CASP3 protein]	24865413
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [Silver Compounds results in increased expression of CASP3 protein modified form]	29306025
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [thymoquinone results in increased cleavage of CASP3 protein]	29981725
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [usnic acid results in increased activity of CASP3 protein]	25870318
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [Bilirubin results in increased cleavage of CASP3 protein]	27578021
C075773	4-phenylbutyric acid	4-phenylbutyric acid results in decreased expression of CASP3 protein	25450231
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	21804221
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [Oxygen deficiency results in increased expression of CASP3 protein]	25450231
C075773	4-phenylbutyric acid	4-phenylbutyric acid inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	30980806
C029728	4-phenylenediamine	4-phenylenediamine results in increased activity of CASP3 protein	26784575
C105260	4-tert-octylphenol	4-tert-octylphenol results in increased expression of and results in increased activity of CASP3 protein	29029336
C105260	4-tert-octylphenol	[Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with 4-nonylphenol co-treated with 4-tert-octylphenol] results in increased expression of and results in increased activity of CASP3 protein	29029336
C012606	4-vinyl-1-cyclohexene dioxide	4-vinyl-1-cyclohexene dioxide affects the expression of CASP3 mRNA	20829426
C012606	4-vinyl-1-cyclohexene dioxide	4-vinyl-1-cyclohexene dioxide results in increased expression of CASP3 protein modified form	20829426
C012606	4-vinyl-1-cyclohexene dioxide	4-vinyl-1-cyclohexene dioxide results in increased activity of CASP3 protein	15710172
C488411	4-vinyl-2,6-dimethoxyphenol	4-vinyl-2,6-dimethoxyphenol results in increased expression of CASP3 protein modified form	30653946
C013733	4-vinylcyclohexene	4-vinylcyclohexene results in increased activity of CASP3 protein	15710172
C031286	4-xylene	4-xylene results in increased activity of CASP3 protein	14705839
C031286	4-xylene	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [4-xylene results in increased activity of CASP3 protein]	14705839
C031286	4-xylene	CASP3 protein affects the susceptibility to 4-xylene	14705839
C466420	5,10,15,20-tetrakis(4-sulfonatophenyl)porphyrinato iron(III) chloride	5,10,15,20-tetrakis(4-sulfonatophenyl)porphyrinato iron(III) chloride inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	21397656
C492721	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III)	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III) inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	19286953
C492721	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III)	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III) inhibits the reaction [Doxorubicin results in increased expression of CASP3 mRNA]	19286953
C492721	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III)	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III) inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	19038279
C480541	5-((2,6-dichlorobenzyl)sulfonyl)-3-((3,5-dimethyl-4-((2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl)carbonyl)-1H-pyrrol-2-yl)methylene)-1,3-dihydro-2H-indol-2-one	5-((2,6-dichlorobenzyl)sulfonyl)-3-((3,5-dimethyl-4-((2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl)carbonyl)-1H-pyrrol-2-yl)methylene)-1,3-dihydro-2H-indol-2-one results in increased cleavage of CASP3 protein	20661229
C480541	5-((2,6-dichlorobenzyl)sulfonyl)-3-((3,5-dimethyl-4-((2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl)carbonyl)-1H-pyrrol-2-yl)methylene)-1,3-dihydro-2H-indol-2-one	Cisplatin promotes the reaction [5-((2,6-dichlorobenzyl)sulfonyl)-3-((3,5-dimethyl-4-((2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl)carbonyl)-1H-pyrrol-2-yl)methylene)-1,3-dihydro-2H-indol-2-one results in increased cleavage of CASP3 protein]	20661229
C555142	5-(3-chlorophenylamino)benzo(c)(2,6)naphthyridine-8-carboxylic acid	5-(3-chlorophenylamino)benzo(c)(2,6)naphthyridine-8-carboxylic acid results in increased activity of CASP3 protein	21174434
C503945	5-(4-bromobenzylidene)-alpha-isopropyl-4-oxo-2-thioxo-3-thazolidineacetic acid	5-(4-bromobenzylidene)-alpha-isopropyl-4-oxo-2-thioxo-3-thazolidineacetic acid results in decreased expression of CASP3 protein	30031050
C503119	5-((4-methylphenyl)methylene)-2-(phenylamino)-4(5H)-thiazolone	5-((4-methylphenyl)methylene)-2-(phenylamino)-4(5H)-thiazolone results in increased cleavage of CASP3 protein	15831436
C503119	5-((4-methylphenyl)methylene)-2-(phenylamino)-4(5H)-thiazolone	pyrazolanthrone inhibits the reaction [5-((4-methylphenyl)methylene)-2-(phenylamino)-4(5H)-thiazolone results in increased cleavage of CASP3 protein]	15831436
C110962	5,6-dichlorobenzimidazole	5,6-dichlorobenzimidazole promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	15688023
C080669	5,7-dihydroxy-6-methoxy-2-phenylchromen-4-one	5,7-dihydroxy-6-methoxy-2-phenylchromen-4-one results in decreased expression of CASP3 protein	19135124
C060298	5,7-dimethoxyflavone	5,7-dimethoxyflavone promotes the reaction [Diethylnitrosamine results in increased expression of CASP3 protein]	21554863
C411425	5-aminoisoquinolinone	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [5-aminoisoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	23352507
C411425	5-aminoisoquinolinone	5-aminoisoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	23352507
C439285	(5-fluoro-2-methyl-1-(4-pyridyl)methylene-3-(N-benzyl)-indene)-acetamide hydrochloride	(5-fluoro-2-methyl-1-(4-pyridyl)methylene-3-(N-benzyl)-indene)-acetamide hydrochloride results in increased activity of CASP3 protein	11051267
C052853	5-hydroxydecanoic acid	5-hydroxydecanoic acid inhibits the reaction [Sildenafil Citrate inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	15811867
C052853	5-hydroxydecanoic acid	5-hydroxydecanoic acid inhibits the reaction [Diazoxide results in decreased activity of CASP3 protein]	21256120
D000078223	5-Methoxypsoralen	5-Methoxypsoralen results in increased cleavage of CASP3 protein	30576070
D000078223	5-Methoxypsoralen	pifithrin inhibits the reaction [5-Methoxypsoralen results in increased cleavage of CASP3 protein]	30576070
C558288	5-methylselenylmethyl-2'-deoxyuridine	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	Acetylcysteine inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	CASP2 protein affects the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	CASP8 protein affects the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	CASP9 protein affects the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558288	5-methylselenylmethyl-2'-deoxyuridine	Quercetin inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
C058176	5-nitro-2-(3-phenylpropylamino)benzoic acid	5-nitro-2-(3-phenylpropylamino)benzoic acid results in decreased expression of CASP3 protein	21538933
C058176	5-nitro-2-(3-phenylpropylamino)benzoic acid	5-nitro-2-(3-phenylpropylamino)benzoic acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15482374
C580598	5-OH-BDE-47	5-OH-BDE-47 results in decreased expression of CASP3 mRNA	27589474
C558289	5-phenylselenylmethyl-2'-deoxyuridine	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	Acetylcysteine inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	CASP2 protein affects the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	CASP8 protein affects the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	CASP9 protein affects the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C558289	5-phenylselenylmethyl-2'-deoxyuridine	Quercetin inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
C576268	6-(3,4-dihydro-1H-isoquinolin-2-yl)-N-(6-methylpyridin-2-yl)nicotinamide	6-(3,4-dihydro-1H-isoquinolin-2-yl)-N-(6-methylpyridin-2-yl)nicotinamide analog results in increased activity of CASP3 protein	27720946
C471843	6-((3-chloro)anilino)-2-(isopropyl-2-hydroxyethylamino)-9-isopropylpurine	[6-((3-chloro)anilino)-2-(isopropyl-2-hydroxyethylamino)-9-isopropylpurine co-treated with Paclitaxel] results in increased activity of CASP3 protein	16170024
C571532	6-(3-cyclopentyl-2-(4-(trifluoromethyl)-1H-imidazol-1-yl)propanamido)nicotinic acid	6-(3-cyclopentyl-2-(4-(trifluoromethyl)-1H-imidazol-1-yl)propanamido)nicotinic acid results in increased cleavage of CASP3 protein	25316768
C485383	6,7-dihydroxyflavone	6,7-dihydroxyflavone inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased activity of CASP3 protein]	20133810
C000601052	(6,7-dimethoxyquinolin-4-yl)(5-methoxy-2,2-dimethyl-2H-chromen-6-yl)methyl acetate	(6,7-dimethoxyquinolin-4-yl)(5-methoxy-2,2-dimethyl-2H-chromen-6-yl)methyl acetate results in increased expression of CASP3 protein modified form	25976766
C584755	6-bromo-8-ethoxy-3-nitro-2H-chromene	6-bromo-8-ethoxy-3-nitro-2H-chromene results in increased cleavage of CASP3 protein	24831963
C550547	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	24726431
C550547	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide promotes the reaction [Camptothecin results in increased activity of CASP3 protein]	24726431
C550547	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21593185
C550547	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	25665036; 26450947;
C550547	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide	[6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide results in decreased activity of SIRT1 protein] which results in increased cleavage of and results in increased activity of CASP3 protein	20370652
C550547	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide	pifithrin inhibits the reaction [6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]]	21593185
C046414	6-codeinone	6-codeinone results in increased activity of CASP3 protein	12894543
C046414	6-codeinone	6-codeinone results in increased cleavage of CASP3 protein	12606908
D018750	6-Cyano-7-nitroquinoxaline-2,3-dione	6-Cyano-7-nitroquinoxaline-2,3-dione inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
C111855	6-formylindolo(3,2-b)carbazole	6-formylindolo(3,2-b)carbazole results in increased activity of CASP3 protein	28289825
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	23711929
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Zinc results in increased cleavage of CASP3 protein]	16799065
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Zinc Sulfate results in increased cleavage of CASP3 protein]	16799065
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [[Tetrachlorodibenzodioxin results in increased activity of CASP3 protein] which results in increased activity of PRKCD protein]	20846705
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Cholesterol analog results in increased expression of CASP3 mRNA]	19477266
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [T-2 Toxin results in increased activity of CASP3 protein]	21296132
C010643	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Vitamin A results in increased activity of CASP3 protein]	17942326
C530630	6(hydroxymethyl)-1,4-anthracenedione	6(hydroxymethyl)-1,4-anthracenedione results in increased activity of CASP3 protein	17912452
C053876	6-isopropoxy-9-oxoxanthene-2-carboxylic acid	[6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] results in increased cleavage of and results in increased activity of CASP3 protein	19407222
C053876	6-isopropoxy-9-oxoxanthene-2-carboxylic acid	6-isopropoxy-9-oxoxanthene-2-carboxylic acid inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C121465	6-methyl-2-(phenylethynyl)pyridine	6-methyl-2-(phenylethynyl)pyridine promotes the reaction [Biological Products results in increased expression of CASP3 protein modified form]	29458170
C583883	6-(N,N-dimethylamino)-2-(naphthalene-1-yl)-4-quinazolinone	6-(N,N-dimethylamino)-2-(naphthalene-1-yl)-4-quinazolinone results in increased expression of CASP3 protein	23212307
C583883	6-(N,N-dimethylamino)-2-(naphthalene-1-yl)-4-quinazolinone	pyrazolanthrone inhibits the reaction [6-(N,N-dimethylamino)-2-(naphthalene-1-yl)-4-quinazolinone results in increased expression of CASP3 protein]	23212307
C531937	6-O-angeloylenolin	6-O-angeloylenolin results in increased cleavage of CASP3 protein	21192922
C041398	7,7'-dimethoxy-(4,4'-bi-1,3-benzodioxole)-5,5'-dicarboxylic acid dimethyl ester	7,7'-dimethoxy-(4,4'-bi-1,3-benzodioxole)-5,5'-dicarboxylic acid dimethyl ester results in decreased activity of CASP3 protein	21467741
C114369	7,8-diacetoxy-4-methylcoumarin	7,8-diacetoxy-4-methylcoumarin results in increased activity of CASP3 protein	19061872
C540361	7,8-diacetoxy-4-methylthiocoumarin	7,8-diacetoxy-4-methylthiocoumarin results in increased activity of CASP3 protein	19061872
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	BAX protein affects the reaction [7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in increased cleavage of CASP3 protein]	21983885
C553817	7-(benzylamino)-1,3,4,8-tetrahydropyrrolo(4,3,2-de)quinolin-8(1H)-one	7-(benzylamino)-1,3,4,8-tetrahydropyrrolo(4,3,2-de)quinolin-8(1H)-one results in increased expression of CASP3 protein modified form	19936915
C559145	7-benzylamino-5-(2-(hydroxymethyl)propyl)amino-3-isopropyl-1(2)H-pyrazolo(4,3-d)pyrimidine	7-benzylamino-5-(2-(hydroxymethyl)propyl)amino-3-isopropyl-1(2)H-pyrazolo(4,3-d)pyrimidine results in increased cleavage of and results in increased activity of CASP3 protein	21417417
C054852	7-hydroxystaurosporine	[7-hydroxystaurosporine co-treated with Sirolimus] results in increased cleavage of CASP3 protein	15767555
C054852	7-hydroxystaurosporine	[alvocidib co-treated with 7-hydroxystaurosporine] results in increased activity of CASP3 protein	16012789
C054852	7-hydroxystaurosporine	Boc-D-FMK inhibits the reaction [[Sirolimus co-treated with 7-hydroxystaurosporine] results in increased cleavage of CASP3 protein]	15767555
C054852	7-hydroxystaurosporine	pyrazolanthrone inhibits the reaction [[Sirolimus co-treated with 7-hydroxystaurosporine] results in increased cleavage of CASP3 protein]	15767555
C003001	7-ketocholesterol	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C003001	7-ketocholesterol	7-ketocholesterol results in increased activity of CASP3 protein	12450566; 16934673; 24650663; 25845326;
C003001	7-ketocholesterol	Acetylcysteine inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C003001	7-ketocholesterol	alpha-Tocopherol inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	12450566
C003001	7-ketocholesterol	BAY 11-7085 inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C003001	7-ketocholesterol	beta-Tocopherol affects the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	12450566
C003001	7-ketocholesterol	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C003001	7-ketocholesterol	Serotonin inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	24650663
C003001	7-ketocholesterol	7-ketocholesterol results in increased activity of CASP3 protein	25845326
C576403	7-methyl-5-(1-((3-(trifluoromethyl)phenyl)acetyl)-2,3-dihydro-1H-indol-5-yl)-7H-pyrrolo(2,3-d)pyrimidin-4-amine	7-methyl-5-(1-((3-(trifluoromethyl)phenyl)acetyl)-2,3-dihydro-1H-indol-5-yl)-7H-pyrrolo(2,3-d)pyrimidin-4-amine inhibits the reaction [Niclosamide results in increased cleavage of CASP3 protein]	26917416
C576403	7-methyl-5-(1-((3-(trifluoromethyl)phenyl)acetyl)-2,3-dihydro-1H-indol-5-yl)-7H-pyrrolo(2,3-d)pyrimidin-4-amine	7-methyl-5-(1-((3-(trifluoromethyl)phenyl)acetyl)-2,3-dihydro-1H-indol-5-yl)-7H-pyrrolo(2,3-d)pyrimidin-4-amine promotes the reaction [Dibutyl Phthalate results in increased activity of CASP3 protein]	30910607
C522803	7-monohydroxyethylrutoside	7-monohydroxyethylrutoside inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17285121
C080122	7-nitroindazole	7-nitroindazole inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
C473217	8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate	8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21745194
C473217	8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate	RAPGEF3 affects the reaction [8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21745194
C015929	8-((4-chlorophenyl)thio)cyclic-3',5'-AMP	8-((4-chlorophenyl)thio)cyclic-3',5'-AMP results in increased activity of CASP3 protein	14996839
C552860	8-bromo-7-methoxychrysin	2-chloro-5-nitrobenzanilide inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
C552860	8-bromo-7-methoxychrysin	8-bromo-7-methoxychrysin results in increased activity of CASP3 protein	20632440
C552860	8-bromo-7-methoxychrysin	Acetylcysteine inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
C552860	8-bromo-7-methoxychrysin	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
C552860	8-bromo-7-methoxychrysin	pyrazolanthrone inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
D015124	8-Bromo Cyclic Adenosine Monophosphate	8-Bromo Cyclic Adenosine Monophosphate results in decreased expression of CASP3 mRNA	22079614
C016276	8-bromocyclic GMP	8-bromocyclic GMP inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	9388267
C016276	8-bromocyclic GMP	KT 5823 inhibits the reaction [8-bromocyclic GMP inhibits the reaction [TNF protein results in increased activity of CASP3 protein]]	9388267
C557120	8-ethoxy-2-(4-fluorophenyl)-3-nitro-2H-chromene	8-ethoxy-2-(4-fluorophenyl)-3-nitro-2H-chromene results in increased cleavage of CASP3 protein	24831963
D017371	8-Hydroxy-2-(di-n-propylamino)tetralin	8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein	30366073
D017371	8-Hydroxy-2-(di-n-propylamino)tetralin	acetovanillone inhibits the reaction [8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein]	30366073
D017371	8-Hydroxy-2-(di-n-propylamino)tetralin	N-(2-(4-(2-methoxyphenyl)-1-piperazinyl)ethyl)-N-(2-pyridinyl)cyclohexanecarboxamide inhibits the reaction [8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein]	30366073
D017371	8-Hydroxy-2-(di-n-propylamino)tetralin	rottlerin inhibits the reaction [8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein]	30366073
C556801	8-phenyl-6a,7,8,9,9a,10-hexahydro-6H-isoindolo(5,6-g)quinoxaline-7,9-dione	8-phenyl-6a,7,8,9,9a,10-hexahydro-6H-isoindolo(5,6-g)quinoxaline-7,9-dione inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	20946892
C042834	9,10-anthraquinone	9,10-anthraquinone analog results in increased activity of CASP3 protein	26915975
C042834	9,10-anthraquinone	9,10-anthraquinone analog results in increased expression of CASP3 mRNA	26915975
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein	21294050; 22729742;
D015127	9,10-Dimethyl-1,2-benzanthracene	geraniol inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	22729742
D015127	9,10-Dimethyl-1,2-benzanthracene	Quercetin inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	21294050
D015127	9,10-Dimethyl-1,2-benzanthracene	[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein	16517061
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in increased expression of CASP3 protein	21785161
D015127	9,10-Dimethyl-1,2-benzanthracene	amarogentin inhibits the reaction [[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein]	16517061
D015127	9,10-Dimethyl-1,2-benzanthracene	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Butyric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Butyric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Butyric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Glucaric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Glucaric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Glucaric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Niacinamide inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Niacinamide inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Niacinamide inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D015127	9,10-Dimethyl-1,2-benzanthracene	Plant Extracts inhibits the reaction [[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein]	16517061
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA	30101532
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein	30101532
D015127	9,10-Dimethyl-1,2-benzanthracene	9,10-Dimethyl-1,2-benzanthracene results in increased expression of CASP3 protein	23969067
D015127	9,10-Dimethyl-1,2-benzanthracene	Taurine inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	30101532
D015127	9,10-Dimethyl-1,2-benzanthracene	Taurine inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	30101532
C005399	9,10-phenanthrenequinone	9,10-phenanthrenequinone results in increased activity of CASP3 protein	25289770; 29108775;
C005399	9,10-phenanthrenequinone	Acetylcysteine inhibits the reaction [9,10-phenanthrenequinone results in increased activity of CASP3 protein]	29108775
C558529	9-(6-aminopyridin-3-yl)-1-(3-(trifluoromethyl)phenyl)benzo(h)(1,6)naphthyridin-2(1H)-one	[Crizotinib co-treated with 9-(6-aminopyridin-3-yl)-1-(3-(trifluoromethyl)phenyl)benzo(h)(1,6)naphthyridin-2(1H)-one] results in increased cleavage of CASP3 protein	22789543
C076778	9-deaza-9-(3-thienylmethyl)guanine	[9-deaza-9-(3-thienylmethyl)guanine co-treated with Deoxyguanosine] results in increased activity of CASP3 protein	9297556; 9403342;
C076778	9-deaza-9-(3-thienylmethyl)guanine	Deoxycytidine inhibits the reaction [[9-deaza-9-(3-thienylmethyl)guanine co-treated with Deoxyguanosine] results in increased activity of CASP3 protein]	9297556; 9403342;
C037112	9-deoxy-delta-9-prostaglandin D2	9-deoxy-delta-9-prostaglandin D2 results in increased activity of CASP3 protein	15843042
C037112	9-deoxy-delta-9-prostaglandin D2	[delta(12)-prostaglandin J(2) co-treated with 9-deoxy-delta-9-prostaglandin D2 co-treated with 15-deoxy-delta(12,14)-prostaglandin J2] results in increased cleavage of CASP3 protein	23973622
C574274	9-hydroxycanthin-6-one	9-hydroxycanthin-6-one results in increased cleavage of CASP3 protein	29225138
C025724	9-methoxycamptothecin	9-methoxycamptothecin results in increased activity of CASP3 protein	23369935
C512352	abexinostat	[Bortezomib co-treated with abexinostat] results in increased activity of CASP3 protein	19417023
C496492	abrine	abrine results in increased cleavage of and results in increased activity of CASP3 protein	23788630
C501332	ABT-737	3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	3-methyladenine promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]	20104024
C501332	ABT-737	3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	[ABT-737 co-treated with Celecoxib] results in increased activity of CASP3 protein	20104024
C501332	ABT-737	ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
C501332	ABT-737	ABT-737 promotes the reaction [Wortmannin promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	ABT-737 results in increased activity of CASP3 protein	20038611; 30461186;
C501332	ABT-737	ABT-737 results in increased cleavage of CASP3 protein	19773376; 20104024; 23918355;
C501332	ABT-737	BCL2 protein inhibits the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	BCL2 protein inhibits the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]]	20104024
C501332	ABT-737	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]]	20104024
C501332	ABT-737	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
C501332	ABT-737	Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]	20104024
C501332	ABT-737	MAP1LC3B mutant form promotes the reaction [[Celecoxib co-treated with ABT-737] results in increased cleavage of CASP3 protein]	20104024
C501332	ABT-737	PIK3C3 mutant form promotes the reaction [[Celecoxib co-treated with ABT-737] results in increased cleavage of CASP3 protein]	20104024
C501332	ABT-737	[Quercetin results in increased susceptibility to ABT-737] which results in increased activity of CASP3 protein	23353698
C501332	ABT-737	ABT-737 results in increased cleavage of CASP3 protein	19010845
D000079	Acetaldehyde	Acetaldehyde results in increased activity of CASP3 protein	14722101; 16814256;
D000079	Acetaldehyde	ADIPOQ protein inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	16814256
D000079	Acetaldehyde	alpha-Tocopherol inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	14722101
D000079	Acetaldehyde	SB 203580 inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	14722101
D000079	Acetaldehyde	U 0126 inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	14722101
D000082	Acetaminophen	Acetaminophen promotes the reaction [Staurosporine results in increased activity of CASP3 protein]	17245372
D000082	Acetaminophen	Acetaminophen results in decreased activity of CASP3 protein	24912781
D000082	Acetaminophen	Acetaminophen results in increased activity of CASP3	12005112
D000082	Acetaminophen	Acetaminophen results in increased cleavage of and results in increased activity of CASP3 protein	14725611
D000082	Acetaminophen	Acetaminophen results in increased expression of CASP3 protein	22230336
D000082	Acetaminophen	CASP3 protein results in increased susceptibility to Acetaminophen	14725611
D000082	Acetaminophen	[Acetaminophen co-treated with TNF protein] results in increased activity of CASP3 protein	12085349
D000082	Acetaminophen	Acetaminophen results in increased activity of and results in increased cleavage of CASP3 protein	30375433
D000082	Acetaminophen	Acetaminophen results in increased activity of CASP3 protein	11343246; 11529661; 15486922; 18270870;
D000082	Acetaminophen	Acetaminophen results in increased cleavage of and results in increased activity of CASP3 protein	14747384
D000082	Acetaminophen	Acetaminophen results in increased cleavage of CASP3 protein	14725611; 28209544;
D000082	Acetaminophen	Acetaminophen results in increased expression of CASP3 protein	12540782
D000082	Acetaminophen	CASP3 protein modified form results in decreased susceptibility to Acetaminophen	22023962
D000082	Acetaminophen	DFFA affects the reaction [Acetaminophen results in increased cleavage of CASP3 protein]	14725611
D000082	Acetaminophen	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	11343246
D000082	Acetaminophen	O(2)-vinyl-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate inhibits the reaction [Acetaminophen results in increased expression of CASP3 protein]	12540782
D000082	Acetaminophen	SESN2 protein inhibits the reaction [Acetaminophen results in increased cleavage of CASP3 protein]	28209544
D000082	Acetaminophen	SOD3 inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	11529661
D000082	Acetaminophen	Acetaminophen results in increased activity of CASP3 protein	11562448; 21170329; 26767949; 28682524;
D000082	Acetaminophen	Acetaminophen results in increased cleavage of and results in increased activity of CASP3 protein	19922764
D000082	Acetaminophen	Acetaminophen results in increased cleavage of CASP3 protein	20097795; 26011634; 26767949;
D000082	Acetaminophen	Acetaminophen results in increased expression of CASP3 mRNA	22093918
D000082	Acetaminophen	Acetaminophen results in increased expression of CASP3 protein	22093918
D000082	Acetaminophen	arjunolic acid inhibits the reaction [Acetaminophen results in increased cleavage of and results in increased activity of CASP3 protein]	19922764
D000082	Acetaminophen	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	11562448
D000082	Acetaminophen	chrysin inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	28682524
D000082	Acetaminophen	Hesperidin inhibits the reaction [Acetaminophen results in increased expression of CASP3 mRNA]	22093918
D000082	Acetaminophen	Hesperidin inhibits the reaction [Acetaminophen results in increased expression of CASP3 protein]	22093918
D000082	Acetaminophen	morin inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	26767949
D000082	Acetaminophen	morin inhibits the reaction [Acetaminophen results in increased cleavage of CASP3 protein]	26767949
D000086	Acetazolamide	Acetazolamide promotes the reaction [bleomycetin results in increased activity of CASP3 protein]	21040473
D019342	Acetic Acid	Acetic Acid results in increased expression of CASP3 mRNA	29518435
D019342	Acetic Acid	Acetic Acid results in increased expression of CASP3 protein	29518435; 30594690;
D019342	Acetic Acid	Mesalamine inhibits the reaction [Acetic Acid results in increased expression of CASP3 mRNA]	29518435
D019342	Acetic Acid	Olmesartan Medoxomil inhibits the reaction [Acetic Acid results in increased expression of CASP3 protein]	30594690
D019342	Acetic Acid	Plant Extracts inhibits the reaction [Acetic Acid results in increased expression of CASP3 mRNA]	29518435
D019342	Acetic Acid	Plant Extracts inhibits the reaction [Acetic Acid results in increased expression of CASP3 protein]	29518435
C043377	acetochlor	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [acetochlor results in increased expression of CASP3 protein modified form]	25291404
C043377	acetochlor	acetochlor results in increased expression of CASP3 protein modified form	25291404
C056165	acetovanillone	[tempol co-treated with UCF 101 co-treated with acetovanillone] inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	20153346
C056165	acetovanillone	acetovanillone inhibits the reaction [8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein]	30366073
C056165	acetovanillone	acetovanillone inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	22147442
C056165	acetovanillone	acetovanillone inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	24291008
C056165	acetovanillone	acetovanillone inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
C056165	acetovanillone	acetovanillone inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	26522475
C094432	acetyl-11-ketoboswellic acid	acetyl-11-ketoboswellic acid results in decreased expression of CASP3 protein	20692244
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Clodronic Acid results in increased activity of CASP3 protein]	23377347
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Aclarubicin results in increased activity of CASP3 protein]	16215684
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16215684
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Mitoxantrone results in increased activity of CASP3 protein]	16215684
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	23747833
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [cucurbitacin E results in increased cleavage of CASP3 protein]	27106530
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]]	23747833
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Okadaic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	19084044
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Parathion results in increased activity of CASP3 protein]	11032765
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein]	11032765
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	17419000
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [ursolic acid results in increased cleavage of and results in increased activity of CASP3 protein]	16012738
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [arsenite results in increased activity of CASP3 protein]	17520061
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	17520061
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Masoprocol results in increased activity of CASP3 protein]	10653524
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [monomethylarsonous acid results in increased activity of CASP3 protein]	17520061
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	12826665
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	[acetyl-aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] inhibits the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased cleavage of and results in increased activity of PRKCD protein]	11880503
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	[acetyl-aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to cobaltous chloride	11891799
C099158	acetyl-aspartyl-glutamyl-valyl-aspartal	acetyl-aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein	10604926; 11880503; 11891799; 12115584; 12953835; 15817572; 16047940; 9570801;
C430230	acetyl-aspartyl-glutamyl-valyl-aspartic acid p-nitroanilide	acetyl-aspartyl-glutamyl-valyl-aspartic acid p-nitroanilide inhibits the reaction [thallium nitrate analog results in increased activity of CASP3 protein]	19371624
C430230	acetyl-aspartyl-glutamyl-valyl-aspartic acid p-nitroanilide	acetyl-aspartyl-glutamyl-valyl-aspartic acid p-nitroanilide inhibits the reaction [thallium nitrate results in increased activity of CASP3 protein]	19371624
C487680	acetylbritannilatone	acetylbritannilatone analog results in increased activity of CASP3 protein	27262408
C487680	acetylbritannilatone	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [acetylbritannilatone analog results in increased activity of CASP3 protein]	27262408
C487680	acetylbritannilatone	TP53 protein affects the reaction [acetylbritannilatone analog results in increased activity of CASP3 protein]	27262408
D000108	Acetylcarnitine	Acetylcarnitine inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	29278859
D000108	Acetylcarnitine	Acetylcarnitine inhibits the reaction [Sodium Selenite results in increased expression of CASP3 mRNA]	20067779
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[cadmium sulfate results in increased abundance of Cadmium] which results in increased expression of CASP3 mRNA]	31419506
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[epigallocatechin gallate co-treated with arsenite] results in increased activity of CASP3 protein]	26375285
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [2-chloroethyl ethyl sulfide results in increased activity of CASP3 protein]	12815614
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	19782097
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Copper Sulfate results in increased expression of CASP3 mRNA]	30389602
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [2,3,4,5-Tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [2'-(4-chlorophenyl)-3-(4-chlorophenylidene)-5,10-dimethyl-12-methylene-decahydro-1,2-(1',3'-dioxocyclopenta(c))azuleno(4,5-b)furan-4,11-dione results in increased cleavage of and results in increased activity of CASP3 protein]	21741372
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [2-aminodiphenyl results in increased activity of CASP3 protein]	23836369
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [2'-benzoyloxycinnamaldehyde results in increased activity of CASP3 protein]	14660655
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [9,10-phenanthrenequinone results in increased activity of CASP3 protein]	29108775
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Acrylonitrile results in increased activity of CASP3 protein]	20981856
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [aristolochic acid I results in increased activity of CASP3 protein]	21300145
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]]	29944906
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Poly I-C results in increased activity of CASP3 protein]]	21418039
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Resveratrol results in increased expression of CASP3 protein]]	26772155
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12168106; 12750841; 12754411; 19771260;
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	26772155
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [arsenite results in increased activity of CASP3 protein]	22260869
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [cadmium acetate results in increased activity of CASP3 protein]	16169029
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	18703135
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	30236763
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [chromium tripicolinate results in increased activity of CASP3 protein]	19376147
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Cisplatin co-treated with FASLG protein] results in increased activity of CASP3 protein]	17574045
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cisplatin promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]]	29944906
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21166495; 27417252;
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	15496615
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [cordycepin results in increased activity of CASP3 protein]	21310227
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [cucurbitacin E results in increased cleavage of CASP3 protein]	27106530
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Curcumin results in increased activity of CASP3 protein]	17332930
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [diallyl trisulfide results in increased cleavage of CASP3 protein]	22578287
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [dimethoxycurcumin results in increased activity of CASP3 protein]	21221209
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Dopamine results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17542780
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Eosine I Bluish results in increased activity of CASP3 protein]	22440610
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	16014620
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [formononetin results in increased expression of CASP3 mRNA]	23867903
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [fucoxanthin results in increased cleavage of CASP3 protein]	20594983
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [ganoderic acid analog results in increased activity of CASP3 protein]	26282491
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [ganoderic acid T analog results in increased activity of CASP3 protein]	26282491
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [ganoderic acid T results in increased activity of CASP3 protein]	26282491
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [geldanamycin results in increased activity of CASP3 protein]	24998639
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	19837105
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Heterocyclic Compounds binds to Thiazoles] which results in increased activity of CASP3 protein]	19014919
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [hydroquinone results in increased activity of CASP3 protein]	15816534
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Isoproterenol results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Malathion results in increased cleavage of CASP3 protein]	30769050
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [manumycin results in increased activity of CASP3]	19409983
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [menadione epoxide results in increased cleavage of and results in increased activity of CASP3 protein]	21453688
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Naphthalimides co-treated with Spermidine] results in increased activity of CASP3 protein]	21349322
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [NCX 4040 results in increased cleavage of and results in increased activity of CASP3 protein]	16282376
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Norepinephrine results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [osimertinib results in increased expression of CASP3 protein modified form]	28237877
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	31381934
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein]	30590774
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [platycodin D results in increased activity of CASP3 protein]	18804340
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Poly I-C promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	21418039
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Propofol results in increased cleavage of CASP3 protein]	28804952
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [pyrovalerone analog results in increased activity of CASP3 protein]	28578026
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	22710416
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Resveratrol promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]]	26772155
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	26549478
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Resveratrol results in increased expression of CASP3 protein]	26772155
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[S100A11 mutant form results in increased susceptibility to Cisplatin] which results in increased cleavage of CASP3 protein]	25940438
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [salvin results in increased cleavage of CASP3 protein]	28918123
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[sodium arsenite co-treated with Vitamin K 3] results in increased activity of CASP3 protein]	19082730
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	19536524
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Soot analog results in increased expression of CASP3 protein]	30240709
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[sulforafan co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	22922937
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [sulforafan promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]]	22922937
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	18281123
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein]	17888894
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [thymoquinone results in increased expression of CASP3 protein modified form]	31433961
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [titanium dioxide results in increased cleavage of CASP3 protein]	20362650
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[TNFSF10 protein co-treated with gingerol] results in increased cleavage of CASP3 protein]	25034532
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	23711929
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Vitamin K 2 co-treated with Arsenic Trioxide] results in increased expression of CASP3]	24273890
D000111	Acetylcysteine	Acetylcysteine promotes the reaction [brazilin results in increased activity of CASP3 protein]	28063998
D000111	Acetylcysteine	Acetylcysteine promotes the reaction [dihydromyricetin results in increased cleavage of CASP3 protein]	27539140
D000111	Acetylcysteine	Acetylcysteine promotes the reaction [sinularin results in increased cleavage of CASP3 protein]	28548367
D000111	Acetylcysteine	Acetylcysteine results in decreased susceptibility to [1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane results in increased cleavage of CASP3 protein]	20674558
D000111	Acetylcysteine	Acetylcysteine results in increased activity of CASP3 protein	28063998
D000111	Acetylcysteine	Acetylcysteine results in increased cleavage of CASP3 protein	19722195
D000111	Acetylcysteine	[Glucose deficiency co-treated with Acetylcysteine] results in increased activity of CASP3 protein	17309078
D000111	Acetylcysteine	Oxygen deficiency affects the reaction [Acetylcysteine results in increased activity of CASP3 protein]	17468103
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	22692000
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	16918248
D000111	Acetylcysteine	Acetylcysteine affects the reaction [nonylphenol results in increased cleavage of CASP3 protein]	23677851
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [1,3-dichloro-2-propanol results in increased cleavage of CASP3 protein]	29248572
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21533816; 24157283;
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	21565247
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased activity of CASP3 protein]	20100472
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	24299490
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21616140
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29454061
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [maduramicin results in increased expression of CASP3 protein modified form]	31229567
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [mancozeb results in increased cleavage of CASP3 protein]	30037311
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Mercuric Chloride co-treated with prolinedithiocarbamate] results in increased degradation of CASP3 protein]	22909951
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	15050407
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21549813
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Methylmercury Compounds results in increased expression of CASP3 mRNA]	21549813
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [nitrofen results in increased cleavage of CASP3 protein]	15582350
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [POMC protein promotes the reaction [cobaltous chloride results in increased activity of CASP3 protein]]	24412703
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	20883752
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [T-2 Toxin results in increased activity of CASP3 protein]	29432840
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Zinc Oxide analog results in increased cleavage of CASP3 protein]	24614525
D000111	Acetylcysteine	[Acetylcysteine results in decreased abundance of Reactive Oxygen Species] inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29454061
D000111	Acetylcysteine	Acetylcysteine results in increased activity of CASP3	15375156
D000111	Acetylcysteine	Acetylcysteine results in increased expression of CASP3 protein modified form	25891866
D000111	Acetylcysteine	Resveratrol inhibits the reaction [Acetylcysteine results in increased expression of CASP3 protein modified form]	25891866
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Nitroprusside results in increased activity of CASP3]	19725096
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23023949
D000111	Acetylcysteine	[Acetylcysteine co-treated with Atorvastatin] inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	20946910
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	20114059; 24291486;
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [4-nonylphenol results in increased cleavage of CASP3 protein]	26804764
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21145380
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	24634002
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [arsenite results in decreased expression of CASP3 protein]	18077580
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	19523979
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	23405080
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Carboplatin results in increased expression of CASP3 protein]	18483861
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Carmustine results in increased activity of and results in increased cleavage of CASP3 protein]	21600974
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Chlorpyrifos results in increased activity of CASP3 protein]	22714038
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cholesterol analog results in increased expression of CASP3 mRNA]	19477266
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	21804221
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased cleavage of CASP3 protein]	22085843
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Glucose results in increased activity of CASP3]	18791325
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15683462
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [JP8 aviation fuel results in increased activity of CASP3 protein]	11969376
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [manganese chloride results in increased expression of CASP3 protein modified form]	28778520
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [nickel sulfate results in increased expression of CASP3 protein]	28296042
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Norepinephrine results in increased activity of CASP3 protein]	15158148; 17041759;
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Pilocarpine results in increased cleavage of CASP3 protein]	22824136
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	18547707
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Sodium Fluoride results in increased cleavage of CASP3 protein]	30633982
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	19840221
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [tetrachlorobenzoquinone results in increased cleavage of CASP3 protein]	27484784
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [tributyltin results in increased expression of CASP3 protein modified form]	26079211
D000111	Acetylcysteine	Acetylcysteine results in decreased activity of CASP3 protein	21242791; 21804221;
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	26849945
D000111	Acetylcysteine	[Acetylcysteine co-treated with Zearalenone] results in decreased expression of CASP3 protein	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	17383151
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	19135140
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 protein]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
D000111	Acetylcysteine	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]]	29109043
C022918	acetylenedicarboxylic acid dimethyl ester	acetylenedicarboxylic acid dimethyl ester results in increased cleavage of CASP3 protein	21105742
C401206	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [hispanolone analog results in increased activity of CASP3 protein]	25930665
C401206	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [Parathion results in increased activity of CASP3 protein]	11032765
C401206	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein]	11032765
C401206	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [TNFSF10 protein promotes the reaction [hispanolone analog results in increased activity of CASP3 protein]]	25930665
C063261	acetylleucyl-leucyl-norleucinal	acetylleucyl-leucyl-norleucinal inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
C063261	acetylleucyl-leucyl-norleucinal	acetylleucyl-leucyl-norleucinal inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	27481217
C063261	acetylleucyl-leucyl-norleucinal	acetylleucyl-leucyl-norleucinal results in increased activity of CASP3 protein	15618349
C063261	acetylleucyl-leucyl-norleucinal	acetylleucyl-leucyl-norleucinal inhibits the reaction [IL1B protein results in increased activity of CASP3 protein]	18606398
D017255	Acitretin	Acitretin results in increased activity of CASP3 protein	16196285; 18624760;
C006303	acivicin	acivicin results in increased activity of CASP3 protein	11478776
D015250	Aclarubicin	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Aclarubicin results in increased activity of CASP3 protein]	16215684
D015250	Aclarubicin	Aclarubicin results in increased activity of CASP3 protein	16215684
D015250	Aclarubicin	Aclarubicin results in increased activity of CASP3 protein	20399885
D000157	Aconitine	Aconitine results in increased expression of CASP3 protein	24840785
D000166	Acridines	Acridines analog results in increased activity of CASP3 protein	15603970
D000171	Acrolein	Acrolein results in decreased activity of CASP3 protein	15843039
D000171	Acrolein	Acrolein results in increased cleavage of CASP3 protein	15843039
D000171	Acrolein	3-methyladenine inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	29902662
D000171	Acrolein	Acrolein affects the alkylation of CASP3 protein	17222828
D000171	Acrolein	[Acrolein co-treated with Zidovudine] results in increased cleavage of CASP3 protein	27238871
D000171	Acrolein	Acrolein results in decreased activity of CASP3 protein	11504702
D000171	Acrolein	Acrolein results in decreased expression of CASP3 mRNA	26719373
D000171	Acrolein	Acrolein results in increased activity of CASP3 protein	16267686; 19596284;
D000171	Acrolein	Acrolein results in increased cleavage of CASP3 protein	27238871; 29902662; 29964147;
D000171	Acrolein	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	29964147
D000171	Acrolein	TP53 protein affects the reaction [Acrolein results in increased cleavage of CASP3 protein]	29964147
D000171	Acrolein	Acrolein results in decreased activity of CASP3 protein	11803030
D000171	Acrolein	Acrolein results in increased activity of CASP3 protein	17950725; 18515264;
D000171	Acrolein	Acrolein results in increased cleavage of CASP3 protein	21256123; 24376112;
D000171	Acrolein	Acrolein results in increased expression of CASP3 protein	21256123
D000171	Acrolein	ALDH1A1 protein inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	21256123
D000171	Acrolein	capsazepine inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	24376112
D000171	Acrolein	CD8A protein promotes the reaction [Acrolein results in increased activity of CASP3 protein]	17950725
D000171	Acrolein	Glutathione inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	24376112
D000171	Acrolein	Acrolein results in increased activity of CASP3 protein	16337876
D000171	Acrolein	Acrolein results in increased expression of CASP3 mRNA	19815060
D020106	Acrylamide	Acrylamide results in increased activity of CASP3 protein	16876394
D020106	Acrylamide	3,4-dihydroxyphenylethanol inhibits the reaction [Acrylamide results in increased activity of CASP3 protein]	21777647
D020106	Acrylamide	Acrylamide results in increased activity of CASP3 protein	19475399; 21777647;
D020106	Acrylamide	Acrylamide results in increased expression of CASP3 mRNA	28159594
D020106	Acrylamide	salvin inhibits the reaction [Acrylamide results in increased expression of CASP3 mRNA]	28159594
D020106	Acrylamide	tris(dicarboxymethylene)fullerene-C3 inhibits the reaction [Acrylamide results in increased activity of CASP3 protein]	19475399
D020106	Acrylamide	Acrylamide results in increased expression of CASP3 mRNA	22459607
D000181	Acrylonitrile	Acetylcysteine inhibits the reaction [Acrylonitrile results in increased activity of CASP3 protein]	20981856
D000181	Acrylonitrile	Acrylonitrile results in increased activity of CASP3 protein	20981856
C499366	Active Hexose Correlated Compound	Active Hexose Correlated Compound inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	11137978
C109238	acyline	acyline results in increased activity of CASP3 protein	17268770
D000241	Adenosine	Adenosine results in increased activity of CASP3 protein	11570579; 17303086; 20063052;
D000241	Adenosine	Dipyridamole inhibits the reaction [Adenosine results in increased activity of CASP3 protein]	17303086
D000241	Adenosine	Thymidine inhibits the reaction [Adenosine results in increased activity of CASP3 protein]	11570579
D000241	Adenosine	Adenosine results in increased activity of CASP3 protein	16469385
D000241	Adenosine	BCL2L1 protein inhibits the reaction [Adenosine results in increased activity of CASP3 protein]	20063052
D000241	Adenosine	BIRC2 protein inhibits the reaction [Adenosine results in increased activity of CASP3 protein]	20063052
D000255	Adenosine Triphosphate	Adenosine Triphosphate results in increased expression of CASP3	19448140
D000255	Adenosine Triphosphate	Suramin inhibits the reaction [Adenosine Triphosphate results in increased expression of CASP3]	19448140
C042151	aeroplysinin I	aeroplysinin I results in increased cleavage of and results in increased activity of CASP3 protein	27120392
D000336	Aerosols	Aerosols results in increased expression of CASP3 mRNA	29505817
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of CASP3 mRNA	25261862
D016604	Aflatoxin B1	Sodium Selenite inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	25261862
D016604	Aflatoxin B1	Aflatoxin B1 promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	30668976
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased expression of CASP3 protein	22743290
D016604	Aflatoxin B1	Aflatoxin B1 results in increased cleavage of CASP3 protein	22743290
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of CASP3 mRNA	27017951; 30668976;
D016604	Aflatoxin B1	CYP2A13 protein promotes the reaction [Aflatoxin B1 results in increased cleavage of CASP3 protein]	22743290
D016604	Aflatoxin B1	gluconic acid promotes the reaction [Zinc Sulfate inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]]	27017951
D016604	Aflatoxin B1	Methoxsalen inhibits the reaction [Aflatoxin B1 results in increased cleavage of CASP3 protein]	22743290
D016604	Aflatoxin B1	Nicotine inhibits the reaction [Aflatoxin B1 results in increased cleavage of CASP3 protein]	22743290
D016604	Aflatoxin B1	[Zearalenone co-treated with Aflatoxin B1] promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	30668976
D016604	Aflatoxin B1	Zinc Sulfate inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	27017951
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of CASP3 mRNA	19770486; 25445755; 28789997; 30126036;
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of CASP3 protein	30126036
D016604	Aflatoxin B1	deoxynivalenol promotes the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	25445755
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of CASP3 mRNA	27288928
D016604	Aflatoxin B1	[Curcumin analog co-treated with Hydrogels] inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	27288928
C027955	aflatoxin G1	aflatoxin G1 results in increased expression of CASP3 protein modified form	23907605
C027955	aflatoxin G1	Methoxsalen inhibits the reaction [aflatoxin G1 results in increased expression of CASP3 protein modified form]	23907605
C027955	aflatoxin G1	Nicotine inhibits the reaction [aflatoxin G1 results in increased expression of CASP3 protein modified form]	23907605
C000593263	afuresertib	[afuresertib co-treated with pomalidomide co-treated with Dexamethasone] results in increased cleavage of CASP3 protein	29928335
C000593263	afuresertib	afuresertib results in increased activity of CASP3 protein	28960945
C512484	AG-012986	AG-012986 results in increased activity of CASP3 protein	22095879
C412373	AG 1879	AG 1879 inhibits the reaction [allyl isothiocyanate results in decreased cleavage of CASP3 protein]	23219522
C412373	AG 1879	AG 1879 inhibits the reaction [(Cr(salprn)(H2O)2)ClO4 results in increased activity of CASP3 protein]	15124906
C412373	AG 1879	AG 1879 inhibits the reaction [tris(1,10-phenanthroline)chromium(III) chloride results in increased activity of CASP3 protein]	15124906
C079168	agathisflavone	agathisflavone inhibits the reaction [Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form]	29425760
C096920	AGN 193109	AGN 193109 inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16972258
C430898	AGN 194204	[AGN 194204 co-treated with IGFBP3 protein] results in increased activity of CASP3 protein	16000583
C430898	AGN 194204	AGN 194204 results in increased activity of CASP3 protein	16000583
C046926	AH 23848	[6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] results in increased cleavage of and results in increased activity of CASP3 protein	19407222
C031143	AICA ribonucleotide	AICA ribonucleotide inhibits the reaction [Sunitinib results in increased cleavage of CASP3 protein]	21906609
C031143	AICA ribonucleotide	AICA ribonucleotide results in increased cleavage of CASP3 protein	22137261; 25603053;
C031143	AICA ribonucleotide	AICA ribonucleotide inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	26989860
C031143	AICA ribonucleotide	AICA ribonucleotide results in increased activity of CASP3 protein	16469385
D000393	Air Pollutants	Air Pollutants results in increased expression of and results in increased activity of CASP3 protein	28389379
D000393	Air Pollutants	Air Pollutants results in increased expression of CASP3 mRNA	28389379
D000393	Air Pollutants	Air Pollutants results in increased expression of CASP3 protein	28389379
C048980	ajoene	ajoene analog results in increased cleavage of CASP3 protein	27449564
C004363	alantolactone	alantolactone results in increased cleavage of CASP3 protein	22721982; 24252419;
C012708	alborixin	alborixin results in increased cleavage of CASP3 protein	27378626
D000450	Aldosterone	Aldosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D000077556	Alitretinoin	Alitretinoin results in increased expression of CASP3	16909596
D000077556	Alitretinoin	Alitretinoin results in increased expression of CASP3 protein	16109544
D000077556	Alitretinoin	[TO-901317 co-treated with Alitretinoin] promotes the reaction [Palmitic Acid results in increased activity of CASP3 protein]	17194744
D000487	Allethrins	Allethrins results in increased activity of CASP3 protein	24055895
D000487	Allethrins	Allethrins results in decreased expression of CASP3 protein	25072698
D000493	Allopurinol	Allopurinol inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D000496	Alloxan	Alloxan results in increased activity of CASP3 protein	21982801
D000496	Alloxan	Alloxan results in increased expression of CASP3 protein modified form	22138235; 23092809;
D000496	Alloxan	D-Glucaric acid, 1,4-lactone inhibits the reaction [Alloxan results in increased activity of CASP3 protein]	21982801
D000496	Alloxan	Taurine inhibits the reaction [Alloxan results in increased expression of CASP3 protein modified form]	22138235; 23092809;
D000497	Alloys	Alloys results in decreased activity of CASP3 protein	25620057
C023698	allyl chloride	allyl chloride results in increased expression of CASP3 protein	17194518
C004471	allyl isothiocyanate	AG 1879 inhibits the reaction [allyl isothiocyanate results in decreased cleavage of CASP3 protein]	23219522
C004471	allyl isothiocyanate	allyl isothiocyanate results in decreased cleavage of CASP3 protein	23219522
C004471	allyl isothiocyanate	Ruthenium Red inhibits the reaction [allyl isothiocyanate results in decreased cleavage of CASP3 protein]	23219522
C038491	allyl sulfide	allyl sulfide results in increased activity of CASP3 protein	17647244; 29694836;
C038491	allyl sulfide	allyl sulfide inhibits the reaction [Bleomycin results in increased expression of CASP3 protein]	23656969
C518327	aloe emodin	aloe emodin results in increased activity of CASP3 protein	19928967; 22210228;
C518327	aloe emodin	aloe emodin results in increased cleavage of CASP3 protein	22210228
C518327	aloe emodin	aloe emodin results in increased expression of CASP3 protein modified form	19928967
C518327	aloe emodin	[Fluorouracil co-treated with aloe emodin] affects the expression of CASP3	19928967
C518327	aloe emodin	Fluorouracil promotes the reaction [aloe emodin results in increased expression of CASP3 protein modified form]	19928967
C062701	aloperine	aloperine results in decreased expression of CASP3 mRNA	11218852
D018350	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid	6-Cyano-7-nitroquinoxaline-2,3-dione inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D018350	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]	24995437
D018350	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid	Cadmium Chloride inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D018350	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid	Nifedipine inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D018350	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid	omega-agatoxin-Aa4b inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D018350	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid	staurosporine aglycone inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D000517	alpha-Chlorohydrin	alpha-Chlorohydrin results in decreased expression of CASP3 mRNA	27732882
D000517	alpha-Chlorohydrin	alpha-Chlorohydrin results in increased activity of CASP3 protein	28070108
D000517	alpha-Chlorohydrin	alpha-Chlorohydrin results in increased expression of and results in increased cleavage of CASP3 protein	27732882
D000517	alpha-Chlorohydrin	alpha-Chlorohydrin results in increased cleavage of CASP3 protein	30107153
D000517	alpha-Chlorohydrin	alpha-Chlorohydrin results in increased expression of CASP3 mRNA	30107153
D000517	alpha-Chlorohydrin	Apigenin inhibits the reaction [alpha-Chlorohydrin results in increased cleavage of CASP3 protein]	30107153
D000517	alpha-Chlorohydrin	Apigenin inhibits the reaction [alpha-Chlorohydrin results in increased expression of CASP3 mRNA]	30107153
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with bisphenol A] results in decreased activity of CASP3 protein]	23850738
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with bisphenol A] results in decreased expression of CASP3 protein]	23850738
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with Estradiol] results in decreased activity of CASP3 protein]	23850738
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with Estradiol] results in decreased expression of CASP3 protein]	23850738
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [LEP protein results in decreased activity of CASP3 protein]	23850738
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [LEP protein results in decreased expression of CASP3 protein]	23850738
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide affects the reaction [Cocaine results in increased cleavage of CASP3 protein]	29673861
C095512	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide inhibits the reaction [Quercetin analog results in increased activity of CASP3 protein]	23907460
C040534	alpha-hexachlorocyclohexane	alpha-hexachlorocyclohexane results in increased activity of CASP3 protein	19818741
C011512	alpha-naphthoflavone	alpha-naphthoflavone results in increased activity of CASP3 protein	18334599
C011512	alpha-naphthoflavone	alpha-naphthoflavone results in increased cleavage of CASP3 protein	30508555
C011512	alpha-naphthoflavone	alpha-naphthoflavone results in decreased activity of CASP3 protein	15710172
C514919	alpha-solanine	alpha-solanine results in increased expression of CASP3 mRNA	29247839
D024502	alpha-Tocopherol	[alpha-Tocopherol co-treated with beta-ionone] results in increased activity of CASP3 protein	17618090
D024502	alpha-Tocopherol	[alpha-Tocopherol co-treated with Tretinoin] results in increased activity of CASP3 protein	17874176
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	12450566
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	14722101
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [cholest-5-en-3 beta,7 alpha-diol results in increased activity of CASP3 protein]	12450566
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [Galactosamine results in increased cleavage of and results in increased activity of CASP3 protein]	17936189
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [S-(1,2-dichlorovinyl)cysteine results in increased activity of CASP3 protein]	29129777
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [Vitamin A results in increased activity of CASP3 protein]	17618090
D024502	alpha-Tocopherol	alpha-Tocopherol promotes the reaction [Amiodarone results in increased activity of CASP3 protein]	23042730
D024502	alpha-Tocopherol	alpha-Tocopherol promotes the reaction [beta Carotene metabolite results in decreased activity of CASP3 protein]	17618090
D024502	alpha-Tocopherol	alpha-Tocopherol promotes the reaction [TNF protein promotes the reaction [Amiodarone results in increased activity of CASP3 protein]]	23042730
D024502	alpha-Tocopherol	alpha-Tocopherol results in decreased activity of CASP3 protein	15095415; 17618090;
D024502	alpha-Tocopherol	alpha-Tocopherol results in increased cleavage of and results in increased activity of CASP3 protein	21869839
D024502	alpha-Tocopherol	[alpha-Tocopherol co-treated with beta-Tocopherol co-treated with gamma-Tocopherol co-treated with delta-tocopherol] affects the reaction [Estradiol affects the expression of CASP3 protein]	22389237
D024502	alpha-Tocopherol	alpha-Tocopherol inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
C064176	alpha-viniferin	alpha-viniferin analog results in increased activity of CASP3 protein	16158945
C064176	alpha-viniferin	alpha-viniferin results in increased activity of CASP3 protein	16158945
C052036	alpidem	alpidem results in increased activity of CASP3 protein	22700542
C052036	alpidem	Palmitic Acid promotes the reaction [alpidem results in increased activity of CASP3 protein]	22700542
C000154	alpinumisoflavone	alpinumisoflavone results in increased cleavage of CASP3 protein	23850732
C000154	alpinumisoflavone	[alpinumisoflavone results in increased expression of FAS protein] which results in increased cleavage of CASP3 protein	23850732
D000525	Alprazolam	[Caffeine co-treated with Alprazolam] results in increased cleavage of CASP3 protein	19490937
D000527	Alprostadil	Alprostadil inhibits the reaction [Galactosamine results in increased cleavage of and results in increased activity of CASP3 protein]	15565661
C120793	alsterpaullone	alsterpaullone inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	20300959
C005197	alternariol	alternariol results in increased activity of CASP3 protein	22542754
C018206	alternariol monomethyl ether	alternariol monomethyl ether results in increased activity of CASP3 protein	22001388
D000535	Aluminum	Aluminum results in increased expression of CASP3	21972528
D000077410	Aluminum Chloride	Aluminum Chloride results in increased activity of CASP3 protein	15150681
D000077410	Aluminum Chloride	CASP3 protein affects the susceptibility to Aluminum Chloride	20487627
D000077410	Aluminum Chloride	Aluminum Chloride results in increased activity of CASP3 protein	25263842; 27476752;
D000077410	Aluminum Chloride	Aluminum Chloride results in increased expression of CASP3 mRNA	23065425; 25263842; 27476752;
C104223	aluminum lactate	aluminum lactate results in increased expression of CASP3 protein modified form	26944603
C104223	aluminum lactate	Quercetin inhibits the reaction [aluminum lactate results in increased expression of CASP3 protein modified form]	26944603
C067527	aluminum maltolate	aluminum maltolate results in increased activity of CASP3 protein	24878590; 30481499;
C067527	aluminum maltolate	aluminum maltolate results in increased expression of CASP3 mRNA	30481499
C067527	aluminum maltolate	hyperforin inhibits the reaction [aluminum maltolate results in increased activity of CASP3 protein]	30481499
C067527	aluminum maltolate	hyperforin inhibits the reaction [aluminum maltolate results in increased expression of CASP3 mRNA]	30481499
C067527	aluminum maltolate	aluminum maltolate results in increased activity of CASP3 protein	15537749
C067527	aluminum maltolate	Cycloheximide inhibits the reaction [aluminum maltolate results in increased activity of CASP3 protein]	15537749
C067527	aluminum maltolate	aluminum maltolate results in increased activity of CASP3 protein	11382389; 11592846;
C067527	aluminum maltolate	aluminum maltolate results in increased activity of CASP3 protein	30481499
C067527	aluminum maltolate	aluminum maltolate results in increased expression of CASP3 protein modified form	16087240
C067527	aluminum maltolate	GDNF protein inhibits the reaction [aluminum maltolate results in increased activity of CASP3 protein]	11592846
D000537	Aluminum Oxide	Aluminum Oxide results in increased expression of CASP3	21329562
C077990	alvocidib	alvocidib affects the cleavage of and results in increased activity of CASP3 protein	9808574
C077990	alvocidib	alvocidib affects the cleavage of CASP3 protein	10896673
C077990	alvocidib	[alvocidib co-treated with 7-hydroxystaurosporine] results in increased activity of CASP3 protein	16012789
C077990	alvocidib	[alvocidib co-treated with ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate] results in increased cleavage of CASP3 protein	15634644
C077990	alvocidib	[alvocidib co-treated with gemcitabine] results in increased cleavage of CASP3 protein	15770523
C077990	alvocidib	alvocidib promotes the reaction [Paclitaxel results in increased activity of CASP3 protein]	10430095
C077990	alvocidib	alvocidib promotes the reaction [romidepsin results in increased activity of CASP3 protein]	15014036
C077990	alvocidib	alvocidib results in increased activity of CASP3 protein	11482875; 12170773;
C077990	alvocidib	alvocidib results in increased cleavage of and results in increased activity of CASP3 protein	12589031; 14555534;
C077990	alvocidib	alvocidib results in increased cleavage of CASP3 protein	12517783
C077990	alvocidib	BCL2 protein mutant form inhibits the reaction [alvocidib results in increased activity of CASP3 protein]	12170773
C077990	alvocidib	Boc-D-FMK inhibits the reaction [alvocidib results in increased cleavage of and results in increased activity of CASP3 protein]	14555534
C077990	alvocidib	[Imatinib Mesylate co-treated with alvocidib] results in increased activity of CASP3 protein	12231544
C077990	alvocidib	[Irinotecan co-treated with alvocidib] results in increased activity of CASP3 protein	11751522
C077990	alvocidib	alvocidib inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	12941380
C077990	alvocidib	alvocidib results in increased activity of CASP3 protein	12688354
C102609	amarogentin	amarogentin inhibits the reaction [[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein]	16517061
C011164	amentoflavone	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [amentoflavone inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]]	28185818
C011164	amentoflavone	amentoflavone inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	28185818
D004999	Amifostine	[Amifostine co-treated with Doxorubicin] results in increased activity of CASP3 protein	15985719
D004999	Amifostine	Amifostine inhibits the reaction [Idarubicin results in increased activity of CASP3 protein]	18438337
D004999	Amifostine	Amifostine promotes the reaction [Idarubicin results in increased activity of CASP3 protein]	18438337
D000584	Amiloride	Amiloride promotes the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	15607733
D000584	Amiloride	Amiloride promotes the reaction [TNFSF10 protein results in increased cleavage of and results in increased activity of CASP3 protein]	16059913
D000596	Amino Acids	Amino Acids inhibits the reaction [KL gene mutant form results in increased expression of CASP3 protein modified form]	25309793
D000596	Amino Acids	H 1356 inhibits the reaction [Amino Acids inhibits the reaction [KL gene mutant form results in increased expression of CASP3 protein modified form]]	25309793
D000602	Amino Acids, Peptides, and Proteins	Amino Acids, Peptides, and Proteins results in increased expression of CASP3 mRNA	23747718
C091584	aminochrome 1	[aminochrome 1 co-treated with Dicumarol] results in increased activity of CASP3 protein	21427056
C091584	aminochrome 1	aminochrome 1 results in increased activity of CASP3 protein	21427056
D000622	Aminolevulinic Acid	Aminolevulinic Acid analog results in increased activity of CASP3 protein	11281435; 17245620;
D000622	Aminolevulinic Acid	3-methyladenine inhibits the reaction [Aminolevulinic Acid analog results in increased activity of CASP3 protein]	20426806
D000622	Aminolevulinic Acid	Aminolevulinic Acid analog results in increased activity of CASP3 protein	20426806
D000638	Amiodarone	3-methyladenine promotes the reaction [Amiodarone results in increased cleavage of CASP3 protein]	23912912
D000638	Amiodarone	alpha-Tocopherol promotes the reaction [Amiodarone results in increased activity of CASP3 protein]	23042730
D000638	Amiodarone	alpha-Tocopherol promotes the reaction [TNF protein promotes the reaction [Amiodarone results in increased activity of CASP3 protein]]	23042730
D000638	Amiodarone	Amiodarone results in increased activity of CASP3 protein	23042730; 23135547;
D000638	Amiodarone	Amiodarone results in increased cleavage of CASP3 protein	23912912; 28526448;
D000638	Amiodarone	Amiodarone results in increased expression of CASP3 mRNA	12084619
D000638	Amiodarone	ATG7 protein affects the reaction [Amiodarone results in increased cleavage of CASP3 protein]	23912912
D000638	Amiodarone	TNF protein promotes the reaction [Amiodarone results in increased activity of CASP3 protein]	23042730
D000638	Amiodarone	[TNFSF10 co-treated with Amiodarone] results in increased cleavage of CASP3 protein	21292685
D000638	Amiodarone	Amiodarone affects the expression of CASP3 mRNA	19483382
D000638	Amiodarone	Amiodarone results in decreased expression of CASP3 protein modified form	21224497
D000638	Amiodarone	Amiodarone results in increased activity of CASP3 protein	12747577
D000638	Amiodarone	Amiodarone results in increased expression of CASP3 mRNA	19815060
D000639	Amitriptyline	Amitriptyline inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D000639	Amitriptyline	Amitriptyline results in increased activity of CASP3 protein	16717317
D000639	Amitriptyline	Amitriptyline results in increased expression of CASP3 mRNA	19815060
D000640	Amitrole	[Amitrole co-treated with Ditiocarb] promotes the reaction [Dichlorvos results in increased activity of CASP3 protein]	17640809
D000640	Amitrole	Amitrole inhibits the reaction [Cadmium results in increased degradation of CASP3 protein]	12538343
D000640	Amitrole	Amitrole results in increased activity of CASP3 protein	20417273
D017311	Amlodipine	[Amlodipine co-treated with Topotecan] results in increased activity of CASP3 protein	16516327
D017311	Amlodipine	Amlodipine results in decreased cleavage of CASP3 protein	17563544
C065419	ammodytin L	ammodytin L analog results in increased activity of CASP3 protein	23266427
C068117	ammodytoxin A	ammodytoxin A analog results in increased activity of CASP3 protein	23266427
C068117	ammodytoxin A	ammodytoxin A results in increased activity of CASP3 protein	23266427
D000641	Ammonia	Ammonia affects the activity of CASP3 protein	12654341
D000643	Ammonium Chloride	(1,2,5,6-tetrahydropyridin-4-yl)methylphosphinic acid inhibits the reaction [4-aminocrotonic acid inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]]	14535961
D000643	Ammonium Chloride	4-aminocrotonic acid inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]	14535961
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of CASP3 mRNA	16483693
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of CASP3 protein	16483693
D000643	Ammonium Chloride	Ammonium Chloride results in increased activity of CASP3 protein	14535961; 18722528;
D000643	Ammonium Chloride	Ammonium Chloride results in increased expression of CASP3 protein modified form	30508503
D000643	Ammonium Chloride	Roscovitine inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]	18722528
D000643	Ammonium Chloride	TLR5 gene mutant form inhibits the reaction [Ammonium Chloride results in increased expression of CASP3 protein modified form]	30508503
C054105	ammonium trichloro(dioxoethylene-O,O'-)tellurate	ammonium trichloro(dioxoethylene-O,O'-)tellurate results in decreased activity of CASP3 protein	18571097
D000661	Amphetamine	Amphetamine results in increased cleavage of and results in increased activity of CASP3 protein	15731293
D000661	Amphetamine	Amphetamine results in increased activity of CASP3 protein	16638611
D000666	Amphotericin B	Amphotericin B results in increased expression of CASP3 protein	23988732
C088115	anacardic acid	[anacardic acid co-treated with TNF protein] results in increased cleavage of CASP3 protein	18349320
D000728	Androgens	Androgens affects the expression of CASP3 protein	17237611
C030419	andrographolide	[andrographolide co-treated with Cisplatin] results in increased expression of CASP3 mRNA	24563380
C030419	andrographolide	andrographolide results in increased activity of CASP3 protein	19097688
C030419	andrographolide	andrographolide results in increased expression of CASP3 mRNA	24563380
C030419	andrographolide	CASP8 affects the reaction [Fluorouracil promotes the reaction [andrographolide results in increased activity of CASP3 protein]]	19097688
C030419	andrographolide	Fluorouracil promotes the reaction [andrographolide results in increased activity of CASP3 protein]	19097688
C030419	andrographolide	andrographolide inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]	20946909
C030419	andrographolide	andrographolide promotes the reaction [Penicillamine inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]]	20946909
C030419	andrographolide	Penicillamine promotes the reaction [andrographolide inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]]	20946909
D000814	Aniline Compounds	Aniline Compounds results in increased activity of CASP3 protein	25123791
D000841	Anisomycin	Anisomycin promotes the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D000841	Anisomycin	Anisomycin results in increased cleavage of and results in increased activity of CASP3 protein	18241849
D000841	Anisomycin	Anisomycin results in increased expression of CASP3 protein modified form	29944914
D000841	Anisomycin	[Colistin co-treated with Anisomycin] results in increased cleavage of CASP3 protein	28842171
C053442	annonacin	annonacin results in increased activity of CASP3 protein	12697268
D000872	Anthocyanins	Anthocyanins inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	28856781
C034020	anthracene	anthracene results in increased expression of CASP3 protein	28803881
C034020	anthracene	[naphthalene co-treated with anthracene co-treated with phenanthrene co-treated with pyrene] results in increased expression of CASP3 protein	28803881
C529696	anthracenylmethyl homospermidine	anthracenylmethyl homospermidine results in decreased activity of CASP3	19595733
D000875	Anthralin	Anthralin results in decreased activity of CASP3 protein	23611293
C010680	antibiotic G 418	antibiotic G 418 results in increased activity of CASP3 protein	15241557
D000936	Antigen-Antibody Complex	Antigen-Antibody Complex inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29702141
D000942	Antigens, Bacterial	[MYD88 gene mutant form affects the susceptibility to [Antigens, Bacterial co-treated with Ovalbumin]] which affects the expression of CASP3 mRNA	29067999
D000952	Antigens, Polyomavirus Transforming	Antigens, Polyomavirus Transforming promotes the reaction [Asbestos, Crocidolite results in increased activity of CASP3 protein]	24130165
D000967	Antimony Sodium Gluconate	[Antimony Sodium Gluconate co-treated with Isosorbide Dinitrate] results in decreased activity of CASP3 protein	20576500
C054672	antimony trichloride	antimony trichloride results in increased cleavage of CASP3 protein	30055241
C032456	antimycin	antimycin results in increased cleavage of and results in increased activity of CASP3 protein	10463952
D000968	Antimycin A	Antimycin A results in increased cleavage of CASP3 protein	24040102
D000968	Antimycin A	NAD inhibits the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D000968	Antimycin A	Niacinamide promotes the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D000968	Antimycin A	Resveratrol inhibits the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D000968	Antimycin A	splitomicin promotes the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D000968	Antimycin A	Antimycin A results in increased activity of CASP3 protein	11078377
C558369	antrocin	antrocin results in increased cleavage of CASP3 protein	21158420
C102351	apicidin	apicidin results in increased activity of CASP3 protein	18313654; 19070610;
D047310	Apigenin	Apigenin promotes the reaction [Fluorouracil results in increased activity of CASP3 protein]	19885610
D047310	Apigenin	Apigenin results in increased activity of CASP3 protein	17132221; 19647729; 24148603;
D047310	Apigenin	Apigenin results in increased cleavage of CASP3 protein	15486995; 19397994; 24148603;
D047310	Apigenin	[Polylactic Acid-Polyglycolic Acid Copolymer co-treated with Apigenin] results in increased expression of CASP3 mRNA	24070738
D047310	Apigenin	[Polylactic Acid-Polyglycolic Acid Copolymer co-treated with Apigenin] results in increased expression of CASP3 protein	24070738
D047310	Apigenin	[TNFSF10 protein results in increased susceptibility to Apigenin] which results in increased cleavage of CASP3 protein	29247770
D047310	Apigenin	Apigenin inhibits the reaction [Brefeldin A results in increased activity of CASP3 protein]	20493918
D047310	Apigenin	Apigenin inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	20493918
D047310	Apigenin	Apigenin promotes the reaction [Fluorouracil results in increased activity of CASP3 protein]	28025107
D047310	Apigenin	Apigenin results in increased activity of CASP3 protein	28025107
D047310	Apigenin	Fluorouracil promotes the reaction [Apigenin results in increased activity of CASP3 protein]	28025107
D047310	Apigenin	Apigenin inhibits the reaction [alpha-Chlorohydrin results in increased cleavage of CASP3 protein]	30107153
D047310	Apigenin	Apigenin inhibits the reaction [alpha-Chlorohydrin results in increased expression of CASP3 mRNA]	30107153
D047310	Apigenin	Apigenin inhibits the reaction [Isoproterenol results in increased expression of CASP3 protein]	30152906
D047310	Apigenin	Apigenin inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	25557508
D047310	Apigenin	Apigenin promotes the reaction [hydroxygenkwanin results in increased activity of CASP3 protein]	24144774
D047310	Apigenin	Apigenin results in increased activity of CASP3 protein	24144774
D047310	Apigenin	hydroxygenkwanin promotes the reaction [Apigenin results in increased activity of CASP3 protein]	24144774
C407151	apomine	apomine results in increased activity of CASP3 protein	10733934
D000077608	Aprepitant	Aprepitant promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	30145367
D000077608	Aprepitant	Aprepitant results in increased activity of CASP3 protein	30145367
D000077608	Aprepitant	Arsenic Trioxide promotes the reaction [Aprepitant results in increased activity of CASP3 protein]	30145367
D016718	Arachidonic Acid	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Arachidonic Acid results in increased degradation of CASP3 protein alternative form]	19540902
D016718	Arachidonic Acid	[Arachidonic Acid co-treated with Iron] results in decreased expression of CASP3 protein	19620254
D016718	Arachidonic Acid	[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein	27916511
D016718	Arachidonic Acid	[Arachidonic Acid co-treated with Iron] results in increased expression of CASP3 protein modified form	30626086
D016718	Arachidonic Acid	Arachidonic Acid results in increased activity of CASP3 protein	16704987; 19720122;
D016718	Arachidonic Acid	Arachidonic Acid results in increased degradation of CASP3 protein alternative form	19540902
D016718	Arachidonic Acid	Drugs, Chinese Herbal inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein]	27916511
D016718	Arachidonic Acid	FADD protein promotes the reaction [Arachidonic Acid results in increased activity of CASP3 protein]	19720122
D016718	Arachidonic Acid	Plant Extracts inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein]	27916511
D016718	Arachidonic Acid	Plant Extracts inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased expression of CASP3 protein modified form]	30626086
D016718	Arachidonic Acid	Resveratrol inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in decreased expression of CASP3 protein]	19620254
D016718	Arachidonic Acid	Arachidonic Acid results in increased activity of CASP3 protein	23266427
C119325	arachidonyl-2-chloroethylamide	arachidonyl-2-chloroethylamide inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31256211
C081565	arachidonyltrifluoromethane	arachidonyltrifluoromethane inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D001115	Arecoline	Arecoline results in increased activity of CASP3 protein	22108589
C000228	aristolochic acid I	Acetylcysteine inhibits the reaction [aristolochic acid I results in increased activity of CASP3 protein]	21300145
C000228	aristolochic acid I	aristolochic acid I results in increased activity of CASP3 protein	21300145
C000228	aristolochic acid I	aristolochic acid I results in increased expression of CASP3 protein	31048001
C000228	aristolochic acid I	Glutathione inhibits the reaction [aristolochic acid I results in increased activity of CASP3 protein]	21300145
C000228	aristolochic acid I	aristolochic acid I results in increased expression of CASP3 protein modified form	26656393
C000228	aristolochic acid I	aristolochic acid I results in increased cleavage of and results in increased activity of CASP3 protein	21658425
C000228	aristolochic acid I	MK-886 inhibits the reaction [aristolochic acid I results in increased cleavage of and results in increased activity of CASP3 protein]	21658425
C000228	aristolochic acid I	U 0126 inhibits the reaction [aristolochic acid I results in increased cleavage of and results in increased activity of CASP3 protein]	21658425
D034341	Aristolochic Acids	Aristolochic Acids results in increased activity of CASP3 protein	20696222
D034341	Aristolochic Acids	BMP7 protein inhibits the reaction [Aristolochic Acids results in increased activity of CASP3 protein]	20696222
C061640	arjunolic acid	arjunolic acid inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	21420465
C061640	arjunolic acid	arjunolic acid inhibits the reaction [Acetaminophen results in increased cleavage of and results in increased activity of CASP3 protein]	19922764
C061640	arjunolic acid	arjunolic acid inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	19133311; 19682444; 20053369;
C028617	aroclor 1248	aroclor 1248 results in decreased expression of CASP3 protein	16263226
D001147	Arsanilic Acid	Arsanilic Acid results in increased activity of CASP3 protein	23848144
D001151	Arsenic	Acetylcysteine inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	19782097
D001151	Arsenic	Arsenic results in increased activity of CASP3 protein	19782097; 21798276;
D001151	Arsenic	Dimethyl Sulfoxide inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	19782097
D001151	Arsenic	U 0126 inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	21798276
D001151	Arsenic	Arsenic results in increased expression of CASP3 mRNA	27838757
D001151	Arsenic	Arsenic results in increased activity of CASP3 protein	10828279
D001151	Arsenic	Arsenic results in increased cleavage of CASP3 protein	27289040
D001151	Arsenic	Arsenic results in increased activity of CASP3 protein	20114059; 24295472;
D001151	Arsenic	Arsenic results in increased cleavage of and results in increased activity of CASP3 protein	28903487
D001151	Arsenic	Ascorbic Acid inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	24295472
D001151	Arsenic	BDNF protein inhibits the reaction [Arsenic results in increased cleavage of and results in increased activity of CASP3 protein]	28903487
D001151	Arsenic	diallyl trisulfide inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	24295472
D001151	Arsenic	NOG protein inhibits the reaction [Arsenic results in increased cleavage of CASP3 protein]	28903487
D001151	Arsenic	staurosporine aglycone inhibits the reaction [NOG protein inhibits the reaction [Arsenic results in increased cleavage of CASP3 protein]]	28903487
D001151	Arsenic	Arsenic results in increased activity of CASP3 protein	22963862
D001151	Arsenic	[Arsenic results in increased activity of CASP3 protein] which results in increased abundance of Progesterone	22963862
C058317	arsenic disulfide	arsenic disulfide affects the expression of CASP3 protein	24026139
C058317	arsenic disulfide	[arsenic disulfide co-treated with indirubin] results in increased expression of CASP3 mRNA	25789073
C058317	arsenic disulfide	arsenic disulfide results in increased degradation of and results in increased activity of CASP3 protein	18298901
C058317	arsenic disulfide	arsenic disulfide results in increased degradation of CASP3 protein	17615687
C058317	arsenic disulfide	arsenic disulfide results in increased expression of CASP3	15972126
C058317	arsenic disulfide	arsenic disulfide results in increased expression of CASP3 mRNA	24026139; 25789073;
C058317	arsenic disulfide	arsenic disulfide results in increased expression of CASP3 protein	24989285
C042120	arsenic pentoxide	arsenic pentoxide results in increased activity of CASP3 protein	18451318
C530601	arsenic triiodide	arsenic triiodide results in increased activity of CASP3 protein	18451318
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of CASP3 protein	23542815
D000077237	Arsenic Trioxide	Ly-364947 inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23542815
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 mRNA	27041665; 29571380;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein	29684096
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Copper Sulfate] results in increased expression of CASP3 mRNA	29569195; 30543957;
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Copper Sulfate] results in increased expression of CASP3 protein	29569195; 30543957;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 mRNA	28454103; 29569195; 29705899; 29762750; 30543957;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein	28454103; 29569195; 29705899; 29762750; 29778937; 30516227; 30543957;
D000077237	Arsenic Trioxide	[Copper Sulfate co-treated with Arsenic Trioxide] results in increased expression of CASP3 protein	29778937
D000077237	Arsenic Trioxide	3,4-dihydro-5-(4-(1-piperidinyl)butoxy)-1(2H)-isoquinolinone inhibits the reaction [[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein]	17237268
D000077237	Arsenic Trioxide	4-amino-1,8-naphthalimide promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	25499136
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]]	29944906
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Poly I-C results in increased activity of CASP3 protein]]	21418039
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Resveratrol results in increased expression of CASP3 protein]]	26772155
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12168106; 12750841; 12754411; 19771260;
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	26772155
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Cisplatin promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]]	29944906
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Poly I-C promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	21418039
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Resveratrol promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]]	26772155
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [[sulforafan co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	22922937
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [sulforafan promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]]	22922937
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	18281123
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [[Vitamin K 2 co-treated with Arsenic Trioxide] results in increased expression of CASP3]	24273890
D000077237	Arsenic Trioxide	AKT1 mutant form promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	21655183
D000077237	Arsenic Trioxide	Aprepitant promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	30145367
D000077237	Arsenic Trioxide	Arsenic Trioxide affects the activity of CASP3 protein	20632473
D000077237	Arsenic Trioxide	Arsenic Trioxide affects the expression of CASP3 protein	12962562
D000077237	Arsenic Trioxide	Arsenic Trioxide analog results in increased activity of CASP3 protein	22753750
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with benzyloxycarbonylleucyl-leucyl-leucine aldehyde] results in increased cleavage of CASP3 protein	25449439
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with BIBR 1532] results in increased activity of CASP3 protein	23293885
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Bortezomib] results in increased activity of CASP3 protein	20471514
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Bortezomib] results in increased cleavage of CASP3 protein	17495969
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Curcumin] results in increased expression of CASP3 protein	27430728
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Doxorubicin co-treated with Magnetite Nanoparticles analog] affects the expression of CASP3 mRNA	24738333
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Doxorubicin co-treated with Magnetite Nanoparticles analog] affects the expression of CASP3 protein	24738333
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with epigallocatechin gallate] results in increased activity of CASP3 protein	20950636
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein	23082001
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with IL24 protein] results in decreased expression of CASP3	12883035
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Indomethacin] results in increased activity of CASP3 protein	24312908
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with lonidamine] results in increased cleavage of and results in increased activity of CASP3 protein	21889928
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with MIR15A protein co-treated with MIR16-1 protein] results in increased activity of CASP3 protein	21056550
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein	17237268
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with Plant Extracts] results in increased cleavage of CASP3 protein	26160715
D000077237	Arsenic Trioxide	[Arsenic Trioxide co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	24345465
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [2-Methoxyestradiol results in increased expression of CASP3 protein modified form]	23967052
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Aprepitant results in increased activity of CASP3 protein]	30145367
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	29944906
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Curcumin results in increased expression of CASP3 protein modified form]	27430728
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Dasatinib results in increased cleavage of CASP3 protein]	29266867
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Genistein results in increased activity of CASP3 protein]	20219070
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Imatinib Mesylate results in increased activity of CASP3 protein]	12135670
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [matrine results in increased cleavage of CASP3 protein]	23700110
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Poly I-C results in increased activity of CASP3 protein]	21418039
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [puerarin results in increased expression of CASP3 protein]	20416161
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Resveratrol results in increased expression of CASP3 protein]	26772155
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Silybin results in increased activity of CASP3 protein]	21969006
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Sorafenib results in decreased expression of CASP3 protein]	25416439
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Sorafenib results in increased activity of CASP3 protein]	25416439
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [tetraarsenic tetrasulfide results in decreased expression of CASP3 mRNA]	26110921
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [tetraarsenic tetrasulfide results in increased cleavage of CASP3 protein]	26110921
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [VS-5584 results in increased cleavage of CASP3 protein]	29574283
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of and affects the cleavage of CASP3 protein	25174355
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of CASP3 mRNA	17956674; 26110921;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of CASP3 protein	17956674; 25416439; 29164574;
D000077237	Arsenic Trioxide	[Arsenic Trioxide results in decreased expression of MIR376A1 mRNA] which results in increased expression of CASP3 protein	23373993
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of CASP3 protein	10428472; 10673743; 11027660; 11304686; 11779429; 11940349; 12005185; 12063550; 12135670; 12148893; 12168106; 12181429; 12296996; 12684647; 12750841; 12754411; 12883267; 12931215; 14610070; 14632209; 15142122; 15314284; 15493360; 15665116; 15979894; 16360329; 16951922; 17374990; 17673311; 17869043; 18451318; 18539383; 18546268; 18566239; 18599993; 19364129; 19662097; 19763917; 19771260; 20016248; 20138156; 20164150; 20200477; 20219070; 20534739; 20799280; 20889596; 20953137; 21061466; 21418039; 21518486; 21649584; 21969006; 22072212; 22199276; 22959511; 22977528; 22988968; 23737871; 24312908; 25003661; 25416439; 27770503; 29486283; 30145367; 30316766; 9734658;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein	10477740; 11146441; 11739184; 12851490; 16867262; 19014326; 19408305; 19695276; 23041229; 25258189;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased cleavage of CASP3 protein	12480548; 15131059; 15637062; 18491231; 20408844; 20458559; 20723298; 20724260; 20977926; 21594580; 21655183; 22922937; 23700110; 23721794; 23861973; 24466103; 25174355; 25335113; 25449439; 25574600; 26110921; 26160715; 28978663; 29266867; 29774349; 29944906; 30333888; 30338810;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased degradation of CASP3 protein	10850458
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of and results in increased activity of CASP3 protein	15774171; 9801394;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of and results in increased cleavage of CASP3 protein	24944602; 30472098;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3	16569477
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 mRNA	15979894; 21969006; 27770503;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein	19208092; 23337567; 23980369; 25499136; 26772155; 27430728; 30091188;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein modified form	20953137; 24685274; 27430728;
D000077237	Arsenic Trioxide	Ascorbic Acid promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12750841
D000077237	Arsenic Trioxide	Ascorbic Acid promotes the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	16867262
D000077237	Arsenic Trioxide	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] inhibits the reaction [Arsenic Trioxide results in decreased phosphorylation of AKT1 protein]	21655183
D000077237	Arsenic Trioxide	BCL2L11 mutant form inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	21655183
D000077237	Arsenic Trioxide	BCL2 protein inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12168106
D000077237	Arsenic Trioxide	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	18566239
D000077237	Arsenic Trioxide	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	15131059
D000077237	Arsenic Trioxide	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
D000077237	Arsenic Trioxide	[Bortezomib co-treated with Arsenic Trioxide] affects the expression of CASP3 protein	18718063
D000077237	Arsenic Trioxide	[Bortezomib co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	21518486
D000077237	Arsenic Trioxide	[Bortezomib co-treated with Arsenic Trioxide] results in increased expression of CASP3 protein	24377552
D000077237	Arsenic Trioxide	buthionine analog promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12750841
D000077237	Arsenic Trioxide	Buthionine Sulfoximine promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	10673743; 25003661;
D000077237	Arsenic Trioxide	CASP3 protein promotes the reaction [Arsenic Trioxide results in increased activity of IFNG protein]	14668793
D000077237	Arsenic Trioxide	Chloroquine promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	30338810
D000077237	Arsenic Trioxide	Cisplatin promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	29944906
D000077237	Arsenic Trioxide	[CSF2 protein co-treated with Arsenic Trioxide] affects the activity of CASP3 protein	16174796
D000077237	Arsenic Trioxide	[CSF2 protein co-treated with Arsenic Trioxide] results in decreased expression of and results in increased cleavage of CASP3 protein	16174796
D000077237	Arsenic Trioxide	[Curcumin co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	20605902
D000077237	Arsenic Trioxide	Curcumin promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27430728
D000077237	Arsenic Trioxide	DAPK2 protein affects the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	28978663
D000077237	Arsenic Trioxide	[Dasatinib co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	29266867
D000077237	Arsenic Trioxide	Dasatinib promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	29266867
D000077237	Arsenic Trioxide	Dehydroascorbic Acid promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	16951922
D000077237	Arsenic Trioxide	Deoxyglucose promotes the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	23041229
D000077237	Arsenic Trioxide	diphenyleneiodonium inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12754411
D000077237	Arsenic Trioxide	Dithiothreitol inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	10673743
D000077237	Arsenic Trioxide	[Docosahexaenoic Acids co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	12609832
D000077237	Arsenic Trioxide	[Genistein co-treated with Arsenic Trioxide] results in decreased expression of CASP3 protein	21078540
D000077237	Arsenic Trioxide	Genistein promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	18546268; 20219070;
D000077237	Arsenic Trioxide	GSTP1 mutant form promotes the reaction [[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein]	23082001
D000077237	Arsenic Trioxide	HMOX1 protein inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25003661
D000077237	Arsenic Trioxide	Hydrogen Peroxide inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	15142122
D000077237	Arsenic Trioxide	Imatinib Mesylate promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12135670
D000077237	Arsenic Trioxide	KNK 437 promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	20724260
D000077237	Arsenic Trioxide	MAPK8 mutant form inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20799280
D000077237	Arsenic Trioxide	MAPK8 protein affects the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20534739
D000077237	Arsenic Trioxide	MAPK9 mutant form inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20799280
D000077237	Arsenic Trioxide	matrine promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	23700110
D000077237	Arsenic Trioxide	[MCL1 mutant form results in increased susceptibility to [Ethacrynic Acid co-treated with Arsenic Trioxide]] which results in increased cleavage of CASP3 protein	23082001
D000077237	Arsenic Trioxide	MIR203A protein promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23737871
D000077237	Arsenic Trioxide	[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased activity of and results in increased cleavage of CASP3 protein	29774349
D000077237	Arsenic Trioxide	MSI1 protein inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	29486283
D000077237	Arsenic Trioxide	MT2A protein inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	23664956
D000077237	Arsenic Trioxide	NVP-BKM120 promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	30316766
D000077237	Arsenic Trioxide	PMAIP1 protein promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21518486
D000077237	Arsenic Trioxide	PMAIP1 protein promotes the reaction [[Bortezomib co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	21518486
D000077237	Arsenic Trioxide	Poly I-C promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21418039
D000077237	Arsenic Trioxide	pyrazolanthrone inhibits the reaction [[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein]	23082001
D000077237	Arsenic Trioxide	pyrazolanthrone inhibits the reaction [[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	18281123
D000077237	Arsenic Trioxide	RARA gene mutant form inhibits the reaction [Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	25003661
D000077237	Arsenic Trioxide	Resveratrol promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	26772155
D000077237	Arsenic Trioxide	[sanguinarine co-treated with Arsenic Trioxide co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	24345465
D000077237	Arsenic Trioxide	[sanguinarine co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	24345465
D000077237	Arsenic Trioxide	SB 203580 inhibits the reaction [[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein]	17237268
D000077237	Arsenic Trioxide	Silybin promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 mRNA]	21969006
D000077237	Arsenic Trioxide	Sorafenib promotes the reaction [Arsenic Trioxide results in decreased expression of CASP3 protein]	25416439
D000077237	Arsenic Trioxide	Sorafenib promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25416439
D000077237	Arsenic Trioxide	[sulforafan co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	22922937
D000077237	Arsenic Trioxide	sulforafan promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	22922937
D000077237	Arsenic Trioxide	[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	18281123
D000077237	Arsenic Trioxide	tetraarsenic tetrasulfide promotes the reaction [Arsenic Trioxide results in decreased expression of CASP3 mRNA]	26110921
D000077237	Arsenic Trioxide	tetraarsenic tetrasulfide promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	26110921
D000077237	Arsenic Trioxide	Tetradecanoylphorbol Acetate inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	14610070
D000077237	Arsenic Trioxide	Tetradecanoylphorbol Acetate promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	14610070
D000077237	Arsenic Trioxide	TNF protein promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	17673311
D000077237	Arsenic Trioxide	TP53 protein inhibits the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	12851490
D000077237	Arsenic Trioxide	TP73 protein affects the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	28978663
D000077237	Arsenic Trioxide	Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25003661
D000077237	Arsenic Trioxide	[Vitamin K 2 co-treated with Arsenic Trioxide] results in increased expression of CASP3	24273890
D000077237	Arsenic Trioxide	Wortmannin inhibits the reaction [Hydrogen Peroxide inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	15142122
D000077237	Arsenic Trioxide	zinc protoporphyrin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25003661
D000077237	Arsenic Trioxide	[Zoledronic Acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	20977926
D000077237	Arsenic Trioxide	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23892647
D000077237	Arsenic Trioxide	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	24157283
D000077237	Arsenic Trioxide	2-aminoethoxydiphenyl borate inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
D000077237	Arsenic Trioxide	2-aminoethyl diphenylborinate inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
D000077237	Arsenic Trioxide	4-phenylbutyric acid inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21533816; 24157283;
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	21565247
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [CDKN1A protein binds to CASP3 protein]	21565247
D000077237	Arsenic Trioxide	Arsenic Trioxide promotes the reaction [Drugs, Chinese Herbal results in decreased expression of CASP3 protein]	28587418
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of and results in increased cleavage of CASP3 protein	29767511
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of CASP3 protein	15688020; 15979664; 18332854; 20693187; 21533816; 24157283; 25787108; 9734658;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein	21565247; 23892647;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased cleavage of CASP3 protein	15761769; 24801902; 27461142;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein	20693187
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein modified form	23664956; 27638049; 29095437;
D000077237	Arsenic Trioxide	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	21565247
D000077237	Arsenic Trioxide	ATF4 protein affects the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
D000077237	Arsenic Trioxide	ATF4 protein promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
D000077237	Arsenic Trioxide	DDIT3 mutant form inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	24157283
D000077237	Arsenic Trioxide	Deoxyglucose promotes the reaction [Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]]	29095437
D000077237	Arsenic Trioxide	Glucose deficiency inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	29095437
D000077237	Arsenic Trioxide	HSPA5 mutant form inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	24157283
D000077237	Arsenic Trioxide	Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	29095437
D000077237	Arsenic Trioxide	PD 150606 inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
D000077237	Arsenic Trioxide	pyrazolanthrone inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	24157283
D000077237	Arsenic Trioxide	Quin2 inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
D000077237	Arsenic Trioxide	Resveratrol inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	18332854
D000077237	Arsenic Trioxide	Rotenone inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	29095437
D000077237	Arsenic Trioxide	Thapsigargin promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
D000077237	Arsenic Trioxide	Thioctic Acid inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23892647
D000077237	Arsenic Trioxide	Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	15688020
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23023949
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of CASP3 protein	23023949
D000077237	Arsenic Trioxide	Sodium Selenite inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23023949
D000077237	Arsenic Trioxide	[17-(dimethylaminoethylamino)-17-demethoxygeldanamycin co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D000077237	Arsenic Trioxide	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
D000077237	Arsenic Trioxide	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [salvianolic acid B inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	23201927
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21145380
D000077237	Arsenic Trioxide	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	24634002
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of CASP3 protein	20079407; 20356860; 20937774; 21145380; 23201927; 23363563; 23542815; 23832679;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased cleavage of CASP3 protein	24634002
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein	23337567; 28391263;
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 protein modified form	23664956
D000077237	Arsenic Trioxide	Ascorbic Acid inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20356860
D000077237	Arsenic Trioxide	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20937774
D000077237	Arsenic Trioxide	[Buthionine Sulfoximine co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D000077237	Arsenic Trioxide	[Ditiocarb co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D000077237	Arsenic Trioxide	Genistein inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23363563
D000077237	Arsenic Trioxide	GSR protein inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	24634002
D000077237	Arsenic Trioxide	pyrazolanthrone inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
D000077237	Arsenic Trioxide	salvianolic acid A inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
D000077237	Arsenic Trioxide	salvianolic acid B inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23201927
D000077237	Arsenic Trioxide	SB 203580 inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
D000077237	Arsenic Trioxide	[VER 155008 co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3 mRNA	27041665
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of CASP3	13129816
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased activity of CASP3 protein	10721769; 11890109;
C015001	arsenite	Acetylcysteine inhibits the reaction [[epigallocatechin gallate co-treated with arsenite] results in increased activity of CASP3 protein]	26375285
C015001	arsenite	[epigallocatechin gallate co-treated with arsenite] results in increased activity of CASP3 protein	26375285
C015001	arsenite	Acetylcysteine inhibits the reaction [arsenite results in increased activity of CASP3 protein]	22260869
C015001	arsenite	[arsenite results in decreased activity of PARP1 protein] which results in decreased cleavage of and results in decreased activity of CASP3 protein	22387748
C015001	arsenite	arsenite results in decreased cleavage of and results in decreased activity of CASP3 protein	22387748
C015001	arsenite	arsenite results in increased activity of CASP3 protein	22260869
C015001	arsenite	arsenite results in increased cleavage of and results in increased activity of CASP3 protein	20083129
C015001	arsenite	arsenite results in increased cleavage of CASP3 protein	17553788
C015001	arsenite	TP53 mutant form inhibits the reaction [arsenite results in increased activity of CASP3 protein]	22260869
C015001	arsenite	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [arsenite results in increased activity of CASP3 protein]	17520061
C015001	arsenite	arsenite results in increased activity of CASP3 protein	17520061; 18316066;
C015001	arsenite	arsenite results in increased expression of CASP3 mRNA	18929588
C015001	arsenite	TRP53 protein inhibits the reaction [arsenite results in increased expression of CASP3 mRNA]	18929588
C015001	arsenite	Acetylcysteine inhibits the reaction [arsenite results in decreased expression of CASP3 protein]	18077580
C015001	arsenite	arsenite results in decreased expression of CASP3 protein	18077580
C015001	arsenite	arsenite results in increased activity of CASP3 protein	18226606
C015001	arsenite	arsenite results in increased expression of CASP3 protein	29324385
C015001	arsenite	GDNF protein inhibits the reaction [arsenite results in increased activity of CASP3 protein]	18226606
C015001	arsenite	Selenium inhibits the reaction [arsenite results in increased expression of CASP3 protein]	29324385
C015001	arsenite	arsenite results in increased activity of CASP3 protein	9766529
C031327	artemisinine	artemisinine results in increased activity of CASP3 protein	17948936
D000077332	Artesunate	Artesunate results in increased activity of CASP3 protein	19513562; 24704559;
C078098	ar-turmerone	ar-turmerone results in increased activity of CASP3 protein	19250610
C000606252	ARV-825	ARV-825 results in increased activity of CASP3 protein	26051217
C519899	AS602868	AS602868 promotes the reaction [TNF protein results in increased cleavage of and results in increased activity of CASP3 protein]	18182997
C519899	AS602868	AS602868 results in increased cleavage of and results in increased activity of CASP3 protein	18182997
C519899	AS602868	Irinotecan promotes the reaction [AS602868 results in increased cleavage of and results in increased activity of CASP3 protein]	18182997
D017639	Asbestos, Amosite	Asbestos, Amosite results in increased activity of CASP3 protein	11329530
D017639	Asbestos, Amosite	Phytic Acid inhibits the reaction [Asbestos, Amosite results in increased activity of CASP3 protein]	11329530
D017639	Asbestos, Amosite	Sodium Benzoate inhibits the reaction [Asbestos, Amosite results in increased activity of CASP3 protein]	11329530
D017638	Asbestos, Crocidolite	Asbestos, Crocidolite inhibits the reaction [Asbestos, Crocidolite results in increased activity of CASP3 protein]	22608188
D017638	Asbestos, Crocidolite	Asbestos, Crocidolite results in increased activity of CASP3 protein	19783790; 22608188;
D017638	Asbestos, Crocidolite	Asbestos, Crocidolite results in increased cleavage of CASP3 protein	17191120
D017638	Asbestos, Crocidolite	Antigens, Polyomavirus Transforming promotes the reaction [Asbestos, Crocidolite results in increased activity of CASP3 protein]	24130165
D017638	Asbestos, Crocidolite	Asbestos, Crocidolite results in increased activity of CASP3 protein	24130165
D017638	Asbestos, Crocidolite	Asbestos, Crocidolite results in increased expression of CASP3 protein modified form	24918270
D017638	Asbestos, Crocidolite	OGG1 protein mutant form promotes the reaction [Asbestos, Crocidolite results in increased expression of CASP3 protein modified form]	24918270
D017638	Asbestos, Crocidolite	Asbestos, Crocidolite results in increased expression of CASP3 mRNA	12909582
D017632	Asbestos, Serpentine	Asbestos, Serpentine results in increased activity of CASP3 protein	22608188
D017632	Asbestos, Serpentine	Asbestos, Serpentine results in increased cleavage of CASP3 protein	18300051
D001205	Ascorbic Acid	[Ascorbic Acid co-treated with Ethanol] results in decreased activity of CASP3 protein	22149461
D001205	Ascorbic Acid	[Ascorbic Acid co-treated with Eosine I Bluish] results in increased activity of CASP3 protein	24488945
D001205	Ascorbic Acid	[Ascorbic Acid co-treated with ferrous sulfate] results in increased activity of CASP3 protein	17879260
D001205	Ascorbic Acid	[Ascorbic Acid co-treated with ferrous sulfate] results in increased expression of CASP3 mRNA	17879260
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [deoxynivalenol results in increased expression of CASP3 protein]	17166419
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16124896; 16407847;
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Oleanolic Acid results in increased cleavage of CASP3 protein]	22678527
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	16124896
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Silicon Dioxide results in decreased expression of CASP3 mRNA]	22245848
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Silicon Dioxide results in increased activity of CASP3 protein]	22245848
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	23711929
D001205	Ascorbic Acid	Ascorbic Acid promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12750841
D001205	Ascorbic Acid	Ascorbic Acid promotes the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	16867262
D001205	Ascorbic Acid	Ascorbic Acid promotes the reaction [chromium hexavalent ion results in increased cleavage of CASP3 protein]	17301063
D001205	Ascorbic Acid	Ascorbic Acid results in decreased activity of CASP3 protein	17618090
D001205	Ascorbic Acid	Ascorbic Acid results in increased expression of CASP3 mRNA	30597948
D001205	Ascorbic Acid	CAT protein inhibits the reaction [[Ascorbic Acid co-treated with Eosine I Bluish] results in increased activity of CASP3 protein]	24488945
D001205	Ascorbic Acid	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased activity of CASP3 protein]	17879260
D001205	Ascorbic Acid	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased expression of CASP3 mRNA]	17879260
D001205	Ascorbic Acid	[juglone co-treated with Ascorbic Acid] results in decreased expression of CASP3 protein	29992683
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	24295472
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20356860
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Norepinephrine results in increased activity of CASP3 protein]	15158148
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Potassium Dichromate results in increased cleavage of CASP3 protein]	21262251
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
D001205	Ascorbic Acid	Ascorbic Acid inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	18758938
D001205	Ascorbic Acid	[Vitamin E co-treated with Ascorbic Acid] inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	16973328
D001205	Ascorbic Acid	[Troglitazone co-treated with beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CASP3 mRNA	30481989
C017032	asiatic acid	asiatic acid inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
C017032	asiatic acid	[Carnosine co-treated with asiatic acid] inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
C017032	asiatic acid	asiatic acid inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]	29108773
D001218	Aspartame	[Aspartame co-treated with Methotrexate] results in increased expression of CASP3 mRNA	25009784
D001218	Aspartame	[Aspartame co-treated with Methotrexate] results in increased expression of CASP3 protein modified form	25009784
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [15-deoxyprostaglandin J2 results in increased activity of CASP3 protein]	19167456
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [teroxirone results in increased cleavage of CASP3 protein]	23954467
C108637	aspartyl-glutamyl-valyl-aspartal	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] inhibits the reaction [Arsenic Trioxide results in decreased phosphorylation of AKT1 protein]	21655183
C108637	aspartyl-glutamyl-valyl-aspartal	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] promotes the reaction [[tyrosyl-valyl-alanyl-aspartal results in decreased activity of CASP1 protein] which results in decreased susceptibility to Resveratrol]	9680369
C108637	aspartyl-glutamyl-valyl-aspartal	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased degradation of PPP2R1A protein	21655183
C108637	aspartyl-glutamyl-valyl-aspartal	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol	9680369
C108637	aspartyl-glutamyl-valyl-aspartal	[tyrosyl-valyl-alanyl-aspartal results in decreased activity of CASP1 protein] promotes the reaction [[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol]	9680369
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	21565247
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	14718643
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Manganese results in increased activity of CASP3 protein]	21985864
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [satratoxin G results in increased activity of CASP3 protein]	18535002
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [4-xylene results in increased activity of CASP3 protein]	14705839
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Toluene results in increased activity of CASP3 protein]	14705839
C108637	aspartyl-glutamyl-valyl-aspartal	aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein	14622122; 14976342; 9680369;
C115495	aspartyl-glutamyl-valyl-aspartyl-7-amino-4-trifluoromethylcoumarin	aspartyl-glutamyl-valyl-aspartyl-7-amino-4-trifluoromethylcoumarin results in decreased activity of CASP3 protein	20557081
C475509	aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide	BCL2 protein inhibits the reaction [Resveratrol promotes the reaction [[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline]]	11577002
C475509	aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide	Resveratrol promotes the reaction [[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline]	11577002
C475509	aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide	CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide	11577002
C475509	aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide	[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline	11577002
C010302	aspidin BB	aspidin BB results in increased activity of CASP3 protein	23628508
C010302	aspidin BB	aspidin BB results in increased expression of CASP3 protein modified form	23628508
D001241	Aspirin	[Aspirin co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	18483385
D001241	Aspirin	Aspirin inhibits the reaction [Deoxycholic Acid results in increased activity of CASP3 protein]	17644113
D001241	Aspirin	Aspirin inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	21617849
D001241	Aspirin	Aspirin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	14753751
D001241	Aspirin	Aspirin inhibits the reaction [Methotrexate results in decreased expression of CASP3 protein]	23799623
D001241	Aspirin	Aspirin results in increased activity of CASP3 protein	11034327
D001241	Aspirin	Aspirin results in increased cleavage of and results in increased activity of CASP3 protein	11228543; 11532860; 15481331;
D001241	Aspirin	Aspirin results in increased expression of CASP3 protein	12490308
D001241	Aspirin	BCL2 protein inhibits the reaction [[TNFSF10 protein co-treated with Aspirin] results in increased cleavage of and results in increased activity of CASP3 protein]	16199534
D001241	Aspirin	CDKN1A mutant form inhibits the reaction [Aspirin inhibits the reaction [Etoposide results in increased activity of CASP3 protein]]	21617849
D001241	Aspirin	[TNFSF10 protein co-treated with Aspirin] results in increased cleavage of and results in increased activity of CASP3 protein	16199534
D001241	Aspirin	[Troglitazone co-treated with Aspirin] results in increased cleavage of and results in increased activity of CASP3 protein	19908241
D001241	Aspirin	Aspirin results in decreased expression of CASP3 mRNA	21353610
D001241	Aspirin	Aspirin results in increased activity of CASP3 protein	16880202
D001241	Aspirin	Aspirin results in increased expression of CASP3 mRNA	30885738
D001241	Aspirin	Aspirin results in increased expression of CASP3 protein	30885738
D001241	Aspirin	Bee Venoms inhibits the reaction [Aspirin results in increased expression of CASP3 mRNA]	30885738
D001241	Aspirin	Bee Venoms inhibits the reaction [Aspirin results in increased expression of CASP3 protein]	30885738
D001241	Aspirin	Ranitidine inhibits the reaction [Aspirin results in increased expression of CASP3 mRNA]	30885738
D001241	Aspirin	Ranitidine inhibits the reaction [Aspirin results in increased expression of CASP3 protein]	30885738
D001241	Aspirin	Aspirin results in increased activity of CASP3 protein	19706045
D001241	Aspirin	Lithium Chloride inhibits the reaction [Aspirin results in increased activity of CASP3 protein]	19706045
D001241	Aspirin	SB 216763 inhibits the reaction [Aspirin results in increased activity of CASP3 protein]	19706045
C099069	astilbin	astilbin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	29471006
C082414	astin B	3-methyladenine promotes the reaction [astin B results in increased cleavage of CASP3 protein]	25219577
C082414	astin B	astin B results in increased cleavage of CASP3 protein	25219577
C052064	astragaloside A	astragaloside A inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	22278385
C052064	astragaloside A	astragaloside A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	30842369
D001262	Atenolol	Atenolol inhibits the reaction [Epinephrine results in increased activity of CASP3 protein]	10728402
C050701	atipamezole	atipamezole inhibits the reaction [Dexmedetomidine inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]]	30597158
D000069059	Atorvastatin	[Atorvastatin co-treated with Celecoxib] results in increased cleavage of and results in increased activity of CASP3 protein	18172863
D000069059	Atorvastatin	Atorvastatin results in increased activity of CASP3 protein	16470222
D000069059	Atorvastatin	Atorvastatin results in increased cleavage of CASP3 protein	20876807
D000069059	Atorvastatin	bafilomycin A1 promotes the reaction [Atorvastatin results in increased cleavage of CASP3 protein]	20876807
D000069059	Atorvastatin	geranylgeranyl pyrophosphate inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	16470222
D000069059	Atorvastatin	Mevalonic Acid inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	16470222
D000069059	Atorvastatin	RHOA protein inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	16470222
D000069059	Atorvastatin	ATG5 mutant form promotes the reaction [Atorvastatin results in increased cleavage of CASP3 protein]	20876807
D000069059	Atorvastatin	Atorvastatin inhibits the reaction [Homocysteine results in increased activity of CASP3 protein]	20305681
D000069059	Atorvastatin	Atorvastatin results in increased cleavage of CASP3 protein	20876807; 30511338;
D000069059	Atorvastatin	[PPARGC1B protein affects the susceptibility to Atorvastatin] which affects the cleavage of CASP3 protein	30511338
D000069059	Atorvastatin	[Acetylcysteine co-treated with Atorvastatin] inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	20946910
D000069059	Atorvastatin	Atorvastatin results in decreased activity of CASP3 protein	19429019
D000069059	Atorvastatin	Atorvastatin results in increased activity of CASP3 protein	18339080
D000069059	Atorvastatin	Mevalonic Acid inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	18339080
D000069059	Atorvastatin	U 0126 inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	18339080
C424804	atractylenolide I	atractylenolide I inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein]	28481321
C026304	atranorin	atranorin results in increased activity of CASP3 protein	22285236
C026304	atranorin	atranorin results in increased activity of CASP3 protein	26969521
D001280	Atrazine	Atrazine results in increased expression of CASP3 mRNA	25929836
D001280	Atrazine	Atrazine results in increased cleavage of CASP3 protein	30877919
D001280	Atrazine	Atrazine results in decreased expression of CASP3 mRNA	22378314
D001280	Atrazine	Atrazine results in increased expression of CASP3 mRNA	21333729
D001280	Atrazine	kolaviron inhibits the reaction [Atrazine results in increased expression of CASP3 mRNA]	21333729
D001280	Atrazine	Atrazine results in increased expression of CASP3 mRNA	29040958
D001280	Atrazine	Atrazine affects the expression of CASP3	21726175
D001280	Atrazine	Atrazine results in increased activity of CASP3 protein	21726175
D001280	Atrazine	Atrazine results in increased expression of CASP3 mRNA	27102619
D001280	Atrazine	Atrazine results in increased expression of CASP3 protein	24863870
D001280	Atrazine	Curcumin inhibits the reaction [Atrazine results in increased expression of CASP3 protein]	24863870
D001280	Atrazine	kolaviron inhibits the reaction [Atrazine affects the expression of CASP3]	21726175
D001280	Atrazine	kolaviron inhibits the reaction [Atrazine results in increased activity of CASP3 protein]	21726175
D001280	Atrazine	Lycopene inhibits the reaction [Atrazine results in increased expression of CASP3 mRNA]	27102619
D001285	Atropine	Atropine results in increased expression of CASP3 mRNA	19815060
D001310	Auranofin	Auranofin promotes the reaction [TNF protein results in increased activity of CASP3 protein]	18789312
D001310	Auranofin	Auranofin results in decreased expression of and results in increased cleavage of CASP3 protein	20542334
D001310	Auranofin	Auranofin results in increased activity of CASP3 protein	15159275; 18789312; 21699084;
D001310	Auranofin	BCL2 protein inhibits the reaction [Auranofin results in increased activity of CASP3 protein]	18789312
D001310	Auranofin	Auranofin results in increased activity of CASP3 protein	18789312
D001310	Auranofin	BAK1 mutant form inhibits the reaction [Auranofin results in increased activity of CASP3 protein]	18789312
D001310	Auranofin	BAX mutant form inhibits the reaction [Auranofin results in increased activity of CASP3 protein]	18789312
D001310	Auranofin	Auranofin results in increased activity of CASP3 protein	15191400
C516713	auriculasin	[auriculasin co-treated with TNFSF10 protein] results in increased expression of CASP3 protein	30817944
C516713	auriculasin	TNFRSF10B protein affects the reaction [[auriculasin co-treated with TNFSF10 protein] results in increased expression of CASP3 protein]	30817944
C426023	austenitic steel	[Nickel co-treated with austenitic steel analog] results in increased expression of CASP3 mRNA	23638002
D001374	Azacitidine	Azacitidine affects the expression of CASP3 protein	18443271
D001374	Azacitidine	[metacept-1 co-treated with Azacitidine] results in increased expression of CASP3	19148494
D001374	Azacitidine	Azacitidine results in increased expression of CASP3 mRNA	23395740
C010329	azadirachtin	azadirachtin results in increased expression of CASP3 mRNA	20429769
C010329	azadirachtin	azadirachtin results in increased expression of CASP3 protein	20429769
C479321	azadiradione	azadiradione results in increased activity of CASP3 protein	21381696
C406592	azaspiracid	azaspiracid results in increased activity of CASP3 protein	20047973
C099015	azaspirane	azaspirane results in increased cleavage of and results in increased activity of CASP3 protein	15705788
C517975	AZD 6244	AZD 6244 inhibits the reaction [[KRAS protein mutant form affects the susceptibility to Vemurafenib] promotes the reaction [TNFRSF10B protein results in increased cleavage of CASP3 protein]]	27222248
C517975	AZD 6244	AZD 6244 results in increased cleavage of CASP3 protein	17876044
C517975	AZD 6244	Doxorubicin promotes the reaction [AZD 6244 results in increased cleavage of CASP3 protein]	17876044
C547126	AZM551248	AZM551248 results in increased expression of CASP3 mRNA	22323515
D001397	Azoxymethane	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of CASP3 mRNA	29950665
C040929	bafilomycin A1	[bafilomycin A1 co-treated with cobaltous chloride co-treated with TP53 gene mutant form] results in increased activity of CASP3 protein	23380477
C040929	bafilomycin A1	bafilomycin A1 inhibits the reaction [Soot analog results in increased expression of CASP3 protein]	30240709
C040929	bafilomycin A1	bafilomycin A1 inhibits the reaction [tetrandrine results in increased cleavage of CASP3 protein]	25266202
C040929	bafilomycin A1	bafilomycin A1 promotes the reaction [Atorvastatin results in increased cleavage of CASP3 protein]	20876807
C040929	bafilomycin A1	bafilomycin A1 promotes the reaction [brazilin results in increased activity of CASP3 protein]	28063998
C040929	bafilomycin A1	bafilomycin A1 promotes the reaction [fosbretabulin results in increased cleavage of CASP3 protein]	24321340
C040929	bafilomycin A1	bafilomycin A1 results in decreased activity of CASP3 protein	25981168
C040929	bafilomycin A1	bafilomycin A1 results in increased activity of CASP3 protein	28063998
C040929	bafilomycin A1	bafilomycin A1 inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
C040929	bafilomycin A1	bafilomycin A1 inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	28378122
C040929	bafilomycin A1	bafilomycin A1 promotes the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
C528809	BAG956	BAG956 results in increased cleavage of CASP3 protein	22885370
C006680	baicalein	baicalein inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form]	20850421
C038044	baicalin	baicalin inhibits the reaction [Rotenone affects the expression of CASP3 protein]	25423838
C012765	bakuchiol	[TNFSF10 protein co-treated with bakuchiol] results in increased cleavage of CASP3 protein	27033605
C012765	bakuchiol	bakuchiol results in increased activity of and results in increased cleavage of CASP3 protein	17292878
C012765	bakuchiol	pyrazolanthrone inhibits the reaction [bakuchiol results in increased activity of and results in increased cleavage of CASP3 protein]	17292878
C060988	baohuoside I	baohuoside I results in increased activity of CASP3 protein	19289254
C060988	baohuoside I	baohuoside I results in increased cleavage of CASP3 protein	22687635
C028559	bathocuproine sulfonate	bathocuproine sulfonate inhibits the reaction [[Copper binds to neocuproine] which results in increased activity of CASP3 protein]	18056745
C028559	bathocuproine sulfonate	bathocuproine sulfonate inhibits the reaction [[Disulfiram binds to cupric chloride] which results in increased activity of CASP3 protein]	11239917
C028559	bathocuproine sulfonate	bathocuproine sulfonate inhibits the reaction [[pyrrolidine dithiocarbamic acid co-treated with Copper] results in increased activity of CASP3 protein]	10941151
C017049	bathophenanthroline disulfonic acid	bathophenanthroline disulfonic acid inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	20096349
C416282	BAY 11-7085	BAY 11-7085 inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C416282	BAY 11-7085	BAY 11-7085 inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C580697	BDMC-A	BDMC-A results in increased cleavage of CASP3 protein	24365254
C004456	beauvericin	beauvericin results in increased activity of CASP3 protein	25178661
D001514	Bee Venoms	Bee Venoms results in increased expression of CASP3 protein	15922390
D001514	Bee Venoms	Bee Venoms inhibits the reaction [Aspirin results in increased expression of CASP3 mRNA]	30885738
D001514	Bee Venoms	Bee Venoms inhibits the reaction [Aspirin results in increased expression of CASP3 protein]	30885738
D001514	Bee Venoms	Bee Venoms inhibits the reaction [propionic acid results in increased expression of CASP3 mRNA]	26048086
D001514	Bee Venoms	Bee Venoms results in increased expression of CASP3 mRNA	24822179
D001514	Bee Venoms	[Bleomycin co-treated with Bee Venoms] results in increased expression of CASP3 mRNA	24822179
C487081	belinostat	belinostat results in increased cleavage of CASP3 protein	18223231
C487081	belinostat	Bortezomib promotes the reaction [belinostat results in increased cleavage of CASP3 protein]	18223231
D000069461	Bendamustine Hydrochloride	Bendamustine Hydrochloride results in increased activity of CASP3 protein	12948851
D000069461	Bendamustine Hydrochloride	Cladribine promotes the reaction [Bendamustine Hydrochloride results in increased activity of CASP3 protein]	12948851
C005177	benserazide, levodopa drug combination	benserazide, levodopa drug combination inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27053303
D001546	Bentonite	Bentonite inhibits the reaction [[HT-2 toxin co-treated with T-2 Toxin] results in increased expression of CASP3 mRNA]	25296281
C037689	benzamide	benzamide results in increased activity of CASP3 protein	15450410
C037689	benzamide	benzamide results in increased activity of CASP3 protein	18695944
D001553	Benzbromarone	Benzbromarone affects the expression of CASP3 mRNA	19483382
D001554	Benzene	Benzene affects the activity of CASP3 protein	22960397
D001554	Benzene	Benzene analog results in increased activity of CASP3 protein	15826604
D001554	Benzene	Benzene results in increased expression of CASP3 mRNA	19162166
D001554	Benzene	[Benzene co-treated with Formaldehyde] results in increased activity of CASP3 protein	27339418
D001554	Benzene	Benzene results in increased activity of CASP3 protein	27339418
D001554	Benzene	[Benzene co-treated with methylmercury II co-treated with Trichloroethylene] results in increased expression of CASP3 mRNA	17905399
D001554	Benzene	Benzene results in increased expression of CASP3 mRNA	21143203
D001554	Benzene	Decitabine inhibits the reaction [Benzene results in increased expression of CASP3 mRNA]	21143203
D001564	Benzo(a)pyrene	2,4,5,2',4',5'-hexachlorobiphenyl inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	24954032
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased activity of CASP3 protein	23318731; 24685774;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased cleavage of CASP3 protein	16041517; 24954032; 30659931;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of CASP3 mRNA	21393351; 24239969;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of CASP3 protein	22581694
D001564	Benzo(a)pyrene	Clotrimazole inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 mRNA]	24239969
D001564	Benzo(a)pyrene	CYP1B1 mutant form inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 mRNA]	24239969
D001564	Benzo(a)pyrene	Estradiol inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	24954032
D001564	Benzo(a)pyrene	fostriecin inhibits the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D001564	Benzo(a)pyrene	Nitrogen Oxides inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	16041517
D001564	Benzo(a)pyrene	Okadaic Acid inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D001564	Benzo(a)pyrene	Okadaic Acid inhibits the reaction [Estradiol inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D001564	Benzo(a)pyrene	Okadaic Acid inhibits the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D001564	Benzo(a)pyrene	Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	24954032
D001564	Benzo(a)pyrene	AHR protein inhibits the reaction [Benzo(a)pyrene results in decreased expression of CASP3 mRNA]	15034205
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased cleavage of and results in decreased activity of CASP3 protein	20206614
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of CASP3 mRNA	15034205
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of CASP3 protein modified form	20206614
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased activity of CASP3 protein	19041363; 19874837; 27208085;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of CASP3 mRNA	19770486
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of CASP3 protein	22342234; 28032951; 30520250;
D001564	Benzo(a)pyrene	Chlordan promotes the reaction [Benzo(a)pyrene results in increased activity of CASP3 protein]	19874837
D001564	Benzo(a)pyrene	GJA1 mutant form promotes the reaction [Benzo(a)pyrene results in increased activity of CASP3 protein]	19874837
D001564	Benzo(a)pyrene	Phytol inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 protein]	30520250
D001564	Benzo(a)pyrene	Plant Extracts inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 protein]	28032951
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased activity of CASP3 protein	22051199; 31368503;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased cleavage of CASP3 protein	31568845
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of and results in increased activity of CASP3 protein	23510837
D001564	Benzo(a)pyrene	Glycyrrhizic Acid inhibits the reaction [Benzo(a)pyrene results in increased activity of CASP3 protein]	22051199
D001564	Benzo(a)pyrene	Lycopene inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	31568845
D001565	Benzoates	Benzoates analog results in decreased expression of CASP3 mRNA	29472718
D001565	Benzoates	Benzoates analog results in increased expression of CASP3 protein modified form	29472718
C026487	benzo(e)pyrene	benzo(e)pyrene results in increased activity of CASP3 protein	18586875; 19959636;
C026487	benzo(e)pyrene	Genistein inhibits the reaction [benzo(e)pyrene results in increased activity of CASP3 protein]	19959636
C026487	benzo(e)pyrene	Memantine inhibits the reaction [benzo(e)pyrene results in increased activity of CASP3 protein]	19959636
C026487	benzo(e)pyrene	Resveratrol inhibits the reaction [benzo(e)pyrene results in increased activity of CASP3 protein]	19959636
C026487	benzo(e)pyrene	benzo(e)pyrene results in increased activity of CASP3 protein	19899995
D053119	Benzophenanthridines	Benzophenanthridines analog results in increased activity of CASP3 protein	23117580
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [2-(3'-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone results in increased cleavage of CASP3 protein]	23523585
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide results in increased cleavage of CASP3 protein]	26549707
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	18566239
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [bis(2-hydroxy-2-ethylbutanoato)oxochromate(V) results in increased activity of CASP3 protein]	14572611
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [danthron results in increased activity of CASP3 protein]	21126053
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	17681413
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [diepoxybutane results in increased activity of CASP3 protein]	14998682
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Endosulfan results in increased activity of CASP3 protein]	20361990
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [IL1B protein results in increased activity of CASP3 protein]	17404069
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [NCX 4040 results in increased cleavage of and results in increased activity of CASP3 protein]	16282376
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [phenethyl isothiocyanate results in increased activity of CASP3 protein]	16054126
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	14572611
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Resveratrol results in increased cleavage of CASP3 protein]	24264887
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [TP53 protein affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]]	16166740
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein	12907145; 14563161; 15476743;
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to 10-methoxy-2,2-dimethyl-2,6-dihydropyrano(3,2-c)quinolin-5-one	20833157
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to 1-(3',4',5'-trimethoxyphenyl)-3-(3'',4''-dimethoxy-2'-hydroxyphenyl)propane	20674558
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to flavanone	22056764
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to Hydrazones	22056764
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to methyl antcinate A	20557081
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol	15827328
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16728380
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16728380
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [methylmercuric chloride results in increased activity of CASP3 protein]	31330229
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16291826
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to Nanotubes, Carbon	22664788
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	11562448
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [CASP3 protein results in increased susceptibility to Cacodylic Acid]	15276415
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	19459161
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	14514686
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	25169008
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein	15276415
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] inhibits the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased cleavage of and results in increased activity of PRKCD protein]	11880503
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein	11190270; 11880503; 12015209; 14732211; 15033169; 15158148; 15180944; 15827328; 16054126; 16310883; 16367743; 16728380; 20557081; 20661774; 20674558; 20833157; 21292685; 22056764; 22079975; 22664788; 23639247; 9395239;
C110772	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] inhibits the reaction [methyl jasmonate metabolite results in increased susceptibility to TNFSF10 protein]	22079975
C427308	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C427308	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C427308	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [Docetaxel results in increased cleavage of and results in increased activity of CASP3 protein]	17308071
C427308	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [Silybin results in increased cleavage of and results in increased activity of CASP3 protein]	16777994
C090535	benzyloxycarbonyl-isoleucyl-glutamyl(O-tert-butyl)-alanyl-leucinal	benzyloxycarbonyl-isoleucyl-glutamyl(O-tert-butyl)-alanyl-leucinal inhibits the reaction [Lipopolysaccharides results in increased ubiquitination of and results in increased degradation of and results in decreased activity of CASP3 protein]	15454145
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]]	20104024
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]]	20104024
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [dioscin results in increased expression of CASP3 protein]	29990575
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [methyl protodioscin results in increased expression of CASP3 protein]	31271762
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Mustard Gas results in increased activity of CASP3 protein]	20226831
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein]	21067863
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [nimesulide results in increased cleavage of and results in increased activity of CASP3 protein]	19360361
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [N,N-dimethylphytosphingosine results in increased cleavage of and results in increased activity of CASP3 protein]	19481559
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Okadaic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	19084044
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Resveratrol results in increased activity of CASP8 protein] which results in increased activity of CASP3 protein]	19423619
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	21362627
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone results in decreased expression of CASP3 protein	29990575
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16728380
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16728380
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
C403753	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Zearalenone results in increased cleavage of CASP3 protein]	30600648
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone affects the reaction [rubimaillin results in increased activity of CASP3 protein]	19716835
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased activity of CASP3 protein]	22002103
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Cisplatin co-treated with FASLG protein] results in increased activity of CASP3 protein]	17574045
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [dioscin results in increased expression of CASP3 protein]	29990575
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	18056177
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	23747687
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [methyl protodioscin results in increased expression of CASP3 protein]	31271762
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Resveratrol results in increased cleavage of CASP3 protein]	24264887
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [titanium dioxide results in increased cleavage of CASP3 protein]	20362650
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone results in decreased activity of CASP3 protein	16531423
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone results in decreased expression of CASP3 protein	29990575
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16728380
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16728380
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Paraoxon results in increased cleavage of and results in increased activity of CASP3 protein]	12831782
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Resveratrol results in increased cleavage of CASP3 protein]	22137261
C403754	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	[Arsenic Trioxide co-treated with benzyloxycarbonylleucyl-leucyl-leucine aldehyde] results in increased cleavage of CASP3 protein	25449439
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [evodiamine results in increased activity of and results in increased cleavage of CASP3 protein]	20005289
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased cleavage of and results in increased activity of CASP3 protein	15498850
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased cleavage of CASP3 protein	18790767; 25449439;
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	[XBP1 mutant form co-treated with benzyloxycarbonylleucyl-leucyl-leucine aldehyde] promotes the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	Acetylcysteine inhibits the reaction [benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased activity of CASP3 protein]	20100472
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased activity of CASP3 protein	16880202; 20100472; 20449726; 20649845;
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of CASP3 protein modified form	29944914
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased activity of CASP3 protein	15725397; 18463101;
C072553	benzyloxycarbonylleucyl-leucyl-leucine aldehyde	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased cleavage of CASP3 protein	23684743
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide results in increased cleavage of CASP3 protein]	26549707
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [acetylbritannilatone analog results in increased activity of CASP3 protein]	27262408
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	29964147
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	15131059
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Biological Products results in increased expression of and results in increased cleavage of CASP3 protein]	30465897
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Cisplatin co-treated with chrysin] results in increased cleavage of CASP3 protein]	25770930
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [cryptotanshinone results in increased cleavage of CASP3 protein]	28600121
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Cycloheximide co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein]	18222423
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Fluorouracil co-treated with olaparib] results in increased cleavage of CASP3 protein]	26544897
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[gambogic acid co-treated with Bortezomib] results in increased activity of CASP3 protein]	24291039
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Lithocholic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	19054763
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [NCQ 344 results in increased activity of CASP3 protein]	10996300
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [NCQ 436 results in increased activity of CASP3 protein]	10996300
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Organometallic Compounds results in increased activity of CASP3 protein]	24781711
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	22987761
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Quercetin co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein]	20096292
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	14688022
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Quercetin results in increased susceptibility to TNFSF10 protein] promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]]	21933852
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Resveratrol co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein]	18222423
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[shogaol co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein]	25619640
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein]	17888894
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [thymoquinone results in increased activity of CASP3 protein]	29981725
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Zinc Oxide analog results in increased activity of CASP3 protein]	27544635
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [3-methyladenine promotes the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]]	19139269
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [dihydrocapsaicin promotes the reaction [3-methyladenine results in increased activity of CASP3 protein]]	19139269
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]	19139269
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Fingolimod Hydrochloride results in increased cleavage of CASP3 protein]	25939952
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Niclosamide results in increased cleavage of CASP3 protein]	21871175
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Oligopeptides analog results in increased cleavage of CASP3 protein]	24875536
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Pyrogallol results in increased activity of CASP3 protein]	19000662
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [[Resveratrol co-treated with Clofarabine] promotes the reaction [MCL1 mutant form results in increased activity of CASP3 protein]]	24924397
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [[Resveratrol co-treated with Clofarabine] results in increased activity of CASP3 protein]	24924397
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Sevoflurane results in increased cleavage of CASP3 protein]	19433662
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	20937774
C517629	benzyloxycarbonyl-valyl-alanyl-aspartic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Manganese Compounds results in increased cleavage of and results in increased activity of CASP3 protein]	21856324
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane analog inhibits the reaction [Zearalenone results in increased expression of CASP3 protein]	28011299
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Dactinomycin results in increased cleavage of and results in increased activity of CASP3 protein]	14640974
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane analog inhibits the reaction [2,6-dichloro-4-nitrophenol results in increased activity of CASP3 protein]	11227219
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [3-methyladenine results in increased activity of CASP3 protein]	18818525
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [4-chromone analog results in increased expression of CASP3 protein modified form]	30256521
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	30890322
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [ginsenoside Rk1 results in increased cleavage of CASP3 protein]	30797898
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	24647664
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane analog inhibits the reaction [Paraoxon results in increased cleavage of and results in increased activity of CASP3 protein]	12831782
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [[triptolide co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form]	30633930
C103712	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	25997894
C048081	beraprost	beraprost inhibits the reaction [[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein]	28887131
C027870	berbamine	berbamine results in increased activity of CASP3 protein	17531122
D001599	Berberine	[Berberine co-treated with Niacinamide] results in increased cleavage of CASP3 protein	26712469
D001599	Berberine	Berberine results in increased activity of CASP3 protein	20656010
D001599	Berberine	Berberine results in increased cleavage of and results in increased activity of CASP3 protein	16505103
D001599	Berberine	Berberine results in increased cleavage of CASP3 protein	26712469
D001599	Berberine	Berberine results in increased expression of CASP3 mRNA	20656010
D001599	Berberine	[Berberine co-treated with Thioacetamide] results in increased expression of CASP3 mRNA	30138605
D001599	Berberine	Berberine inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	25600690
C000617228	beta-2-himachalen-6-ol	beta-2-himachalen-6-ol results in increased cleavage of CASP3 protein	28782499
D019207	beta Carotene	alpha-Tocopherol promotes the reaction [beta Carotene metabolite results in decreased activity of CASP3 protein]	17618090
D019207	beta Carotene	beta Carotene metabolite results in increased activity of CASP3 protein	17618090
D019207	beta Carotene	beta Carotene results in increased activity of CASP3 protein	26733226
C031463	beta-glycerophosphoric acid	[Troglitazone co-treated with beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CASP3 mRNA	30481989
C023888	beta-hexachlorocyclohexane	beta-hexachlorocyclohexane results in increased cleavage of CASP3 protein	19760616
C023888	beta-hexachlorocyclohexane	beta-hexachlorocyclohexane results in increased expression of CASP3 mRNA	19175174
C023888	beta-hexachlorocyclohexane	[Dichlorodiphenyl Dichloroethylene co-treated with beta-hexachlorocyclohexane] results in increased expression of CASP3 mRNA	19175174
D001622	Betaine	Betaine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	24632105
C008157	beta-ionone	[alpha-Tocopherol co-treated with beta-ionone] results in increased activity of CASP3 protein	17618090
C008157	beta-ionone	beta-ionone results in increased cleavage of CASP3 protein	31506784
C008157	beta-ionone	beta-ionone results in increased expression of CASP3 protein modified form	23100158
C044887	beta-methylcholine	beta-methylcholine affects the expression of CASP3 mRNA	21179406
D019324	beta-Naphthoflavone	beta-Naphthoflavone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	21947872
C000614835	beta-patchoulene	beta-patchoulene analog inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	29339218
C026609	beta-solamarine	beta-solamarine promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	17619073
C026609	beta-solamarine	beta-solamarine results in increased activity of CASP3 protein	17619073
C026609	beta-solamarine	beta-solamarine results in increased cleavage of CASP3 protein	20647040
D024503	beta-Tocopherol	beta-Tocopherol affects the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	12450566
D024503	beta-Tocopherol	beta-Tocopherol affects the reaction [cholest-5-en-3 beta,7 alpha-diol results in increased activity of CASP3 protein]	12450566
D024503	beta-Tocopherol	[alpha-Tocopherol co-treated with beta-Tocopherol co-treated with gamma-Tocopherol co-treated with delta-tocopherol] affects the reaction [Estradiol affects the expression of CASP3 protein]	22389237
C002070	betulinic acid	betulinic acid results in increased activity of CASP3 protein	26772157
C002070	betulinic acid	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [betulinic acid analog results in increased cleavage of CASP3 protein]	23000516
C002070	betulinic acid	betulinic acid analog results in increased activity of CASP3 protein	29454615
C002070	betulinic acid	betulinic acid analog results in increased cleavage of CASP3 protein	23000516
C002070	betulinic acid	betulinic acid results in increased activity of CASP3 protein	22260869; 26772157;
C002070	betulinic acid	betulinic acid results in increased cleavage of CASP3 protein	28578903
C002070	betulinic acid	CA 074 methyl ester inhibits the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [betulinic acid analog results in increased cleavage of CASP3 protein]]	23000516
C002070	betulinic acid	VDAC1 protein inhibits the reaction [betulinic acid results in increased expression of CASP3 protein modified form]	30136359
C002070	betulinic acid	betulinic acid promotes the reaction [TNF protein results in decreased expression of CASP3 protein]	22285267
C002070	betulinic acid	betulinic acid promotes the reaction [TNF protein results in increased expression of CASP3 protein modified form]	22285267
C002070	betulinic acid	betulinic acid results in increased activity of CASP3 protein	20026015
D000077610	Bexarotene	Bexarotene results in decreased expression of CASP3 mRNA	17849452
D001629	Bezafibrate	Bezafibrate inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16316343
D001632	Bibenzyls	Bibenzyls inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	27180985
C458523	BIBR 1532	[Arsenic Trioxide co-treated with BIBR 1532] results in increased activity of CASP3 protein	23293885
C053541	bicalutamide	[bicalutamide co-treated with Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein	27132804
C053541	bicalutamide	bicalutamide results in increased cleavage of and results in increased activity of CASP3 protein	15638997
C099952	bifenthrin	bifenthrin results in increased activity of CASP3 protein	26071804
C099952	bifenthrin	bifenthrin results in increased expression of CASP3 mRNA	27916261
D001663	Bilirubin	Bilirubin results in increased cleavage of CASP3 protein	27578021
D001663	Bilirubin	4-phenylbutyric acid inhibits the reaction [Bilirubin results in increased cleavage of CASP3 protein]	27578021
D001663	Bilirubin	Bilirubin inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]	20709802
D001663	Bilirubin	Bilirubin results in increased cleavage of CASP3 protein	23628428
D001663	Bilirubin	CYP2A5 protein inhibits the reaction [Bilirubin results in increased cleavage of CASP3 protein]	23628428
D001663	Bilirubin	Bilirubin inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D001664	Biliverdine	Biliverdine inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D001664	Biliverdine	[Methylene Chloride co-treated with Biliverdine] inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
C519495	BIM 23120	[BIM 23120 results in increased activity of SSTR2 protein] which results in increased activity of CASP3 protein	16954443
C004541	biochanin A	biochanin A results in increased activity of CASP3 protein	12791511
D056804	Biofuels	[Biofuels co-treated with Triacetin] results in decreased expression of CASP3 mRNA	30738890
D056804	Biofuels	Biofuels inhibits the reaction [Vehicle Emissions results in decreased expression of CASP3 mRNA]	30738890
D056804	Biofuels	Biofuels results in increased expression of CASP3 mRNA	30738890
D001685	Biological Factors	Biological Factors inhibits the reaction [lead acetate results in increased expression of CASP3 mRNA]	30703413
D001685	Biological Factors	Biological Factors inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30703413
D001688	Biological Products	3-methyladenine inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
D001688	Biological Products	3-methyladenine promotes the reaction [Biological Products results in increased expression of and results in increased cleavage of CASP3 protein]	30465897
D001688	Biological Products	Acetylcysteine inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
D001688	Biological Products	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Biological Products results in increased expression of and results in increased cleavage of CASP3 protein]	30465897
D001688	Biological Products	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
D001688	Biological Products	Biological Products results in increased activity of CASP3 protein	22654482
D001688	Biological Products	Biological Products results in increased cleavage of CASP3 protein	28219700
D001688	Biological Products	Biological Products results in increased expression of and results in increased cleavage of CASP3 protein	30465897
D001688	Biological Products	Biological Products results in increased expression of CASP3 mRNA	22654482
D001688	Biological Products	Chloroquine inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
D001688	Biological Products	Chloroquine promotes the reaction [Biological Products results in increased expression of and results in increased cleavage of CASP3 protein]	30465897
D001688	Biological Products	Dactinomycin inhibits the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
D001688	Biological Products	pyrazolanthrone inhibits the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
D001688	Biological Products	SB 203580 inhibits the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
D001688	Biological Products	U 0126 promotes the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
D001688	Biological Products	6-methyl-2-(phenylethynyl)pyridine promotes the reaction [Biological Products results in increased expression of CASP3 protein modified form]	29458170
D001688	Biological Products	Biological Products results in increased expression of CASP3 protein modified form	29458170
D001688	Biological Products	GRM5 protein inhibits the reaction [Biological Products results in increased expression of CASP3 protein modified form]	29458170
C534987	biphosphinic palladacycle complex	biphosphinic palladacycle complex results in increased activity of CASP3 protein	19026616
C534987	biphosphinic palladacycle complex	N-(3-propylcarbamoyloxirane-2-carbonyl)-isoleucyl-proline inhibits the reaction [biphosphinic palladacycle complex results in increased activity of CASP3 protein]	19026616
C083520	bis(2-hydroxy-2-ethylbutanoato)oxochromate(V)	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [bis(2-hydroxy-2-ethylbutanoato)oxochromate(V) results in increased activity of CASP3 protein]	14572611
C083520	bis(2-hydroxy-2-ethylbutanoato)oxochromate(V)	bis(2-hydroxy-2-ethylbutanoato)oxochromate(V) results in increased activity of CASP3 protein	14572611
C083520	bis(2-hydroxy-2-ethylbutanoato)oxochromate(V)	CAT protein inhibits the reaction [bis(2-hydroxy-2-ethylbutanoato)oxochromate(V) results in increased activity of CASP3 protein]	14572611
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased activity of CASP3 protein	29261303
C482801	bis(acetato)(1-adamantylamine)amminedichloroplatinum(IV)	bis(acetato)(1-adamantylamine)amminedichloroplatinum(IV) promotes the reaction [TNFSF10 protein results in increased cleavage of and results in increased activity of CASP3 protein]	21037225
C109992	bis(isopropyl methyl)phosphonate	bis(isopropyl methyl)phosphonate results in increased cleavage of CASP3 protein	27665771
C439296	bisnaphthalimidopropylspermidine	bisnaphthalimidopropylspermidine results in increased activity of CASP3 protein	18983836; 29966682;
C006780	bisphenol A	bisphenol A results in increased activity of CASP3 protein	29261303
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 mRNA	26911650
C006780	bisphenol A	bisphenol A results in increased cleavage of CASP3 protein	30877919
C006780	bisphenol A	MLH1 protein affects the reaction [bisphenol A results in increased cleavage of CASP3 protein]	30877919
C006780	bisphenol A	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[bisphenol A co-treated with LEP protein] results in decreased activity of CASP3 protein]	23850738
C006780	bisphenol A	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [bisphenol A results in decreased activity of CASP3 protein]	23850738
C006780	bisphenol A	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [bisphenol A results in decreased expression of CASP3 protein]	23850738
C006780	bisphenol A	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[LEP protein co-treated with bisphenol A] results in decreased expression of CASP3 protein]	23850738
C006780	bisphenol A	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with bisphenol A] results in decreased activity of CASP3 protein]	23850738
C006780	bisphenol A	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with bisphenol A] results in decreased expression of CASP3 protein]	23850738
C006780	bisphenol A	[bisphenol A co-treated with LEP protein] results in decreased expression of CASP3 mRNA	23850738
C006780	bisphenol A	[bisphenol A co-treated with LEP protein] results in decreased expression of CASP3 protein	23850738
C006780	bisphenol A	bisphenol A promotes the reaction [LEP protein results in decreased activity of CASP3 protein]	23850738
C006780	bisphenol A	bisphenol A results in decreased activity of CASP3 protein	21277958; 23850738;
C006780	bisphenol A	bisphenol A results in decreased expression of CASP3 mRNA	23850738; 29275510;
C006780	bisphenol A	bisphenol A results in decreased expression of CASP3 protein	21277958; 23850738;
C006780	bisphenol A	bisphenol A results in increased activity of CASP3 protein	30036487; 30841469; 31278978;
C006780	bisphenol A	bisphenol A results in increased cleavage of CASP3 protein	20214975; 30953815;
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 mRNA	30036487; 30841469;
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 protein	28951153; 31400064;
C006780	bisphenol A	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of CASP3 mRNA	28628672
C006780	bisphenol A	LEP protein promotes the reaction [bisphenol A results in decreased activity of CASP3 protein]	23850738
C006780	bisphenol A	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein]	26096086
C006780	bisphenol A	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	24905940
C006780	bisphenol A	bisphenol A results in decreased expression of and results in decreased cleavage of CASP3 protein	26146954
C006780	bisphenol A	bisphenol A results in decreased expression of CASP3	25205691
C006780	bisphenol A	bisphenol A results in decreased expression of CASP3 protein	24909818
C006780	bisphenol A	bisphenol A results in increased activity of CASP3 protein	16684133; 18521933; 29161229; 31387175;
C006780	bisphenol A	bisphenol A results in increased cleavage of CASP3 protein	24905940
C006780	bisphenol A	bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein	26096086
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 mRNA	21932408; 31387175;
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 protein	19193734; 23900028;
C006780	bisphenol A	KN 62 inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	24905940
C006780	bisphenol A	KN 93 inhibits the reaction [bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein]	26096086
C006780	bisphenol A	[Streptozocin co-treated with bisphenol A] results in increased expression of CASP3 mRNA	29935216
C006780	bisphenol A	W 7 inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	24905940
C006780	bisphenol A	W 7 inhibits the reaction [bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein]	26096086
C006780	bisphenol A	bisphenol A results in decreased expression of CASP3 mRNA	30528428
C006780	bisphenol A	bisphenol A affects the expression of CASP3 mRNA	25181051
C006780	bisphenol A	[bisphenol A co-treated with 4-nonylphenol] results in increased expression of CASP3 mRNA	30228064
C006780	bisphenol A	bisphenol A inhibits the reaction [4-nonylphenol results in increased expression of CASP3 protein modified form]	30228064
C006780	bisphenol A	bisphenol A inhibits the reaction [Genistein results in increased cleavage of CASP3 protein]	24884420
C006780	bisphenol A	bisphenol A results in decreased cleavage of CASP3 protein	24884420; 27296223;
C006780	bisphenol A	bisphenol A results in decreased expression of CASP3 protein	24464975
C006780	bisphenol A	bisphenol A results in increased activity of CASP3 protein	23788033; 25454643; 25461564; 26877094;
C006780	bisphenol A	bisphenol A results in increased cleavage of CASP3 protein	23328667; 25461909; 25963729;
C006780	bisphenol A	bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein	25461564
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 mRNA	23554804; 25461564; 25461909; 27296223;
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 protein	16909604; 17322771; 24768697; 27925325;
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 protein modified form	26139607; 27539358;
C006780	bisphenol A	Curcumin inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	25963729
C006780	bisphenol A	Fulvestrant inhibits the reaction [bisphenol A results in increased activity of CASP3 protein]	23788033
C006780	bisphenol A	[Genistein co-treated with bisphenol A] results in decreased cleavage of CASP3 protein	24884420
C006780	bisphenol A	Genistein inhibits the reaction [bisphenol A results in decreased cleavage of CASP3 protein]	24884420
C006780	bisphenol A	Melatonin inhibits the reaction [bisphenol A results in increased activity of CASP3 protein]	25454643
C006780	bisphenol A	[bisphenol A co-treated with fisetin] results in increased expression of CASP3 mRNA	29544186
C006780	bisphenol A	bisphenol A results in increased expression of CASP3 mRNA	29544186
D017438	Bisphenol A-Glycidyl Methacrylate	Bisphenol A-Glycidyl Methacrylate results in increased activity of CASP3 protein	26756871
D017438	Bisphenol A-Glycidyl Methacrylate	wogonin inhibits the reaction [Bisphenol A-Glycidyl Methacrylate results in increased activity of CASP3 protein]	26756871
C000611646	bisphenol F	bisphenol F results in increased expression of CASP3 mRNA	31453682
C005961	bis(tri-n-butyltin)oxide	bis(tri-n-butyltin)oxide results in increased cleavage of CASP3 protein	22613032
C005961	bis(tri-n-butyltin)oxide	bis(tri-n-butyltin)oxide results in increased phosphorylation of CASP3 protein	22174045
C518299	BIX 01294	[BIX 01294 results in increased susceptibility to IFNA2 protein alternative form] which results in increased activity of CASP3 protein	25079219
C518299	BIX 01294	[BIX 01294 results in increased susceptibility to Imatinib Mesylate] which results in increased activity of CASP3 protein	25079219
C518299	BIX 01294	BIX 01294 affects the reaction [Neomycin affects the cleavage of CASP3 protein]	23429292
C025703	bleomycetin	Acetazolamide promotes the reaction [bleomycetin results in increased activity of CASP3 protein]	21040473
C025703	bleomycetin	bleomycetin results in increased activity of CASP3 protein	21040473
C025703	bleomycetin	CA9 protein inhibits the reaction [bleomycetin results in increased activity of CASP3 protein]	21040473
D001761	Bleomycin	[Polyphenols co-treated with Bleomycin] results in increased expression of CASP3 mRNA	26800624
D001761	Bleomycin	[Tea co-treated with Bleomycin] results in increased expression of CASP3 mRNA	26800624
D001761	Bleomycin	Bleomycin results in increased activity of CASP3 protein	22687607
D001761	Bleomycin	allyl sulfide inhibits the reaction [Bleomycin results in increased expression of CASP3 protein]	23656969
D001761	Bleomycin	[Bleomycin co-treated with Bee Venoms] results in increased expression of CASP3 mRNA	24822179
D001761	Bleomycin	Bleomycin results in increased cleavage of and results in increased activity of CASP3 protein	15371238
D001761	Bleomycin	Bleomycin results in increased expression of CASP3 mRNA	24822179; 26093215;
D001761	Bleomycin	Bleomycin results in increased expression of CASP3 protein	23656969
D001761	Bleomycin	Phytochemicals inhibits the reaction [Bleomycin results in increased expression of CASP3 mRNA]	26093215
D001786	Blood Glucose	SOD1 protein inhibits the reaction [Blood Glucose results in increased cleavage of CASP3 protein]	22425406
D001786	Blood Glucose	Blood Glucose results in increased cleavage of CASP3 protein	22425406
D001786	Blood Glucose	[Blood Glucose deficiency co-treated with Oxygen deficiency] results in increased cleavage of CASP3 protein	27693381
D001786	Blood Glucose	[Blood Glucose deficiency co-treated with Oxygen deficiency] results in increased expression of CASP3 mRNA	25322861
D001786	Blood Glucose	Blood Glucose results in increased activity of CASP3 protein	15246841
D001786	Blood Glucose	Ethanol promotes the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D001786	Blood Glucose	Hemin inhibits the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D001786	Blood Glucose	Hemin inhibits the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D001786	Blood Glucose	[[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] co-treated with Hemin] results in increased cleavage of CASP3 protein	26747958
D001786	Blood Glucose	[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein	26747958
D001786	Blood Glucose	[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein	26747958
D001786	Blood Glucose	[Oxygen deficiency co-treated with Blood Glucose deficiency] results in increased expression of CASP3 protein modified form	24058562
D001786	Blood Glucose	sodium bisulfide inhibits the reaction [[Oxygen deficiency co-treated with Blood Glucose deficiency] results in increased expression of CASP3 protein modified form]	24058562
D001786	Blood Glucose	zinc protoporphyrin promotes the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D001786	Blood Glucose	zinc protoporphyrin promotes the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
C478223	BMS 310705	BMS 310705 results in increased activity of CASP3 protein	14529678
C557045	BO-1051	ATM protein promotes the reaction [BO-1051 results in increased cleavage of CASP3 protein]	21184746
C557045	BO-1051	BO-1051 results in increased cleavage of CASP3 protein	21184746
C476029	Boc-D-FMK	Boc-D-FMK inhibits the reaction [alvocidib results in increased cleavage of and results in increased activity of CASP3 protein]	14555534
C476029	Boc-D-FMK	Boc-D-FMK inhibits the reaction [[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein]	16985072
C476029	Boc-D-FMK	Boc-D-FMK inhibits the reaction [[fludarabine co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein]	15850772
C476029	Boc-D-FMK	Boc-D-FMK inhibits the reaction [[Sirolimus co-treated with 7-hydroxystaurosporine] results in increased cleavage of CASP3 protein]	15767555
C476029	Boc-D-FMK	Boc-D-FMK inhibits the reaction [Sorafenib results in increased cleavage of and results in increased activity of CASP3 protein]	16007148
C115950	bornyl caffeate	bornyl caffeate results in increased activity of CASP3 protein	24907532
D001895	Boron	Boron results in increased expression of CASP3 protein modified form	23462526
C005066	borrelidin	borrelidin results in increased activity of CASP3 protein	14563161
C005066	borrelidin	borrelidin results in increased cleavage of CASP3 protein	26271225
D000069286	Bortezomib	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt affects the reaction [Bortezomib results in increased cleavage of CASP3 protein]	15509775
D000069286	Bortezomib	AKT1 protein inhibits the reaction [[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein]	16985072
D000069286	Bortezomib	[Arsenic Trioxide co-treated with Bortezomib] results in increased activity of CASP3 protein	20471514
D000069286	Bortezomib	[Arsenic Trioxide co-treated with Bortezomib] results in increased cleavage of CASP3 protein	17495969
D000069286	Bortezomib	BECN1 mutant form promotes the reaction [Bortezomib results in increased cleavage of and results in increased activity of CASP3 protein]	22842577
D000069286	Bortezomib	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[gambogic acid co-treated with Bortezomib] results in increased activity of CASP3 protein]	24291039
D000069286	Bortezomib	Boc-D-FMK inhibits the reaction [[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein]	16985072
D000069286	Bortezomib	[Bortezomib co-treated with 1-(2-cyano-3,12-dioxooleana-1,9-dien-28-oyl) imidazole] results in increased activity of CASP3 protein	15070698
D000069286	Bortezomib	[Bortezomib co-treated with abexinostat] results in increased activity of CASP3 protein	19417023
D000069286	Bortezomib	[Bortezomib co-treated with Arsenic Trioxide] affects the expression of CASP3 protein	18718063
D000069286	Bortezomib	[Bortezomib co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	21518486
D000069286	Bortezomib	[Bortezomib co-treated with Arsenic Trioxide] results in increased expression of CASP3 protein	24377552
D000069286	Bortezomib	[Bortezomib co-treated with Butyrates] results in increased cleavage of and results in increased activity of CASP3 protein	12893773
D000069286	Bortezomib	[Bortezomib co-treated with N,N-dimethylsphingosine] results in increased cleavage of and results in increased activity of CASP3 protein	21195056
D000069286	Bortezomib	[Bortezomib co-treated with oblimersen co-treated with Cyclophosphamide] results in increased activity of CASP3 protein	16675587
D000069286	Bortezomib	[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein	16985072
D000069286	Bortezomib	[Bortezomib co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein	17510429; 19261616;
D000069286	Bortezomib	[Bortezomib co-treated with trichostatin A] results in increased cleavage of and results in increased activity of CASP3 protein	16904634
D000069286	Bortezomib	[Bortezomib co-treated with Vorinostat] results in increased activity of CASP3 protein	18005386; 18641367;
D000069286	Bortezomib	[Bortezomib co-treated with Vorinostat] results in increased cleavage of and results in increased activity of CASP3 protein	12893773
D000069286	Bortezomib	Bortezomib promotes the reaction [belinostat results in increased cleavage of CASP3 protein]	18223231
D000069286	Bortezomib	Bortezomib promotes the reaction [Butyrates results in increased activity of CASP3 protein]	15173093
D000069286	Bortezomib	Bortezomib promotes the reaction [gallium nitrate results in increased activity of CASP3 protein]	17121930
D000069286	Bortezomib	Bortezomib promotes the reaction [NSC606985 results in increased activity of CASP3 protein]	19662097
D000069286	Bortezomib	Bortezomib promotes the reaction [romidepsin results in increased cleavage of CASP3 protein]	18223231
D000069286	Bortezomib	Bortezomib promotes the reaction [Thapsigargin results in increased activity of CASP3 protein]	16357177
D000069286	Bortezomib	Bortezomib promotes the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	19100720
D000069286	Bortezomib	Bortezomib promotes the reaction [Tunicamycin results in increased activity of CASP3 protein]	16357177
D000069286	Bortezomib	Bortezomib promotes the reaction [Vorinostat results in increased activity of CASP3 protein]	15173093
D000069286	Bortezomib	Bortezomib results in increased activity of CASP3 protein	16357177; 18223318; 18342500; 18534018; 19100720; 20022965; 20150630; 20383943; 20524303; 23300809;
D000069286	Bortezomib	Bortezomib results in increased cleavage of and results in increased activity of CASP3 protein	16024631; 16778179; 17510429; 17898787; 22842577;
D000069286	Bortezomib	Bortezomib results in increased cleavage of CASP3 protein	12393500; 15509775; 16118318; 16617327; 17898295; 18223231; 18223318; 18790767; 20051518;
D000069286	Bortezomib	Bortezomib results in increased expression of CASP3 protein	17156654
D000069286	Bortezomib	[Bortezomib results in increased susceptibility to and results in increased activity of TNFSF10 protein] which results in increased cleavage of CASP3 protein	17326159
D000069286	Bortezomib	[CASP8 protein results in increased activity of CASP3 protein] affects the reaction [Bortezomib results in increased cleavage of ATM protein]	12393500
D000069286	Bortezomib	[CASP8 protein results in increased activity of CASP3 protein] affects the reaction [Bortezomib results in increased cleavage of MDM2 protein]	12393500
D000069286	Bortezomib	[CASP8 protein results in increased activity of CASP3 protein] affects the reaction [Bortezomib results in increased cleavage of PRKDC protein]	12393500
D000069286	Bortezomib	[CASP8 protein results in increased activity of CASP3 protein] affects the reaction [Bortezomib results in increased phosphorylation of TP53 protein]	12393500
D000069286	Bortezomib	[Cisplatin co-treated with Bortezomib] results in increased activity of CASP3 protein	16357177
D000069286	Bortezomib	[Dexamethasone co-treated with Bortezomib] results in increased activity of CASP3 protein	23063726
D000069286	Bortezomib	[gambogic acid co-treated with Bortezomib] results in increased activity of CASP3 protein	24291039
D000069286	Bortezomib	[lonafarnib co-treated with Bortezomib] results in increased cleavage of CASP3 protein	16118318
D000069286	Bortezomib	MAPK14 mutant form inhibits the reaction [Bortezomib results in increased cleavage of CASP3 protein]	18790767
D000069286	Bortezomib	[nutlin 3 co-treated with Bortezomib] results in increased activity of CASP3 protein	20850924
D000069286	Bortezomib	PMAIP1 protein promotes the reaction [[Bortezomib co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	21518486
D000069286	Bortezomib	pyrazolanthrone inhibits the reaction [Bortezomib results in increased activity of CASP3 protein]	16357177
D000069286	Bortezomib	pyrazolanthrone inhibits the reaction [Bortezomib results in increased cleavage of CASP3 protein]	12393500
D000069286	Bortezomib	SCIO-469 promotes the reaction [Bortezomib results in increased cleavage of CASP3 protein]	16617327
D000069286	Bortezomib	STK4 mutant form inhibits the reaction [Bortezomib results in increased activity of CASP3 protein]	16778179
D000069286	Bortezomib	TNFRSF10B mutant form inhibits the reaction [[Bortezomib co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein]	17510429
D000069286	Bortezomib	TNFRSF10B mutant form inhibits the reaction [Bortezomib results in increased cleavage of CASP3 protein]	17510429
D000069286	Bortezomib	[TNFSF10 protein co-treated with Bortezomib] results in increased activity of CASP3 protein	15930312
D000069286	Bortezomib	TNFSF10 protein promotes the reaction [Bortezomib results in increased activity of CASP3 protein]	19100720
D000069286	Bortezomib	[trichostatin A co-treated with Bortezomib] results in increased cleavage of CASP3 protein	21345073
D000069286	Bortezomib	[Vorinostat co-treated with Bortezomib] results in increased activity of CASP3 protein	15514602; 21472287;
D000069286	Bortezomib	[Vorinostat co-treated with Bortezomib] results in increased cleavage of CASP3 protein	17351739
D000069286	Bortezomib	ATG5 gene mutant form inhibits the reaction [Bortezomib results in increased cleavage of and results in increased activity of CASP3 protein]	22842577
D000069286	Bortezomib	ATG5 gene mutant form inhibits the reaction [HRAS protein promotes the reaction [Bortezomib results in increased cleavage of and results in increased activity of CASP3 protein]]	22842577
D000069286	Bortezomib	Bortezomib results in increased cleavage of and results in increased activity of CASP3 protein	22842577
D000069286	Bortezomib	Bortezomib results in increased cleavage of CASP3 protein	29384525
D000069286	Bortezomib	HRAS protein promotes the reaction [Bortezomib results in increased cleavage of and results in increased activity of CASP3 protein]	22842577
D000069286	Bortezomib	[SCIO-469 co-treated with Bortezomib] results in increased activity of CASP3 protein	16617327
C089020	brassinin	brassinin analog results in increased activity of CASP3 protein	24747292
C023623	brassinolide	brassinolide results in increased activity of CASP3 protein	17557751
C023623	brassinolide	brassinolide results in increased expression of CASP3 protein modified form	20833159
C044362	brazilin	Acetylcysteine promotes the reaction [brazilin results in increased activity of CASP3 protein]	28063998
C044362	brazilin	bafilomycin A1 promotes the reaction [brazilin results in increased activity of CASP3 protein]	28063998
C044362	brazilin	BECN1 inhibits the reaction [brazilin results in increased activity of CASP3 protein]	28063998
C044362	brazilin	brazilin results in increased activity of CASP3 protein	28063998
D020126	Brefeldin A	Brefeldin A results in increased activity of CASP3 protein	20150630
D020126	Brefeldin A	Apigenin inhibits the reaction [Brefeldin A results in increased activity of CASP3 protein]	20493918
D020126	Brefeldin A	Brefeldin A results in increased activity of CASP3 protein	20493918
C025191	bromodichloromethane	[bromodichloromethane co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form	24211274
C025191	bromodichloromethane	LEP protein affects the reaction [[bromodichloromethane co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form]	24211274
C025191	bromodichloromethane	[PRF1 protein co-treated with RAG2 protein] affects the reaction [[bromodichloromethane co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form]	24211274
C017092	bromopyruvate	bromopyruvate results in increased cleavage of CASP3 protein	24307199
C017092	bromopyruvate	bromopyruvate results in increased activity of CASP3 protein	28433571
C514835	bromotetrandrine	[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 mRNA	19421372
C514835	bromotetrandrine	[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 protein	19421372
C514835	bromotetrandrine	bromotetrandrine promotes the reaction [[ferric oxide co-treated with ferrous oxide co-treated with Daunorubicin] results in increased expression of CASP3 protein]	19421372
C514835	bromotetrandrine	bromotetrandrine promotes the reaction [[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 mRNA]	19421372
C514835	bromotetrandrine	[Daunorubicin co-treated with bromotetrandrine co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 mRNA	21720514
C514835	bromotetrandrine	[Daunorubicin co-treated with bromotetrandrine co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 protein	21720514
C514835	bromotetrandrine	[Daunorubicin co-treated with bromotetrandrine] results in increased expression of CASP3 mRNA	21720514
C514835	bromotetrandrine	[Daunorubicin co-treated with bromotetrandrine] results in increased expression of CASP3 protein	21720514
C514835	bromotetrandrine	[Magnetite Nanoparticles co-treated with Daunorubicin] promotes the reaction [bromotetrandrine results in increased expression of CASP3 protein]	19421372
C514835	bromotetrandrine	Magnetite Nanoparticles promotes the reaction [[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 mRNA]	19421372
C106525	broussochalcone A	broussochalcone A results in increased cleavage of CASP3 protein	31163223
C083806	brucine	brucine results in increased activity of CASP3 protein	17449162; 21684292;
C083806	brucine	[brucine results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein	16443926
C083806	brucine	brucine results in increased expression of and results in increased activity of CASP3 protein	16442763
C083806	brucine	Cyclosporine inhibits the reaction [[brucine results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein]	16443926
C083806	brucine	brucine results in increased expression of CASP3 protein	21684292
C020237	brusatol	brusatol promotes the reaction [T-2 Toxin results in increased activity of CASP3 protein]	29432840
C046785	bryostatin 1	bryostatin 1 inhibits the reaction [BCL2L1 protein inhibits the reaction [Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein]]	10516758
D003994	Bucladesine	Bucladesine inhibits the reaction [CASP3 protein results in increased cleavage of RB1 protein]	10697531
D003994	Bucladesine	Bucladesine promotes the reaction [Hydroxyurea results in increased activity of CASP3 protein]	10697531
D019819	Budesonide	Budesonide results in decreased expression of CASP3 mRNA	17163412
C022777	bufalin	bufalin results in increased expression of CASP3 mRNA	27444971
C022777	bufalin	bufalin results in increased expression of CASP3 protein modified form	27444971
C061022	bullatacin	bullatacin results in increased activity of CASP3 protein	29991444
C061022	bullatacin	ND1 gene mutant form promotes the reaction [bullatacin results in increased activity of CASP3 protein]	29991444
D002045	Bupivacaine	Bupivacaine results in decreased expression of CASP3 protein	20194319
D002045	Bupivacaine	Bupivacaine results in increased activity of CASP3 protein	16109997
D016642	Bupropion	Bupropion results in increased cleavage of and results in increased activity of CASP3 protein	21354251
D002064	Buserelin	Buserelin results in increased expression of CASP3 protein	15965100
D002065	Buspirone	Buspirone results in decreased expression of CASP3 mRNA	24136188
D002066	Busulfan	ARHGDIA mRNA affects the reaction [Busulfan results in increased activity of CASP3 protein]	17264767
D002066	Busulfan	Busulfan results in increased activity of CASP3 protein	17264767; 18339423;
D002066	Busulfan	[Clofarabine co-treated with fludarabine co-treated with Busulfan] results in increased cleavage of CASP3 protein	20933509
D002066	Busulfan	[Decitabine co-treated with Busulfan] results in increased activity of CASP3 protein	19732952
C048491	butaprost	butaprost results in increased activity of CASP3 protein	25715797
C040918	butein	butein results in increased activity of CASP3 protein	24931875
C042415	buthionine	buthionine analog promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12750841
D019328	Buthionine Sulfoximine	Buthionine Sulfoximine promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	10673743; 25003661;
D019328	Buthionine Sulfoximine	Buthionine Sulfoximine promotes the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
D019328	Buthionine Sulfoximine	[O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate co-treated with Buthionine Sulfoximine] results in increased cleavage of CASP3 protein	20962031
D019328	Buthionine Sulfoximine	Buthionine Sulfoximine results in increased activity of CASP3 protein	17200146
D019328	Buthionine Sulfoximine	Buthionine Sulfoximine results in increased expression of CASP3 mRNA	17989939
D019328	Buthionine Sulfoximine	Sodium Selenite promotes the reaction [Buthionine Sulfoximine results in increased expression of CASP3 mRNA]	17989939
D019328	Buthionine Sulfoximine	[Buthionine Sulfoximine co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D019328	Buthionine Sulfoximine	Buthionine Sulfoximine inhibits the reaction [Cacodylic Acid results in increased activity of CASP3 protein]	15276415
D019328	Buthionine Sulfoximine	Buthionine Sulfoximine promotes the reaction [Vitamin K 3 results in increased activity of CASP3 protein]	16310883
D019328	Buthionine Sulfoximine	[monomethylarsonic acid co-treated with Buthionine Sulfoximine] results in increased activity of CASP3 protein	15963344
D002078	Butoxamine	Butoxamine results in increased cleavage of CASP3 protein	19106745
D002083	Butylated Hydroxyanisole	[Butylated Hydroxyanisole co-treated with Butylated Hydroxytoluene] results in decreased activity of CASP3 protein	14981915
D002083	Butylated Hydroxyanisole	Butylated Hydroxyanisole inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
D002083	Butylated Hydroxyanisole	Butylated Hydroxyanisole inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16407847
D002083	Butylated Hydroxyanisole	Butylated Hydroxyanisole results in decreased activity of CASP3 protein	14981915
D002083	Butylated Hydroxyanisole	Butylated Hydroxyanisole inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased activity of CASP3 protein]	15950244
D002084	Butylated Hydroxytoluene	[Butylated Hydroxyanisole co-treated with Butylated Hydroxytoluene] results in decreased activity of CASP3 protein	14981915
D002084	Butylated Hydroxytoluene	Butylated Hydroxytoluene results in decreased activity of CASP3 protein	14981915
D002084	Butylated Hydroxytoluene	[Butylated Hydroxytoluene co-treated with Oxygen] results in increased cleavage of CASP3 protein	16272459
D002084	Butylated Hydroxytoluene	zAsp(Ome)-Arg-His-Asp(Ome)-fluoromethyl ketone inhibits the reaction [[Butylated Hydroxytoluene co-treated with Oxygen] results in increased cleavage of CASP3 protein]	16272459
D002084	Butylated Hydroxytoluene	Butylated Hydroxytoluene inhibits the reaction [ganglioside, GD3 results in increased cleavage of and results in increased activity of CASP3 protein]	10783138
D002084	Butylated Hydroxytoluene	Butylated Hydroxytoluene inhibits the reaction [Lithium Carbonate results in increased activity of CASP3 protein]	27588890
C027561	butylbenzyl phthalate	butylbenzyl phthalate results in increased expression of CASP3 protein alternative form	23220035
C027561	butylbenzyl phthalate	butylbenzyl phthalate results in increased expression of and results in increased activity of CASP3 protein	29029336
C027561	butylbenzyl phthalate	[Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with 4-nonylphenol co-treated with 4-tert-octylphenol] results in increased expression of and results in increased activity of CASP3 protein	29029336
C026105	butylidenephthalide	butylidenephthalide results in increased cleavage of CASP3 protein	16987298
D002087	Butyrates	[Bortezomib co-treated with Butyrates] results in increased cleavage of and results in increased activity of CASP3 protein	12893773
D002087	Butyrates	Bortezomib promotes the reaction [Butyrates results in increased activity of CASP3 protein]	15173093
D002087	Butyrates	Butyrates results in increased activity of CASP3 protein	15173093; 15177505; 20346929;
D002087	Butyrates	[Docosahexaenoic Acids co-treated with Butyrates] results in increased activity of CASP3 protein	19116882
D002087	Butyrates	[Eicosapentaenoic Acid co-treated with Butyrates] results in increased activity of CASP3 protein	19116882
D002087	Butyrates	[perifosine co-treated with Butyrates] results in increased activity of CASP3 protein	15781658
D002087	Butyrates	[Butyrates co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased activity of CASP3 protein	16256798
D020148	Butyric Acid	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D020148	Butyric Acid	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D020148	Butyric Acid	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D020148	Butyric Acid	Butyric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D020148	Butyric Acid	Butyric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D020148	Butyric Acid	Butyric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
C547107	C60-bis(N,N-dimethylpyrrolidinium)	C60-bis(N,N-dimethylpyrrolidinium) results in increased activity of CASP3 protein	19905986
C584509	C646 compound	C646 compound results in increased cleavage of CASP3 protein	26921506; 27381264;
C584509	C646 compound	catalase-polyethylene glycol inhibits the reaction [C646 compound results in increased cleavage of CASP3 protein]	27381264
C400541	CA 074 methyl ester	CA 074 methyl ester affects the reaction [28-O-acetylbetulin-3-ylglucopyranoside results in increased activity of CASP3 protein]	22343715
C400541	CA 074 methyl ester	CA 074 methyl ester inhibits the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [betulinic acid analog results in increased cleavage of CASP3 protein]]	23000516
C400541	CA 074 methyl ester	CA 074 methyl ester inhibits the reaction [Fluorouracil results in increased cleavage of CASP3 protein]	19816940
C400541	CA 074 methyl ester	CA 074 methyl ester inhibits the reaction [Trifluridine results in increased cleavage of CASP3 protein]	19816940
C400541	CA 074 methyl ester	CA 074 methyl ester inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	28378122
C497192	cacalol	cacalol results in increased activity of CASP3 protein	20665104
D002101	Cacodylic Acid	Cacodylic Acid analog results in increased activity of CASP3 protein	23994116
D002101	Cacodylic Acid	Cacodylic Acid results in increased activity of CASP3 protein	19465042
D002101	Cacodylic Acid	[sodium arsenite co-treated with monomethylarsonic acid co-treated with Cacodylic Acid] affects the expression of CASP3 mRNA	23192986
D002101	Cacodylic Acid	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [CASP3 protein results in increased susceptibility to Cacodylic Acid]	15276415
D002101	Cacodylic Acid	Buthionine Sulfoximine inhibits the reaction [Cacodylic Acid results in increased activity of CASP3 protein]	15276415
D002101	Cacodylic Acid	Cacodylic Acid results in increased activity of CASP3 protein	15276415
D002101	Cacodylic Acid	Cacodylic Acid results in increased expression of CASP3 mRNA	16122865
D002101	Cacodylic Acid	CASP3 protein results in increased susceptibility to Cacodylic Acid	15276415
D002104	Cadmium	Acetylcysteine inhibits the reaction [[cadmium sulfate results in increased abundance of Cadmium] which results in increased expression of CASP3 mRNA]	31419506
D002104	Cadmium	[cadmium sulfate results in increased abundance of Cadmium] which results in increased expression of CASP3 mRNA	31419506
D002104	Cadmium	Cadmium results in decreased expression of CASP3 mRNA	22768170
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	22768170
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	23954723
D002104	Cadmium	Cadmium results in increased expression of CASP3	25805271
D002104	Cadmium	Nitric Oxide inhibits the reaction [Cadmium results in increased expression of CASP3 mRNA]	25490952
D002104	Cadmium	Selenium inhibits the reaction [Cadmium results in increased expression of CASP3]	25805271
D002104	Cadmium	spermine nitric oxide complex inhibits the reaction [Cadmium results in increased expression of CASP3 mRNA]	25490952
D002104	Cadmium	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium results in increased cleavage of and results in increased activity of CASP3 protein]	19442655
D002104	Cadmium	Amitrole inhibits the reaction [Cadmium results in increased degradation of CASP3 protein]	12538343
D002104	Cadmium	Cadmium results in increased activity of and results in increased cleavage of CASP3 protein	24824807
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	21787653
D002104	Cadmium	Cadmium results in increased cleavage of and results in increased activity of CASP3 protein	19442655; 30985881;
D002104	Cadmium	Cadmium results in increased degradation of CASP3 protein	12538343
D002104	Cadmium	CAT promotes the reaction [Cadmium results in increased degradation of CASP3 protein]	12538343
D002104	Cadmium	Chloroquine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	30985881
D002104	Cadmium	GSTP1 protein inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	21787653
D002104	Cadmium	MT2A protein inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29982767
D002104	Cadmium	SB 203580 promotes the reaction [Cadmium results in increased activity of and results in increased cleavage of CASP3 protein]	24824807
D002104	Cadmium	U 0126 inhibits the reaction [Cadmium results in increased activity of and results in increased cleavage of CASP3 protein]	24824807
D002104	Cadmium	VMP1 affects the reaction [Cadmium results in increased cleavage of and results in increased activity of CASP3 protein]	30985881
D002104	Cadmium	1,3-dimethylthiourea inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	22692000
D002104	Cadmium	Acetylcysteine inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	22692000
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	22692000
D002104	Cadmium	[1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid co-treated with Egtazic Acid] inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	Acetylcysteine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	acetylleucyl-leucyl-norleucinal inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	ATG5 protein affects the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	bafilomycin A1 inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16728380
D002104	Cadmium	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16728380
D002104	Cadmium	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16728380
D002104	Cadmium	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	15254339; 16728380; 16780805; 22634143; 23548128;
D002104	Cadmium	Cadmium results in increased cleavage of CASP3 protein	29111403; 29982767;
D002104	Cadmium	Cadmium results in increased expression of CASP3 mRNA	15010501
D002104	Cadmium	calpeptin inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	Chloroquine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	Egtazic Acid inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	O(2)-vinyl-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate inhibits the reaction [Cadmium results in increased expression of CASP3 mRNA]	15010501
D002104	Cadmium	piperine inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16780805
D002104	Cadmium	pyrazolanthrone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	15254339
D002104	Cadmium	rosmarinic acid inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	23548128
D002104	Cadmium	Sirolimus promotes the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002104	Cadmium	Cadmium inhibits the reaction [Camptothecin results in increased cleavage of CASP3 protein]	16263807
D002104	Cadmium	Cadmium inhibits the reaction [TNF protein results in increased cleavage of CASP3 protein]	16263807
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	16478757; 16809017; 18463101; 24144892; 25388156;
D002104	Cadmium	Cadmium results in increased cleavage of and results in increased activity of CASP3 protein	25643798
D002104	Cadmium	Cadmium results in increased cleavage of CASP3 protein	16809017; 23741317; 27658547;
D002104	Cadmium	Cadmium results in increased expression of CASP3 protein	20455018
D002104	Cadmium	Lithium inhibits the reaction [Cadmium results in increased expression of CASP3 protein]	20455018
D002104	Cadmium	W 7 inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	24144892
D002104	Cadmium	Acetylcysteine inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	19135140
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	19135140
D002104	Cadmium	Cadmium results in increased cleavage of CASP3 protein	16785314
D002104	Cadmium	oxalomalic acid promotes the reaction [Cadmium results in increased cleavage of CASP3 protein]	16785314
D002104	Cadmium	Selenium inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	19135140
D002104	Cadmium	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	21544200
D002104	Cadmium	Cadmium results in increased activity of CASP3 protein	26146868
D002104	Cadmium	Egtazic Acid inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	21544200
D002104	Cadmium	Resveratrol inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	26146868
D002104	Cadmium	Trifluoperazine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	21544200
C028031	cadmium acetate	cadmium acetate results in increased activity of CASP3 protein	15862569
C028031	cadmium acetate	cadmium acetate results in increased expression of CASP3 mRNA	15862569
C028031	cadmium acetate	Acetylcysteine inhibits the reaction [cadmium acetate results in increased activity of CASP3 protein]	16169029
C028031	cadmium acetate	cadmium acetate results in increased activity of CASP3 protein	15450950; 16169029;
C028031	cadmium acetate	isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone analog inhibits the reaction [cadmium acetate results in increased activity of CASP3 protein]	15450950; 16169029;
C028031	cadmium acetate	2-aminoethoxydiphenylborane inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	29883672
C028031	cadmium acetate	cadmium acetate results in increased activity of CASP3 protein	27717697
C028031	cadmium acetate	cadmium acetate results in increased cleavage of CASP3 protein	24577723; 25043952; 29883672;
C028031	cadmium acetate	cadmium acetate results in increased expression of CASP3 protein modified form	30605698
C028031	cadmium acetate	Caspase Inhibitors inhibits the reaction [cadmium acetate results in increased expression of CASP3 protein modified form]	30605698
C028031	cadmium acetate	KN 93 inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	29883672
C028031	cadmium acetate	puerarin inhibits the reaction [cadmium acetate results in increased activity of CASP3 protein]	27717697
C028031	cadmium acetate	pyrazolanthrone inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	24577723; 25043952;
C028031	cadmium acetate	Thioctic Acid inhibits the reaction [cadmium acetate results in increased expression of CASP3 protein modified form]	30605698
C028031	cadmium acetate	U 0126 inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	24577723; 25043952;
D019256	Cadmium Chloride	Cadmium Chloride affects the localization of CASP3 protein	21262342
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	21262342
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 mRNA	25035189
D019256	Cadmium Chloride	Quercetin inhibits the reaction [Cadmium Chloride affects the localization of CASP3 protein]	21262342
D019256	Cadmium Chloride	Quercetin inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	21262342
D019256	Cadmium Chloride	Selenium inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 mRNA]	25035189
D019256	Cadmium Chloride	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21544200
D019256	Cadmium Chloride	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	18703135
D019256	Cadmium Chloride	Cadmium Chloride results in decreased activity of CASP3 protein	23376331
D019256	Cadmium Chloride	Cadmium Chloride results in decreased expression of CASP3 mRNA	12160620
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	16264267; 17943274; 21697648; 21745561; 21787858; 22659318; 23485651; 25111876;
D019256	Cadmium Chloride	Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein	18703135; 21544200;
D019256	Cadmium Chloride	Cadmium Chloride results in increased cleavage of CASP3 protein	21809093; 24419708; 28422390;
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein	28342888
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein modified form	24291162
D019256	Cadmium Chloride	Egtazic Acid inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21544200
D019256	Cadmium Chloride	HRAS protein mutant form affects the reaction [Cadmium Chloride results in decreased activity of CASP3 protein]	23376331
D019256	Cadmium Chloride	naringin inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	28422390
D019256	Cadmium Chloride	salubrinal inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	21809093
D019256	Cadmium Chloride	TGFB1 protein inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	28342888
D019256	Cadmium Chloride	Trifluoperazine inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21544200
D019256	Cadmium Chloride	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	18850067
D019256	Cadmium Chloride	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	24299490
D019256	Cadmium Chloride	ACHE mutant form inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	26026611
D019256	Cadmium Chloride	APP mutant form inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	26026611
D019256	Cadmium Chloride	arjunolic acid inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	21420465
D019256	Cadmium Chloride	ATG16L1 protein affects the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	29218509
D019256	Cadmium Chloride	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16728380
D019256	Cadmium Chloride	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16728380
D019256	Cadmium Chloride	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16728380
D019256	Cadmium Chloride	Cadmium Chloride affects the cleavage of CASP3 protein	18506790
D019256	Cadmium Chloride	[Cadmium Chloride co-treated with Potassium Dichromate] results in increased activity of CASP3 protein	25409916
D019256	Cadmium Chloride	[Cadmium Chloride co-treated with Potassium Dichromate] results in increased expression of CASP3 mRNA	25409916
D019256	Cadmium Chloride	Cadmium Chloride results in decreased expression of CASP3 mRNA	15501611
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	16728380; 17706638; 18850067; 19748544; 24299490; 25111876; 25409916; 26026611; 30030080;
D019256	Cadmium Chloride	Cadmium Chloride results in increased cleavage of CASP3 protein	21420465; 28163110; 29218509;
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 mRNA	25409916
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein	21337715; 21620867; 28342888;
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein modified form	21252392; 29486218;
D019256	Cadmium Chloride	Carnosine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	19748544
D019256	Cadmium Chloride	Cholesterol inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein modified form]	29486218
D019256	Cadmium Chloride	GSK3B mutant form inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	26026611
D019256	Cadmium Chloride	[HTT gene mutant form results in increased susceptibility to Cadmium Chloride] which results in increased activity of CASP3 protein	30399392
D019256	Cadmium Chloride	MDL 201053 inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	30030080
D019256	Cadmium Chloride	[MT1 gene mutant form results in increased susceptibility to Cadmium Chloride] which results in increased expression of CASP3 protein	23880315
D019256	Cadmium Chloride	[MT2 gene mutant form results in increased susceptibility to Cadmium Chloride] which results in increased expression of CASP3 protein	23880315
D019256	Cadmium Chloride	piperidine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	17706638
D019256	Cadmium Chloride	Quercetin inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	21337715
D019256	Cadmium Chloride	Sirolimus inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	24299490; 30030080;
D019256	Cadmium Chloride	Sirolimus inhibits the reaction [TGFB1 protein inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]]	28342888
D019256	Cadmium Chloride	Telmisartan inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	21620867
D019256	Cadmium Chloride	TFE3 protein inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	30030080
D019256	Cadmium Chloride	TRP53 protein affects the reaction [Cadmium Chloride results in increased expression of CASP3 protein modified form]	21252392
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	16339863
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	20435356
D019256	Cadmium Chloride	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
D019256	Cadmium Chloride	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
D019256	Cadmium Chloride	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
D019256	Cadmium Chloride	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	19523979
D019256	Cadmium Chloride	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	23405080
D019256	Cadmium Chloride	[ATG16L1 protein affects the susceptibility to Cadmium Chloride] which results in increased cleavage of CASP3 protein	29218509
D019256	Cadmium Chloride	Betaine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	24632105
D019256	Cadmium Chloride	Cadmium Chloride affects the localization of CASP3 protein modified form	22457795
D019256	Cadmium Chloride	[Cadmium Chloride co-treated with lead acetate] results in increased expression of CASP3 protein	25031709
D019256	Cadmium Chloride	Cadmium Chloride inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D019256	Cadmium Chloride	Cadmium Chloride inhibits the reaction [Camptothecin results in increased cleavage of CASP3 protein]	16263807
D019256	Cadmium Chloride	Cadmium Chloride inhibits the reaction [TNF protein results in increased cleavage of CASP3 protein]	16263807
D019256	Cadmium Chloride	Cadmium Chloride results in decreased cleavage of CASP3 protein	22457795
D019256	Cadmium Chloride	Cadmium Chloride results in decreased expression of CASP3 protein	22457795
D019256	Cadmium Chloride	Cadmium Chloride results in decreased methylation of CASP3 promoter	22457795
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	16478757; 16597613; 16809017; 18629305; 19150641; 19523979; 21664405; 24632105;
D019256	Cadmium Chloride	Cadmium Chloride results in increased cleavage of CASP3 protein	16809017; 19233221; 23405080; 24111524; 28747609;
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of and results in increased cleavage of CASP3 protein	28457857
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 mRNA	19815060; 22209727;
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein	21819444; 26462792; 27389774;
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein modified form	31348969
D019256	Cadmium Chloride	DDIT3 protein promotes the reaction [Cadmium Chloride results in increased expression of CASP3 protein modified form]	31348969
D019256	Cadmium Chloride	Decitabine inhibits the reaction [Cadmium Chloride results in decreased cleavage of CASP3 protein]	22457795
D019256	Cadmium Chloride	[Grape Seed Proanthocyanidins co-treated with Cadmium Chloride] affects the expression of CASP3 protein	25719599
D019256	Cadmium Chloride	Grape Seed Proanthocyanidins inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	26462792
D019256	Cadmium Chloride	Hemin inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	19150641
D019256	Cadmium Chloride	JUN mutant form inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	24111524
D019256	Cadmium Chloride	JUN mutant form promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
D019256	Cadmium Chloride	KN 93 promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
D019256	Cadmium Chloride	PD 150606 inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16597613
D019256	Cadmium Chloride	PTEN protein promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
D019256	Cadmium Chloride	pyrazolanthrone inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	18703135
D019256	Cadmium Chloride	pyrazolanthrone inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	23405080; 24111524;
D019256	Cadmium Chloride	pyrazolanthrone promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
D019256	Cadmium Chloride	Quercetin inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	27389774
D019256	Cadmium Chloride	RTKI cpd promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
D019256	Cadmium Chloride	SENP3 protein affects the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	28747609
D019256	Cadmium Chloride	[sodium arsenite co-treated with lead acetate co-treated with Cadmium Chloride] results in increased expression of CASP3 protein modified form	23680456
D019256	Cadmium Chloride	Telmisartan inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	21819444
D019256	Cadmium Chloride	tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	24111524
D019256	Cadmium Chloride	U 0126 inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	18703135
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 mRNA	27041665
D019256	Cadmium Chloride	Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	17383151
D019256	Cadmium Chloride	[Cadmium Chloride co-treated with MIR125A mRNA mutant form] results in increased expression of CASP3 protein	26607349
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	17383151
D019256	Cadmium Chloride	Cadmium Chloride results in increased cleavage of CASP3 protein	16785314
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of CASP3 protein	26607349
D019256	Cadmium Chloride	MIR125A mRNA inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	26607349
D019256	Cadmium Chloride	oxalomalic acid promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	16785314
D019256	Cadmium Chloride	Selenium inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	17383151
D019256	Cadmium Chloride	Sodium Selenite inhibits the reaction [[Cadmium Chloride co-treated with MIR125A mRNA mutant form] results in increased expression of CASP3 protein]	26607349
D019256	Cadmium Chloride	Sodium Selenite inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	26607349
D019256	Cadmium Chloride	Cadmium Chloride results in increased activity of CASP3 protein	19475715
D019187	Cadmium Compounds	Cadmium Compounds results in increased activity of CASP3 protein	25684395
C058667	cadmium selenide	cadmium selenide results in decreased activity of CASP3 protein	18632727
C037123	cadmium sulfate	Acetylcysteine inhibits the reaction [[cadmium sulfate results in increased abundance of Cadmium] which results in increased expression of CASP3 mRNA]	31419506
C037123	cadmium sulfate	[cadmium sulfate results in increased abundance of Cadmium] which results in increased expression of CASP3 mRNA	31419506
C037123	cadmium sulfate	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [cadmium sulfate results in increased activity of CASP3 protein]	14687664
C037123	cadmium sulfate	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [cadmium sulfate results in increased activity of CASP3 protein]	14687664
C037123	cadmium sulfate	cadmium sulfate results in increased activity of CASP3 protein	14687664
C037123	cadmium sulfate	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [cadmium sulfate results in increased activity of CASP3 protein]	14687664
C028337	cadmium telluride	cadmium telluride analog results in increased cleavage of and results in increased activity of CASP3 protein	23485651
C028337	cadmium telluride	cadmium telluride results in increased cleavage of and results in increased activity of CASP3 protein	21291946
C053400	cafestol	cafestol results in increased activity of CASP3 protein	21334318
C040048	caffeic acid	[caffeic acid results in decreased activity of ALOX15 protein] inhibits the reaction [Vorinostat results in increased activity of CASP3 protein]	15574791
C040048	caffeic acid	caffeic acid inhibits the reaction [Valproic Acid results in increased expression of CASP3 protein]	29968957
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	18436364
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	28363435
C055494	caffeic acid phenethyl ester	caffeic acid phenethyl ester results in decreased activity of CASP3 protein	15469948
D002110	Caffeine	Caffeine affects the cleavage of CASP3 protein	19242509
D002110	Caffeine	[Caffeine co-treated with Alprazolam] results in increased cleavage of CASP3 protein	19490937
D002110	Caffeine	Caffeine inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	18201823
D002110	Caffeine	Caffeine inhibits the reaction [Silybin results in increased cleavage of and results in increased activity of CASP3 protein]	16777994
D002110	Caffeine	Caffeine results in increased activity of CASP3 protein	12378022; 21229324;
D002110	Caffeine	Caffeine results in increased cleavage of and results in increased expression of CASP3 protein	16522534
D002110	Caffeine	Caffeine results in increased cleavage of CASP3 protein	12907610
D002110	Caffeine	[Caffeine co-treated with Ephedrine] results in increased cleavage of CASP3 protein	15537744
D002110	Caffeine	Caffeine results in decreased expression of CASP3 protein modified form	18283038
D002110	Caffeine	Caffeine results in increased activity of CASP3 protein	12395097
D002110	Caffeine	Caffeine results in increased cleavage of CASP3 protein	21081844
D002110	Caffeine	Caffeine results in increased expression of CASP3 mRNA	19815060
C472707	caffeoylquinic acid	caffeoylquinic acid analog inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19647727
C080866	cagA protein, Helicobacter pylori	cagA protein, Helicobacter pylori results in decreased cleavage of CASP3 protein	26427350
C080866	cagA protein, Helicobacter pylori	ginsenoside Rg3 inhibits the reaction [cagA protein, Helicobacter pylori results in decreased cleavage of CASP3 protein]	26427350
C471767	cajanol	[[[cajanol results in decreased expression of BCL2 protein] co-treated with [cajanol results in increased expression of BAX protein]] affects the localization of CYCS protein] which results in increased activity of CASP3 protein	20638373
C471767	cajanol	cajanol results in increased activity of CASP3 protein	20638373
D000001	Calcimycin	Calcimycin inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	19837105; 20020783;
D000001	Calcimycin	Calcimycin results in increased activity of CASP3 protein	16000378
D000001	Calcimycin	CRYAB protein inhibits the reaction [Calcimycin results in increased activity of CASP3 protein]	16000378
D000001	Calcimycin	U 0126 inhibits the reaction [Calcimycin results in increased activity of CASP3 protein]	16000378
D000001	Calcimycin	Calcimycin results in increased expression of CASP3 protein	16787641
D002117	Calcitriol	[Calcitriol co-treated with gemcitabine] results in increased expression of CASP3 protein	20699664
D002117	Calcitriol	Calcitriol results in increased activity of CASP3 protein	21933904
D002117	Calcitriol	Calcitriol inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	22892342
D002117	Calcitriol	Calcitriol results in decreased expression of CASP3 protein	17570329
D002118	Calcium	Calcium deficiency inhibits the reaction [Dasatinib results in increased activity of CASP3 protein]	29803841
D002118	Calcium	Calcium deficiency inhibits the reaction [Ionomycin results in increased activity of CASP3 protein]	29803841
D002118	Calcium	Calcium affects the reaction [Sodium Fluoride results in increased expression of CASP3 protein]	29642045
D002118	Calcium	Calcium affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
D002118	Calcium	[Calcium co-treated with Zinc] affects the reaction [monoisoamyl-2,3-dimercaptosuccinate affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	24184500
D002118	Calcium	[Calcium co-treated with Zinc] affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
D002119	Calcium Carbonate	Calcium Carbonate analog results in increased activity of CASP3 protein	24412303
C028042	calcium magnesium carbonate	calcium magnesium carbonate results in increased activity of CASP3 protein	25663373
C028042	calcium magnesium carbonate	calcium magnesium carbonate results in increased expression of CASP3 mRNA	25663373
D002129	Calcium Oxalate	Calcium Oxalate results in increased activity of CASP3 protein	25446497
D002129	Calcium Oxalate	Diosgenin inhibits the reaction [Calcium Oxalate results in increased activity of CASP3 protein]	25446497
C031938	calmidazolium	calmidazolium results in increased activity of CASP3 protein	27247146
C071482	calpeptin	calpeptin inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
C071482	calpeptin	calpeptin inhibits the reaction [[lactacystin results in increased activity of CASP3 protein] which results in increased cleavage of SPTAN1 protein]	21683092
C071482	calpeptin	calpeptin inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
C533734	calycopterin	calycopterin results in decreased susceptibility to [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	22081883
C533734	calycopterin	calycopterin results in decreased susceptibility to [Hydrogen Peroxide results in increased expression of CASP3 modified form]	22081883
C019286	camphene	[camphene co-treated with geraniol] inhibits the reaction [nimesulide results in increased cleavage of CASP3 protein]	22509279
D002166	Camptothecin	15-deoxyprostaglandin J2 promotes the reaction [Camptothecin results in increased activity of CASP3 protein]	21683069
D002166	Camptothecin	3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole promotes the reaction [Camptothecin results in increased activity of CASP3 protein]	19481069
D002166	Camptothecin	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	24726431
D002166	Camptothecin	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide promotes the reaction [Camptothecin results in increased activity of CASP3 protein]	24726431
D002166	Camptothecin	[Camptothecin co-treated with FAS protein] results in increased activity of CASP3 protein	15958570
D002166	Camptothecin	[Camptothecin co-treated with FAS protein] results in increased cleavage of CASP3 protein	19633536
D002166	Camptothecin	Camptothecin promotes the reaction [15-deoxyprostaglandin J2 results in increased activity of CASP3 protein]	21683069
D002166	Camptothecin	Camptothecin results in increased activity of CASP3 protein	15862279; 16273314; 16962673; 19481069; 21683069; 22302033; 24726431; 24792648; 25592883;
D002166	Camptothecin	Camptothecin results in increased cleavage of CASP3 protein	10896673; 16756956; 30720231;
D002166	Camptothecin	Diethylhexyl Phthalate inhibits the reaction [Camptothecin results in increased cleavage of CASP3 protein]	30720231
D002166	Camptothecin	palbociclib inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	22302033
D002166	Camptothecin	SMN1 mRNA affects the reaction [Camptothecin results in increased activity of CASP3 protein]	15862279
D002166	Camptothecin	THBS1 protein inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	16962673
D002166	Camptothecin	Camptothecin results in increased cleavage of CASP3 protein	18506790; 29384525;
D002166	Camptothecin	Cadmium Chloride inhibits the reaction [Camptothecin results in increased cleavage of CASP3 protein]	16263807
D002166	Camptothecin	Cadmium inhibits the reaction [Camptothecin results in increased cleavage of CASP3 protein]	16263807
D002166	Camptothecin	Camptothecin results in increased activity of CASP3 protein	19339209
D002166	Camptothecin	Camptothecin results in increased cleavage of CASP3 protein	16263807; 25843524;
D002166	Camptothecin	Dexamethasone inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	19339209
D002166	Camptothecin	Naphthoquinones analog inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	19497415
D002166	Camptothecin	Tetrachlorodibenzodioxin promotes the reaction [Camptothecin results in increased cleavage of CASP3 protein]	25843524
C081643	candesartan	[candesartan co-treated with epigallocatechin gallate] inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
C081643	candesartan	candesartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
C081643	candesartan	candesartan inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
D063387	Cannabinoid Receptor Antagonists	[Cannabinoid Receptor Antagonists results in decreased activity of CNR2 protein] inhibits the reaction [XLR-11 results in increased activity of CASP3 protein]	29410032
D063387	Cannabinoid Receptor Antagonists	[Cannabinoid Receptor Antagonists results in decreased activity of CNR2 protein] which results in increased activity of CASP3 protein	29410032
D002186	Cannabinoids	Cannabinoids results in increased activity of CASP3 protein	24211273
C000626960	cantharidic acid	cantharidic acid results in increased cleavage of CASP3 protein	29159945; 29345422;
C000626960	cantharidic acid	SB 203580 inhibits the reaction [cantharidic acid results in increased cleavage of CASP3 protein]	29159945
D002193	Cantharidin	Cantharidin results in increased cleavage of and results in increased activity of CASP3 protein	27113412
D002211	Capsaicin	Capsaicin affects the activity of CASP3 protein	25603234
D002211	Capsaicin	Capsaicin promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	19846903
D002211	Capsaicin	Capsaicin promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	19939880
D002211	Capsaicin	Capsaicin promotes the reaction [TNFSF10 results in increased activity of CASP3 protein]	22200406
D002211	Capsaicin	Capsaicin promotes the reaction [TRPV1 protein results in increased activity of CASP3 protein]	17442041
D002211	Capsaicin	Capsaicin results in increased activity of CASP3 protein	11275362; 17505005; 18405923; 19139269; 19331147; 19381455; 19502594; 19846903; 19855437; 20925121; 21859781;
D002211	Capsaicin	Capsaicin results in increased cleavage of and results in increased activity of CASP3 protein	17442041
D002211	Capsaicin	Capsaicin results in increased cleavage of CASP3 protein	19002586; 21647434; 21745629;
D002211	Capsaicin	Capsaicin results in increased expression of CASP3 protein	18991268
D002211	Capsaicin	capsazepine inhibits the reaction [Capsaicin results in increased cleavage of and results in increased activity of CASP3 protein]	17442041
D002211	Capsaicin	CAT protein inhibits the reaction [Capsaicin results in increased cleavage of CASP3 protein]	21647434
D002211	Capsaicin	EUK-134 inhibits the reaction [Capsaicin results in increased cleavage of CASP3 protein]	21647434
D002211	Capsaicin	[ND1 gene mutant form results in increased susceptibility to Capsaicin] which results in increased activity of CASP3 protein	29991444
D002211	Capsaicin	Resveratrol promotes the reaction [Capsaicin results in increased activity of CASP3 protein]	19846903
D002211	Capsaicin	CALCA protein promotes the reaction [Capsaicin results in decreased expression of CASP3 protein]	17360009
D002211	Capsaicin	Capsaicin results in decreased expression of CASP3 protein	17360009
D002211	Capsaicin	Capsaicin results in increased activity of CASP3 protein	17295509; 17306913;
D002211	Capsaicin	Capsaicin affects the expression of CASP3 protein	16477149
D002211	Capsaicin	Capsaicin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased activity of CASP3 protein]	19011674
D002211	Capsaicin	Capsaicin results in increased cleavage of CASP3 protein	18456414
D002211	Capsaicin	Capsaicin results in increased expression of CASP3 protein	16125681
C071423	capsazepine	capsazepine inhibits the reaction [Capsaicin results in increased cleavage of and results in increased activity of CASP3 protein]	17442041
C071423	capsazepine	capsazepine inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	24376112
C104525	caraway oil	caraway oil inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	25859307
D002217	Carbachol	Carbachol inhibits the reaction [domoic acid results in increased activity of CASP3 protein]	19200344
D002217	Carbachol	Carbachol results in decreased expression of CASP3 protein	17708838
D002217	Carbachol	Carbachol results in decreased cleavage of CASP3 protein	16439036
D002219	Carbamates	Carbamates results in increased activity of CASP3 protein	19455394
D002220	Carbamazepine	Carbamazepine affects the expression of CASP3 mRNA	25979313
D002220	Carbamazepine	Carbamazepine results in increased expression of CASP3 mRNA	19815060
D012721	Carbaryl	Carbaryl results in increased expression of CASP3	27296064
C006698	carbendazim	carbendazim results in decreased expression of CASP3 mRNA	26055223
D002235	Carbofuran	Carbofuran results in increased cleavage of and results in increased activity of CASP3 protein	25564422
D002235	Carbofuran	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide inhibits the reaction [Carbofuran results in increased expression of CASP3 protein modified form]	28982980
D002235	Carbofuran	Carbofuran results in decreased expression of CASP3 protein modified form	22240977
D002235	Carbofuran	Carbofuran results in increased expression of CASP3 protein modified form	28982980; 30471306;
D002246	Carbon Disulfide	Carbon Disulfide results in increased expression of CASP3 mRNA	24080331
D002246	Carbon Disulfide	Carbon Disulfide results in increased expression of CASP3 protein	24080331
D002248	Carbon Monoxide	Carbon Monoxide inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17173083
D002248	Carbon Monoxide	Carbon Monoxide results in increased activity of CASP3 protein	25562542
D002248	Carbon Monoxide	Carbon Monoxide results in increased cleavage of and results in increased activity of CASP3 protein	19520142
D002248	Carbon Monoxide	[Carbon Monoxide results in increased expression of ADIPOQ protein] inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	19356108
D002248	Carbon Monoxide	Hemin inhibits the reaction [Carbon Monoxide results in increased cleavage of and results in increased activity of CASP3 protein]	19520142
D002248	Carbon Monoxide	tin protoporphyrin IX inhibits the reaction [Hemin inhibits the reaction [Carbon Monoxide results in increased cleavage of and results in increased activity of CASP3 protein]]	19520142
D002251	Carbon Tetrachloride	1-trifluoromethoxyphenyl-3-(1-propionylpiperidine-4-yl)urea inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	25827057
D002251	Carbon Tetrachloride	2,3,5-trimethyl-6-(12-hydroxy-5,10-dodecadiynyl)-1,4-benzoquinone inhibits the reaction [PTGS1 gene mutant form promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]]	25432964
D002251	Carbon Tetrachloride	caffeic acid phenethyl ester inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	18436364
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased activity of CASP3 protein	14578185; 18270870; 18291569; 18436364; 25445725; 25827057;
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased cleavage of CASP3 protein	25432964; 29522708;
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased expression of CASP3 protein	23279844; 24530446;
D002251	Carbon Tetrachloride	CDKN1A protein affects the reaction [Carbon Tetrachloride affects the activity of CASP3 protein]	12759355
D002251	Carbon Tetrachloride	Changkil inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	18291569
D002251	Carbon Tetrachloride	Dinoprostone inhibits the reaction [PTGS1 gene mutant form promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]]	25432964
D002251	Carbon Tetrachloride	Flavonoids inhibits the reaction [Carbon Tetrachloride results in increased expression of CASP3 protein]	23279844
D002251	Carbon Tetrachloride	Lipids inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	25445725
D002251	Carbon Tetrachloride	neohesperidin dihydrochalcone inhibits the reaction [Carbon Tetrachloride results in increased expression of CASP3 protein]	24530446
D002251	Carbon Tetrachloride	Plant Extracts inhibits the reaction [Carbon Tetrachloride results in increased expression of CASP3 protein]	23279844
D002251	Carbon Tetrachloride	PTGS1 gene mutant form promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]	25432964
D002251	Carbon Tetrachloride	Rutin inhibits the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]	29522708
D002251	Carbon Tetrachloride	SC 560 promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]	25432964
D002251	Carbon Tetrachloride	Carbon Monoxide inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17173083
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased activity of CASP3 protein	12388182; 16038630; 17069927; 17173083; 17244260; 17761835; 25899501;
D002251	Carbon Tetrachloride	crocin inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	25899501
D002251	Carbon Tetrachloride	[Dimethylformamide co-treated with Carbon Tetrachloride] results in increased activity of CASP3 protein	20097184
D002251	Carbon Tetrachloride	fasudil inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17761835
D002251	Carbon Tetrachloride	Hemin inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17173083
D002251	Carbon Tetrachloride	salvianolic acid A inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17244260
D002251	Carbon Tetrachloride	Taurocholic Acid inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	12388182
D002258	Carbonyl Cyanide m-Chlorophenyl Hydrazone	Carbonyl Cyanide m-Chlorophenyl Hydrazone results in increased expression of CASP3 protein modified form	29241732
D002258	Carbonyl Cyanide m-Chlorophenyl Hydrazone	DNM1L protein promotes the reaction [Carbonyl Cyanide m-Chlorophenyl Hydrazone results in increased expression of CASP3 protein modified form]	29241732
D002258	Carbonyl Cyanide m-Chlorophenyl Hydrazone	PGAM5 protein promotes the reaction [Carbonyl Cyanide m-Chlorophenyl Hydrazone results in increased expression of CASP3 protein modified form]	29241732
D002258	Carbonyl Cyanide m-Chlorophenyl Hydrazone	Carbonyl Cyanide m-Chlorophenyl Hydrazone inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
D002259	Carbonyl Cyanide p-Trifluoromethoxyphenylhydrazone	Carbonyl Cyanide p-Trifluoromethoxyphenylhydrazone results in increased activity of CASP3 protein	20683024
D016190	Carboplatin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Carboplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16275998
D016190	Carboplatin	Carboplatin results in increased activity of CASP3 protein	22302033
D016190	Carboplatin	Carboplatin results in increased cleavage of and results in increased activity of CASP3 protein	16275998
D016190	Carboplatin	Carboplatin results in increased expression of CASP3 mRNA	15576332
D016190	Carboplatin	palbociclib inhibits the reaction [Carboplatin results in increased activity of CASP3 protein]	22302033
D016190	Carboplatin	Carboplatin results in increased expression of CASP3 protein	18483861; 20368269;
D016190	Carboplatin	Pravastatin inhibits the reaction [Carboplatin results in increased expression of CASP3 protein]	20368269
D016190	Carboplatin	Acetylcysteine inhibits the reaction [Carboplatin results in increased expression of CASP3 protein]	18483861
D016190	Carboplatin	Carboplatin results in increased expression of CASP3 protein	20368269
D016190	Carboplatin	Pravastatin inhibits the reaction [Carboplatin results in increased expression of CASP3 protein]	18483861; 20368269;
C062058	carboxyamido-triazole	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [[LM-1685 co-treated with carboxyamido-triazole] results in increased cleavage of CASP3 protein]	15867384
C111238	carboxycinnamic acid bishydroxamide	carboxycinnamic acid bishydroxamide results in increased cleavage of CASP3 protein	15897598
D002330	Carmustine	[Carmustine co-treated with 4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid] results in increased activity of CASP3 protein	18590702
D002330	Carmustine	Carmustine results in increased cleavage of CASP3 protein	24193513
D002330	Carmustine	Carmustine results in increased expression of CASP3 protein	20920327
D002330	Carmustine	Disulfiram promotes the reaction [Carmustine results in increased cleavage of CASP3 protein]	24193513
D002330	Carmustine	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Carmustine results in increased activity of and results in increased cleavage of CASP3 protein]	21600974
D002330	Carmustine	Acetylcysteine inhibits the reaction [Carmustine results in increased activity of and results in increased cleavage of CASP3 protein]	21600974
D002330	Carmustine	Carmustine results in increased activity of and results in increased cleavage of CASP3 protein	21600974
D002330	Carmustine	Carmustine results in increased activity of CASP3 protein	20046642
D002330	Carmustine	[LCN2 protein co-treated with Carmustine] results in increased cleavage of and results in increased activity of CASP3 protein	19860839
D002330	Carmustine	pyrazolanthrone inhibits the reaction [Carmustine results in increased activity of and results in increased cleavage of CASP3 protein]	21600974
D002330	Carmustine	Zinc Sulfate inhibits the reaction [Carmustine results in increased activity of CASP3 protein]	20046642
D002331	Carnitine	Carnitine inhibits the reaction [Gentamicins results in increased cleavage of CASP3 protein]	19491382
D002331	Carnitine	Carnitine inhibits the reaction [Ifosfamide results in increased expression of CASP3 mRNA]	23213347
D002331	Carnitine	Carnitine inhibits the reaction [Iohexol promotes the reaction [Glycerol results in increased expression of CASP3 mRNA]]	26562095
D002336	Carnosine	[Carnosine co-treated with asiatic acid] inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
D002336	Carnosine	Carnosine inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
D002336	Carnosine	Carnosine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	19748544
D002336	Carnosine	Carnosine inhibits the reaction [Cisplatin results in increased expression of and results in increased cleavage of CASP3 protein]	29191451
D002336	Carnosine	Carnosine inhibits the reaction [Sodium Nitrite results in increased activity of CASP3 protein]	28833918
C068623	carnosol	carnosol inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	17047462
C073316	carvacrol	carvacrol results in increased activity of CASP3 protein	23146755
C073316	carvacrol	carvacrol inhibits the reaction [Poloxamer results in increased expression of CASP3 protein]	29071762
C073316	carvacrol	carvacrol inhibits the reaction [propiconazole results in increased expression of CASP3 protein]	29852196
C073316	carvacrol	carvacrol inhibits the reaction [Simvastatin promotes the reaction [Poloxamer results in increased expression of CASP3 protein]]	29071762
D000077261	Carvedilol	Carvedilol results in decreased activity of CASP3 protein	12875697
D000077261	Carvedilol	Carvedilol inhibits the reaction [Epinephrine results in increased activity of CASP3 protein]	10728402
D000077261	Carvedilol	Carvedilol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	24012798
D000077261	Carvedilol	Carvedilol inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21044617
D000077261	Carvedilol	Carvedilol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15380674
D000077261	Carvedilol	Carvedilol inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26036690
D000077261	Carvedilol	Carvedilol inhibits the reaction [Potassium Dichromate results in increased cleavage of CASP3 protein]	25245570
C024714	caryophyllene	caryophyllene inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30836069
C024714	caryophyllene	iodopravadoline inhibits the reaction [caryophyllene inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30836069
D061945	Caspase Inhibitors	Caspase Inhibitors inhibits the reaction [2,3,5-trichloro-6-phenyl-(1,4)benzoquinone results in increased cleavage of CASP3 protein]	25950987
D061945	Caspase Inhibitors	Caspase Inhibitors inhibits the reaction [cadmium acetate results in increased expression of CASP3 protein modified form]	30605698
D061945	Caspase Inhibitors	[Caspase Inhibitors results in decreased activity of CASP8 protein] inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
C054133	casticin	casticin results in increased activity of CASP3 protein	29098808
C054133	casticin	casticin results in increased cleavage of and results in increased activity of CASP3 protein	27862857
C070295	catalase-polyethylene glycol	catalase-polyethylene glycol inhibits the reaction [C646 compound results in increased cleavage of CASP3 protein]	27381264
D002392	Catechin	Catechin analog results in increased activity of CASP3 protein	16413414
D002392	Catechin	Catechin inhibits the reaction [catechol results in increased activity of CASP3 protein]	20347921
D002392	Catechin	Catechin results in increased activity of CASP3 protein	20206613
D002392	Catechin	Catechin results in increased expression of CASP3 mRNA	23706674
D002392	Catechin	Catechin results in increased expression of CASP3 protein	23706674
D002392	Catechin	Catechin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	20883750
D002392	Catechin	Catechin inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	16753784
C034221	catechol	Catechin inhibits the reaction [catechol results in increased activity of CASP3 protein]	20347921
C034221	catechol	catechol results in increased activity of CASP3 protein	20347921; 23776099;
C034221	catechol	Memantine inhibits the reaction [catechol results in increased activity of CASP3 protein]	20347921
C561931	CAY 10580	CAY 10580 inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
C523455	CCG 1423	CCG 1423 results in increased activity of CASP3 protein	17699722
C099555	CD 437	CD 437 results in increased activity of CASP3 protein	10374879; 10766194; 11423908; 16024638;
C099555	CD 437	[CD 437 results in increased activity of CASP3 protein] which results in increased degradation of RARA protein	10374879
C099555	CD 437	CD 437 results in increased cleavage of and results in increased activity of CASP3 protein	9343396
C099555	CD 437	CD 437 results in increased expression of CASP3	16720286
C099555	CD 437	helenalin inhibits the reaction [CD 437 results in increased activity of CASP3 protein]	16024638
C099555	CD 437	NFKBIA protein affects the reaction [CD 437 results in increased activity of CASP3 protein]	16024638
C066624	CDRI 85-287	CDRI 85-287 results in increased activity of CASP3 protein	25655200
C574493	CDRI-97-78	CDRI-97-78 results in increased activity of CASP3 protein	23769964
D000068579	Celecoxib	3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	3-methyladenine promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	[ABT-737 co-treated with Celecoxib] results in increased activity of CASP3 protein	20104024
D000068579	Celecoxib	ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	ABT-737 promotes the reaction [Wortmannin promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	[Atorvastatin co-treated with Celecoxib] results in increased cleavage of and results in increased activity of CASP3 protein	18172863
D000068579	Celecoxib	BCL2L1 mutant form promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	BCL2 protein inhibits the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	BCL2 protein inhibits the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	BCL2 protein inhibits the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]]	20104024
D000068579	Celecoxib	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [3-methyladenine promotes the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]]	20104024
D000068579	Celecoxib	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [ABT-737 promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]]	20104024
D000068579	Celecoxib	BIRC5 protein inhibits the reaction [Celecoxib results in increased activity of CASP3 protein]	17466271
D000068579	Celecoxib	Celecoxib analog results in decreased expression of CASP3 protein	19682443
D000068579	Celecoxib	Celecoxib analog results in increased cleavage of and results in increased activity of CASP3 protein	15499625
D000068579	Celecoxib	Celecoxib inhibits the reaction [Fluorouracil results in increased expression of CASP3 protein]	17461495
D000068579	Celecoxib	Celecoxib promotes the reaction [ABT-737 results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	Celecoxib promotes the reaction [Docetaxel results in increased activity of and results in increased expression of CASP3 protein]	15688368
D000068579	Celecoxib	Celecoxib promotes the reaction [tetracycline CMT-3 results in increased activity of and results in increased expression of CASP3 protein]	15688368
D000068579	Celecoxib	Celecoxib results in decreased expression of CASP3 protein	19682443
D000068579	Celecoxib	Celecoxib results in increased activity of and results in increased expression of CASP3 protein	15688368
D000068579	Celecoxib	Celecoxib results in increased activity of CASP3	18202791
D000068579	Celecoxib	Celecoxib results in increased activity of CASP3 protein	10753955; 12824303; 17466271;
D000068579	Celecoxib	Celecoxib results in increased cleavage of and results in increased activity of CASP3 protein	15197583; 15572759; 16123214;
D000068579	Celecoxib	Celecoxib results in increased cleavage of CASP3 protein	19665451; 20104024;
D000068579	Celecoxib	Celecoxib results in increased expression of CASP3 protein	19635192
D000068579	Celecoxib	Docetaxel promotes the reaction [Celecoxib results in increased activity of and results in increased expression of CASP3 protein]	15688368
D000068579	Celecoxib	FADD mutant form inhibits the reaction [Celecoxib results in increased cleavage of and results in increased activity of CASP3 protein]	15572759
D000068579	Celecoxib	MAP1LC3B mutant form promotes the reaction [[Celecoxib co-treated with ABT-737] results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	PIK3C3 mutant form promotes the reaction [[Celecoxib co-treated with ABT-737] results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	tetracycline CMT-3 promotes the reaction [Celecoxib results in increased activity of and results in increased expression of CASP3 protein]	15688368
D000068579	Celecoxib	TNFSF10 protein promotes the reaction [Celecoxib results in increased cleavage of and results in increased activity of CASP3 protein]	15572759
D000068579	Celecoxib	Wortmannin promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
D000068579	Celecoxib	Celecoxib results in increased activity of CASP3 protein	17201140; 17761345;
D000068579	Celecoxib	Celecoxib inhibits the reaction [Freund's Adjuvant results in increased activity of CASP3 protein]	24932515
D000068579	Celecoxib	Celecoxib results in increased activity of CASP3 protein	17510421; 17717820;
C532683	Cellfood	Cellfood results in increased activity of CASP3 protein	24016597; 24598211;
D002512	Cephalothin	Cephalothin results in increased cleavage of and results in increased activity of CASP3 protein	15012731
D002518	Ceramides	Ceramides results in increased expression of CASP3	23495037
D002518	Ceramides	Ceramides results in increased activity of CASP3 protein	12588799
D002518	Ceramides	PRKN protein inhibits the reaction [Ceramides results in increased activity of CASP3 protein]	12588799
C030583	ceric oxide	ceric oxide results in increased cleavage of CASP3 protein	26028148
C030583	ceric oxide	ceric oxide results in increased expression of CASP3 protein	24987704
C086276	cerivastatin	cerivastatin results in increased activity of CASP3 protein	15705602; 16470222;
C086276	cerivastatin	geranylgeranyl pyrophosphate inhibits the reaction [cerivastatin results in increased activity of CASP3 protein]	16470222
C086276	cerivastatin	Mevalonic Acid inhibits the reaction [cerivastatin results in increased activity of CASP3 protein]	16470222
D002569	Cerulenin	Cerulenin results in increased activity of CASP3 protein	20805790
D002108	Ceruletide	Ceruletide results in increased cleavage of and results in increased activity of CASP3 protein	16339139
D002108	Ceruletide	[Glycodeoxycholic Acid co-treated with Ceruletide] results in decreased activity of CASP3 protein	18832452
C062876	cetrorelix	cetrorelix results in increased activity of CASP3 protein	21062912
C062876	cetrorelix	cetrorelix results in increased activity of CASP3 protein	17268770
C119032	CFM 1	CFM 1 results in increased activity of CASP3 protein	23826121
D002599	Chalcone	Chalcone results in increased cleavage of CASP3 protein	20620131
D002599	Chalcone	MYC protein affects the susceptibility to [Chalcone results in increased cleavage of CASP3 protein]	20620131
D047188	Chalcones	BCL2 protein inhibits the reaction [Chalcones analog results in increased cleavage of and results in increased activity of CASP3 protein]	30576621
D047188	Chalcones	Chalcones analog results in increased cleavage of and results in increased activity of CASP3 protein	30576621
C440574	Changkil	Changkil inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	18291569
C095591	chan su	chan su results in increased cleavage of and results in increased activity of CASP3 protein	16012733
C016299	chelerythrine	Acetylcysteine inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
C016299	chelerythrine	chelerythrine results in increased cleavage of CASP3 protein	26124276
C016299	chelerythrine	Dithiothreitol inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
C016299	chelerythrine	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
C016299	chelerythrine	S-methyl glutathione inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
C016299	chelerythrine	chelerythrine results in increased activity of CASP3 protein	21664962
C016299	chelerythrine	malonic acid inhibits the reaction [chelerythrine results in increased activity of CASP3 protein]	21664962
C016299	chelerythrine	Rotenone inhibits the reaction [chelerythrine results in increased activity of CASP3 protein]	21664962
D002635	Chenodeoxycholic Acid	Chenodeoxycholic Acid results in increased activity of CASP3 protein	16573382
D002635	Chenodeoxycholic Acid	Chenodeoxycholic Acid results in increased cleavage of and results in increased activity of CASP3 protein	19054763
D048271	Chitosan	Chitosan metabolite inhibits the reaction [Copper results in increased activity of CASP3 protein]	25542178
D048271	Chitosan	Chitosan analog inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30928397
D002699	Chlorambucil	Chlorambucil results in increased activity of CASP3 protein	11675354
D002701	Chloramphenicol	CDKN1A mutant form inhibits the reaction [Chloramphenicol inhibits the reaction [Mitomycin results in increased activity of CASP3 protein]]	15905168
D002701	Chloramphenicol	Chloramphenicol inhibits the reaction [Mitomycin results in increased activity of CASP3 protein]	15905168
D002706	Chlordan	Chlordan promotes the reaction [Benzo(a)pyrene results in increased activity of CASP3 protein]	19874837
D002713	Chlorine	[Ozone co-treated with Chlorine] affects the expression of CASP3 mRNA	18636392
C004656	chloroacetaldehyde	chloroacetaldehyde results in decreased activity of CASP3 protein	17035713
C004656	chloroacetaldehyde	chloroacetaldehyde results in increased activity of CASP3 protein	16267686
C006972	chloroacetic acid	chloroacetic acid results in increased cleavage of and results in increased activity of CASP3 protein	23103613
C006972	chloroacetic acid	chloroacetic acid results in increased cleavage of CASP3 protein	25451595
C006972	chloroacetic acid	HSP90B1 protein promotes the reaction [chloroacetic acid results in increased cleavage of CASP3 protein]	25451595
C006972	chloroacetic acid	HSPA5 protein promotes the reaction [chloroacetic acid results in increased cleavage of CASP3 protein]	25451595
C006972	chloroacetic acid	SB 203580 inhibits the reaction [chloroacetic acid results in increased activity of CASP3 protein]	23103613
C069277	chloroacetonitrile	chloroacetonitrile results in increased activity of CASP3 protein	19576970
D020111	Chlorodiphenyl (54% Chlorine)	Chlorodiphenyl (54% Chlorine) results in increased activity of CASP3 protein	19022367
D020111	Chlorodiphenyl (54% Chlorine)	2,3-bis(4-hydroxyphenyl)-propionitrile promotes the reaction [Chlorodiphenyl (54% Chlorine) results in increased activity of CASP3 protein]	24216299
D020111	Chlorodiphenyl (54% Chlorine)	4,4',4''-(4-propyl-((1)H)-pyrazole-1,3,5-triyl) tris-phenol inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in increased activity of CASP3 protein]	24216299
D020111	Chlorodiphenyl (54% Chlorine)	Chlorodiphenyl (54% Chlorine) results in increased activity of CASP3 protein	24216299; 30578594;
D020111	Chlorodiphenyl (54% Chlorine)	Chlorodiphenyl (54% Chlorine) results in increased expression of CASP3 mRNA	11323195
D002726	Chlorogenic Acid	Chlorogenic Acid inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25043994
D002726	Chlorogenic Acid	Chlorogenic Acid inhibits the reaction [Methotrexate results in increased activity of CASP3 protein]	28479099
D002738	Chloroquine	Chloroquine inhibits the reaction [Biological Products results in increased cleavage of CASP3 protein]	28219700
D002738	Chloroquine	Chloroquine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	30985881
D002738	Chloroquine	Chloroquine inhibits the reaction [formosanin C results in increased expression of and results in increased cleavage of CASP3 protein]	27180204
D002738	Chloroquine	Chloroquine promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	30338810
D002738	Chloroquine	Chloroquine promotes the reaction [Biological Products results in increased expression of and results in increased cleavage of CASP3 protein]	30465897
D002738	Chloroquine	Chloroquine promotes the reaction [usnic acid results in increased activity of CASP3 protein]	25078063
D002738	Chloroquine	Chloroquine results in increased expression of CASP3 protein	25266202
D002738	Chloroquine	BAX mutant form inhibits the reaction [Chloroquine results in increased activity of CASP3 protein]	11589424
D002738	Chloroquine	BCL2L1 mutant form promotes the reaction [Chloroquine results in increased activity of CASP3 protein]	11589424
D002738	Chloroquine	Chloroquine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D002738	Chloroquine	Chloroquine inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]]	29476062
D002738	Chloroquine	Chloroquine promotes the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29476062
D002738	Chloroquine	Chloroquine promotes the reaction [Sunitinib results in increased activity of CASP3 protein]	24751611
D002738	Chloroquine	Chloroquine results in increased activity of CASP3 protein	11589424
D002738	Chloroquine	[Rotenone co-treated with Chloroquine] results in increased cleavage of CASP3 protein	26847702
D002738	Chloroquine	TRP53 mutant form inhibits the reaction [Chloroquine results in increased activity of CASP3 protein]	11589424
D002738	Chloroquine	Chloroquine inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]]	29476062
D002738	Chloroquine	Chloroquine promotes the reaction [ochratoxin A results in increased cleavage of CASP3 protein]	30287338
C023676	chloroquine diphosphate	chloroquine diphosphate inhibits the reaction [MIR145 results in decreased activity of CASP3 protein]	29956747
C023676	chloroquine diphosphate	chloroquine diphosphate inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]	29133031
C023676	chloroquine diphosphate	chloroquine diphosphate promotes the reaction [Doxorubicin inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]]	29133031
C023676	chloroquine diphosphate	Doxorubicin promotes the reaction [chloroquine diphosphate inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]]	29133031
D004390	Chlorpyrifos	Chlorpyrifos affects the cleavage of CASP3 protein	26070385
D004390	Chlorpyrifos	[Chlorpyrifos affects the localization of CYCS protein] which results in increased activity of CASP3 protein	23416140
D004390	Chlorpyrifos	Chlorpyrifos results in increased activity of CASP3 protein	18996166; 26198043;
D004390	Chlorpyrifos	Chlorpyrifos results in increased cleavage of CASP3 protein	24793810; 28549829;
D004390	Chlorpyrifos	Chlorpyrifos results in increased expression of CASP3 protein	26435000
D004390	Chlorpyrifos	Chlorpyrifos results in increased expression of CASP3 protein modified form	23416140; 26070385;
D004390	Chlorpyrifos	MitoTEMPO inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein]	26435000
D004390	Chlorpyrifos	PRKN protein inhibits the reaction [Chlorpyrifos results in increased cleavage of CASP3 protein]	26070385
D004390	Chlorpyrifos	PRKN protein inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein modified form]	26070385
D004390	Chlorpyrifos	pyrazolanthrone inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein modified form]	23416140
D004390	Chlorpyrifos	Rosiglitazone promotes the reaction [Chlorpyrifos results in increased cleavage of CASP3 protein]	24793810
D004390	Chlorpyrifos	SB 203580 inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein modified form]	23416140
D004390	Chlorpyrifos	Chlorpyrifos results in decreased expression of CASP3 mRNA	29156651
D004390	Chlorpyrifos	Chlorpyrifos results in increased activity of CASP3 protein	26210949
D004390	Chlorpyrifos	[cypermethrin co-treated with Chlorpyrifos co-treated with profenofos] results in increased cleavage of CASP3 protein	21987380
D004390	Chlorpyrifos	Acetylcysteine inhibits the reaction [Chlorpyrifos results in increased activity of CASP3 protein]	22714038
D004390	Chlorpyrifos	Chlorpyrifos results in increased activity of CASP3 protein	22714038; 28373059;
D004390	Chlorpyrifos	gingerol inhibits the reaction [Chlorpyrifos results in increased activity of CASP3 protein]	28373059
D004390	Chlorpyrifos	Chlorpyrifos results in increased activity of CASP3 protein	19167454
D002762	Cholecalciferol	Cholecalciferol results in increased activity of CASP3 protein	24451003
D002762	Cholecalciferol	Cholecalciferol inhibits the reaction [Dietary Fats results in increased cleavage of CASP3 protein]	29653100
D002772	Cholera Toxin	Cholera Toxin results in decreased activity of CASP3 protein	12837940
C011724	cholest-5-en-3 beta,7 alpha-diol	alpha-Tocopherol inhibits the reaction [cholest-5-en-3 beta,7 alpha-diol results in increased activity of CASP3 protein]	12450566
C011724	cholest-5-en-3 beta,7 alpha-diol	beta-Tocopherol affects the reaction [cholest-5-en-3 beta,7 alpha-diol results in increased activity of CASP3 protein]	12450566
C011724	cholest-5-en-3 beta,7 alpha-diol	cholest-5-en-3 beta,7 alpha-diol results in increased activity of CASP3 protein	12450566; 16934673;
D002784	Cholesterol	Cholesterol results in increased cleavage of CASP3 protein	28275691
D002784	Cholesterol	Cholesterol inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein modified form]	29486218
D002784	Cholesterol	Cholesterol results in increased activity of CASP3 protein	21872649
D002784	Cholesterol	[Copper co-treated with Cholesterol] results in increased activity of CASP3 protein	17134702
D002784	Cholesterol	methyl-beta-cyclodextrin inhibits the reaction [Cholesterol results in increased activity of CASP3 protein]	21872649
D002784	Cholesterol	Cholesterol results in increased cleavage of CASP3 protein	17029598
D002784	Cholesterol	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Cholesterol analog results in increased expression of CASP3 mRNA]	19477266
D002784	Cholesterol	Acetylcysteine inhibits the reaction [Cholesterol analog results in increased expression of CASP3 mRNA]	19477266
D002784	Cholesterol	Cholesterol analog results in increased cleavage of CASP3 protein	19477266
D002784	Cholesterol	Cholesterol analog results in increased expression of CASP3 mRNA	19477266
D002791	Cholesterol, Dietary	[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased cleavage of CASP3 protein	27394961
D002791	Cholesterol, Dietary	MET gene mutant form promotes the reaction [[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased cleavage of CASP3 protein]	27394961
D002791	Cholesterol, Dietary	Cholesterol, Dietary results in increased cleavage of CASP3 protein	27239252
D002791	Cholesterol, Dietary	Cholesterol, Dietary results in increased expression of CASP3 mRNA	27239252
D002791	Cholesterol, Dietary	Rutin inhibits the reaction [Cholesterol, Dietary results in increased cleavage of CASP3 protein]	27239252
D002791	Cholesterol, Dietary	Rutin inhibits the reaction [Cholesterol, Dietary results in increased expression of CASP3 mRNA]	27239252
D002788	Cholesterol Esters	SAN 58035 promotes the reaction [Cholesterol Esters results in increased cleavage of CASP3 protein]	28275691
D019826	Cholic Acid	Cholic Acid inhibits the reaction [Diethylnitrosamine results in increased cleavage of CASP3 protein]	27151938
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of CASP3 mRNA	20938992
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency] results in increased expression of CASP3 protein modified form	28100771
D002794	Choline	geraniol inhibits the reaction [[Methionine deficiency co-treated with Choline deficiency] results in increased activity of CASP3 protein]	26695085
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency] results in increased activity of CASP3 protein	26695085
C529269	cholix toxin, Vibrio cholerae	[cholix toxin, Vibrio cholerae co-treated with TNF protein] results in increased activity of CASP3 protein	28087840
D002809	Chondroitin Sulfates	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased activity of CASP3 protein]	17879260
D002809	Chondroitin Sulfates	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased expression of CASP3 mRNA]	17879260
C022990	chromic chloride	chromic chloride results in increased expression of and results in increased activity of CASP3 protein	14741615
C023600	chromic oxide	chromic oxide analog results in increased activity of CASP3 protein	21384495
D002857	Chromium	Chromium results in increased expression of CASP3 protein	17692352
D017608	Chromium Compounds	Chromium Compounds results in increased activity of CASP3 protein	19406221
C074702	chromium hexavalent ion	Acetylcysteine inhibits the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	30236763
C074702	chromium hexavalent ion	Ascorbic Acid promotes the reaction [chromium hexavalent ion results in increased cleavage of CASP3 protein]	17301063
C074702	chromium hexavalent ion	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [TP53 protein affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]]	16166740
C074702	chromium hexavalent ion	chromium hexavalent ion affects the cleavage of CASP3 protein	15831465
C074702	chromium hexavalent ion	chromium hexavalent ion results in increased activity of CASP3 protein	15966574; 16166740; 22710416; 30236763; 31433169;
C074702	chromium hexavalent ion	chromium hexavalent ion results in increased cleavage of and results in increased activity of CASP3 protein	22886373
C074702	chromium hexavalent ion	chromium hexavalent ion results in increased cleavage of CASP3 protein	17301063; 29069462;
C074702	chromium hexavalent ion	MLH1 protein affects the reaction [chromium hexavalent ion affects the activity of CASP3 protein]	15831465
C074702	chromium hexavalent ion	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	15966574
C074702	chromium hexavalent ion	[SEMA3A protein co-treated with chromium hexavalent ion] results in increased activity of CASP3 protein	30236763
C074702	chromium hexavalent ion	Sirolimus inhibits the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	30236763
C074702	chromium hexavalent ion	TP53 protein affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	16166740
C074702	chromium hexavalent ion	Zinc affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	15966574
C074702	chromium hexavalent ion	chromium hexavalent ion results in increased activity of CASP3 protein	24374135
C074702	chromium hexavalent ion	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	19459161
C074702	chromium hexavalent ion	chromium hexavalent ion results in increased activity of CASP3 protein	19459161
C079689	chromium tripicolinate	Acetylcysteine inhibits the reaction [chromium tripicolinate results in increased activity of CASP3 protein]	19376147
C079689	chromium tripicolinate	chromium tripicolinate results in increased activity of CASP3 protein	19376147
C031180	chrysene	chrysene results in increased activity of CASP3 protein	21571051
C043561	chrysin	BCL2 protein inhibits the reaction [chrysin results in increased cleavage of and results in increased activity of CASP3 protein]	16215670
C043561	chrysin	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Cisplatin co-treated with chrysin] results in increased cleavage of CASP3 protein]	25770930
C043561	chrysin	chrysin inhibits the reaction [Topotecan results in increased activity of CASP3 protein]	20457140
C043561	chrysin	chrysin promotes the reaction [TNFSF10 protein results in increased degradation of CASP3 protein]	21195158
C043561	chrysin	chrysin results in increased cleavage of and results in increased activity of CASP3 protein	16215670
C043561	chrysin	chrysin results in increased cleavage of CASP3 protein	18331776; 19397994; 25770930;
C043561	chrysin	[Cisplatin co-treated with chrysin] results in increased cleavage of CASP3 protein	25770930
C043561	chrysin	chrysin inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	28682524
C043561	chrysin	chrysin inhibits the reaction [Colistin results in increased expression of CASP3 protein]	30273961
C043561	chrysin	chrysin inhibits the reaction [Freund's Adjuvant results in increased activity of CASP3 protein]	24932515
C043561	chrysin	chrysin inhibits the reaction [Testosterone results in decreased cleavage of CASP3 protein]	29247772
C043561	chrysin	chrysin inhibits the reaction [Thioacetamide results in increased expression of CASP3 protein]	30500344
C043561	chrysin	[Diethylnitrosamine co-treated with chrysin] results in increased expression of CASP3 protein	21167192
C472594	chrysophsin	chrysophsin promotes the reaction [Epirubicin results in increased expression of CASP3 mRNA]	26335193
C472594	chrysophsin	chrysophsin results in increased expression of CASP3 mRNA	26335193
C472594	chrysophsin	[Epirubicin analog co-treated with chrysophsin analog] results in increased expression of CASP3 mRNA	26335193
C472594	chrysophsin	Epirubicin promotes the reaction [chrysophsin results in increased expression of CASP3 mRNA]	26335193
D000077404	Cidofovir	Cidofovir results in decreased activity of CASP3 protein	11697818
C000598873	CIGB-552 peptide	CIGB-552 peptide results in increased cleavage of CASP3 protein	23401744
C039671	ciglitazone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein]	21067863
C039671	ciglitazone	ciglitazone results in increased expression of CASP3 mRNA	15387324
C039671	ciglitazone	DDIT3 mutant form inhibits the reaction [[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein]	21067863
C039671	ciglitazone	GAST protein inhibits the reaction [ciglitazone results in increased expression of CASP3 mRNA]	15387324
C039671	ciglitazone	[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein	21067863
C000628468	ciji-hua'ai-baosheng	ciji-hua'ai-baosheng results in increased cleavage of CASP3 protein	30670974
D015377	Cilastatin	Cilastatin inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20435919
D000077407	Cilostazol	Cilostazol results in increased activity of CASP3 protein	20131233
D000077407	Cilostazol	KT 5720 inhibits the reaction [Cilostazol results in increased activity of CASP3 protein]	20131233
D000077407	Cilostazol	Cilostazol inhibits the reaction [Nitroprusside results in increased activity of CASP3 protein]	18311796
D002927	Cimetidine	Cimetidine results in increased activity of CASP3 protein	17273750; 20127008;
D002927	Cimetidine	Cimetidine inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	27983966
D002927	Cimetidine	Cimetidine results in increased expression of CASP3 protein	26021711
C029010	cinnamic acid	cinnamic acid inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30144576
C012843	cinnamic aldehyde	cinnamic aldehyde analog results in increased activity of CASP3 protein	16343908
C012843	cinnamic aldehyde	cinnamic aldehyde analog results in increased expression of CASP3 protein	17510524
C012843	cinnamic aldehyde	cinnamic aldehyde results in increased activity of CASP3 protein	15566391
C012843	cinnamic aldehyde	cinnamic aldehyde results in increased cleavage of CASP3 protein	19000754
C012843	cinnamic aldehyde	Vitamin E inhibits the reaction [cinnamic aldehyde results in increased activity of CASP3 protein]	15566391
C063451	cinobufotalin	cinobufotalin results in increased cleavage of CASP3 protein	22898211
D002939	Ciprofloxacin	Ciprofloxacin results in increased activity of CASP3 protein	11832715; 11875713; 12632069;
D002939	Ciprofloxacin	Ciprofloxacin results in increased cleavage of and results in increased activity of CASP3 protein	10741713
D002945	Cisplatin	Cisplatin results in increased activity of CASP3 protein	20396870
D002945	Cisplatin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16013042
D002945	Cisplatin	Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein	16013042
D002945	Cisplatin	U 0126 inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16013042
D002945	Cisplatin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20802529
D002945	Cisplatin	[3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [FAM168A results in decreased susceptibility to Cisplatin]] which results in increased cleavage of CASP3 protein	23251525
D002945	Cisplatin	[4-methylene-2-octyl-5-oxofuran-3-carboxylic acid co-treated with Cisplatin] results in increased cleavage of and results in decreased expression of CASP3 protein	21442130
D002945	Cisplatin	[4-methylene-2-octyl-5-oxofuran-3-carboxylic acid co-treated with Cisplatin] results in increased cleavage of and results in increased activity of CASP3 protein	21442130
D002945	Cisplatin	8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21745194
D002945	Cisplatin	ABCB1 protein inhibits the reaction [Cisplatin results in increased activity of and results in increased cleavage of CASP3 protein]	22269388
D002945	Cisplatin	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	23747833
D002945	Cisplatin	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]]	23747833
D002945	Cisplatin	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]]	29944906
D002945	Cisplatin	Acetylcysteine inhibits the reaction [[Cisplatin co-treated with FASLG protein] results in increased activity of CASP3 protein]	17574045
D002945	Cisplatin	Acetylcysteine inhibits the reaction [Cisplatin promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]]	29944906
D002945	Cisplatin	Acetylcysteine inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21166495; 27417252;
D002945	Cisplatin	Acetylcysteine inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	15496615
D002945	Cisplatin	Acetylcysteine inhibits the reaction [[S100A11 mutant form results in increased susceptibility to Cisplatin] which results in increased cleavage of CASP3 protein]	25940438
D002945	Cisplatin	AKT1 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21266360
D002945	Cisplatin	[andrographolide co-treated with Cisplatin] results in increased expression of CASP3 mRNA	24563380
D002945	Cisplatin	Arsenic Trioxide promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	29944906
D002945	Cisplatin	astilbin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	29471006
D002945	Cisplatin	BCL2 inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21618512
D002945	Cisplatin	BCL2 protein inhibits the reaction [[Cisplatin co-treated with FASLG protein] results in increased activity of CASP3 protein]	17574045
D002945	Cisplatin	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Cisplatin co-treated with FASLG protein] results in increased activity of CASP3 protein]	17574045
D002945	Cisplatin	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Cisplatin co-treated with chrysin] results in increased cleavage of CASP3 protein]	25770930
D002945	Cisplatin	beta-solamarine promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	17619073
D002945	Cisplatin	BMI1 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21311599
D002945	Cisplatin	CD40LG protein inhibits the reaction [Cisplatin promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	16545138
D002945	Cisplatin	[Cisplatin co-treated with Bortezomib] results in increased activity of CASP3 protein	16357177
D002945	Cisplatin	[Cisplatin co-treated with CDKN1A protein] results in increased cleavage of CASP3 protein	18483502
D002945	Cisplatin	[Cisplatin co-treated with chrysin] results in increased cleavage of CASP3 protein	25770930
D002945	Cisplatin	[Cisplatin co-treated with FASLG protein] results in increased activity of CASP3 protein	17574045
D002945	Cisplatin	[Cisplatin co-treated with fisetin] results in increased cleavage of and results in increased activity of CASP3 protein	21216935
D002945	Cisplatin	Cisplatin promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]	29690507
D002945	Cisplatin	Cisplatin promotes the reaction [5-((2,6-dichlorobenzyl)sulfonyl)-3-((3,5-dimethyl-4-((2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl)carbonyl)-1H-pyrrol-2-yl)methylene)-1,3-dihydro-2H-indol-2-one results in increased cleavage of CASP3 protein]	20661229
D002945	Cisplatin	Cisplatin promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	29944906
D002945	Cisplatin	Cisplatin promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	16545138
D002945	Cisplatin	Cisplatin promotes the reaction [Metformin results in increased activity of CASP3 protein]	21388661
D002945	Cisplatin	Cisplatin promotes the reaction [TNFSF10 protein results in increased cleavage of and results in increased activity of CASP3 protein]	20856198; 21037225;
D002945	Cisplatin	[Cisplatin promotes the reaction [TNFSF10 protein results in increased cleavage of and results in increased activity of CASP3 protein]] which results in increased cleavage of XIAP protein	20856198
D002945	Cisplatin	Cisplatin results in increased activity of and results in increased cleavage of CASP3 protein	17399942
D002945	Cisplatin	Cisplatin results in increased activity of CASP3 protein	10663630; 12565868; 14512787; 14727531; 15863139; 16009487; 16080519; 16357177; 16803524; 17619073; 18383853; 20106947; 20654585; 20655883; 20802529; 20878076; 21035837; 21052098; 21132272; 21166495; 21266360; 21311599; 21368866; 21372221; 21507255; 21527773; 21641698; 21737676; 21742513; 21801448; 23165153; 23287709; 23747833; 27417252; 28914995;
D002945	Cisplatin	[Cisplatin results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein	18176112
D002945	Cisplatin	Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein	17853063; 20623264; 21216935; 21745194;
D002945	Cisplatin	Cisplatin results in increased cleavage of CASP3 protein	15496615; 17021654; 18058806; 18071906; 18483502; 20145152; 20661229; 20947521; 21255191; 21334329; 21618512; 21660965; 23956100; 25611565; 25770930; 25940438; 27186303; 27234046; 27815112; 28371273; 29471006; 29944906; 30452898; 31153982;
D002945	Cisplatin	Cisplatin results in increased expression of and results in increased cleavage of CASP3 protein	20674069
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 mRNA	20623264; 21278888; 24563380; 27594783;
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 protein	16803524; 20623183; 21274007; 21278888; 25776512;
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 protein modified form	24345465
D002945	Cisplatin	CITED2 mutant form promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21660965
D002945	Cisplatin	[CITED2 results in decreased susceptibility to Cisplatin] which results in decreased activity of CASP3 protein	21660965
D002945	Cisplatin	CXCL8 inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21742513
D002945	Cisplatin	DICER1 mutant form inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25940438
D002945	Cisplatin	ESR2 protein promotes the reaction [Cisplatin results in increased expression of CASP3 protein]	20623183
D002945	Cisplatin	FAM168A protein inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21334329
D002945	Cisplatin	[Fluorouracil co-treated with Cisplatin] results in increased activity of CASP3 protein	16803524
D002945	Cisplatin	[Fluorouracil co-treated with Cisplatin] results in increased expression of CASP3 protein	16803524
D002945	Cisplatin	GCS-100 promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21368866
D002945	Cisplatin	[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	23747833
D002945	Cisplatin	GNAS protein inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21255191
D002945	Cisplatin	Hemin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	27815112
D002945	Cisplatin	hesperetin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31153982
D002945	Cisplatin	HMGN5 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	28914995
D002945	Cisplatin	HSPA5 protein affects the reaction [Cisplatin results in increased cleavage of CASP3 protein]	27234046
D002945	Cisplatin	IER5 protein promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	27186303
D002945	Cisplatin	ING4 protein promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21052098
D002945	Cisplatin	MIR630 mRNA inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	20145152
D002945	Cisplatin	Nicotine inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20106947
D002945	Cisplatin	[Noscapine co-treated with Cisplatin] results in increased cleavage of CASP3 protein	20674069
D002945	Cisplatin	Noscapine promotes the reaction [Cisplatin results in increased expression of and results in increased cleavage of CASP3 protein]	20674069
D002945	Cisplatin	oleylamide inhibits the reaction [[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]]	23747833
D002945	Cisplatin	Omeprazole inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	30452898
D002945	Cisplatin	Oxygen deficiency promotes the reaction [Cisplatin promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]]	29690507
D002945	Cisplatin	[Paclitaxel co-treated with Cisplatin] results in increased activity of CASP3 protein	12709826
D002945	Cisplatin	PD 150606 inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21368866
D002945	Cisplatin	PLK1 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20655883
D002945	Cisplatin	PRDX6 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21166495
D002945	Cisplatin	[Quercetin co-treated with Cisplatin] results in increased activity of CASP3 protein	27514524
D002945	Cisplatin	Quercetin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25611565
D002945	Cisplatin	[Quercetin results in increased susceptibility to Cisplatin] which results in increased activity of CASP3 protein	25611565
D002945	Cisplatin	RAPGEF3 affects the reaction [8-(4-chloro-phenylthio)-2'-O-methyladenosine-3'-5'-cyclic monophosphate inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21745194
D002945	Cisplatin	RELA protein mutant form inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21737676
D002945	Cisplatin	RNF34 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	16080519
D002945	Cisplatin	[S100A11 mutant form results in increased susceptibility to Cisplatin] which results in increased cleavage of CASP3 protein	25940438
D002945	Cisplatin	Sirolimus promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	18058806
D002945	Cisplatin	[SLC39A8 protein affects the susceptibility to Cisplatin] which affects the cleavage of CASP3 protein	30342059
D002945	Cisplatin	SMG1 protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21418860
D002945	Cisplatin	SND1 mutant form promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25940438
D002945	Cisplatin	[SND1 mutant form results in increased susceptibility to Cisplatin] which results in increased cleavage of and results in increased activity of CASP3 protein	25940438
D002945	Cisplatin	tauroursodeoxycholic acid inhibits the reaction [Quercetin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]]	25611565
D002945	Cisplatin	[TNFSF10 protein co-treated with Cisplatin] results in increased activity of CASP3 protein	21252285
D002945	Cisplatin	TNFSF10 protein promotes the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	20623264
D002945	Cisplatin	TRAP1 protein inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	17853063
D002945	Cisplatin	Tretinoin promotes the reaction [[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]]	23747833
D002945	Cisplatin	TYMP inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	14727531
D002945	Cisplatin	TYMP protein inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	12565868
D002945	Cisplatin	Valproic Acid promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21507255
D002945	Cisplatin	YAP1 protein inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	20947521
D002945	Cisplatin	zinc protoporphyrin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	27815112
D002945	Cisplatin	3-(5-(2,3-dichlorophenyl)-1H-tetrazol-1-yl)methylpyridine inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	25308879
D002945	Cisplatin	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21593185
D002945	Cisplatin	acetovanillone inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	22147442
D002945	Cisplatin	Acetylcysteine inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21616140
D002945	Cisplatin	Acetylcysteine inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29454061
D002945	Cisplatin	[Acetylcysteine results in decreased abundance of Reactive Oxygen Species] inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29454061
D002945	Cisplatin	arachidonyl-2-chloroethylamide inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31256211
D002945	Cisplatin	ATG7 gene mutant form inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]]	29476062
D002945	Cisplatin	ATG7 gene mutant form inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]]	29476062
D002945	Cisplatin	CARM1 protein affects the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31256211
D002945	Cisplatin	Carnosine inhibits the reaction [Cisplatin results in increased expression of and results in increased cleavage of CASP3 protein]	29191451
D002945	Cisplatin	Carvedilol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	24012798
D002945	Cisplatin	Catechin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	20883750
D002945	Cisplatin	CDKN1A protein inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21325496
D002945	Cisplatin	Chlorogenic Acid inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25043994
D002945	Cisplatin	Chloroquine inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]]	29476062
D002945	Cisplatin	Chloroquine promotes the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29476062
D002945	Cisplatin	[Cisplatin co-treated with Vinorelbine] results in increased activity of CASP3 protein	21544650
D002945	Cisplatin	Cisplatin results in increased activity of CASP3 protein	15983031; 20547441; 21220912; 21526214; 21616140; 21763304; 22147442; 22269388; 29476062;
D002945	Cisplatin	Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein	21593185; 21745194; 24012798;
D002945	Cisplatin	Cisplatin results in increased cleavage of and results in increased expression of CASP3 protein	23770416
D002945	Cisplatin	Cisplatin results in increased cleavage of CASP3 protein	20883750; 21325496; 21616140; 22269388; 23628706; 25043994; 26193055; 28975372; 31153982; 31256211;
D002945	Cisplatin	Cisplatin results in increased expression of and results in increased cleavage of CASP3 protein	29191451
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 mRNA	20702592; 20883750;
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 protein	20510337; 25308879; 25665769;
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 protein modified form	20702592; 29454061; 29476062;
D002945	Cisplatin	coenzyme Q10 inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	20510337
D002945	Cisplatin	Colforsin inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21745194
D002945	Cisplatin	cyclohexyl carbamic acid 3'-carbamoylbiphenyl-3-yl ester inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31256211
D002945	Cisplatin	erdosteine inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	26193055
D002945	Cisplatin	IL6 inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21570986
D002945	Cisplatin	Isoproterenol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21745194
D002945	Cisplatin	Luteolin inhibits the reaction [Cisplatin results in increased cleavage of and results in increased expression of CASP3 protein]	23770416
D002945	Cisplatin	MAP2K1 protein promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	20547441
D002945	Cisplatin	PAK2 protein modified form promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21499899
D002945	Cisplatin	pifithrin inhibits the reaction [6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]]	21593185
D002945	Cisplatin	PRMT3 protein affects the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31256211
D002945	Cisplatin	RAPGEF3 mutant form inhibits the reaction [Isoproterenol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21745194
D002945	Cisplatin	Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21593185
D002945	Cisplatin	rosemarinic acid inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21526214
D002945	Cisplatin	salubrinal promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21616140
D002945	Cisplatin	salubrinal promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21616140
D002945	Cisplatin	[SLC39A8 protein results in increased susceptibility to Cisplatin] which results in increased cleavage of CASP3 protein	30342059
D002945	Cisplatin	Streptozocin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	25665769
D002945	Cisplatin	Thioctic Acid inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21763304
D002945	Cisplatin	TIMD2 promotes the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	20702592
D002945	Cisplatin	trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	29476062
D002945	Cisplatin	trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29476062
D002945	Cisplatin	2-((aminocarbonyl)amino)-5-(4-fluorophenyl)-3-thiophenecarboxamide inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	28119452
D002945	Cisplatin	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III) inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	19038279
D002945	Cisplatin	acetovanillone inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	24291008
D002945	Cisplatin	astragaloside A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	30842369
D002945	Cisplatin	Carvedilol inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21044617
D002945	Cisplatin	Chloroquine inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]]	29476062
D002945	Cisplatin	Cisplatin results in increased activity of CASP3 protein	17604343; 19038279; 19152827; 19578154; 20809784; 21044617; 23603837; 24291008; 29476062;
D002945	Cisplatin	Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein	15315938; 24973089; 28119452;
D002945	Cisplatin	Cisplatin results in increased cleavage of CASP3 protein	23628706; 25184746; 29852128; 30125553;
D002945	Cisplatin	Cisplatin results in increased expression of and results in increased activity of CASP3 protein	31103702
D002945	Cisplatin	Cisplatin results in increased expression of CASP3	24632086
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 mRNA	26612654
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 protein	16787641; 20368269; 21525749; 27616468; 28902463;
D002945	Cisplatin	Cisplatin results in increased expression of CASP3 protein modified form	28414026
D002945	Cisplatin	CTNNA1 gene affects the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	24973089
D002945	Cisplatin	cyclo(Trp-Asp-Pro-Val-Leu) inhibits the reaction [Cisplatin results in increased expression of CASP3]	24632086
D002945	Cisplatin	Eicosanoids analog inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	23603837
D002945	Cisplatin	fisetin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25184746
D002945	Cisplatin	formononetin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	28414026
D002945	Cisplatin	HNF1B protein inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	28119452
D002945	Cisplatin	MIR375 mRNA promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	28119452
D002945	Cisplatin	montelukast inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	28902463
D002945	Cisplatin	naringin inhibits the reaction [Cisplatin results in increased expression of CASP3 mRNA]	26612654
D002945	Cisplatin	Pravastatin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	20368269
D002945	Cisplatin	SB 203580 promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	19578154
D002945	Cisplatin	Sildenafil Citrate inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	19152827
D002945	Cisplatin	Silymarin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	27616468
D002945	Cisplatin	tangeretin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	27616468
D002945	Cisplatin	Venlafaxine Hydrochloride inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	29852128
D002945	Cisplatin	wogonin inhibits the reaction [Cisplatin results in increased expression of and results in increased activity of CASP3 protein]	31103702
D002945	Cisplatin	Bezafibrate inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16316343
D002945	Cisplatin	Cilastatin inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20435919
D002945	Cisplatin	[Cisplatin co-treated with EPO protein] results in increased cleavage of CASP3 protein	21497595
D002945	Cisplatin	Cisplatin results in increased activity of CASP3 protein	20435919
D002945	Cisplatin	Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein	16316343
D002945	Cisplatin	Cisplatin results in increased expression of CASP3	12712633
D002945	Cisplatin	Cisplatin results in increased activity of CASP3 protein	22269388
D015283	Citalopram	Citalopram results in increased cleavage of and results in increased activity of CASP3 protein	10487422
D019343	Citric Acid	[Citric Acid co-treated with zinc chloride] results in increased activity of CASP3 protein	16624386
D002953	Citrinin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Citrinin results in increased activity of CASP3 protein]	19361540
D002953	Citrinin	Citrinin inhibits the reaction [ochratoxin A results in increased activity of CASP3 protein]	29673704
D002953	Citrinin	Citrinin results in increased activity of CASP3 protein	18767140; 19361540;
D002953	Citrinin	[Citrinin results in increased activity of CASP3 protein] which results in increased activity of PAK2 protein	18767140
D002953	Citrinin	pyrazolanthrone inhibits the reaction [Citrinin results in increased activity of CASP3 protein]	18767140; 19361540;
D002953	Citrinin	Citrinin results in increased activity of CASP3 protein	21622943
D002953	Citrinin	Citrinin results in increased activity of CASP3 protein	22564900
D002953	Citrinin	Citrinin results in increased expression of CASP3 protein modified form	22564900
D017338	Cladribine	BCL2 inhibits the reaction [Cladribine results in increased cleavage of and results in increased activity of CASP3 protein]	15516989
D017338	Cladribine	Cladribine promotes the reaction [Bendamustine Hydrochloride results in increased activity of CASP3 protein]	12948851
D017338	Cladribine	Cladribine results in increased activity of CASP3 protein	11672427; 12948851; 21679466;
D017338	Cladribine	Cladribine results in increased cleavage of and results in increased activity of CASP3 protein	15516989
D017338	Cladribine	Cladribine results in increased activity of CASP3 protein	9689121
C057741	clavulone II	clavulone II results in increased activity of CASP3 protein	15920677
D007464	Clioquinol	Clioquinol inhibits the reaction [Isoflurane results in increased cleavage of and results in increased activity of CASP3 protein]	17287498
C028677	clivorine	clivorine results in increased cleavage of CASP3 protein	19437449
C028677	clivorine	EGF protein inhibits the reaction [clivorine results in increased cleavage of CASP3 protein]	19437449
D002990	Clobetasol	Clobetasol results in increased activity of CASP3 protein	15086553
D004002	Clodronic Acid	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Clodronic Acid results in increased activity of CASP3 protein]	23377347
D004002	Clodronic Acid	Clodronic Acid results in increased activity of CASP3 protein	23377347
D004002	Clodronic Acid	Clodronic Acid results in increased expression of CASP3	19448140
D004002	Clodronic Acid	Suramin inhibits the reaction [Clodronic Acid results in increased expression of CASP3]	19448140
D000077866	Clofarabine	BCL2L1 protein affects the reaction [[Clofarabine co-treated with Resveratrol] results in increased activity of CASP3 protein]	25408576
D000077866	Clofarabine	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [[Resveratrol co-treated with Clofarabine] promotes the reaction [MCL1 mutant form results in increased activity of CASP3 protein]]	24924397
D000077866	Clofarabine	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [[Resveratrol co-treated with Clofarabine] results in increased activity of CASP3 protein]	24924397
D000077866	Clofarabine	[Clofarabine co-treated with fludarabine co-treated with Busulfan] results in increased cleavage of CASP3 protein	20933509
D000077866	Clofarabine	[Clofarabine co-treated with Resveratrol] promotes the reaction [BCL2L1 mutant form results in increased activity of CASP3 protein]	25408576
D000077866	Clofarabine	[Clofarabine co-treated with Resveratrol] promotes the reaction [BCL2L1 mutant form results in increased cleavage of CASP3 protein]	25408576
D000077866	Clofarabine	[Clofarabine co-treated with Resveratrol] results in increased activity of CASP3 protein	25408576
D000077866	Clofarabine	MCL1 mutant form promotes the reaction [[Resveratrol co-treated with Clofarabine] results in increased cleavage of CASP3 protein]	24924397
D000077866	Clofarabine	[Resveratrol co-treated with Clofarabine] promotes the reaction [MCL1 mutant form results in increased activity of CASP3 protein]	24924397
D000077866	Clofarabine	[Resveratrol co-treated with Clofarabine] results in increased cleavage of and results in increased activity of CASP3 protein	24924397
D000077866	Clofarabine	[Resveratrol co-treated with Clofarabine] results in increased expression of CASP3 protein modified form	24239893
D002994	Clofibrate	Clofibrate affects the expression of CASP3 mRNA	19483382
D002994	Clofibrate	Clofibrate inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	10200566
D002994	Clofibrate	Clofibrate results in decreased activity of CASP3 protein	10200566
D002997	Clomipramine	Clomipramine results in increased activity of CASP3 protein	22700542
D002997	Clomipramine	Clomipramine results in increased cleavage of and results in increased activity of CASP3 protein	10487422
D002997	Clomipramine	Palmitic Acid promotes the reaction [Clomipramine results in increased activity of CASP3 protein]	22700542
D002997	Clomipramine	Clomipramine results in increased activity of CASP3 protein	28482088
D003000	Clonidine	Clonidine results in increased activity of CASP3 protein	28115640
D003000	Clonidine	Clonidine results in increased expression of CASP3 mRNA	15351510
D003022	Clotrimazole	Clotrimazole inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 mRNA]	24239969
D003022	Clotrimazole	Clotrimazole inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
D003022	Clotrimazole	[S-allylcysteine co-treated with Clotrimazole] inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
D003024	Clozapine	Clozapine results in increased activity of CASP3 protein	22700542
D003024	Clozapine	Palmitic Acid promotes the reaction [Clozapine results in increased activity of CASP3 protein]	22700542
D003024	Clozapine	Clozapine results in increased activity of CASP3 protein	24709159
D060729	Coal Ash	Coal Ash results in increased expression of CASP3 protein modified form	26773838
D060729	Coal Ash	Simvastatin inhibits the reaction [Coal Ash results in increased expression of CASP3 protein modified form]	26773838
D003035	Cobalt	Cobalt results in increased expression of CASP3 mRNA	22983774
D003035	Cobalt	Cobalt analog results in increased activity of CASP3 protein	21501578; 28024936;
D003035	Cobalt	Cobalt results in increased expression of CASP3 mRNA	26378417
D003035	Cobalt	[Tungsten co-treated with Nickel co-treated with Cobalt] results in decreased activity of CASP3 protein	20934443
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [Deoxycholic Acid results in increased cleavage of CASP3 protein]	21362092
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [FASLG protein results in increased activity of CASP3 protein]	16051694
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [FASLG protein results in increased cleavage of CASP3 protein]	16051694
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in decreased activity of CASP3 protein	16051694
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in increased cleavage of and results in increased activity of CASP3 protein	18289802
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin affects the activity of CASP3 protein	23435964
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin affects the cleavage of CASP3 protein	25171655
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	14512878
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [TNF protein promotes the reaction [Galactosamine results in increased activity of CASP3 protein]]	14512878
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in decreased expression of CASP3 protein	15919478
C007095	cobaltiprotoporphyrin	NFE2L2 protein affects the reaction [cobaltiprotoporphyrin affects the cleavage of CASP3 protein]	25171655
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	24810525
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in decreased activity of CASP3 protein	22237591
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in decreased cleavage of and results in decreased activity of CASP3 protein	22111038
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in decreased expression of CASP3 protein	20357190
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin results in increased activity of CASP3 protein	27097841
C007095	cobaltiprotoporphyrin	zinc protoporphyrin inhibits the reaction [cobaltiprotoporphyrin results in decreased expression of CASP3 protein]	20357190
C007095	cobaltiprotoporphyrin	cobaltiprotoporphyrin inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	18819247
C007095	cobaltiprotoporphyrin	[cobaltiprotoporphyrin inhibits the reaction [TNF protein results in increased activity of CASP3 protein]] which results in decreased cleavage of PARP1 protein	18819247
C007095	cobaltiprotoporphyrin	[cobaltiprotoporphyrin results in increased expression of HMOX1 protein] inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
C007095	cobaltiprotoporphyrin	tin protoporphyrin IX inhibits the reaction [[cobaltiprotoporphyrin results in increased expression of HMOX1 protein] inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]]	16371440
C018021	cobaltous chloride	[3-methyladenine co-treated with cobaltous chloride co-treated with TP53 gene mutant form] results in increased activity of CASP3 protein	23380477
C018021	cobaltous chloride	[bafilomycin A1 co-treated with cobaltous chloride co-treated with TP53 gene mutant form] results in increased activity of CASP3 protein	23380477
C018021	cobaltous chloride	[cobaltous chloride affects the localization of CDKN1A protein] which results in increased expression of and results in increased stability of CASP3 protein	20974702
C018021	cobaltous chloride	[cobaltous chloride co-treated with TP53 gene mutant form] results in increased activity of CASP3 protein	21687937
C018021	cobaltous chloride	cobaltous chloride inhibits the reaction [Cyclosporine results in increased cleavage of and results in increased activity of CASP3 protein]	22343435
C018021	cobaltous chloride	cobaltous chloride inhibits the reaction [Gentamicins results in increased cleavage of and results in increased activity of CASP3 protein]	23145036
C018021	cobaltous chloride	cobaltous chloride promotes the reaction [nickel chloride results in increased cleavage of CASP3 protein]	22172632
C018021	cobaltous chloride	cobaltous chloride results in increased activity of CASP3 protein	16374551; 21687937; 23326189; 24386346; 25125499;
C018021	cobaltous chloride	cobaltous chloride results in increased cleavage of CASP3 protein	22172632
C018021	cobaltous chloride	cobaltous chloride results in increased expression of and results in increased activity of CASP3 protein	14741615
C018021	cobaltous chloride	cobaltous chloride results in increased expression of and results in increased stability of CASP3 protein	20974702
C018021	cobaltous chloride	ginsenoside Rg1 inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	24386346
C018021	cobaltous chloride	lysophosphatidylethanolamine analog inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	25125499
C018021	cobaltous chloride	nickel chloride promotes the reaction [cobaltous chloride results in increased cleavage of CASP3 protein]	22172632
C018021	cobaltous chloride	TP53 protein promotes the reaction [cobaltous chloride results in increased activity of CASP3 protein]	21687937
C018021	cobaltous chloride	Acetylcysteine inhibits the reaction [POMC protein promotes the reaction [cobaltous chloride results in increased activity of CASP3 protein]]	24412703
C018021	cobaltous chloride	cobaltous chloride results in increased activity of CASP3 protein	23251428; 24412703;
C018021	cobaltous chloride	lysophosphatidic acid analog inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	23251428
C018021	cobaltous chloride	lysophosphatidic acid inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	23251428
C018021	cobaltous chloride	POMC protein promotes the reaction [cobaltous chloride results in increased activity of CASP3 protein]	24412703
C018021	cobaltous chloride	4-phenylbutyric acid inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	21804221
C018021	cobaltous chloride	[acetyl-aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to cobaltous chloride	11891799
C018021	cobaltous chloride	Acetylcysteine inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	21804221
C018021	cobaltous chloride	Acetylcysteine inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C018021	cobaltous chloride	cobaltous chloride results in decreased expression of CASP3 protein	29155206
C018021	cobaltous chloride	cobaltous chloride results in increased activity of CASP3 protein	11078377; 18442013; 19156866; 21804221; 21998720;
C018021	cobaltous chloride	cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein	21998720
C018021	cobaltous chloride	cobaltous chloride results in increased expression of CASP3 protein	19520152; 30551423;
C018021	cobaltous chloride	cobaltous chloride results in increased expression of CASP3 protein modified form	21925238
C018021	cobaltous chloride	DDAH2 protein promotes the reaction [Tretinoin inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]]	19156866
C018021	cobaltous chloride	Plant Extracts inhibits the reaction [cobaltous chloride results in increased expression of CASP3 protein]	30551423
C018021	cobaltous chloride	Protein Kinase Inhibitors inhibits the reaction [cobaltous chloride results in increased expression of CASP3 protein modified form]	21925238
C018021	cobaltous chloride	SB 203580 inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C018021	cobaltous chloride	scutellarin inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	18442013
C018021	cobaltous chloride	sodium bisulfide inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C018021	cobaltous chloride	Tretinoin inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	19156866
C018021	cobaltous chloride	U 0126 inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C060728	cobalt oxide	cobalt oxide results in increased activity of CASP3 protein	23326189
C060728	cobalt oxide	cobalt oxide results in increased cleavage of CASP3 protein	25639670
C060728	cobalt oxide	cobalt oxide results in increased expression of CASP3 protein	25437709
C026305	cobalt sulfate	cobalt sulfate results in decreased expression of CASP3 protein	25310813
D003042	Cocaine	Cocaine results in increased expression of CASP3 protein	16686379
D003042	Cocaine	ADCYAP1 protein modified form affects the reaction [Cocaine results in increased cleavage of CASP3 protein]	29673861
D003042	Cocaine	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide affects the reaction [Cocaine results in increased cleavage of CASP3 protein]	29673861
D003042	Cocaine	Cocaine affects the expression of CASP3 mRNA	15681117
D003042	Cocaine	Cocaine results in increased cleavage of CASP3 protein	29673861; 30393195;
D003042	Cocaine	IL6 protein affects the reaction [Cocaine results in increased cleavage of CASP3 protein]	29673861
D003042	Cocaine	PRKCD protein affects the reaction [Cocaine results in increased cleavage of CASP3 protein]	30393195
D003042	Cocaine	rottlerin inhibits the reaction [Cocaine results in increased cleavage of CASP3 protein]	30393195
D003042	Cocaine	TNF protein affects the reaction [Cocaine results in increased cleavage of CASP3 protein]	29673861
D003042	Cocaine	TNF protein affects the reaction [IL6 protein affects the reaction [Cocaine results in increased cleavage of CASP3 protein]]	29673861
D003042	Cocaine	Cocaine affects the expression of CASP3 protein	16179556
D003042	Cocaine	Cocaine results in increased activity of CASP3 protein	10604926; 11392460; 12639677; 15365088; 16638611; 17084983; 17635674; 18974856; 20600547;
D003042	Cocaine	Cocaine results in increased cleavage of and results in increased activity of CASP3 protein	19183502
D003042	Cocaine	Cocaine results in increased cleavage of CASP3 protein	14741756
D003042	Cocaine	[Heroin co-treated with Cocaine] results in increased activity of CASP3 protein	20600547
D003042	Cocaine	Heroin promotes the reaction [Cocaine results in increased activity of CASP3 protein]	20600547
D003042	Cocaine	SB 203580 inhibits the reaction [Cocaine results in increased activity of CASP3 protein]	15365088
C463759	codonoposide	codonoposide results in increased activity of CASP3 protein	15863893
C024989	coenzyme Q10	coenzyme Q10 inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	20510337
C024989	coenzyme Q10	coenzyme Q10 inhibits the reaction [APP protein results in increased cleavage of CASP3 protein]	22186599
C024989	coenzyme Q10	coenzyme Q10 inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	27087047
D003078	Colchicine	Colchicine results in increased activity of CASP3 protein	22342440
D003078	Colchicine	alsterpaullone inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	20300959
D003078	Colchicine	alvocidib inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	12941380
D003078	Colchicine	Colchicine results in increased activity of CASP3 protein	12941380; 15005753; 16478524; 20300959;
D003078	Colchicine	Colchicine results in increased cleavage of CASP3 protein	20624997
D003078	Colchicine	Colchicine results in increased expression of CASP3 mRNA	18255150; 19815060;
D003078	Colchicine	Lithium inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	15005753
D003078	Colchicine	N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	20300959
D003078	Colchicine	SB 216763 inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	20300959
D003078	Colchicine	Colchicine results in increased activity of CASP3 protein	12576187
D005576	Colforsin	Colforsin results in increased activity of CASP3 protein	20131233; 31278978;
D005576	Colforsin	KT 5720 inhibits the reaction [Colforsin results in increased activity of CASP3 protein]	20131233
D005576	Colforsin	Colforsin inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21745194
D005576	Colforsin	Colforsin inhibits the reaction [Puromycin Aminonucleoside results in increased activity of CASP3 protein]	16396944
D003091	Colistin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rhodioloside inhibits the reaction [Colistin results in increased activity of and results in increased cleavage of CASP3 protein]]	28465020
D003091	Colistin	chrysin inhibits the reaction [Colistin results in increased expression of CASP3 protein]	30273961
D003091	Colistin	[Colistin co-treated with Anisomycin] results in increased cleavage of CASP3 protein	28842171
D003091	Colistin	Colistin results in increased activity of and results in increased cleavage of CASP3 protein	28465020
D003091	Colistin	Colistin results in increased expression of CASP3 protein	30138604; 30273961;
D003091	Colistin	Curcumin inhibits the reaction [Colistin results in increased expression of CASP3 protein]	30138604
D003091	Colistin	rhodioloside inhibits the reaction [Colistin results in increased activity of and results in increased cleavage of CASP3 protein]	28465020
C036978	concanamycin A	concanamycin A inhibits the reaction [enterotoxin C, staphylococcal analog results in increased activity of CASP3 protein]	27742270
C036978	concanamycin A	concanamycin A inhibits the reaction [enterotoxin C, staphylococcal results in increased activity of CASP3 protein]	27742270
C447284	conocarpan	conocarpan results in increased cleavage of CASP3 protein	31054997
C447284	conocarpan	SAR7334 inhibits the reaction [conocarpan results in increased cleavage of CASP3 protein]	31054997
D003300	Copper	Copper results in increased expression of CASP3 mRNA	25461751
D003300	Copper	Copper results in increased activity of CASP3 protein	25562835
D003300	Copper	Inositol inhibits the reaction [Copper results in increased activity of CASP3 protein]	25562835
D003300	Copper	Chitosan metabolite inhibits the reaction [Copper results in increased activity of CASP3 protein]	25542178
D003300	Copper	[Copper binds to Isatin binds to 2-(2-aminoethyl)pyridine] which results in increased cleavage of CASP3 protein	17327230
D003300	Copper	[Copper binds to Isatin binds to trimethylenediamine] which results in increased cleavage of CASP3 protein	17327230
D003300	Copper	Copper inhibits the reaction [IAPP protein results in increased cleavage of CASP3 protein]	23793354
D003300	Copper	Copper results in increased activity of CASP3 protein	25542178
D003300	Copper	Copper results in increased expression of CASP3 protein	16246896; 16962711;
D003300	Copper	[Disulfiram binds to Copper] which results in increased activity of CASP3 protein	24690739
D003300	Copper	[[Ditiocarb binds to Copper] which affects the localization of CYCS protein] promotes the reaction [[[CYCS protein binds to APAF1 protein binds to CASP9 protein] which results in increased metabolism of and results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein]	22951949
D003300	Copper	[NSC 689534 binds to Copper] which results in increased activity of CASP3 protein	20971185
D003300	Copper	[pyrrolidine dithiocarbamic acid binds to Copper] which results in increased activity of CASP3 protein	18671963
D003300	Copper	[Thiosemicarbazones binds to Copper] which results in decreased activity of CASP3 protein	20931265
D003300	Copper	Copper analog results in increased cleavage of CASP3 protein	21319953; 22000994;
D003300	Copper	Copper analog results in increased expression of and results in increased cleavage of CASP3 protein	21319953
D003300	Copper	[Copper co-treated with Cholesterol] results in increased activity of CASP3 protein	17134702
D003300	Copper	[Copper Sulfate results in increased abundance of Copper] which results in increased expression of CASP3 mRNA	31491480
D003300	Copper	[Copper Sulfate results in increased abundance of Copper] which results in increased expression of CASP3 protein	31491480
D003300	Copper	Copper results in increased activity of CASP3 protein	16672322
D003300	Copper	pyrazolanthrone inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
D003300	Copper	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
D003300	Copper	SB 203580 inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
D003300	Copper	U 0126 inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
D003300	Copper	Acetylcysteine inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
D003300	Copper	Acetylcysteine inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased cleavage of CASP3 protein]	22085843
D003300	Copper	bathocuproine sulfonate inhibits the reaction [[Copper binds to neocuproine] which results in increased activity of CASP3 protein]	18056745
D003300	Copper	bathocuproine sulfonate inhibits the reaction [[pyrrolidine dithiocarbamic acid co-treated with Copper] results in increased activity of CASP3 protein]	10941151
D003300	Copper	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
D003300	Copper	[Copper binds to neocuproine] which results in increased activity of CASP3 protein	18056745
D003300	Copper	[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein	22085843
D003300	Copper	[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased cleavage of CASP3 protein	22085843
D003300	Copper	[Copper deficiency co-treated with tetrathiomolybdate] results in increased cleavage of CASP3 protein	22276220
D003300	Copper	[Copper deficiency co-treated with tetrathiomolybdate] results in increased expression of CASP3 protein	22276220
D003300	Copper	Copper deficiency results in increased activity of CASP3 protein	22362149
D003300	Copper	Copper results in increased expression of CASP3 mRNA	22465980
D003300	Copper	Copper results in increased expression of CASP3 protein	30556269
D003300	Copper	MAPK1 protein affects the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
D003300	Copper	[pyrrolidine dithiocarbamic acid co-treated with Copper] results in increased activity of CASP3 protein	10941151
C464760	copper-1,10-phenanthroline	Acetylcysteine inhibits the reaction [[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein]	30590774
C464760	copper-1,10-phenanthroline	copper-1,10-phenanthroline results in increased cleavage of CASP3 protein	24638265
C464760	copper-1,10-phenanthroline	[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein	30590774
C464760	copper-1,10-phenanthroline	XIAP protein inhibits the reaction [[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein]	30590774
C515714	copper (N-2-hydroxyacetophenone)glycinate	copper (N-2-hydroxyacetophenone)glycinate results in increased activity of CASP3 protein	21409205
C515714	copper (N-2-hydroxyacetophenone)glycinate	copper (N-2-hydroxyacetophenone)glycinate promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	16289015
D019327	Copper Sulfate	Copper Sulfate results in increased activity of CASP3 protein	17640809
D019327	Copper Sulfate	Acetylcysteine inhibits the reaction [Copper Sulfate results in increased expression of CASP3 mRNA]	30389602
D019327	Copper Sulfate	[Arsenic Trioxide co-treated with Copper Sulfate] results in increased expression of CASP3 mRNA	29569195; 30543957;
D019327	Copper Sulfate	[Arsenic Trioxide co-treated with Copper Sulfate] results in increased expression of CASP3 protein	29569195; 30543957;
D019327	Copper Sulfate	[Copper Sulfate co-treated with Arsenic Trioxide] results in increased expression of CASP3 protein	29778937
D019327	Copper Sulfate	Copper Sulfate results in increased expression of CASP3 mRNA	29569195; 30389602; 30543957;
D019327	Copper Sulfate	Copper Sulfate results in increased expression of CASP3 protein	29569195; 29778937; 30389602; 30543957;
D019327	Copper Sulfate	Copper Sulfate results in increased activity of CASP3 protein	21765606
D019327	Copper Sulfate	Copper Sulfate results in increased expression of CASP3 mRNA	19549813
D019327	Copper Sulfate	GW0742 inhibits the reaction [Copper Sulfate results in increased activity of CASP3 protein]	21765606
D019327	Copper Sulfate	[Copper Sulfate results in increased abundance of Copper] which results in increased expression of CASP3 mRNA	31491480
D019327	Copper Sulfate	[Copper Sulfate results in increased abundance of Copper] which results in increased expression of CASP3 protein	31491480
D019327	Copper Sulfate	andrographolide inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]	20946909
D019327	Copper Sulfate	andrographolide promotes the reaction [Penicillamine inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]]	20946909
D019327	Copper Sulfate	Copper Sulfate inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	28442376
D019327	Copper Sulfate	Copper Sulfate results in increased cleavage of CASP3 protein	20946909
D019327	Copper Sulfate	Copper Sulfate results in increased expression of CASP3 mRNA	18369385
D019327	Copper Sulfate	Copper Sulfate results in increased secretion of CASP3 protein	30431687
D019327	Copper Sulfate	Curcumin analog inhibits the reaction [Copper Sulfate results in increased secretion of CASP3 protein]	30431687
D019327	Copper Sulfate	Curcumin inhibits the reaction [Copper Sulfate results in increased secretion of CASP3 protein]	30431687
D019327	Copper Sulfate	Deferoxamine inhibits the reaction [Copper Sulfate results in increased secretion of CASP3 protein]	30431687
D019327	Copper Sulfate	Penicillamine inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]	20946909
D019327	Copper Sulfate	Penicillamine promotes the reaction [andrographolide inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]]	20946909
D019327	Copper Sulfate	Copper Sulfate affects the expression of CASP3 mRNA	26368670
C034384	coptisine	coptisine analog results in increased cleavage of CASP3 protein	30472432
C058120	cordycepin	Acetylcysteine inhibits the reaction [cordycepin results in increased activity of CASP3 protein]	21310227
C058120	cordycepin	cordycepin results in increased activity of CASP3 protein	21310227; 21933677;
C058120	cordycepin	cordycepin results in increased expression of CASP3 mRNA	28987792
C532843	coronarin D	coronarin D results in increased expression of CASP3 protein modified form	29968959
C532843	coronarin D	pyrazolanthrone inhibits the reaction [coronarin D results in increased expression of CASP3 protein modified form]	29968959
C113861	corosolic acid	corosolic acid results in decreased expression of CASP3 mRNA	28506699
C113861	corosolic acid	corosolic acid results in increased cleavage of CASP3 protein	28506699
C113861	corosolic acid	corosolic acid inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D003345	Corticosterone	Corticosterone inhibits the reaction [Deoxyglucose results in increased activity of CASP3 protein]	15755911
D003345	Corticosterone	Corticosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911; 26915917;
D003345	Corticosterone	Corticosterone inhibits the reaction [Palmitates results in increased activity of CASP3 protein]	15755911
D003345	Corticosterone	Corticosterone results in increased cleavage of CASP3 protein	29625166
D003345	Corticosterone	Corticosterone results in increased expression of CASP3 mRNA	27988398
D003345	Corticosterone	Estradiol inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]	29625166
D003345	Corticosterone	Estradiol promotes the reaction [Testosterone inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]]	29625166
D003345	Corticosterone	Mifepristone inhibits the reaction [Corticosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	15755911; 26915917;
D003345	Corticosterone	so-ochim-tang-gamibang inhibits the reaction [Corticosterone results in increased expression of CASP3 mRNA]	27988398
D003345	Corticosterone	Testosterone inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]	29625166
D003345	Corticosterone	Testosterone promotes the reaction [Estradiol inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]]	29625166
D003348	Cortisone	Cortisone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D003367	Cotinine	Cotinine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22687995
D003373	Coumaric Acids	Coumaric Acids results in increased cleavage of CASP3 protein	25824411
D003375	Coumestrol	Coumestrol results in increased expression of CASP3 protein	28986287
D003375	Coumestrol	Coumestrol results in increased expression of CASP3 protein	19165469
C408982	CPG-oligonucleotide	CPG-oligonucleotide results in increased activity of CASP3 protein	17046822
D003401	Creatine	[Creatine co-treated with Ribose] results in decreased activity of CASP3 protein	21220914
D000077547	Crizotinib	BCL2L11 protein affects the reaction [Crizotinib results in increased cleavage of CASP3 protein]	22729845
D000077547	Crizotinib	Crizotinib results in increased activity of CASP3 protein	23707608
D000077547	Crizotinib	Crizotinib results in increased cleavage of CASP3 protein	22729845
D000077547	Crizotinib	MET gene mutant form promotes the reaction [Crizotinib results in increased cleavage of CASP3 protein]	22729845
D000077547	Crizotinib	[Crizotinib co-treated with 9-(6-aminopyridin-3-yl)-1-(3-(trifluoromethyl)phenyl)benzo(h)(1,6)naphthyridin-2(1H)-one] results in increased cleavage of CASP3 protein	22789543
C029036	crocin	crocin results in increased cleavage of CASP3 protein	30672053
C029036	crocin	MYCN protein inhibits the reaction [crocin results in increased cleavage of CASP3 protein]	30672053
C029036	crocin	crocin affects the reaction [Ethanol results in increased expression of CASP3 mRNA]	25637687
C029036	crocin	crocin inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	25899501
C029036	crocin	crocin inhibits the reaction [Diazinon results in increased activity of CASP3 protein]	23523949
C029036	crocin	crocin inhibits the reaction [Diazinon results in increased cleavage of CASP3 protein]	27353299
C029036	crocin	crocin inhibits the reaction [Diazinon results in increased expression of CASP3 protein modified form]	23523949
C029036	crocin	crocin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	26807765
C029036	crocin	crocin inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	25637687
D003436	Croton Oil	[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein	16517061
D003436	Croton Oil	amarogentin inhibits the reaction [[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein]	16517061
D003436	Croton Oil	Plant Extracts inhibits the reaction [[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein]	16517061
C417305	(Cr(salprn)(H2O)2)ClO4	AG 1879 inhibits the reaction [(Cr(salprn)(H2O)2)ClO4 results in increased activity of CASP3 protein]	15124906
C417305	(Cr(salprn)(H2O)2)ClO4	(Cr(salprn)(H2O)2)ClO4 results in increased activity of CASP3 protein	15124906
C037886	cryptotanshinone	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [cryptotanshinone results in increased cleavage of CASP3 protein]	28600121
C037886	cryptotanshinone	cryptotanshinone results in increased activity of CASP3 protein	26564229
C037886	cryptotanshinone	cryptotanshinone results in increased cleavage of CASP3 protein	28600121
D065366	Cryptoxanthins	Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]	18636177
D065366	Cryptoxanthins	Cryptoxanthins results in increased expression of CASP3 mRNA	18636177
D065366	Cryptoxanthins	[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]	18636177
D065366	Cryptoxanthins	[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]	18636177
D065366	Cryptoxanthins	Cycloheximide inhibits the reaction [Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Cycloheximide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Cycloheximide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Cycloheximide inhibits the reaction [Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Dichlororibofuranosylbenzimidazole inhibits the reaction [Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Dichlororibofuranosylbenzimidazole inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Dichlororibofuranosylbenzimidazole inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Dichlororibofuranosylbenzimidazole inhibits the reaction [Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D065366	Cryptoxanthins	Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]	18636177
C102326	cucurbitacin E	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [cucurbitacin E results in increased cleavage of CASP3 protein]	27106530
C102326	cucurbitacin E	Acetylcysteine inhibits the reaction [cucurbitacin E results in increased cleavage of CASP3 protein]	27106530
C102326	cucurbitacin E	cucurbitacin E results in increased cleavage of CASP3 protein	27106530
C102326	cucurbitacin E	cucurbitacin E results in increased cleavage of CASP3 protein	27363783
C038106	cucurbitacin I	cucurbitacin I results in increased cleavage of CASP3 protein	24858077
C542041	cudraflavone B	cudraflavone B results in increased activity of CASP3 protein	23881456
C542041	cudraflavone B	Resveratrol inhibits the reaction [cudraflavone B results in increased activity of CASP3 protein]	23881456
C542041	cudraflavone B	sirtinol promotes the reaction [cudraflavone B results in increased activity of CASP3 protein]	23881456
C523076	CuFe2O4	CuFe2O4 results in increased activity of CASP3 protein	26918645
C523076	CuFe2O4	CuFe2O4 results in increased expression of CASP3 mRNA	26918645
C029892	cupric chloride	CAT protein inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C029892	cupric chloride	[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein	29803612
C029892	cupric chloride	cupric chloride results in decreased activity of CASP3 protein	22954531
C029892	cupric chloride	cupric chloride results in increased activity of CASP3 protein	22954531
C029892	cupric chloride	Ethanol inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C029892	cupric chloride	Mannitol inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C029892	cupric chloride	neocuproine inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C029892	cupric chloride	[prolinedithiocarbamate analog co-treated with cupric chloride] results in increased activity of CASP3 protein	21035945
C029892	cupric chloride	Thiourea inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C029892	cupric chloride	cupric chloride results in decreased expression of CASP3 mRNA	24650576
C029892	cupric chloride	cupric chloride results in increased expression of CASP3 protein	23313662; 24170445;
C029892	cupric chloride	cupric chloride results in increased activity of CASP3 protein	16339863
C029892	cupric chloride	cupric chloride results in increased activity of CASP3 protein	20435356
C029892	cupric chloride	cupric chloride results in decreased expression of CASP3 protein	22699969
C029892	cupric chloride	bathocuproine sulfonate inhibits the reaction [[Disulfiram binds to cupric chloride] which results in increased activity of CASP3 protein]	11239917
C029892	cupric chloride	[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased cleavage of CASP3 protein	20920558
C029892	cupric chloride	cupric chloride results in increased activity of CASP3 protein	18056745
C029892	cupric chloride	[Disulfiram binds to cupric chloride] which results in increased activity of CASP3 protein	11239917
C029892	cupric chloride	MAPK8 protein promotes the reaction [[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased activity of CASP3 protein]	20920558
C029892	cupric chloride	pyrazolanthrone inhibits the reaction [[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased cleavage of CASP3 protein]	20920558
C030973	cupric oxide	cupric oxide results in decreased activity of CASP3 protein	22954531
D003474	Curcumin	Acetylcysteine inhibits the reaction [Curcumin results in increased activity of CASP3 protein]	17332930
D003474	Curcumin	AR protein affects the reaction [[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein]	27132804
D003474	Curcumin	[Arsenic Trioxide co-treated with Curcumin] results in increased expression of CASP3 protein	27430728
D003474	Curcumin	Arsenic Trioxide promotes the reaction [Curcumin results in increased expression of CASP3 protein modified form]	27430728
D003474	Curcumin	[bicalutamide co-treated with Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein	27132804
D003474	Curcumin	Curcumin analog results in increased activity of CASP3 protein	17041101; 26409325;
D003474	Curcumin	[Curcumin co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	20605902
D003474	Curcumin	[Curcumin co-treated with lonidamine] results in increased cleavage of CASP3 protein	20605902
D003474	Curcumin	[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein	27132804
D003474	Curcumin	[Curcumin co-treated with Sirolimus] results in increased activity of CASP3 protein	19373661
D003474	Curcumin	Curcumin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	30463061
D003474	Curcumin	Curcumin inhibits the reaction [quinocetone results in increased activity of CASP3 protein]	27375190
D003474	Curcumin	Curcumin inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	23710286
D003474	Curcumin	Curcumin promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27430728
D003474	Curcumin	Curcumin results in decreased activity of CASP3 protein	15095415; 21450334;
D003474	Curcumin	Curcumin results in decreased expression of CASP3 protein	17148446; 30935902;
D003474	Curcumin	Curcumin results in increased activity of CASP3	21595920
D003474	Curcumin	Curcumin results in increased activity of CASP3 protein	17041101; 17096185; 17332930; 17363495; 17640567; 17671742; 19235267; 19294764; 20127174; 21594647;
D003474	Curcumin	Curcumin results in increased cleavage of and results in increased activity of CASP3 protein	16023083
D003474	Curcumin	Curcumin results in increased cleavage of CASP3 protein	19401701; 21594647;
D003474	Curcumin	Curcumin results in increased expression of CASP3 mRNA	16101141; 23555722;
D003474	Curcumin	Curcumin results in increased expression of CASP3 protein	18555241
D003474	Curcumin	Curcumin results in increased expression of CASP3 protein modified form	27430728
D003474	Curcumin	Dihydrotestosterone inhibits the reaction [[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein]	27132804
D003474	Curcumin	Glutathione inhibits the reaction [Curcumin results in increased activity of CASP3 protein]	17640567
D003474	Curcumin	piperine inhibits the reaction [Curcumin results in decreased expression of CASP3 protein]	30935902
D003474	Curcumin	Vitamin E inhibits the reaction [Curcumin results in decreased expression of CASP3 protein]	30935902
D003474	Curcumin	zinc protoporphyrin inhibits the reaction [Curcumin inhibits the reaction [quinocetone results in increased activity of CASP3 protein]]	27375190
D003474	Curcumin	[Curcumin co-treated with gemcitabine] results in decreased expression of CASP3 protein	17440100
D003474	Curcumin	Curcumin results in decreased expression of CASP3 protein modified form	29571711
D003474	Curcumin	Curcumin results in increased activity of CASP3 protein	21397623; 21594647;
D003474	Curcumin	Curcumin results in increased cleavage of and results in increased activity of CASP3 protein	17277231; 17885582;
D003474	Curcumin	NFE2L2 gene mutant form inhibits the reaction [Curcumin results in decreased expression of CASP3 protein modified form]	29571711
D003474	Curcumin	[Curcumin analog co-treated with Hydrogels] inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	27288928
D003474	Curcumin	Curcumin analog inhibits the reaction [Copper Sulfate results in increased secretion of CASP3 protein]	30431687
D003474	Curcumin	Curcumin analog inhibits the reaction [Rotenone results in increased expression of CASP3 protein modified form]	27535828
D003474	Curcumin	Curcumin inhibits the reaction [AGT protein modified form results in increased cleavage of and results in increased activity of CASP3 protein]	26612707
D003474	Curcumin	Curcumin inhibits the reaction [Atrazine results in increased expression of CASP3 protein]	24863870
D003474	Curcumin	Curcumin inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	25963729
D003474	Curcumin	Curcumin inhibits the reaction [Colistin results in increased expression of CASP3 protein]	30138604
D003474	Curcumin	Curcumin inhibits the reaction [Copper Sulfate results in increased secretion of CASP3 protein]	30431687
D003474	Curcumin	Curcumin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	29315967
D003474	Curcumin	Curcumin inhibits the reaction [Peroxynitrous Acid results in increased cleavage of and results in increased activity of CASP3 protein]	20869986
D003474	Curcumin	Curcumin inhibits the reaction [Peroxynitrous Acid results in increased expression of CASP3 mRNA]	20869986
D003474	Curcumin	Curcumin inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	27966075
D003474	Curcumin	Curcumin inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	24952339
D003474	Curcumin	Curcumin inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	25541178
D003474	Curcumin	Curcumin inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	23267840
D003474	Curcumin	Curcumin inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	15569404
D003474	Curcumin	Curcumin results in decreased activity of CASP3 protein	17351913
D003474	Curcumin	Curcumin results in decreased cleavage of and results in decreased activity of CASP3 protein	26612707
D003474	Curcumin	[Resveratrol co-treated with Curcumin] inhibits the reaction [IL1B protein results in increased expression of CASP3 protein modified form]	19889203
C114438	cyanidin 3-O-glucoside	cyanidin 3-O-glucoside inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	24518827
C114438	cyanidin 3-O-glucoside	cyanidin 3-O-glucoside results in increased expression of CASP3 mRNA	30597948
C057862	cyanoginosin LR	cyanoginosin LR results in increased expression of CASP3 protein	24594009
C057862	cyanoginosin LR	Quercetin inhibits the reaction [cyanoginosin LR results in increased expression of CASP3 protein]	24594009
C057862	cyanoginosin LR	cyanoginosin LR results in increased expression of CASP3 mRNA	22539157
C057862	cyanoginosin LR	cyanoginosin LR results in increased activity of CASP3 protein	21684301
C057862	cyanoginosin LR	cyanoginosin LR results in increased expression of CASP3 mRNA	23891578; 28414124;
C057862	cyanoginosin LR	cyanoginosin LR results in increased expression of CASP3 protein	23454832; 23891578; 28414124;
C057862	cyanoginosin LR	sulforafan inhibits the reaction [cyanoginosin LR results in increased activity of CASP3 protein]	21684301
C057862	cyanoginosin LR	cyanoginosin LR results in increased cleavage of CASP3 protein	31157505
C057862	cyanoginosin LR	pifithrin inhibits the reaction [cyanoginosin LR results in increased cleavage of CASP3 protein]	31157505
D006152	Cyclic GMP	Cyclic GMP affects the reaction [Nitric Oxide results in decreased activity of CASP3 protein]	9388267
D003513	Cycloheximide	BCL2 protein inhibits the reaction [[Cycloheximide co-treated with TNFSF10 protein] results in increased activity of CASP3 protein]	22343715
D003513	Cycloheximide	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Cycloheximide co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein]	18222423
D003513	Cycloheximide	[Cycloheximide co-treated with TNF] results in increased cleavage of and results in increased activity of CASP3 protein	12925536
D003513	Cycloheximide	[Cycloheximide co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	22343715
D003513	Cycloheximide	Cycloheximide promotes the reaction [FAS protein results in increased activity of CASP3 protein]	12760867
D003513	Cycloheximide	Cycloheximide results in increased activity of CASP3 protein	15685448
D003513	Cycloheximide	IFI6 protein inhibits the reaction [Cycloheximide results in increased activity of CASP3 protein]	15685448
D003513	Cycloheximide	ITPK1 inhibits the reaction [[Cycloheximide co-treated with TNF] results in increased cleavage of and results in increased activity of CASP3 protein]	12925536
D003513	Cycloheximide	Cycloheximide inhibits the reaction [aluminum maltolate results in increased activity of CASP3 protein]	15537749
D003513	Cycloheximide	Cycloheximide inhibits the reaction [Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D003513	Cycloheximide	Cycloheximide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D003513	Cycloheximide	Cycloheximide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D003513	Cycloheximide	Cycloheximide inhibits the reaction [Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]]	17295206
D003513	Cycloheximide	Cycloheximide inhibits the reaction [Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	17295206
D003513	Cycloheximide	Cycloheximide inhibits the reaction [Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D003513	Cycloheximide	Cycloheximide results in increased activity of CASP3 protein	14502240
D003513	Cycloheximide	Cycloheximide results in increased activity of CASP3 protein	15860571
D003513	Cycloheximide	obeticholic acid promotes the reaction [Cycloheximide results in increased activity of CASP3 protein]	15860571
D003513	Cycloheximide	Butylated Hydroxyanisole inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased activity of CASP3 protein]	15950244
D003513	Cycloheximide	CAT protein inhibits the reaction [[SOD2 protein results in increased chemical synthesis of Hydrogen Peroxide] inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased cleavage of and results in increased activity of CASP3 protein]]	16910777
D003513	Cycloheximide	Masoprocol inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased activity of CASP3 protein]	15950244
D003513	Cycloheximide	[SOD2 protein results in increased chemical synthesis of Hydrogen Peroxide] inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased cleavage of and results in increased activity of CASP3 protein]	16910777
D003513	Cycloheximide	[TNF protein co-treated with Cycloheximide] results in increased activity of CASP3 protein	15950244
D003513	Cycloheximide	[TNF protein co-treated with Cycloheximide] results in increased cleavage of and results in increased activity of CASP3 protein	16910777
C500528	cyclohexyl carbamic acid 3'-carbamoylbiphenyl-3-yl ester	cyclohexyl carbamic acid 3'-carbamoylbiphenyl-3-yl ester inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31256211
C013905	cyclopentenone	cyclopentenone results in increased cleavage of and results in increased activity of CASP3 protein	18383863
D003520	Cyclophosphamide	BCL2 protein inhibits the reaction [Cyclophosphamide results in increased activity of CASP3 protein]	11723234
D003520	Cyclophosphamide	[Bortezomib co-treated with oblimersen co-treated with Cyclophosphamide] results in increased activity of CASP3 protein	16675587
D003520	Cyclophosphamide	CASP3 protein alternative form results in decreased susceptibility to Cyclophosphamide	17020986
D003520	Cyclophosphamide	Cyclophosphamide results in increased cleavage of and results in increased activity of CASP3 protein	17898787
D003520	Cyclophosphamide	Cyclophosphamide results in increased expression of CASP3 mRNA	14503796
D003520	Cyclophosphamide	Cyclophosphamide results in increased expression of CASP3 protein	30506662
D003520	Cyclophosphamide	ganoderic acid A inhibits the reaction [Cyclophosphamide results in increased expression of CASP3 protein]	30506662
C000543	cyclopiazonic acid	cyclopiazonic acid inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
D016572	Cyclosporine	cobaltous chloride inhibits the reaction [Cyclosporine results in increased cleavage of and results in increased activity of CASP3 protein]	22343435
D016572	Cyclosporine	Cyclosporine inhibits the reaction [[brucine results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein]	16443926
D016572	Cyclosporine	Cyclosporine inhibits the reaction [FAS protein results in increased activity of CASP3 protein]	15548389
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Mustard Gas results in increased cleavage of and results in increased activity of CASP3 protein]	16935404
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Paraoxon results in increased activity of CASP3 protein]	11032765
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Parathion results in increased activity of CASP3 protein]	11032765
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	26884717
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	12871656
D016572	Cyclosporine	Cyclosporine inhibits the reaction [triphenyl phosphite results in increased activity of CASP3 protein]	11032765
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Zinc Oxide analog results in increased activity of CASP3 protein]	27544635
D016572	Cyclosporine	Cyclosporine results in increased activity of CASP3 protein	22700542
D016572	Cyclosporine	Cyclosporine results in increased cleavage of and results in increased activity of CASP3 protein	22343435
D016572	Cyclosporine	Palmitic Acid promotes the reaction [Cyclosporine results in increased activity of CASP3 protein]	22700542
D016572	Cyclosporine	Cyclosporine inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased activity of CASP3 protein]	10205001
D016572	Cyclosporine	Cyclosporine inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	10205001
D016572	Cyclosporine	Cyclosporine results in increased activity of CASP3 protein	15207740; 22416070;
D016572	Cyclosporine	Cyclosporine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Lithium Carbonate results in increased activity of CASP3 protein]	27588890
D016572	Cyclosporine	Cyclosporine inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D016572	Cyclosporine	Cyclosporine results in increased activity of CASP3 protein	17166486; 17385075;
D016572	Cyclosporine	NGF protein inhibits the reaction [Cyclosporine results in increased activity of CASP3 protein]	17385075
C072247	cyclo(Trp-Asp-Pro-Val-Leu)	[cyclo(Trp-Asp-Pro-Val-Leu) binds to and results in decreased activity of EDNRA protein] affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	14736733
C072247	cyclo(Trp-Asp-Pro-Val-Leu)	cyclo(Trp-Asp-Pro-Val-Leu) inhibits the reaction [Cisplatin results in increased expression of CASP3]	24632086
C037304	cyhalothrin	cyhalothrin results in increased expression of CASP3 mRNA	29727961
C089595	cylindrospermopsin	cylindrospermopsin results in increased cleavage of CASP3 protein	30500929
C089595	cylindrospermopsin	cylindrospermopsin results in increased expression of CASP3 mRNA	23726867
C017160	cypermethrin	cypermethrin results in increased activity of CASP3 protein	21840035
C017160	cypermethrin	cypermethrin results in increased expression of CASP3 mRNA	21316461
C017160	cypermethrin	cypermethrin inhibits the reaction [Docosahexaenoic Acids results in increased cleavage of and results in increased activity of CASP3 protein]	11341974
C017160	cypermethrin	cypermethrin results in increased expression of CASP3 mRNA	27704156
C017160	cypermethrin	[cypermethrin co-treated with Chlorpyrifos co-treated with profenofos] results in increased cleavage of CASP3 protein	21987380
C017160	cypermethrin	cypermethrin results in increased cleavage of and results in increased activity of CASP3 protein	22048644
C017160	cypermethrin	cypermethrin results in increased expression of CASP3 protein	25370934
C017160	cypermethrin	HBEGF protein inhibits the reaction [cypermethrin results in increased cleavage of and results in increased activity of CASP3 protein]	22048644
C108338	cyprodinil	cyprodinil results in increased expression of CASP3 mRNA	22880100
C108338	cyprodinil	[pyrimethanil co-treated with cyprodinil co-treated with fludioxonil] results in increased expression of CASP3 mRNA	22880100
D015853	Cysteine Proteinase Inhibitors	Cysteine Proteinase Inhibitors results in decreased activity of CASP3 protein	17136323
D003561	Cytarabine	Cytarabine results in increased activity of CASP3 protein	16581899
D003561	Cytarabine	Hydrocortisone inhibits the reaction [Cytarabine results in increased activity of CASP3 protein]	16581899
D003561	Cytarabine	BCL2L1 protein inhibits the reaction [Cytarabine results in increased cleavage of and results in increased activity of CASP3 protein]	8840993
D003561	Cytarabine	BCL2 protein inhibits the reaction [Cytarabine results in increased cleavage of and results in increased activity of CASP3 protein]	8840993
D003561	Cytarabine	[Cytarabine co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	12780785
D003561	Cytarabine	Cytarabine results in increased activity of CASP3 protein	12781215; 25003661;
D003561	Cytarabine	Cytarabine results in increased cleavage of and results in increased activity of CASP3 protein	8840993
D003561	Cytarabine	Cytarabine results in increased expression of CASP3 protein	14766721; 22212197;
D003561	Cytarabine	Cytarabine results in increased activity of CASP3 protein	12781215
D003566	Cytidine Diphosphate Choline	Cytidine Diphosphate Choline results in decreased expression of CASP3 protein	12443983
D003571	Cytochalasin B	Cytochalasin B results in increased cleavage of CASP3 protein	27640744
D003606	Dacarbazine	Dacarbazine results in increased cleavage of and results in increased activity of CASP3 protein	17410615
D003606	Dacarbazine	TNFSF10 protein promotes the reaction [Dacarbazine results in increased cleavage of and results in increased activity of CASP3 protein]	17410615
D003609	Dactinomycin	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Dactinomycin results in increased cleavage of and results in increased activity of CASP3 protein]	14640974
D003609	Dactinomycin	Dactinomycin results in increased cleavage of and results in increased activity of CASP3 protein	14640974
D003609	Dactinomycin	Dactinomycin inhibits the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
D003609	Dactinomycin	Dactinomycin promotes the reaction [TNF results in increased activity of CASP3 protein]	16492401
D003609	Dactinomycin	Dactinomycin results in decreased expression of CASP3 mRNA	16001973
D003609	Dactinomycin	Dactinomycin results in increased activity of CASP3 protein	10663630
D003609	Dactinomycin	[TNF co-treated with Dactinomycin] results in increased activity of CASP3 protein	16492401
D003609	Dactinomycin	[TNF protein co-treated with Dactinomycin] results in increased activity of CASP3 protein	21496118
D003609	Dactinomycin	Dactinomycin results in increased cleavage of and results in increased activity of CASP3 protein	26670606
D003609	Dactinomycin	[Dactinomycin co-treated with TNF protein] results in increased activity of CASP3 protein	23300732
D003609	Dactinomycin	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Dactinomycin] results in increased activity of CASP3 protein]]	9706149
D003609	Dactinomycin	[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Dactinomycin] results in increased activity of CASP3 protein]	9706149
C531198	dactolisib	dactolisib results in increased activity of CASP3 protein	21372221
C004742	daidzein	daidzein results in increased activity of CASP3 protein	12791511
C004742	daidzein	daidzein results in increased expression of CASP3 protein	29217487
C028972	dan-shen root extract	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [dan-shen root extract inhibits the reaction [IGF2 protein mutant form results in increased cleavage of and results in increased activity of CASP3 protein]]	23419388
C028972	dan-shen root extract	dan-shen root extract inhibits the reaction [IGF2 protein mutant form results in increased cleavage of and results in increased activity of CASP3 protein]	23419388
C028972	dan-shen root extract	Fulvestrant inhibits the reaction [dan-shen root extract inhibits the reaction [IGF2 protein mutant form results in increased cleavage of and results in increased activity of CASP3 protein]]	23419388
C004315	danthron	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [danthron results in increased activity of CASP3 protein]	21126053
C004315	danthron	danthron results in increased activity of and results in increased expression of CASP3 protein	21126053
C004315	danthron	danthron results in increased expression of CASP3 mRNA	21126053
D003620	Dantrolene	Dantrolene inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	23022152
D003620	Dantrolene	Dantrolene inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17079870
C080598	dapoxetine	dapoxetine inhibits the reaction [Testosterone results in decreased expression of CASP3 protein modified form]	27687055
C109268	darbufelone	darbufelone results in increased activity of CASP3 protein	20352217
C515055	darinaparsin	darinaparsin results in increased activity of CASP3 protein	18633430; 23426167;
C515055	darinaparsin	darinaparsin results in increased cleavage of and results in increased activity of CASP3 protein	22535156
C515055	darinaparsin	darinaparsin results in increased cleavage of CASP3 protein	25316819
D000069439	Dasatinib	Arsenic Trioxide promotes the reaction [Dasatinib results in increased cleavage of CASP3 protein]	29266867
D000069439	Dasatinib	Calcium deficiency inhibits the reaction [Dasatinib results in increased activity of CASP3 protein]	29803841
D000069439	Dasatinib	[Dasatinib co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	29266867
D000069439	Dasatinib	Dasatinib promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	29266867
D000069439	Dasatinib	Dasatinib promotes the reaction [Loratadine results in increased activity of CASP3 protein]	20570632
D000069439	Dasatinib	Dasatinib promotes the reaction [Terfenadine results in increased activity of CASP3 protein]	20570632
D000069439	Dasatinib	Dasatinib results in increased activity of CASP3 protein	19100678; 29803841;
D000069439	Dasatinib	Dasatinib results in increased cleavage of CASP3 protein	18550857; 20682659; 29266867;
D003630	Daunorubicin	[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 mRNA	19421372
D003630	Daunorubicin	[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 protein	19421372
D003630	Daunorubicin	bromotetrandrine promotes the reaction [[ferric oxide co-treated with ferrous oxide co-treated with Daunorubicin] results in increased expression of CASP3 protein]	19421372
D003630	Daunorubicin	bromotetrandrine promotes the reaction [[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 mRNA]	19421372
D003630	Daunorubicin	Daunorubicin affects the expression of CASP3 mRNA	27780733
D003630	Daunorubicin	[Daunorubicin co-treated with bromotetrandrine co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 mRNA	21720514
D003630	Daunorubicin	[Daunorubicin co-treated with bromotetrandrine co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 protein	21720514
D003630	Daunorubicin	[Daunorubicin co-treated with bromotetrandrine] results in increased expression of CASP3 mRNA	21720514
D003630	Daunorubicin	[Daunorubicin co-treated with bromotetrandrine] results in increased expression of CASP3 protein	21720514
D003630	Daunorubicin	[Daunorubicin co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 mRNA	19918366
D003630	Daunorubicin	[Daunorubicin co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	12780785
D003630	Daunorubicin	Daunorubicin results in increased activity of CASP3 protein	10766178; 17699722; 17965967; 19698806; 25003661;
D003630	Daunorubicin	[Magnetite Nanoparticles co-treated with Daunorubicin] promotes the reaction [bromotetrandrine results in increased expression of CASP3 protein]	19421372
D003630	Daunorubicin	[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 mRNA	19421372
D003630	Daunorubicin	[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 protein	19421372
D003630	Daunorubicin	Magnetite Nanoparticles promotes the reaction [[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 mRNA]	19421372
D003630	Daunorubicin	Daunorubicin results in increased cleavage of CASP3 protein	22252735
D003630	Daunorubicin	pyrazolanthrone inhibits the reaction [Daunorubicin results in increased cleavage of CASP3 protein]	22252735
D003634	DDT	DDT results in increased activity of CASP3 protein	15603917
D003634	DDT	SB 203580 inhibits the reaction [DDT results in increased activity of CASP3 protein]	15603917
D003634	DDT	DDT inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	10200566
D003634	DDT	DDT results in decreased activity of CASP3 protein	10200566
C010902	decabromobiphenyl ether	decabromobiphenyl ether results in increased activity of CASP3 protein	22485137
C010902	decabromobiphenyl ether	decabromobiphenyl ether results in increased cleavage of CASP3 protein	25462306
C010902	decabromobiphenyl ether	decabromobiphenyl ether results in increased expression of CASP3 protein	28572024; 31039416;
C017180	decamethrin	decamethrin results in increased activity of CASP3 protein	21555338
C017180	decamethrin	decamethrin results in increased cleavage of and results in increased activity of CASP3 protein	27553674
C017180	decamethrin	Rosiglitazone inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	27553674
C017180	decamethrin	decamethrin results in increased activity of CASP3 protein	24217896
C017180	decamethrin	decamethrin results in increased cleavage of and results in increased activity of CASP3 protein	30247739
C017180	decamethrin	salubrinal inhibits the reaction [decamethrin results in increased cleavage of and results in increased activity of CASP3 protein]	30247739
C017180	decamethrin	Acetylcysteine inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C017180	decamethrin	decamethrin results in increased cleavage of and results in increased activity of CASP3 protein	25359175
C017180	decamethrin	decamethrin results in increased cleavage of CASP3 protein	26588882
C017180	decamethrin	pyrazolanthrone inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C017180	decamethrin	SB 203580 inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C017180	decamethrin	Sirolimus inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C017180	decamethrin	Sirolimus promotes the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C017180	decamethrin	U 0126 inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
D000077209	Decitabine	[Decitabine affects the methylation of CASP3 gene] which affects the expression of CASP3 protein	18649362; 18649362;
D000077209	Decitabine	[Decitabine co-treated with Busulfan] results in increased activity of CASP3 protein	19732952
D000077209	Decitabine	[Decitabine co-treated with trichostatin A] results in increased activity of CASP3 protein	17019711
D000077209	Decitabine	Decitabine promotes the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17283156
D000077209	Decitabine	Decitabine promotes the reaction [IFNA2 protein results in increased cleavage of and results in increased activity of CASP3 protein]	17653094
D000077209	Decitabine	Decitabine promotes the reaction [IFNB1 protein results in increased cleavage of and results in increased activity of CASP3 protein]	17653094
D000077209	Decitabine	[Valproic Acid co-treated with Decitabine co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	21771726
D000077209	Decitabine	Decitabine results in increased expression of CASP3 protein modified form	27915011
D000077209	Decitabine	Decitabine inhibits the reaction [Benzene results in increased expression of CASP3 mRNA]	21143203
D000077209	Decitabine	Decitabine inhibits the reaction [Cadmium Chloride results in decreased cleavage of CASP3 protein]	22457795
D000077588	Deferasirox	Deferasirox results in increased activity of CASP3 protein	21439361
D000077588	Deferasirox	Deferasirox results in increased expression of CASP3 protein	21439361
D003676	Deferoxamine	Deferoxamine promotes the reaction [manganese chloride results in increased activity of CASP3 protein]	23764342
D003676	Deferoxamine	Deferoxamine results in increased activity of CASP3 protein	16374551
D003676	Deferoxamine	Deferoxamine results in increased expression of CASP3 protein	16800926
D003676	Deferoxamine	Nitroprusside inhibits the reaction [Deferoxamine results in increased activity of CASP3 protein]	16374551
D003676	Deferoxamine	Vanadates inhibits the reaction [Deferoxamine results in increased activity of CASP3 protein]	16374551
D003676	Deferoxamine	Deferoxamine inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	26318285
D003676	Deferoxamine	Deferoxamine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
D003676	Deferoxamine	Deferoxamine inhibits the reaction [Copper Sulfate results in increased secretion of CASP3 protein]	30431687
D003676	Deferoxamine	Deferoxamine inhibits the reaction [Manganese results in increased activity of CASP3 protein]	11933051
C107676	deguelin	deguelin results in increased activity of CASP3 protein	19336726; 22623043; 26592500;
C107676	deguelin	deguelin results in increased cleavage of CASP3 protein	18593368; 22986522;
C107676	deguelin	[NPM1 protein mutant form results in increased susceptibility to deguelin] which results in increased cleavage of CASP3 protein	25242579
D003683	Dehydroascorbic Acid	Dehydroascorbic Acid promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	16951922
D003683	Dehydroascorbic Acid	Dehydroascorbic Acid promotes the reaction [Etoposide results in increased activity of CASP3 protein]	16951922
C464444	dehydroxymethylepoxyquinomicin	dehydroxymethylepoxyquinomicin results in increased cleavage of CASP3 protein	15501958
C464444	dehydroxymethylepoxyquinomicin	pyrazolanthrone inhibits the reaction [dehydroxymethylepoxyquinomicin results in increased cleavage of CASP3 protein]	15501958
C017185	delphinidin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [delphinidin inhibits the reaction [TGFB1 results in increased expression of CASP3 protein]]	30365941
C017185	delphinidin	delphinidin inhibits the reaction [TGFB1 results in increased expression of CASP3 protein]	30365941
C017185	delphinidin	delphinidin results in increased activity of CASP3 protein	15740068
C017185	delphinidin	delphinidin results in increased cleavage of CASP3 protein	29451351
C017185	delphinidin	[delphinidin results in increased susceptibility to sodium arsenite] which results in increased cleavage of CASP3 protein	30125548
C499810	delta(12)-prostaglandin J(2)	[delta(12)-prostaglandin J(2) co-treated with 9-deoxy-delta-9-prostaglandin D2 co-treated with 15-deoxy-delta(12,14)-prostaglandin J2] results in increased cleavage of CASP3 protein	23973622
C086916	delta-hexachlorocyclohexane	delta-hexachlorocyclohexane results in increased activity of CASP3 protein	19818741
C479072	delta-tocopherol	[alpha-Tocopherol co-treated with beta-Tocopherol co-treated with gamma-Tocopherol co-treated with delta-tocopherol] affects the reaction [Estradiol affects the expression of CASP3 protein]	22389237
C524257	demalonyl thyrsiflorin A	demalonyl thyrsiflorin A results in increased activity of CASP3 protein	29262311
D003703	Demecolcine	cyclopiazonic acid inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
D003703	Demecolcine	Demecolcine results in increased activity of CASP3 protein	12530016
D003703	Demecolcine	diacetylmonoxime inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
D003703	Demecolcine	geldanamycin inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
D003703	Demecolcine	Lansoprazole inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
D003703	Demecolcine	monorden inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
C050229	demethoxycurcumin	demethoxycurcumin inhibits the reaction [Peroxynitrous Acid results in increased activity of CASP3 protein]	19188863
C100698	demethoxyfumitremorgin C	demethoxyfumitremorgin C results in increased activity of CASP3 protein	28359723
C075597	Dendroaspis natriuretic peptide	Dendroaspis natriuretic peptide results in increased activity of CASP3 protein	15803858
D003840	Deoxycholic Acid	Aspirin inhibits the reaction [Deoxycholic Acid results in increased activity of CASP3 protein]	17644113
D003840	Deoxycholic Acid	CASP3 protein affects the susceptibility to Deoxycholic Acid	12507930
D003840	Deoxycholic Acid	cobaltiprotoporphyrin inhibits the reaction [Deoxycholic Acid results in increased cleavage of CASP3 protein]	21362092
D003840	Deoxycholic Acid	Deoxycholic Acid results in increased activity of CASP3 protein	16573382; 17644113;
D003840	Deoxycholic Acid	Deoxycholic Acid results in increased cleavage of and results in increased activity of CASP3 protein	19054763
D003840	Deoxycholic Acid	Deoxycholic Acid results in increased cleavage of CASP3 protein	21362092
D003840	Deoxycholic Acid	Deoxycholic Acid results in increased activity of CASP3 protein	20137712
D003840	Deoxycholic Acid	Ursodeoxycholic Acid inhibits the reaction [Deoxycholic Acid results in increased activity of CASP3 protein]	20137712
D003841	Deoxycytidine	Deoxycytidine inhibits the reaction [[9-deaza-9-(3-thienylmethyl)guanine co-treated with Deoxyguanosine] results in increased activity of CASP3 protein]	9297556; 9403342;
D003847	Deoxyglucose	ATG7 protein inhibits the reaction [Deoxyglucose results in increased cleavage of CASP3 protein]	20593179
D003847	Deoxyglucose	Deoxyglucose promotes the reaction [Arsenic Trioxide results in increased cleavage of and results in increased activity of CASP3 protein]	23041229
D003847	Deoxyglucose	Deoxyglucose results in increased cleavage of and results in increased activity of CASP3 protein	23041229
D003847	Deoxyglucose	Deoxyglucose results in increased cleavage of CASP3 protein	20593179
D003847	Deoxyglucose	Deoxyglucose promotes the reaction [Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]]	29095437
D003847	Deoxyglucose	Corticosterone inhibits the reaction [Deoxyglucose results in increased activity of CASP3 protein]	15755911
D003847	Deoxyglucose	Deoxyglucose results in increased activity of CASP3 protein	10506188; 15755911;
D003847	Deoxyglucose	GPX4 protein inhibits the reaction [Deoxyglucose results in increased activity of CASP3 protein]	10506188
D003849	Deoxyguanosine	[9-deaza-9-(3-thienylmethyl)guanine co-treated with Deoxyguanosine] results in increased activity of CASP3 protein	9297556; 9403342;
D003849	Deoxyguanosine	Deoxycytidine inhibits the reaction [[9-deaza-9-(3-thienylmethyl)guanine co-treated with Deoxyguanosine] results in increased activity of CASP3 protein]	9297556; 9403342;
C007262	deoxynivalenol	Aflatoxin B1 promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	30668976
C007262	deoxynivalenol	Ascorbic Acid inhibits the reaction [deoxynivalenol results in increased expression of CASP3 protein]	17166419
C007262	deoxynivalenol	deoxynivalenol results in decreased expression of CASP3 protein	22269384
C007262	deoxynivalenol	deoxynivalenol results in increased activity of CASP3 protein	19664677; 22269384; 27757495;
C007262	deoxynivalenol	deoxynivalenol results in increased expression of CASP3 mRNA	30668976
C007262	deoxynivalenol	deoxynivalenol results in increased expression of CASP3 protein	17166419; 22269384;
C007262	deoxynivalenol	[Zearalenone co-treated with Aflatoxin B1] promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	30668976
C007262	deoxynivalenol	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15976193
C007262	deoxynivalenol	4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine inhibits the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15772366
C007262	deoxynivalenol	deoxynivalenol promotes the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	25445755
C007262	deoxynivalenol	deoxynivalenol results in increased activity of and results in increased cleavage of CASP3 protein	22491426
C007262	deoxynivalenol	deoxynivalenol results in increased activity of CASP3 protein	15772366; 15976193;
C007262	deoxynivalenol	deoxynivalenol results in increased cleavage of CASP3 protein	19410639
C007262	deoxynivalenol	deoxynivalenol results in increased expression of CASP3 mRNA	25445755
C007262	deoxynivalenol	HCK protein affects the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15772366
C007262	deoxynivalenol	pifithrin inhibits the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15976193
C007262	deoxynivalenol	SB 203580 inhibits the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15976193
C007262	deoxynivalenol	Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	25445755
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]]	29109043
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]]	29109043
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]]	29109043
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
C007262	deoxynivalenol	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]]	29109043
C007262	deoxynivalenol	deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]	29109043
C007262	deoxynivalenol	deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]	29109043
C007262	deoxynivalenol	deoxynivalenol results in increased activity of CASP3 protein	20937367; 24394488;
C007262	deoxynivalenol	deoxynivalenol results in increased expression of CASP3 mRNA	29109043
C007262	deoxynivalenol	deoxynivalenol results in increased expression of CASP3 protein	29109043
C007262	deoxynivalenol	[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA	29109043
C007262	deoxynivalenol	[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 protein	29109043
C007262	deoxynivalenol	[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
C007262	deoxynivalenol	fumonisin B1 promotes the reaction [deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]]	29109043
C007262	deoxynivalenol	fumonisin B1 promotes the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]]	29109043
C007262	deoxynivalenol	Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	29109043
C007262	deoxynivalenol	Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
C007262	deoxynivalenol	Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]	29109043
D003891	Desipramine	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester promotes the reaction [Desipramine results in increased cleavage of and results in increased activity of CASP3 protein]	18606486
D003891	Desipramine	Desipramine results in increased activity of CASP3 protein	18986328
D003891	Desipramine	Desipramine results in increased cleavage of and results in increased activity of CASP3 protein	18606486
D003891	Desipramine	Desipramine results in increased activity of CASP3 protein	20549303
C040424	destruxin B	destruxin B results in increased cleavage of and results in increased activity of CASP3 protein	22465936; 23751424;
C040424	destruxin B	destruxin B results in increased cleavage of CASP3 protein	24434019
C040424	destruxin B	destruxin B results in increased expression of CASP3 protein	22465936
D003907	Dexamethasone	Dexamethasone results in increased cleavage of and results in increased activity of CASP3 protein	25447644
D003907	Dexamethasone	Dexamethasone results in increased expression of CASP3 protein	21365454
D003907	Dexamethasone	Dexamethasone results in increased cleavage of CASP3 protein	28453788
D003907	Dexamethasone	[afuresertib co-treated with pomalidomide co-treated with Dexamethasone] results in increased cleavage of CASP3 protein	29928335
D003907	Dexamethasone	[Dexamethasone co-treated with Bortezomib] results in increased activity of CASP3 protein	23063726
D003907	Dexamethasone	Dexamethasone inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	17070682
D003907	Dexamethasone	Dexamethasone promotes the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine results in increased cleavage of CASP3 protein]	23318440
D003907	Dexamethasone	Dexamethasone promotes the reaction [Gold results in increased activity of CASP3 protein]	19760634
D003907	Dexamethasone	Dexamethasone promotes the reaction [Nanotubes, Carbon results in increased activity of CASP3 protein]	19760634
D003907	Dexamethasone	Dexamethasone promotes the reaction [Silver results in increased activity of CASP3 protein]	19760634
D003907	Dexamethasone	Dexamethasone results in decreased activity of CASP3 protein	11319611
D003907	Dexamethasone	Dexamethasone results in increased activity of CASP3 protein	15574755; 15576458;
D003907	Dexamethasone	Dexamethasone results in increased expression of CASP3 protein	14633444; 19064852;
D003907	Dexamethasone	FAS protein inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	16164824
D003907	Dexamethasone	[GCS-100 co-treated with Dexamethasone] results in increased activity of CASP3 protein	16166312
D003907	Dexamethasone	Ginkgo biloba extract inhibits the reaction [Dexamethasone results in increased expression of CASP3 protein]	19064852
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of CASP3 mRNA	28628672
D003907	Dexamethasone	isocoumarin NM-3 promotes the reaction [Dexamethasone results in increased activity of CASP3 protein]	15574755
D003907	Dexamethasone	Mifepristone inhibits the reaction [Dexamethasone inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]]	17070682
D003907	Dexamethasone	[PDCD5 protein co-treated with Dexamethasone] results in increased expression of CASP3	20693715
D003907	Dexamethasone	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	14718643
D003907	Dexamethasone	CDKN1A protein affects the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	28940008
D003907	Dexamethasone	Dexamethasone inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	10919278
D003907	Dexamethasone	Dexamethasone results in decreased expression of CASP3 mRNA	21041162
D003907	Dexamethasone	Dexamethasone results in increased activity of CASP3 protein	11399061; 14718643; 16644695;
D003907	Dexamethasone	Dexamethasone results in increased cleavage of CASP3 protein	28940008; 30878453;
D003907	Dexamethasone	Mifepristone inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	16644695
D003907	Dexamethasone	MK 2206 inhibits the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	30878453
D003907	Dexamethasone	naringin inhibits the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	30878453
D003907	Dexamethasone	Spermine inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	11399061
D003907	Dexamethasone	Active Hexose Correlated Compound inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	11137978
D003907	Dexamethasone	caffeic acid phenethyl ester inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	28363435
D003907	Dexamethasone	Dexamethasone inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	19339209
D003907	Dexamethasone	Dexamethasone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D003907	Dexamethasone	Dexamethasone inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17635642
D003907	Dexamethasone	Dexamethasone inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	10200566; 15388240;
D003907	Dexamethasone	Dexamethasone results in decreased activity of CASP3 protein	10200566; 11319611;
D003907	Dexamethasone	Dexamethasone results in increased activity of CASP3 protein	11137978; 16403471; 28363435;
D003907	Dexamethasone	Dexamethasone results in increased cleavage of CASP3 protein	30506661
D003907	Dexamethasone	Dexamethasone results in increased expression of and results in increased cleavage of CASP3 protein	29111458
D003907	Dexamethasone	fludarabine inhibits the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	30506661
D003907	Dexamethasone	[Troglitazone co-treated with beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CASP3 mRNA	30481989
C004180	dexamethasone 21-phosphate	dexamethasone 21-phosphate results in increased cleavage of and results in increased activity of CASP3 protein	25447644
D020927	Dexmedetomidine	Dexmedetomidine results in increased activity of CASP3 protein	18724006
D020927	Dexmedetomidine	atipamezole inhibits the reaction [Dexmedetomidine inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]]	30597158
D020927	Dexmedetomidine	Dexmedetomidine inhibits the reaction [Isoflurane results in increased expression of CASP3 protein]	19352168; 20003127;
D020927	Dexmedetomidine	Dexmedetomidine inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]	30597158
D016264	Dextran Sulfate	Dextran Sulfate results in increased activity of CASP3 protein	27920257
D016264	Dextran Sulfate	Dextran Sulfate results in increased cleavage of CASP3 protein	21989142; 27920257;
D016264	Dextran Sulfate	EIF2AK2 protein affects the reaction [Dextran Sulfate results in increased activity of CASP3 protein]	27920257
D016264	Dextran Sulfate	Plant Extracts inhibits the reaction [Dextran Sulfate results in increased cleavage of CASP3 protein]	21989142
D016264	Dextran Sulfate	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of CASP3 mRNA	29950665
D003915	Dextromethorphan	Dextromethorphan results in increased cleavage of CASP3 protein	28916251
D003915	Dextromethorphan	Dizocilpine Maleate inhibits the reaction [Dextromethorphan results in increased cleavage of CASP3 protein]	28916251
D003915	Dextromethorphan	traxoprodil mesylate inhibits the reaction [Dextromethorphan results in increased cleavage of CASP3 protein]	28916251
C571832	D-Glucaric acid, 1,4-lactone	D-Glucaric acid, 1,4-lactone inhibits the reaction [Alloxan results in increased activity of CASP3 protein]	21982801
C000627634	di(2-picolyl)amine-3(bromoacetyl)coumarin	CAT protein inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C000627634	di(2-picolyl)amine-3(bromoacetyl)coumarin	[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein	29803612
C000627634	di(2-picolyl)amine-3(bromoacetyl)coumarin	Ethanol inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C000627634	di(2-picolyl)amine-3(bromoacetyl)coumarin	Mannitol inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C000627634	di(2-picolyl)amine-3(bromoacetyl)coumarin	neocuproine inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C000627634	di(2-picolyl)amine-3(bromoacetyl)coumarin	Thiourea inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C539263	di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone	di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone results in increased expression of CASP3 protein modified form	24532803
C539263	di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone	NDRG1 protein promotes the reaction [di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone results in increased expression of CASP3 protein modified form]	24532803
C004717	diacetylmonoxime	diacetylmonoxime inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
C020733	diadenosine tetraphosphate	diadenosine tetraphosphate inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	19442829
C028009	diallyl disulfide	diallyl disulfide promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	30677442
C028009	diallyl disulfide	diallyl disulfide results in increased activity of CASP3 protein	14522920; 17647244;
C028009	diallyl disulfide	diallyl disulfide results in increased cleavage of CASP3 protein	30677442
C042577	diallyl trisulfide	Acetylcysteine inhibits the reaction [diallyl trisulfide results in increased cleavage of CASP3 protein]	22578287
C042577	diallyl trisulfide	diallyl trisulfide results in increased activity of CASP3 protein	20055834; 21574149; 22595511; 23754639;
C042577	diallyl trisulfide	diallyl trisulfide results in increased cleavage of CASP3 protein	22578287; 25205294; 27566995;
C042577	diallyl trisulfide	diallyl trisulfide results in increased expression of CASP3 mRNA	21574149
C042577	diallyl trisulfide	[diallyl trisulfide results in increased susceptibility to TNFSF10 protein] which results in increased cleavage of CASP3 protein	28571773
C042577	diallyl trisulfide	LDHA protein inhibits the reaction [diallyl trisulfide results in increased cleavage of CASP3 protein]	27566995
C042577	diallyl trisulfide	diallyl trisulfide inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	24295472
C042577	diallyl trisulfide	diallyl trisulfide inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
C042577	diallyl trisulfide	diallyl trisulfide inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	23453443
C042577	diallyl trisulfide	diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]	25896937
C042577	diallyl trisulfide	diallyl trisulfide inhibits the reaction [Streptozocin results in decreased cleavage of CASP3 protein]	23453443
C042577	diallyl trisulfide	HMOX1 protein promotes the reaction [diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]]	25896937
C042577	diallyl trisulfide	NFE2L2 mutant form inhibits the reaction [diallyl trisulfide inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]]	23453443
C042577	diallyl trisulfide	NFE2L2 protein promotes the reaction [diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]]	25896937
D003973	Diatrizoate	Diatrizoate affects the expression of CASP3 protein	21036957
D003973	Diatrizoate	[Diatrizoate co-treated with Iodine] results in increased activity of CASP3 protein	17173243
D003973	Diatrizoate	Diatrizoate results in increased activity of CASP3 protein	19452295
D003973	Diatrizoate	Telmisartan inhibits the reaction [Diatrizoate results in increased activity of CASP3 protein]	19452295
D003974	Diatrizoate Meglumine	Diatrizoate Meglumine results in increased activity of CASP3 protein	17173243
D003974	Diatrizoate Meglumine	CTF1 protein inhibits the reaction [[Diatrizoate Meglumine co-treated with Gentamicins] results in increased cleavage of CASP3 protein]	23335628
D003974	Diatrizoate Meglumine	[Diatrizoate Meglumine co-treated with Gentamicins] results in increased cleavage of CASP3 protein	23335628
D003974	Diatrizoate Meglumine	Diatrizoate Meglumine results in increased activity of CASP3 protein	31173751
D003974	Diatrizoate Meglumine	Diatrizoate Meglumine results in increased expression of CASP3 mRNA	28412091
D003974	Diatrizoate Meglumine	Lansoprazole inhibits the reaction [Diatrizoate Meglumine results in increased expression of CASP3 mRNA]	28412091
D003974	Diatrizoate Meglumine	NFE2L2 protein affects the reaction [[sulforafan co-treated with Diatrizoate Meglumine] results in increased activity of CASP3 protein]	31173751
D003974	Diatrizoate Meglumine	[sulforafan co-treated with Diatrizoate Meglumine] results in increased activity of CASP3 protein	31173751
C438269	diazepinylbenzoic acid	diazepinylbenzoic acid inhibits the reaction [2,2-(2-chlorophenyl-4'-chlorophenyl)-1,1-dichloroethene results in increased activity of CASP3 protein]	26563996
C438269	diazepinylbenzoic acid	diazepinylbenzoic acid inhibits the reaction [Dichlorodiphenyl Dichloroethylene results in increased activity of CASP3 protein]	26563996
D003976	Diazinon	Diazinon results in increased activity of CASP3 protein	27920530
D003976	Diazinon	Diazinon results in increased expression of CASP3 mRNA	27920530
D003976	Diazinon	Magnesium Oxide analog inhibits the reaction [Diazinon results in increased activity of CASP3 protein]	27920530
D003976	Diazinon	Magnesium Oxide analog inhibits the reaction [Diazinon results in increased expression of CASP3 mRNA]	27920530
D003976	Diazinon	[Selenium analog co-treated with Magnesium Oxide analog] inhibits the reaction [Diazinon results in increased expression of CASP3 mRNA]	27920530
D003976	Diazinon	crocin inhibits the reaction [Diazinon results in increased activity of CASP3 protein]	23523949
D003976	Diazinon	crocin inhibits the reaction [Diazinon results in increased cleavage of CASP3 protein]	27353299
D003976	Diazinon	crocin inhibits the reaction [Diazinon results in increased expression of CASP3 protein modified form]	23523949
D003976	Diazinon	Diazinon results in increased activity of CASP3 protein	23523949
D003976	Diazinon	Diazinon results in increased cleavage of CASP3 protein	27353299
D003976	Diazinon	Diazinon results in increased expression of CASP3 protein modified form	23523949
D003976	Diazinon	Vitamin E inhibits the reaction [Diazinon results in increased activity of CASP3 protein]	23523949
D003976	Diazinon	Vitamin E inhibits the reaction [Diazinon results in increased cleavage of CASP3 protein]	27353299
D003976	Diazinon	Vitamin E inhibits the reaction [Diazinon results in increased expression of CASP3 protein modified form]	23523949
D003981	Diazoxide	5-hydroxydecanoic acid inhibits the reaction [Diazoxide results in decreased activity of CASP3 protein]	21256120
D003981	Diazoxide	Diazoxide results in decreased activity of CASP3 protein	21256120
C041517	dibenzo(a,l)pyrene	2,4,5,2',4',5'-hexachlorobiphenyl affects the reaction [dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein]	24954032
C041517	dibenzo(a,l)pyrene	dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein	24954032
C041517	dibenzo(a,l)pyrene	Estradiol affects the reaction [dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein]	24954032
C041517	dibenzo(a,l)pyrene	Tetrachlorodibenzodioxin affects the reaction [dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein]	24954032
C088674	dibromoacetic acid	dibromoacetic acid results in increased expression of CASP3 protein modified form	29155130
D003992	Dibucaine	Dibucaine inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
C542282	dibutyldi(4-chlorobenzohydroxamato)tin(IV)	dibutyldi(4-chlorobenzohydroxamato)tin(IV) results in increased cleavage of CASP3 protein	23041257
C542282	dibutyldi(4-chlorobenzohydroxamato)tin(IV)	dibutyldi(4-chlorobenzohydroxamato)tin(IV) results in increased expression of CASP3 mRNA	23041257
C048074	dibutyl maleate	dibutyl maleate results in increased cleavage of CASP3 protein	21105742
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in decreased expression of CASP3 mRNA	17361019; 21266533;
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in increased activity of CASP3 protein	30910607
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in increased expression of and results in increased activity of CASP3 protein	29029336
D003993	Dibutyl Phthalate	[Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with 4-nonylphenol co-treated with 4-tert-octylphenol] results in increased expression of and results in increased activity of CASP3 protein	29029336
D003993	Dibutyl Phthalate	NFE2L2 protein affects the reaction [Dibutyl Phthalate results in increased activity of CASP3 protein]	30910607
D003993	Dibutyl Phthalate	7-methyl-5-(1-((3-(trifluoromethyl)phenyl)acetyl)-2,3-dihydro-1H-indol-5-yl)-7H-pyrrolo(2,3-d)pyrimidin-4-amine promotes the reaction [Dibutyl Phthalate results in increased activity of CASP3 protein]	30910607
C100106	dicarbine	dicarbine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17481927
D003999	Dichloroacetic Acid	Dichloroacetic Acid affects the expression of and results in increased cleavage of CASP3 protein	25630799
D003999	Dichloroacetic Acid	Dichloroacetic Acid results in increased expression of CASP3 protein	22705712
D003633	Dichlorodiphenyl Dichloroethylene	Dichlorodiphenyl Dichloroethylene results in increased activity of CASP3 protein	19545618
D003633	Dichlorodiphenyl Dichloroethylene	diazepinylbenzoic acid inhibits the reaction [Dichlorodiphenyl Dichloroethylene results in increased activity of CASP3 protein]	26563996
D003633	Dichlorodiphenyl Dichloroethylene	Dichlorodiphenyl Dichloroethylene results in increased activity of CASP3 protein	26563996
D003633	Dichlorodiphenyl Dichloroethylene	RXRA mRNA promotes the reaction [Dichlorodiphenyl Dichloroethylene results in increased activity of CASP3 protein]	26563996
D003633	Dichlorodiphenyl Dichloroethylene	RXRB mRNA promotes the reaction [Dichlorodiphenyl Dichloroethylene results in increased activity of CASP3 protein]	26563996
D003633	Dichlorodiphenyl Dichloroethylene	Dichlorodiphenyl Dichloroethylene results in increased expression of CASP3 mRNA	28651089
D003633	Dichlorodiphenyl Dichloroethylene	Dichlorodiphenyl Dichloroethylene affects the expression of CASP3 protein	24576310
D003633	Dichlorodiphenyl Dichloroethylene	Dichlorodiphenyl Dichloroethylene results in increased expression of CASP3 mRNA	19644561; 20025943; 21384494; 24576310; 25410718;
D003633	Dichlorodiphenyl Dichloroethylene	[Dichlorodiphenyl Dichloroethylene co-treated with beta-hexachlorocyclohexane] results in increased expression of CASP3 mRNA	19175174
D003633	Dichlorodiphenyl Dichloroethylene	Dichlorodiphenyl Dichloroethylene results in increased expression of CASP3 mRNA	19175174
D004004	Dichlororibofuranosylbenzimidazole	Dichlororibofuranosylbenzimidazole inhibits the reaction [Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D004004	Dichlororibofuranosylbenzimidazole	Dichlororibofuranosylbenzimidazole inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D004004	Dichlororibofuranosylbenzimidazole	Dichlororibofuranosylbenzimidazole inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D004004	Dichlororibofuranosylbenzimidazole	Dichlororibofuranosylbenzimidazole inhibits the reaction [Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]]	17295206
D004004	Dichlororibofuranosylbenzimidazole	Dichlororibofuranosylbenzimidazole inhibits the reaction [Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	17295206
D004004	Dichlororibofuranosylbenzimidazole	Dichlororibofuranosylbenzimidazole inhibits the reaction [Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
C543901	(dichloro)tetraammineruthenium(III)	(dichloro)tetraammineruthenium(III) results in increased activity of CASP3 protein	20600797
D004006	Dichlorvos	[Amitrole co-treated with Ditiocarb] promotes the reaction [Dichlorvos results in increased activity of CASP3 protein]	17640809
D004006	Dichlorvos	Dichlorvos results in increased activity of CASP3 protein	17640809
D004006	Dichlorvos	Quercetin promotes the reaction [Dichlorvos results in increased activity of CASP3 protein]	17640809
D004006	Dichlorvos	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	17681413
D004006	Dichlorvos	Dichlorvos results in increased activity of CASP3 protein	17681413
D004006	Dichlorvos	10-(6'-ubiquinonyl)decyltriphenylphosphonium bromide inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	21784090
D004006	Dichlorvos	Dichlorvos results in decreased expression of CASP3 mRNA	19815060
D004006	Dichlorvos	Dichlorvos results in increased activity of CASP3 protein	16973328; 21784090; 22817663;
D004006	Dichlorvos	Dichlorvos results in increased cleavage of and results in increased activity of CASP3 protein	17850875
D004006	Dichlorvos	Dichlorvos results in increased cleavage of CASP3 protein	24369695
D004006	Dichlorvos	Dichlorvos results in increased expression of CASP3 mRNA	19815060
D004006	Dichlorvos	TEMPOL-H inhibits the reaction [Dichlorvos results in increased cleavage of CASP3 protein]	24369695
D004006	Dichlorvos	[Vitamin E co-treated with Ascorbic Acid] inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	16973328
D004008	Diclofenac	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	26609140
D004008	Diclofenac	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [IFNG protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
D004008	Diclofenac	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [[TNF protein co-treated with IFNG protein] promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
D004008	Diclofenac	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [TNF protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
D004008	Diclofenac	2-aminoethoxydiphenyl borate inhibits the reaction [[TNF protein co-treated with IFNG protein] promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
D004008	Diclofenac	2-aminoethoxydiphenyl borate inhibits the reaction [TNF protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]]	26609140
D004008	Diclofenac	Diclofenac inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	16388830
D004008	Diclofenac	Diclofenac inhibits the reaction [Tunicamycin results in increased activity of CASP3 protein]	16388830
D004008	Diclofenac	Diclofenac results in increased activity of CASP3 protein	24770551; 26609140; 27313093;
D004008	Diclofenac	IFNG protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]	26609140
D004008	Diclofenac	[TNF protein co-treated with IFNG protein] promotes the reaction [Diclofenac results in increased activity of CASP3 protein]	26609140
D004008	Diclofenac	TNF protein promotes the reaction [Diclofenac results in increased activity of CASP3 protein]	26609140; 27313093;
D004008	Diclofenac	Diclofenac results in increased activity of CASP3 protein	12826271
D004008	Diclofenac	2,3-dimethoxy-5-methyl-6-decyl-1,4-benzoquinone inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
D004008	Diclofenac	alpha-Tocopherol inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
D004008	Diclofenac	Cyclosporine inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
D004008	Diclofenac	Diclofenac results in increased activity of CASP3 protein	14599462; 14609740;
D004008	Diclofenac	Gum Arabic inhibits the reaction [[Water deficiency co-treated with Diclofenac] results in increased expression of CASP3 protein]	31042592
D004008	Diclofenac	Thiourea analog inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
D004008	Diclofenac	[Water deficiency co-treated with Diclofenac] results in increased expression of CASP3 protein	31042592
C000944	dicrotophos	dicrotophos results in decreased expression of CASP3 mRNA	28302478
D001728	Dicumarol	Dicumarol inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
D001728	Dicumarol	[aminochrome 1 co-treated with Dicumarol] results in increased activity of CASP3 protein	21427056
D001728	Dicumarol	Dicumarol promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	21947872
D001728	Dicumarol	Progesterone inhibits the reaction [Dicumarol promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]]	21947872
C499970	dideoxypetrosynol A	dideoxypetrosynol A results in increased activity of CASP3 protein	15547680
C552234	didymin	didymin results in increased activity of CASP3 protein	27899290
C552234	didymin	locostatin inhibits the reaction [didymin results in increased activity of CASP3 protein]	27899290
D004026	Dieldrin	BCL2 protein inhibits the reaction [Dieldrin results in increased activity of CASP3 protein]	15033812; 15183012;
D004026	Dieldrin	Dieldrin results in increased activity of CASP3 protein	22634143
D004026	Dieldrin	Dieldrin inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	10200566
D004026	Dieldrin	Dieldrin promotes the reaction [CASP3 protein results in increased cleavage of and results in increased activity of PRKCD protein]	21801747
D004026	Dieldrin	Dieldrin results in decreased activity of CASP3 protein	10200566
D004026	Dieldrin	Dieldrin results in increased activity of CASP3 protein	12831855; 15033812; 15183012;
D004026	Dieldrin	FYN protein promotes the reaction [Dieldrin promotes the reaction [CASP3 protein results in increased cleavage of and results in increased activity of PRKCD protein]]	21801747
D004026	Dieldrin	[Hexachlorocyclohexane co-treated with Dieldrin] results in increased activity of CASP3 protein	20036686
D004026	Dieldrin	rottlerin inhibits the reaction [Dieldrin results in increased activity of CASP3 protein]	12831855
D004026	Dieldrin	SNCA protein promotes the reaction [Dieldrin results in increased expression of CASP3 protein]	15987830
C007366	diepoxybutane	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [diepoxybutane results in increased activity of CASP3 protein]	14998682
C007366	diepoxybutane	diepoxybutane results in increased activity of CASP3 protein	14998682
D004040	Dietary Carbohydrates	[Dietary Carbohydrates co-treated with Dietary Fats] results in decreased cleavage of CASP3 protein	22535755
D004040	Dietary Carbohydrates	Quercetin inhibits the reaction [[Dietary Carbohydrates co-treated with Dietary Fats] results in decreased cleavage of CASP3 protein]	22535755
D004041	Dietary Fats	[Dietary Fats co-treated with Dietary Sucrose] results in decreased expression of CASP3 protein modified form	27070252
D004041	Dietary Fats	Resveratrol promotes the reaction [[Dietary Fats co-treated with Dietary Sucrose] results in decreased expression of CASP3 protein modified form]	27070252
D004041	Dietary Fats	[bromodichloromethane co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form	24211274
D004041	Dietary Fats	[Dietary Fats co-treated with sodium arsenite] results in increased expression of CASP3 mRNA	30302732
D004041	Dietary Fats	Dietary Fats results in decreased expression of CASP3 mRNA	30120929
D004041	Dietary Fats	Dietary Fats results in increased activity of CASP3 protein	20418481
D004041	Dietary Fats	Dietary Fats results in increased expression of CASP3 protein	26655953
D004041	Dietary Fats	[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 mRNA	28916335
D004041	Dietary Fats	[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 protein	28916335
D004041	Dietary Fats	LEP protein affects the reaction [[bromodichloromethane co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form]	24211274
D004041	Dietary Fats	NFE2L2 protein affects the reaction [Resveratrol inhibits the reaction [Dietary Fats results in increased activity of CASP3 protein]]	20418481
D004041	Dietary Fats	obeticholic acid inhibits the reaction [Dietary Fats results in increased expression of CASP3 protein]	26655953
D004041	Dietary Fats	[PRF1 protein co-treated with RAG2 protein] affects the reaction [[bromodichloromethane co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form]	24211274
D004041	Dietary Fats	Resveratrol inhibits the reaction [Dietary Fats results in increased activity of CASP3 protein]	20418481
D004041	Dietary Fats	troxerutin inhibits the reaction [[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 mRNA]	28916335
D004041	Dietary Fats	troxerutin inhibits the reaction [[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 protein]	28916335
D004041	Dietary Fats	[2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine co-treated with Dietary Fats] results in increased expression of CASP3 protein modified form	18616682
D004041	Dietary Fats	Cholecalciferol inhibits the reaction [Dietary Fats results in increased cleavage of CASP3 protein]	29653100
D004041	Dietary Fats	[Dietary Carbohydrates co-treated with Dietary Fats] results in decreased cleavage of CASP3 protein	22535755
D004041	Dietary Fats	[Dietary Fats co-treated with Ethanol] results in increased expression of CASP3 mRNA	30372842
D004041	Dietary Fats	Dietary Fats results in increased cleavage of CASP3 protein	29653100
D004041	Dietary Fats	Dietary Fats results in increased expression of and results in increased cleavage of CASP3 protein	27551045
D004041	Dietary Fats	Dietary Fats results in increased expression of CASP3 mRNA	30372842; 30580332;
D004041	Dietary Fats	Melatonin inhibits the reaction [[Dietary Fats co-treated with Ethanol] results in increased expression of CASP3 mRNA]	30372842
D004041	Dietary Fats	Melatonin inhibits the reaction [Dietary Fats results in increased expression of CASP3 mRNA]	30372842
D004041	Dietary Fats	Metformin inhibits the reaction [Dietary Fats results in increased expression of and results in increased cleavage of CASP3 protein]	27551045
D004041	Dietary Fats	Quercetin inhibits the reaction [[Dietary Carbohydrates co-treated with Dietary Fats] results in decreased cleavage of CASP3 protein]	22535755
D019422	Dietary Sucrose	[Dietary Fats co-treated with Dietary Sucrose] results in decreased expression of CASP3 protein modified form	27070252
D019422	Dietary Sucrose	Resveratrol promotes the reaction [[Dietary Fats co-treated with Dietary Sucrose] results in decreased expression of CASP3 protein modified form]	27070252
C020283	diethanolamine	diethanolamine results in decreased expression of CASP3 mRNA	16014740
C020283	diethanolamine	diethanolamine results in increased activity of CASP3 protein	18948303
C035088	diethyl fumarate	diethyl fumarate results in increased cleavage of CASP3 protein	21105742
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate inhibits the reaction [Camptothecin results in increased cleavage of CASP3 protein]	30720231
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased activity of CASP3 protein	21864672; 22155658;
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased cleavage of CASP3 protein	31112013
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of CASP3 mRNA	31112013
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of CASP3 protein alternative form	23220035
D004051	Diethylhexyl Phthalate	[Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with 4-nonylphenol co-treated with 4-tert-octylphenol] results in increased expression of and results in increased activity of CASP3 protein	29029336
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in decreased expression of CASP3 mRNA	31211961
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased activity of CASP3 protein	24646702
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of and results in increased activity of CASP3 protein	29029336
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of CASP3 mRNA	25701202
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of CASP3 protein	21856391
D004051	Diethylhexyl Phthalate	[Diethylhexyl Phthalate results in increased expression of HMOX1 mRNA] which results in increased activity of CASP3 protein	24646702
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in increased expression of CASP3 protein	26854921
D004051	Diethylhexyl Phthalate	Grape Seed Extract inhibits the reaction [Diethylhexyl Phthalate results in increased expression of CASP3 protein]	26854921
C014476	diethyl maleate	diethyl maleate results in increased cleavage of CASP3 protein	21105742
C014476	diethyl maleate	diethyl maleate results in increased expression of CASP3 mRNA	11875189
D004052	Diethylnitrosamine	ATM protein inhibits the reaction [Diethylnitrosamine results in increased cleavage of and results in increased activity of CASP3 protein]	19919837
D004052	Diethylnitrosamine	Cholic Acid inhibits the reaction [Diethylnitrosamine results in increased cleavage of CASP3 protein]	27151938
D004052	Diethylnitrosamine	CLOCK protein promotes the reaction [Diethylnitrosamine results in increased activity of CASP3 protein]	21167249
D004052	Diethylnitrosamine	CYP2E1 protein promotes the reaction [Diethylnitrosamine results in increased expression of CASP3 mRNA]	18056438
D004052	Diethylnitrosamine	Diethylnitrosamine results in increased activity of CASP3 protein	21167249
D004052	Diethylnitrosamine	Diethylnitrosamine results in increased cleavage of and results in increased activity of CASP3 protein	19919837
D004052	Diethylnitrosamine	Diethylnitrosamine results in increased cleavage of CASP3 protein	27151938
D004052	Diethylnitrosamine	Diethylnitrosamine results in increased expression of CASP3 mRNA	18056438; 26464624;
D004052	Diethylnitrosamine	5,7-dimethoxyflavone promotes the reaction [Diethylnitrosamine results in increased expression of CASP3 protein]	21554863
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with chrysin] results in increased expression of CASP3 protein	21167192
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with lanreotide] results in increased activity of CASP3 protein	19874807
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with thiosalicylic acid] results in increased activity of CASP3 protein	19427195
D004052	Diethylnitrosamine	Diethylnitrosamine promotes the reaction [[Sodium Fluoride results in increased abundance of Fluorides] which results in increased activity of CASP3 protein]	30920066
D004052	Diethylnitrosamine	Diethylnitrosamine results in decreased activity of CASP3 protein	24954034
D004052	Diethylnitrosamine	Diethylnitrosamine results in decreased expression of CASP3 mRNA	22393308; 30423403; 31129132;
D004052	Diethylnitrosamine	Diethylnitrosamine results in decreased expression of CASP3 protein	19931519; 30423403; 31129132;
D004052	Diethylnitrosamine	Diethylnitrosamine results in decreased expression of CASP3 protein modified form	22393308
D004052	Diethylnitrosamine	Diethylnitrosamine results in increased activity of CASP3 protein	19602430; 30920066;
D004052	Diethylnitrosamine	Diethylnitrosamine results in increased expression of CASP3 protein	21554863; 30779474;
D004052	Diethylnitrosamine	[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased cleavage of and results in decreased expression of CASP3 protein	21907755
D004052	Diethylnitrosamine	[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased expression of CASP3 mRNA	21907755
D004052	Diethylnitrosamine	Fluorouracil inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	31129132
D004052	Diethylnitrosamine	Fluorouracil inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	31129132
D004052	Diethylnitrosamine	formylchromone analog inhibits the reaction [Diethylnitrosamine results in decreased activity of CASP3 protein]	24954034
D004052	Diethylnitrosamine	geraniol inhibits the reaction [[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased cleavage of and results in decreased expression of CASP3 protein]	21907755
D004052	Diethylnitrosamine	geraniol inhibits the reaction [[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased expression of CASP3 mRNA]	21907755
D004052	Diethylnitrosamine	Hesperidin promotes the reaction [Diethylnitrosamine results in increased expression of CASP3 protein]	30779474
D004052	Diethylnitrosamine	morin inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	19931519
D004052	Diethylnitrosamine	neferine inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	30423403
D004052	Diethylnitrosamine	neferine inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	30423403
D004052	Diethylnitrosamine	Plant Oils inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	22393308
D004052	Diethylnitrosamine	Plant Oils inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein modified form]	22393308
D004052	Diethylnitrosamine	Polyphenols inhibits the reaction [Diethylnitrosamine results in increased activity of CASP3 protein]	19602430
D004052	Diethylnitrosamine	[Sodium Fluoride results in increased abundance of Fluorides] promotes the reaction [Diethylnitrosamine results in increased activity of CASP3 protein]	30920066
D004052	Diethylnitrosamine	zolmitriptan inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	31129132
D004052	Diethylnitrosamine	zolmitriptan inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	31129132
C007379	diethyl phthalate	diethyl phthalate results in increased expression of CASP3 protein alternative form	23220035
D004054	Diethylstilbestrol	Diethylstilbestrol results in increased activity of CASP3 protein	16924424
D004054	Diethylstilbestrol	Diethylstilbestrol results in decreased expression of CASP3 mRNA	21041162
C011612	diethyl sulfate	diethyl sulfate results in increased cleavage of CASP3 protein	23830811
C011612	diethyl sulfate	diethyl sulfate results in increased expression of CASP3 protein modified form	23830811
D004074	Digitoxin	Digitoxin analog results in decreased expression of CASP3 protein	22037315
D004074	Digitoxin	Digitoxin results in decreased expression of CASP3 protein	22037315
D004074	Digitoxin	Digitoxin results in decreased cleavage of CASP3 protein	28438630
C039060	dihydroartemisinin	dihydroartemisinin results in increased cleavage of CASP3 protein	21547369
C039060	dihydroartemisinin	dihydroartemisinin results in increased expression of CASP3 mRNA	29309768
C012906	dihydrocapsaicin	3-methyladenine promotes the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]	19139269
C012906	dihydrocapsaicin	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [3-methyladenine promotes the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]]	19139269
C012906	dihydrocapsaicin	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [dihydrocapsaicin promotes the reaction [3-methyladenine results in increased activity of CASP3 protein]]	19139269
C012906	dihydrocapsaicin	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [dihydrocapsaicin results in increased activity of CASP3 protein]	19139269
C012906	dihydrocapsaicin	dihydrocapsaicin promotes the reaction [3-methyladenine results in increased activity of CASP3 protein]	19139269
C012906	dihydrocapsaicin	dihydrocapsaicin results in increased activity of CASP3 protein	18818525; 19139269;
C109343	dihydroceramide	dihydroceramide metabolite results in increased cleavage of CASP3 protein	17586710
C015144	dihydrolipoic acid	2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide inhibits the reaction [dihydrolipoic acid results in increased activity of CASP3 protein]	21462292
C015144	dihydrolipoic acid	dihydrolipoic acid results in increased activity of CASP3 protein	21462292
C472036	dihydromyricetin	Acetylcysteine promotes the reaction [dihydromyricetin results in increased cleavage of CASP3 protein]	27539140
C472036	dihydromyricetin	dihydromyricetin results in increased cleavage of CASP3 protein	27539140
C472036	dihydromyricetin	pyrazolanthrone promotes the reaction [dihydromyricetin results in increased cleavage of CASP3 protein]	27539140
C472036	dihydromyricetin	U 0126 promotes the reaction [dihydromyricetin results in increased cleavage of CASP3 protein]	27539140
C000977	dihydroouabain	dihydroouabain results in decreased cleavage of CASP3 protein	28438630
C501843	dihydrosanguinarine	dihydrosanguinarine results in increased activity of CASP3 protein	19346183
D013196	Dihydrotestosterone	Dihydrotestosterone inhibits the reaction [[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein]	27132804
D013196	Dihydrotestosterone	Dihydrotestosterone analog results in increased activity of CASP3	17303658
D013196	Dihydrotestosterone	Dihydrotestosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D013196	Dihydrotestosterone	trilostane inhibits the reaction [Dihydrotestosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]]	25461682
D004098	Dihydroxyacetone	Dihydroxyacetone results in increased cleavage of CASP3 protein	29193605
C005998	dihydroxyfumarate	[Iron co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein	16456084
C005998	dihydroxyfumarate	[Iron-Dextran Complex co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein	16456084
C005998	dihydroxyfumarate	Propranolol inhibits the reaction [[Iron co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein]	16456084
C005998	dihydroxyfumarate	Propranolol inhibits the reaction [[Iron-Dextran Complex co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein]	16456084
D004110	Diltiazem	Diltiazem inhibits the reaction [[Glucose results in increased expression of OLR1 protein] which affects the activity of CASP3 protein]	20973294
C521105	dimethoxycurcumin	Acetylcysteine inhibits the reaction [dimethoxycurcumin results in increased activity of CASP3 protein]	21221209
C521105	dimethoxycurcumin	dimethoxycurcumin results in increased activity of CASP3 protein	21221209
C510843	dimethyl-4,4'-dimethoxy-5,6,5',6'-dimethylene dioxybiphenyl-2,2'-dicarboxylate	[Doxorubicin co-treated with [dimethyl-4,4'-dimethoxy-5,6,5',6'-dimethylene dioxybiphenyl-2,2'-dicarboxylate co-treated with CASP3 protein]] results in increased activity of CASP3 protein	16937080
C472511	dimethylarsinous acid	Acetylcysteine inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
C472511	dimethylarsinous acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
C472511	dimethylarsinous acid	[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased activity of and results in increased cleavage of CASP3 protein	29774349
D004126	Dimethylformamide	CAT protein inhibits the reaction [Dimethylformamide results in increased expression of CASP3 protein modified form]	29984871
D004126	Dimethylformamide	Dimethylformamide results in increased expression of CASP3 protein modified form	29984871
D004126	Dimethylformamide	Thiocarbamates analog inhibits the reaction [Dimethylformamide results in increased expression of CASP3 protein modified form]	29984871
D004126	Dimethylformamide	[Dimethylformamide co-treated with Carbon Tetrachloride] results in increased activity of CASP3 protein	20097184
D004121	Dimethyl Sulfoxide	Dimethyl Sulfoxide inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	19782097
D004121	Dimethyl Sulfoxide	Dimethyl Sulfoxide results in increased cleavage of CASP3 protein	22535522
D004121	Dimethyl Sulfoxide	Dimethyl Sulfoxide results in decreased cleavage of and results in decreased activity of CASP3 protein	12370186
C553669	dinaciclib	dinaciclib promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	27378523
C553669	dinaciclib	[dinaciclib results in increased susceptibility to Doxorubicin] which results in increased cleavage of CASP3 protein	27378523
D004137	Dinitrochlorobenzene	Dinitrochlorobenzene results in decreased expression of CASP3 mRNA	28219650
D015237	Dinoprost	Dinoprost inhibits the reaction [[TNF protein co-treated with IFNG protein] results in increased activity of CASP3 protein]	18463360
D015237	Dinoprost	Dinoprost inhibits the reaction [[TNF protein co-treated with IFNG protein] results in increased expression of CASP3 mRNA]	18463360
D015237	Dinoprost	Dinoprost promotes the reaction [epostane results in increased expression of CASP3 mRNA]	20739670
D015237	Dinoprost	Dinoprost results in increased activity of CASP3 protein	20739670
D015237	Dinoprost	Dinoprost results in increased expression of CASP3 mRNA	20739670
D015237	Dinoprost	[epostane co-treated with Dinoprost] results in increased activity of CASP3 protein	20739670
D015237	Dinoprost	epostane promotes the reaction [Dinoprost results in increased expression of CASP3 mRNA]	20739670
D015232	Dinoprostone	Dinoprostone inhibits the reaction [[TNF protein co-treated with IFNG protein] results in increased activity of CASP3 protein]	18463360
D015232	Dinoprostone	Dinoprostone inhibits the reaction [[TNF protein co-treated with IFNG protein] results in increased expression of CASP3 mRNA]	18463360
D015232	Dinoprostone	Dinoprostone inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
D015232	Dinoprostone	Dinoprostone results in decreased activity of CASP3 protein	12837940
D015232	Dinoprostone	Dinoprostone inhibits the reaction [PTGS1 gene mutant form promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]]	25432964
D015232	Dinoprostone	Dinoprostone inhibits the reaction [SIRT1 mutant form promotes the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	20335659
D015232	Dinoprostone	Dinoprostone inhibits the reaction [Puromycin Aminonucleoside results in increased activity of CASP3 protein]	16396944
D015232	Dinoprostone	Dinoprostone results in decreased activity of CASP3 protein	16396944
D015232	Dinoprostone	Dinoprostone results in increased activity of CASP3 protein	15234114
C019357	dioscin	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [dioscin results in increased expression of CASP3 protein]	29990575
C019357	dioscin	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [dioscin results in increased expression of CASP3 protein]	29990575
C019357	dioscin	dioscin results in increased activity of CASP3 protein	22334414
C019357	dioscin	dioscin results in increased expression of CASP3 mRNA	29990575
C019357	dioscin	dioscin results in increased expression of CASP3 protein	29990575
C019357	dioscin	dioscin inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	24146112
D004144	Diosgenin	Diosgenin inhibits the reaction [Calcium Oxalate results in increased activity of CASP3 protein]	25446497
D004145	Diosmin	Diosmin inhibits the reaction [2-Acetylaminofluorene results in increased activity of CASP3 protein]	23665045
D004145	Diosmin	Diosmin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	21477647
C493087	diphenylarsinic acid	diphenylarsinic acid results in increased activity of CASP3 protein	17628625
C493087	diphenylarsinic acid	[diphenylarsinic acid results in increased activity of CASP3 protein] which results in increased cleavage of GCLC protein	17628625
C434247	diphenylditelluride	diphenylditelluride results in increased activity of CASP3 protein	23182946
C434247	diphenylditelluride	diphenylditelluride results in increased expression of CASP3 protein	22885153
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12754411
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [Docetaxel results in increased activity of CASP3 protein]	15331178
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [ganoderic acid analog results in increased activity of CASP3 protein]	26282491
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [ganoderic acid T analog results in increased activity of CASP3 protein]	26282491
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [ganoderic acid T results in increased activity of CASP3 protein]	26282491
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [AGT protein modified form results in increased activity of CASP3 protein]	12606818
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	20026259
C007517	diphenyleneiodonium	[diphenyleneiodonium co-treated with mitoquinol co-treated with mitoquinone] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
C007517	diphenyleneiodonium	diphenyleneiodonium inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	14732287
D004164	Diphosphonates	Diphosphonates results in increased activity of CASP3 protein	11344045
D004176	Dipyridamole	Dipyridamole inhibits the reaction [Adenosine results in increased activity of CASP3 protein]	17303086
D004176	Dipyridamole	Dipyridamole results in increased activity of CASP3 protein	22700542
D004176	Dipyridamole	Palmitic Acid promotes the reaction [Dipyridamole results in increased activity of CASP3 protein]	22700542
D004178	Diquat	GPX4 protein inhibits the reaction [Diquat results in increased cleavage of CASP3 protein]	15496407
D004178	Diquat	Diquat results in increased cleavage of and results in increased activity of CASP3 protein	18164269
D004178	Diquat	Diquat results in increased cleavage of CASP3 protein	15496407
D004178	Diquat	Diquat results in increased expression of CASP3 mRNA	26785375; 27057282;
D004178	Diquat	procyanidin B2 inhibits the reaction [Diquat results in increased expression of CASP3 mRNA]	27057282
D004178	Diquat	TXN2 protein affects the reaction [Diquat results in increased cleavage of and results in increased activity of CASP3 protein]	18164269
D004178	Diquat	Acetylcysteine inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
D004178	Diquat	Diquat results in increased expression of CASP3 mRNA	19815060
D004178	Diquat	Diquat results in increased expression of CASP3 protein modified form	29484840
D004178	Diquat	Meloxicam inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
D004178	Diquat	pifithrin inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
D004178	Diquat	SN50 peptide inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
D004221	Disulfiram	[Disulfiram binds to Copper] which results in increased activity of CASP3 protein	24690739
D004221	Disulfiram	Disulfiram promotes the reaction [Carmustine results in increased cleavage of CASP3 protein]	24193513
D004221	Disulfiram	Disulfiram results in increased activity of CASP3 protein	17026967; 17079463;
D004221	Disulfiram	bathocuproine sulfonate inhibits the reaction [[Disulfiram binds to cupric chloride] which results in increased activity of CASP3 protein]	11239917
D004221	Disulfiram	[Disulfiram binds to cupric chloride] which results in increased activity of CASP3 protein	11239917
D004227	Dithionite	[Dithionite co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein	21803128
D004227	Dithionite	Quercetin inhibits the reaction [[Dithionite co-treated with Glucose deficiency] results in increased expression of CASP3 protein]	21803128
D004229	Dithiothreitol	[Dithiothreitol co-treated with Peroxynitrous Acid] results in increased metabolism of CASP3 protein	9441900
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	10673743
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [Nitric Oxide results in decreased activity of CASP3 protein]	9388267
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	9755104
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein]	9706149
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] which results in increased metabolism of CASP3 protein]	9706149
D004229	Dithiothreitol	Dithiothreitol promotes the reaction [1-(N-(3-ammoniopropyl)-N-(n-propyl)amino)diazen-1-ium-1,2-diolate results in increased metabolism of CASP3 protein]	9441900
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [2-methyl-3-(2-((4-nitrooxybutyloxy)carbonyl)vinyl)phenyl ursodeoxycholic acid ester results in decreased activity of CASP3 protein]	11226294
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [Nitric Oxide Donors inhibits the reaction [[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein]]	9388267
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one inhibits the reaction [[Nitric Oxide Donors results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein]]	9388267
D004229	Dithiothreitol	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Dactinomycin] results in increased activity of CASP3 protein]]	9706149
D004050	Ditiocarb	[Amitrole co-treated with Ditiocarb] promotes the reaction [Dichlorvos results in increased activity of CASP3 protein]	17640809
D004050	Ditiocarb	[[Ditiocarb binds to Copper] which affects the localization of CYCS protein] promotes the reaction [[[CYCS protein binds to APAF1 protein binds to CASP9 protein] which results in increased metabolism of and results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein]	22951949
D004050	Ditiocarb	[Ditiocarb co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D016291	Dizocilpine Maleate	Dizocilpine Maleate results in increased activity of CASP3 protein	19759125
D016291	Dizocilpine Maleate	Dizocilpine Maleate inhibits the reaction [Dextromethorphan results in increased cleavage of CASP3 protein]	28916251
D016291	Dizocilpine Maleate	Dizocilpine Maleate inhibits the reaction [Pilocarpine results in increased cleavage of CASP3 protein]	22824136
D016291	Dizocilpine Maleate	Dizocilpine Maleate inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
D016291	Dizocilpine Maleate	Dizocilpine Maleate results in increased expression of CASP3 protein modified form	25937004
C478085	D-JNKI-1	D-JNKI-1 inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased activity of CASP3 protein]	22427801
D000077143	Docetaxel	BCL2 inhibits the reaction [Docetaxel results in increased cleavage of and results in increased activity of CASP3 protein]	17308071
D000077143	Docetaxel	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [Docetaxel results in increased cleavage of and results in increased activity of CASP3 protein]	17308071
D000077143	Docetaxel	Celecoxib promotes the reaction [Docetaxel results in increased activity of and results in increased expression of CASP3 protein]	15688368
D000077143	Docetaxel	diphenyleneiodonium inhibits the reaction [Docetaxel results in increased activity of CASP3 protein]	15331178
D000077143	Docetaxel	Docetaxel promotes the reaction [Celecoxib results in increased activity of and results in increased expression of CASP3 protein]	15688368
D000077143	Docetaxel	Docetaxel promotes the reaction [[TP53 protein mutant form results in increased susceptibility to fatostatin] which results in increased cleavage of CASP3 protein]	26512780
D000077143	Docetaxel	Docetaxel results in increased activity of and results in increased expression of CASP3 protein	15688368
D000077143	Docetaxel	Docetaxel results in increased activity of CASP3 protein	15331178; 16361572; 19715609; 25634538;
D000077143	Docetaxel	Docetaxel results in increased cleavage of and results in increased activity of CASP3 protein	15282376; 17308071;
D000077143	Docetaxel	Docetaxel results in increased cleavage of CASP3 protein	15970518; 18186959;
D000077143	Docetaxel	[Zoledronic Acid co-treated with Docetaxel] results in decreased expression of CASP3 protein	17562444
D004281	Docosahexaenoic Acids	[CYP2E1 protein results in increased susceptibility to Docosahexaenoic Acids] which results in increased activity of CASP3 protein	16963249
D004281	Docosahexaenoic Acids	cypermethrin inhibits the reaction [Docosahexaenoic Acids results in increased cleavage of and results in increased activity of CASP3 protein]	11341974
D004281	Docosahexaenoic Acids	[Docosahexaenoic Acids co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	12609832
D004281	Docosahexaenoic Acids	[Docosahexaenoic Acids co-treated with Butyrates] results in increased activity of CASP3 protein	19116882
D004281	Docosahexaenoic Acids	Docosahexaenoic Acids results in increased activity of CASP3 protein	19341237
D004281	Docosahexaenoic Acids	Docosahexaenoic Acids results in increased cleavage of CASP3 protein	11341974
D004281	Docosahexaenoic Acids	tautomycin inhibits the reaction [Docosahexaenoic Acids results in increased cleavage of and results in increased activity of CASP3 protein]	11341974
D004281	Docosahexaenoic Acids	Docosahexaenoic Acids results in increased activity of CASP3 protein	23523905
C012301	domoic acid	Carbachol inhibits the reaction [domoic acid results in increased activity of CASP3 protein]	19200344
C012301	domoic acid	domoic acid results in increased activity of CASP3 protein	19200344
D000077265	Donepezil	Donepezil results in increased activity of CASP3 protein	20522977
D000077265	Donepezil	Donepezil inhibits the reaction [Hydrogen Peroxide results in decreased expression of CASP3 protein]	19345205
D004298	Dopamine	Acetylcysteine inhibits the reaction [Dopamine results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D004298	Dopamine	[Dopamine co-treated with Zinc deficiency] results in increased activity of CASP3 protein	23377617
D004298	Dopamine	Dopamine results in increased activity of and results in increased cleavage of CASP3 protein	17136323
D004298	Dopamine	Dopamine results in increased activity of CASP3 protein	19410601; 22987761;
D004298	Dopamine	Dopamine results in increased cleavage of and results in increased activity of CASP3 protein	17603292
D004298	Dopamine	Dopamine results in increased cleavage of CASP3 protein	15198987
D004298	Dopamine	PRKN protein inhibits the reaction [Dopamine results in increased cleavage of CASP3 protein]	15198987
D004298	Dopamine	Resveratrol inhibits the reaction [Dopamine results in increased cleavage of and results in increased activity of CASP3 protein]	17603292
D004298	Dopamine	Dopamine results in increased activity of CASP3 protein	18194434
D004298	Dopamine	SH-6 compound promotes the reaction [Dopamine results in increased activity of CASP3 protein]	18194434
D004298	Dopamine	SH-6 compound promotes the reaction [tanespimycin promotes the reaction [Dopamine results in increased activity of CASP3 protein]]	18194434
D004298	Dopamine	tanespimycin promotes the reaction [Dopamine results in increased activity of CASP3 protein]	18194434
C516138	dorsomorphin	dorsomorphin results in increased cleavage of CASP3 protein	23274516
C516138	dorsomorphin	TP53 mutant form inhibits the reaction [dorsomorphin results in increased cleavage of CASP3 protein]	23274516
C516138	dorsomorphin	dorsomorphin inhibits the reaction [ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]]	20709802
C516138	dorsomorphin	[dorsomorphin inhibits the reaction [ADIPOQ protein results in increased expression of BCL2L1 protein]] which results in increased activity of CASP3 protein	20709802
D017292	Doxazosin	Doxazosin results in increased activity of CASP3 protein	12771931; 15221243;
D017292	Doxazosin	Doxazosin results in increased cleavage of and results in increased activity of CASP3 protein	22845314
D004317	Doxorubicin	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16215684
D004317	Doxorubicin	Doxorubicin results in increased activity of CASP3 protein	16215684
D004317	Doxorubicin	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17085670
D004317	Doxorubicin	2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	23300809
D004317	Doxorubicin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16843435
D004317	Doxorubicin	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of MAP2K1 protein] inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	18594523
D004317	Doxorubicin	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of MAP2K1 protein] inhibits the reaction [SOD2 protein affects the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	18594523
D004317	Doxorubicin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased activity of and results in increased localization of CASP3 protein]	20856197
D004317	Doxorubicin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	20856197
D004317	Doxorubicin	3-methyladenine inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	31226464
D004317	Doxorubicin	4-amino-1,8-naphthalimide promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15456408
D004317	Doxorubicin	7-monohydroxyethylrutoside inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17285121
D004317	Doxorubicin	Acetylcysteine inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17542780
D004317	Doxorubicin	[Amifostine co-treated with Doxorubicin] results in increased activity of CASP3 protein	15985719
D004317	Doxorubicin	ARHGDIA mRNA affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	17264767
D004317	Doxorubicin	[Arsenic Trioxide co-treated with Doxorubicin co-treated with Magnetite Nanoparticles analog] affects the expression of CASP3 mRNA	24738333
D004317	Doxorubicin	[Arsenic Trioxide co-treated with Doxorubicin co-treated with Magnetite Nanoparticles analog] affects the expression of CASP3 protein	24738333
D004317	Doxorubicin	BCL2 protein inhibits the reaction [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
D004317	Doxorubicin	BCL2 protein inhibits the reaction [PI103 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
D004317	Doxorubicin	CASP3 protein promotes the reaction [Doxorubicin results in increased cleavage of CASP8 protein]	17013758
D004317	Doxorubicin	CASP3 protein promotes the reaction [Doxorubicin results in increased cleavage of CASP9 protein]	17013758
D004317	Doxorubicin	CASP3 protein promotes the reaction [Sildenafil Citrate results in increased susceptibility to Doxorubicin]	20155316
D004317	Doxorubicin	[CASP8 protein co-treated with CASP3 protein] affects the susceptibility to Doxorubicin	22609468
D004317	Doxorubicin	CD40LG protein inhibits the reaction [Doxorubicin promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	16545138
D004317	Doxorubicin	CDKN1A protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16909308
D004317	Doxorubicin	Cotinine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22687995
D004317	Doxorubicin	Decitabine promotes the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17283156
D004317	Doxorubicin	dinaciclib promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	27378523
D004317	Doxorubicin	[dinaciclib results in increased susceptibility to Doxorubicin] which results in increased cleavage of CASP3 protein	27378523
D004317	Doxorubicin	Doxorubicin affects the activity of CASP3 protein	15870702
D004317	Doxorubicin	Doxorubicin affects the cleavage of and affects the activity of CASP3 protein	18278454
D004317	Doxorubicin	Doxorubicin affects the expression of CASP3 mRNA	27780733
D004317	Doxorubicin	Doxorubicin analog results in increased cleavage of CASP3 protein	15981920
D004317	Doxorubicin	[Doxorubicin binds to TF protein] which results in increased activity of CASP3 protein	24998637
D004317	Doxorubicin	[Doxorubicin co-treated with [dimethyl-4,4'-dimethoxy-5,6,5',6'-dimethylene dioxybiphenyl-2,2'-dicarboxylate co-treated with CASP3 protein]] results in increased activity of CASP3 protein	16937080
D004317	Doxorubicin	[Doxorubicin co-treated with FAS protein] results in increased activity of CASP3 protein	15958570
D004317	Doxorubicin	[Doxorubicin co-treated with levistolide A] results in increased activity of CASP3 protein	18358092
D004317	Doxorubicin	[Doxorubicin co-treated with Melatonin] results in increased expression of CASP3 protein	20333787
D004317	Doxorubicin	[Doxorubicin co-treated with Paclitaxel co-treated with Fluorouracil] results in increased activity of CASP3 protein	16168113
D004317	Doxorubicin	[Doxorubicin co-treated with Paclitaxel] results in increased activity of CASP3 protein	16168113
D004317	Doxorubicin	[Doxorubicin co-treated with Phellinus linteus extract] results in increased cleavage of and results in increased activity of CASP3 protein	16868541
D004317	Doxorubicin	[Doxorubicin co-treated with piperlonguminine] results in increased cleavage of CASP3 protein	30611789
D004317	Doxorubicin	[Doxorubicin co-treated with Verapamil] results in increased activity of CASP3 protein	18358092
D004317	Doxorubicin	Doxorubicin promotes the reaction [2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine results in increased activity of CASP3 protein]	23300809
D004317	Doxorubicin	Doxorubicin promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	16545138
D004317	Doxorubicin	Doxorubicin results in increased activity of CASP3 protein	10766178; 11502879; 11779855; 15456408; 15571967; 15578696; 15680309; 15868924; 15981920; 15985719; 16364925; 16823846; 16843435; 16909308; 16962673; 17085670; 17088416; 17264767; 17437844; 18508926; 19047049; 19106633; 19662097; 20884855; 21132272; 21865289; 22302033; 22687995; 23300809; 24287111; 29141199; 30543781; 31563593;
D004317	Doxorubicin	Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein	15897917; 16024631; 16890185; 17283156; 17285121; 17542780; 17651020; 17935137; 18246814;
D004317	Doxorubicin	Doxorubicin results in increased cleavage of CASP3 protein	15555623; 15557793; 17283156; 17653088; 17959036; 18071906; 18594523; 20856197; 20957741; 22751436; 23956100; 26775663; 27378523;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 mRNA	15576332; 15939500; 16001973; 16705698; 28940058;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 protein	25339540
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 protein modified form	29105997; 31226464;
D004317	Doxorubicin	Doxorubicin results in increased phosphorylation of and results in increased activity of CASP3 protein	16937080
D004317	Doxorubicin	F3 protein affects the reaction [Doxorubicin affects the cleavage of and affects the activity of CASP3 protein]	18278454
D004317	Doxorubicin	F3 protein affects the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	18246814
D004317	Doxorubicin	[germacrone results in increased susceptibility to Doxorubicin] which results in increased activity of CASP3 protein	29655913
D004317	Doxorubicin	ginkgolide B inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	26775663
D004317	Doxorubicin	GPX1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	11502879
D004317	Doxorubicin	GSTA1 protein inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	16890185
D004317	Doxorubicin	HFE protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16823846
D004317	Doxorubicin	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D004317	Doxorubicin	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D004317	Doxorubicin	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D004317	Doxorubicin	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D004317	Doxorubicin	IFNA1 protein promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	17959036
D004317	Doxorubicin	[Indomethacin co-treated with Doxorubicin] results in increased activity of CASP3 protein	15812552
D004317	Doxorubicin	LIG4 protein affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	18508926
D004317	Doxorubicin	MAP3K20 protein promotes the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29105997
D004317	Doxorubicin	Morphine inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17542780
D004317	Doxorubicin	MT3 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19767621
D004317	Doxorubicin	palbociclib inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22302033
D004317	Doxorubicin	palbociclib inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	22751436
D004317	Doxorubicin	pepstatin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	31226464
D004317	Doxorubicin	PI103 promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	23300809
D004317	Doxorubicin	PI103 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	20856197
D004317	Doxorubicin	pluronic block copolymer p85 promotes the reaction [Doxorubicin results in increased expression of CASP3 mRNA]	15939500
D004317	Doxorubicin	PQQ Cofactor inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	31226464
D004317	Doxorubicin	PRKDC protein affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	18508926
D004317	Doxorubicin	pyrazolanthrone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16843435
D004317	Doxorubicin	Rifampin inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	26775663
D004317	Doxorubicin	Sildenafil Citrate promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	20884855
D004317	Doxorubicin	Sirolimus promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15571967
D004317	Doxorubicin	SOD2 protein affects the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	18594523
D004317	Doxorubicin	THBS1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16962673
D004317	Doxorubicin	TMSB4X protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16364925
D004317	Doxorubicin	TNFRSF10A protein affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	17437844
D004317	Doxorubicin	TNFSF10 protein promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	19106633
D004317	Doxorubicin	TP53 gene mutant form inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15578696
D004317	Doxorubicin	TP53 protein promotes the reaction [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
D004317	Doxorubicin	TP53 protein promotes the reaction [PI103 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
D004317	Doxorubicin	U 0126 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	15557793
D004317	Doxorubicin	Valproic Acid promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	17088416
D004317	Doxorubicin	Vitamin K 3 analog inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	29141199
D004317	Doxorubicin	Vitamin K 3 analog promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	29141199
D004317	Doxorubicin	Vorinostat promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	20957741
D004317	Doxorubicin	Wortmannin promotes the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17935137
D004317	Doxorubicin	[Zoledronic Acid co-treated with Doxorubicin] results in increased expression of CASP3 protein	18695136
D004317	Doxorubicin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [EPO protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	17928571
D004317	Doxorubicin	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III) inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	19286953
D004317	Doxorubicin	5,10,15,20-tetrakis(N-methyl-4'-pyridyl)porphyrinato-iron(III) inhibits the reaction [Doxorubicin results in increased expression of CASP3 mRNA]	19286953
D004317	Doxorubicin	5-hydroxydecanoic acid inhibits the reaction [Sildenafil Citrate inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	15811867
D004317	Doxorubicin	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	25665036; 26450947;
D004317	Doxorubicin	ABCC1 gene mutant form promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	26822305
D004317	Doxorubicin	copper (N-2-hydroxyacetophenone)glycinate promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	16289015
D004317	Doxorubicin	CYP2J2 protein affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	19429816
D004317	Doxorubicin	dicarbine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17481927
D004317	Doxorubicin	[Doxorubicin co-treated with Razoxane] results in increased activity of CASP3 protein	12714334
D004317	Doxorubicin	Doxorubicin inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	15538571
D004317	Doxorubicin	Doxorubicin promotes the reaction [AZD 6244 results in increased cleavage of CASP3 protein]	17876044
D004317	Doxorubicin	Doxorubicin promotes the reaction [Hesperidin results in increased expression of CASP3 mRNA]	29481770
D004317	Doxorubicin	Doxorubicin results in increased activity of CASP3 protein	12714334; 15505089; 15811867; 16215684; 16289015; 17481927; 17531194; 17673183; 17928571; 19429816; 19767621; 20856801; 21443895; 22763982; 24491677; 24799355; 24812279; 25665036; 26450947; 27155237; 27255381; 29481770;
D004317	Doxorubicin	Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein	18948619; 19286953;
D004317	Doxorubicin	Doxorubicin results in increased cleavage of CASP3 protein	17673183; 25680506; 25896364; 26822305;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 mRNA	19286953; 28329872; 29481770;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 protein	30734460
D004317	Doxorubicin	Doxycycline inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17673183
D004317	Doxorubicin	Doxycycline inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	17673183
D004317	Doxorubicin	EPO protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17928571
D004317	Doxorubicin	Genistein inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30734460
D004317	Doxorubicin	[Hesperidin co-treated with Doxorubicin] results in increased activity of CASP3 protein	29481770
D004317	Doxorubicin	Meloxicam inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	24799355
D004317	Doxorubicin	NAD inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	24491677
D004317	Doxorubicin	PARP1 gene mutant form promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15861398
D004317	Doxorubicin	PSMB10 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	25896364
D004317	Doxorubicin	PSMB8 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	25896364
D004317	Doxorubicin	PSMB9 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	25896364
D004317	Doxorubicin	Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22763982; 25665036; 26450947;
D004317	Doxorubicin	Sildenafil Citrate inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15811867
D004317	Doxorubicin	sirtinol inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	25665036; 26450947;
D004317	Doxorubicin	STAT3 gene mutant form promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	24812279
D004317	Doxorubicin	[STAT3 gene mutant form results in increased susceptibility to Doxorubicin] which results in increased activity of CASP3 protein	24812279
D004317	Doxorubicin	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	19286953
D004317	Doxorubicin	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Doxorubicin results in increased expression of CASP3 mRNA]	19286953
D004317	Doxorubicin	TLR2 gene mutant form inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15505089
D004317	Doxorubicin	tricarbonyldichlororuthenium (II) dimer inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	21443895
D004317	Doxorubicin	TRP53 protein mutant form affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	24812279
D004317	Doxorubicin	[Verapamil results in decreased expression of ABCB1] promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15861398
D004317	Doxorubicin	zinc protoporphyrin inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	22763982
D004317	Doxorubicin	[Zoledronic Acid co-treated with Doxorubicin] results in increased activity of CASP3 protein	19789217
D004317	Doxorubicin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D004317	Doxorubicin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D004317	Doxorubicin	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18164246
D004317	Doxorubicin	5-nitro-2-(3-phenylpropylamino)benzoic acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15482374
D004317	Doxorubicin	AKT1 protein affects the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D004317	Doxorubicin	Doxorubicin results in increased activity of CASP3 protein	15482374; 18164246;
D004317	Doxorubicin	MK 473 inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15482374; 18164246;
D004317	Doxorubicin	Wortmannin inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D004317	Doxorubicin	11,12-epoxy-5,8,14-eicosatrienoic acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19429816
D004317	Doxorubicin	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18775851; 22155320;
D004317	Doxorubicin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
D004317	Doxorubicin	2,3,5,4'-tetrahydroxystilbene 2-O-glucopyranoside inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]	19890356
D004317	Doxorubicin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [NRG1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	19801490
D004317	Doxorubicin	3-aminobenzamide inhibits the reaction [SFRP1 protein promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30377735
D004317	Doxorubicin	Acetylcysteine inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
D004317	Doxorubicin	Aldosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D004317	Doxorubicin	BCL2L1 mRNA affects the reaction [Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	20726854
D004317	Doxorubicin	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	25997894
D004317	Doxorubicin	beta-Naphthoflavone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	21947872
D004317	Doxorubicin	Carvedilol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15380674
D004317	Doxorubicin	Carvedilol inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26036690
D004317	Doxorubicin	caryophyllene inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30836069
D004317	Doxorubicin	Chitosan analog inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30928397
D004317	Doxorubicin	chloroquine diphosphate promotes the reaction [Doxorubicin inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]]	29133031
D004317	Doxorubicin	coenzyme Q10 inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	27087047
D004317	Doxorubicin	Corticosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911; 26915917;
D004317	Doxorubicin	Cortisone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D004317	Doxorubicin	crocin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	26807765
D004317	Doxorubicin	Curcumin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	29315967
D004317	Doxorubicin	Cyclosporine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	[cyclo(Trp-Asp-Pro-Val-Leu) binds to and results in decreased activity of EDNRA protein] affects the reaction [Doxorubicin results in increased activity of CASP3 protein]	14736733
D004317	Doxorubicin	Dantrolene inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17079870
D004317	Doxorubicin	Dexamethasone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D004317	Doxorubicin	Dexamethasone inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17635642
D004317	Doxorubicin	diallyl trisulfide inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
D004317	Doxorubicin	Dicumarol promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	21947872
D004317	Doxorubicin	[diphenyleneiodonium co-treated with mitoquinol co-treated with mitoquinone] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	Doxorubicin inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]	29133031
D004317	Doxorubicin	Doxorubicin promotes the reaction [chloroquine diphosphate inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]]	29133031
D004317	Doxorubicin	Doxorubicin promotes the reaction [MIRLET7F-2 mRNA results in increased cleavage of CASP3 protein]	31570982
D004317	Doxorubicin	Doxorubicin promotes the reaction [protoporphyrin IX results in increased activity of CASP3 protein]	18845130
D004317	Doxorubicin	Doxorubicin promotes the reaction [SFRP1 protein results in increased cleavage of CASP3 protein]	30377735
D004317	Doxorubicin	Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein	15623433; 19890356;
D004317	Doxorubicin	Doxorubicin results in increased activity of CASP3 protein	12379319; 12628736; 12967636; 14736733; 15380674; 15755911; 15792986; 15799720; 16210442; 16651473; 16766856; 17079870; 17935867; 18775851; 18845130; 19139834; 19429816; 19801490; 20726854; 21947872; 22015447; 22155320; 25997894; 26318906; 26678157; 26807765; 26915917; 27255381; 29315967;
D004317	Doxorubicin	Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein	16687611; 17635642; 17651020;
D004317	Doxorubicin	Doxorubicin results in increased cleavage of CASP3 protein	15703961; 18845810; 19168439; 22155320; 24072175; 25169008; 27666003; 28495616; 30009776; 30377735; 30831132; 30836069; 31570982;
D004317	Doxorubicin	Doxorubicin results in increased expression of and results in increased activity of CASP3 protein	15556633; 24593989;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3	24939721
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 mRNA	12505058; 24742701;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 protein	11291592; 12505058; 17671096; 21656368; 25411067; 26036690; 26335259; 27087047; 28815802; 30928397;
D004317	Doxorubicin	Doxorubicin results in increased expression of CASP3 protein modified form	24480152; 24902966; 29087013; 29966675;
D004317	Doxorubicin	EDN1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	14736733
D004317	Doxorubicin	Ellagic Acid inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	28815802
D004317	Doxorubicin	Eugenol inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	21656368
D004317	Doxorubicin	EVP 4593 inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
D004317	Doxorubicin	Febuxostat inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26036690
D004317	Doxorubicin	[Glucose deficiency co-treated with Galactose co-treated with Pyruvic Acid] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	25997894
D004317	Doxorubicin	GPX1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	Hemin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18845130
D004317	Doxorubicin	Heparin promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30377735
D004317	Doxorubicin	HMOX1 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	18845810
D004317	Doxorubicin	HSPD1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	12967636
D004317	Doxorubicin	HSPE1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	12967636
D004317	Doxorubicin	Hydrocortisone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D004317	Doxorubicin	iodopravadoline inhibits the reaction [caryophyllene inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30836069
D004317	Doxorubicin	kaempferol inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	22155320
D004317	Doxorubicin	Lithium Chloride inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30377735
D004317	Doxorubicin	Lithium Chloride inhibits the reaction [Heparin promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30377735
D004317	Doxorubicin	Melatonin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29966675
D004317	Doxorubicin	Mercuric Chloride inhibits the reaction [S-nitro-N-acetylpenicillamine inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]]	15623433
D004317	Doxorubicin	Mifepristone inhibits the reaction [Corticosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	15755911; 26915917;
D004317	Doxorubicin	Mifepristone inhibits the reaction [Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	20726854; 26915917;
D004317	Doxorubicin	MIR23A mRNA affects the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30831132
D004317	Doxorubicin	MIRLET7F-2 mRNA affects the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	31570982
D004317	Doxorubicin	NOL3 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19139834
D004317	Doxorubicin	NRG1 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19801490
D004317	Doxorubicin	pifithrin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18775851
D004317	Doxorubicin	pifithrin inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	16687611
D004317	Doxorubicin	PPARA protein affects the reaction [PTGS1 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	17671096
D004317	Doxorubicin	PPARA protein inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	17671096
D004317	Doxorubicin	Progesterone inhibits the reaction [Dicumarol promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]]	21947872
D004317	Doxorubicin	Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	20726854; 21947872; 26915917;
D004317	Doxorubicin	Propofol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22015447
D004317	Doxorubicin	Propolis inhibits the reaction [Doxorubicin results in increased expression of and results in increased activity of CASP3 protein]	24593989
D004317	Doxorubicin	PTGS1 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	17671096
D004317	Doxorubicin	pyrazolanthrone inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30928397
D004317	Doxorubicin	Quercetin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	25411067
D004317	Doxorubicin	Quercetin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	24902966
D004317	Doxorubicin	Resveratrol inhibits the reaction [Doxorubicin results in increased expression of CASP3]	24939721
D004317	Doxorubicin	rhodioloside inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	24072175
D004317	Doxorubicin	rosmarinic acid inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	28815802
D004317	Doxorubicin	Ryanodine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17079870
D004317	Doxorubicin	salvianolic acid B inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	28495616
D004317	Doxorubicin	SB 203580 inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30928397
D004317	Doxorubicin	SFRP1 protein promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30377735
D004317	Doxorubicin	SHC1 protein promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	26318906
D004317	Doxorubicin	Silymarin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D004317	Doxorubicin	S-nitro-N-acetylpenicillamine inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]	15623433
D004317	Doxorubicin	SOD2 protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
D004317	Doxorubicin	[Taurine binds to Zinc] inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D004317	Doxorubicin	[Taurine co-treated with Zinc Acetate] inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D004317	Doxorubicin	Taurine inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D004317	Doxorubicin	Thioctic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17079870
D004317	Doxorubicin	THPO protein inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16651473
D004317	Doxorubicin	TNF protein promotes the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17651020
D004317	Doxorubicin	Tretinoin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	26915917
D004317	Doxorubicin	U 0126 inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18775851
D004317	Doxorubicin	XPO1 protein inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	31570982
D004317	Doxorubicin	[CAV1 protein binds to CAV3 protein] promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	17982011
D004317	Doxorubicin	Doxorubicin results in increased activity of CASP3 protein	17982011
D004317	Doxorubicin	TSC22D3 protein inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	24480152
D004318	Doxycycline	Doxycycline inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17673183
D004318	Doxycycline	Doxycycline inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	17673183
C060327	dracorhodin	dracorhodin analog results in increased activity of CASP3 protein	15215653; 15684474; 16864444;
C060327	dracorhodin	dracorhodin analog results in increased cleavage of CASP3 protein	15813022
C481244	drimenol	drimenol results in increased activity of CASP3 protein	30935903
D013759	Dronabinol	Dronabinol results in increased activity of CASP3 protein	16616335; 16818634; 16818650;
D013759	Dronabinol	Dronabinol results in increased cleavage of and results in increased activity of CASP3 protein	17583570
D013759	Dronabinol	SR 144528 inhibits the reaction [Dronabinol results in increased activity of CASP3 protein]	16818634; 16818650;
D013759	Dronabinol	thermozymocidin inhibits the reaction [Dronabinol results in increased activity of CASP3 protein]	16818650
D000077764	Dronedarone	Dronedarone results in increased activity of CASP3 protein	23135547
D004365	Drugs, Chinese Herbal	[Drugs, Chinese Herbal co-treated with necrostatin-1] results in increased cleavage of and results in increased activity of CASP3 protein	23811387
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein]	27916511
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal inhibits the reaction [tert-Butylhydroperoxide results in decreased expression of CASP3 protein]	28733231
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal promotes the reaction [Fluorouracil results in increased cleavage of and results in increased expression of CASP3 protein]	21461573
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal promotes the reaction [Zidovudine results in increased expression of CASP3 mRNA]	17696246
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in increased activity of CASP3 protein	15456542; 15802533; 17996228; 19295228; 23239598;
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in increased cleavage of and results in increased activity of CASP3 protein	23811387
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in increased cleavage of and results in increased expression of CASP3 protein	21461573
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in increased expression of and results in increased activity of CASP3 protein	23315830
D004365	Drugs, Chinese Herbal	Fluorouracil promotes the reaction [Drugs, Chinese Herbal results in increased cleavage of and results in increased expression of CASP3 protein]	21461573
D004365	Drugs, Chinese Herbal	Arsenic Trioxide promotes the reaction [Drugs, Chinese Herbal results in decreased expression of CASP3 protein]	28587418
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	27983966
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]	28757890
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19647727
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in decreased expression of CASP3 protein	28587418
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19524685
C042986	ebselen	ebselen inhibits the reaction [Mechlorethamine results in increased activity of CASP3 protein]	23649643
C042986	ebselen	ebselen inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21300091
C042986	ebselen	ebselen inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	30558456
C042986	ebselen	ebselen results in increased activity of CASP3 protein	25068500
D004441	Ecdysterone	Ecdysterone results in increased activity of CASP3 protein	29126784
C000615871	echimidine	echimidine results in increased activity of and results in increased cleavage of CASP3 protein	29458164
C060297	echinacoside	echinacoside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27432061
C060297	echinacoside	echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	23189969
C060297	echinacoside	staurosporine aglycone inhibits the reaction [echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	23189969
C060297	echinacoside	U 0126 inhibits the reaction [echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	23189969
C022999	echinocystic acid	echinocystic acid analog results in increased activity of CASP3 protein	15863893
D000077553	Edaravone	Edaravone analog results in increased activity of CASP3 protein	25684395
D000077553	Edaravone	Edaravone inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D000077553	Edaravone	Edaravone inhibits the reaction [PRNP protein alternative form results in increased activity of CASP3 protein]	20806394
C098320	efavirenz	efavirenz metabolite results in increased cleavage of and results in increased activity of CASP3 protein	21958719
C098320	efavirenz	efavirenz results in increased cleavage of and results in increased activity of CASP3 protein	21958719
D004533	Egtazic Acid	Egtazic Acid inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21544200
D004533	Egtazic Acid	Egtazic Acid promotes the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	19837105; 20020783;
D004533	Egtazic Acid	[1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid co-treated with Egtazic Acid] inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D004533	Egtazic Acid	Egtazic Acid inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D004533	Egtazic Acid	Egtazic Acid inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	21544200
D015777	Eicosanoids	Eicosanoids analog inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	23603837
D015118	Eicosapentaenoic Acid	[Eicosapentaenoic Acid co-treated with Butyrates] results in increased activity of CASP3 protein	19116882
D004610	Ellagic Acid	Ellagic Acid results in decreased activity of CASP3 protein	22386815
D004610	Ellagic Acid	Ellagic Acid results in decreased expression of CASP3 mRNA	12002526
D004610	Ellagic Acid	Ellagic Acid results in increased activity of CASP3 protein	23811531
D004610	Ellagic Acid	Ellagic Acid results in increased expression of and results in increased activity of CASP3 protein	23554011
D004610	Ellagic Acid	Ellagic Acid results in increased expression of CASP3 mRNA	12002526
D004610	Ellagic Acid	Ellagic Acid inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	28815802
D004610	Ellagic Acid	Ellagic Acid inhibits the reaction [sodium arsenate results in increased activity of CASP3 protein]	29854611
C034192	ellipticine	Acetylcysteine inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
C034192	ellipticine	Butylated Hydroxyanisole inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
C034192	ellipticine	ellipticine results in increased activity of CASP3 protein	16027529
C034192	ellipticine	ellipticine results in increased cleavage of and results in increased activity of CASP3 protein	21843585
C034192	ellipticine	pyrazolanthrone inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
C034192	ellipticine	U 0126 inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
C108024	emamectin benzoate	emamectin benzoate results in increased expression of CASP3 protein	28601557
C010945	embelin	3-methyladenine promotes the reaction [embelin results in increased degradation of CASP3 protein]	28722333
C010945	embelin	embelin results in increased cleavage of CASP3 protein	24694877
C010945	embelin	embelin results in increased degradation of CASP3 protein	28722333
D004640	Emetine	Emetine results in increased activity of CASP3 protein	14502240
D004642	Emodin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Emodin results in increased cleavage of CASP3 protein]	27032576
D004642	Emodin	2-chloro-5-nitrobenzanilide inhibits the reaction [Emodin results in increased activity of CASP3 protein]	25448808
D004642	Emodin	Emodin results in increased activity of CASP3 protein	23848338
D004642	Emodin	Emodin results in increased cleavage of and results in increased activity of CASP3 protein	25448808
D004642	Emodin	Emodin results in increased cleavage of CASP3 protein	27032576
D004642	Emodin	Emodin results in increased expression of CASP3 protein	23848338
D004642	Emodin	SB 203580 inhibits the reaction [Emodin results in increased cleavage of CASP3 protein]	27032576
D004642	Emodin	U 0126 promotes the reaction [Emodin results in increased cleavage of CASP3 protein]	27032576
D004642	Emodin	Emodin affects the expression of CASP3 protein modified form	19549930
D004656	Enalapril	Enalapril inhibits the reaction [Isoproterenol results in increased expression of CASP3 protein]	30623541
D004656	Enalapril	Enalapril results in decreased activity of CASP3 protein	21153712
D052244	Endocrine Disruptors	Endocrine Disruptors results in increased expression of CASP3 mRNA	25198161
D052244	Endocrine Disruptors	Endocrine Disruptors results in increased expression of and results in increased activity of CASP3 protein	29029336
D004726	Endosulfan	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Endosulfan results in increased activity of CASP3 protein]	20361990
D004726	Endosulfan	Endosulfan results in increased activity of CASP3 protein	17189834; 20361990; 26615145; 26714676; 28161397; 29705383;
D004726	Endosulfan	MIR22 mRNA affects the reaction [Endosulfan results in increased activity of CASP3 protein]	28161397
D004726	Endosulfan	MIR22 mRNA affects the reaction [Endosulfan results in increased expression of CASP3 mRNA]	28161397
D004726	Endosulfan	Endosulfan results in decreased expression of CASP3 mRNA	29391264
D004726	Endosulfan	Endosulfan results in increased cleavage of and results in increased activity of CASP3 protein	30796443
D004726	Endosulfan	PRKCD affects the reaction [Endosulfan results in increased cleavage of and results in increased activity of CASP3 protein]	30796443
D004731	Endotoxins	[Galactosamine co-treated with Endotoxins] results in increased activity of CASP3 protein	22023962
C100264	enniatins	enniatins results in decreased expression of CASP3 mRNA	27163883
C530049	ent-1,3,6,11-tetrahydroxykaur-16-ene-15-one 3,11-diacetate	ent-1,3,6,11-tetrahydroxykaur-16-ene-15-one 3,11-diacetate results in increased cleavage of CASP3 protein	19509257
C034959	enterotoxin C, staphylococcal	concanamycin A inhibits the reaction [enterotoxin C, staphylococcal analog results in increased activity of CASP3 protein]	27742270
C034959	enterotoxin C, staphylococcal	concanamycin A inhibits the reaction [enterotoxin C, staphylococcal results in increased activity of CASP3 protein]	27742270
C034959	enterotoxin C, staphylococcal	enterotoxin C, staphylococcal analog results in increased activity of CASP3 protein	27742270
C034959	enterotoxin C, staphylococcal	enterotoxin C, staphylococcal results in increased activity of CASP3 protein	27742270
C118739	entinostat	entinostat results in increased activity of CASP3 protein	25068794
C118739	entinostat	MC1568 inhibits the reaction [entinostat results in increased activity of CASP3 protein]	25068794
C118739	entinostat	entinostat results in increased activity of CASP3 protein	21041383
C118739	entinostat	entinostat results in increased cleavage of and results in increased activity of CASP3 protein	26251326
C118739	entinostat	entinostat results in increased cleavage of CASP3 protein	29845424
C118739	entinostat	entinostat results in increased expression of CASP3 protein	29845424
C118739	entinostat	TNFSF10 protein promotes the reaction [entinostat results in increased activity of CASP3 protein]	21041383
D004785	Environmental Pollutants	Environmental Pollutants results in decreased expression of CASP3 mRNA	24534155
D004791	Enzyme Inhibitors	[Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of CASP3 protein	23301498
D010697	Eosine I Bluish	Acetylcysteine inhibits the reaction [Eosine I Bluish results in increased activity of CASP3 protein]	22440610
D010697	Eosine I Bluish	[Ascorbic Acid co-treated with Eosine I Bluish] results in increased activity of CASP3 protein	24488945
D010697	Eosine I Bluish	CAT protein inhibits the reaction [[Ascorbic Acid co-treated with Eosine I Bluish] results in increased activity of CASP3 protein]	24488945
D010697	Eosine I Bluish	[Eosine I Bluish results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	22440610
D010697	Eosine I Bluish	Eosine I Bluish results in increased activity of CASP3 protein	22440610
C038131	epalrestat	epalrestat results in increased cleavage of and results in increased activity of CASP3 protein	28204799
D004809	Ephedrine	[Caffeine co-treated with Ephedrine] results in increased cleavage of CASP3 protein	15537744
C062669	epicatechin gallate	epicatechin gallate results in increased activity of CASP3 protein	21945981
C045651	epigallocatechin gallate	Acetylcysteine inhibits the reaction [[epigallocatechin gallate co-treated with arsenite] results in increased activity of CASP3 protein]	26375285
C045651	epigallocatechin gallate	[epigallocatechin gallate co-treated with arsenite] results in increased activity of CASP3 protein	26375285
C045651	epigallocatechin gallate	[Arsenic Trioxide co-treated with epigallocatechin gallate] results in increased activity of CASP3 protein	20950636
C045651	epigallocatechin gallate	epigallocatechin gallate affects the cleavage of CASP3 protein	15975156
C045651	epigallocatechin gallate	epigallocatechin gallate analog results in increased cleavage of CASP3 protein	16115949
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	12672908; 15795422;
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [Nitroprusside binds to and results in increased activity of CASP3 protein]	23665936
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [potassium chromate(VI) results in increased cleavage of and results in increased activity of CASP3 protein]	22079256
C045651	epigallocatechin gallate	epigallocatechin gallate results in increased activity of CASP3 protein	15657356; 15705601; 15764647;
C045651	epigallocatechin gallate	epigallocatechin gallate results in increased cleavage of CASP3 protein	22348037
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [Formaldehyde results in increased expression of CASP3 protein]	30395894
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	28365685
C045651	epigallocatechin gallate	[candesartan co-treated with epigallocatechin gallate] inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
C045651	epigallocatechin gallate	epigallocatechin gallate inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	17936647
C045651	epigallocatechin gallate	epigallocatechin gallate promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]]	29999212
D004837	Epinephrine	Atenolol inhibits the reaction [Epinephrine results in increased activity of CASP3 protein]	10728402
D004837	Epinephrine	Carvedilol inhibits the reaction [Epinephrine results in increased activity of CASP3 protein]	10728402
D004837	Epinephrine	Epinephrine results in increased activity of CASP3 protein	10728402
D004837	Epinephrine	Epinephrine promotes the reaction [[Xanthine co-treated with XDH protein] results in increased activity of CASP3 protein]	19135123
D004837	Epinephrine	Epinephrine results in increased activity of CASP3 protein	19135123
D015251	Epirubicin	3',4',7-trihydroxyisoflavone promotes the reaction [Epirubicin results in increased expression of CASP3 mRNA]	22914566
D015251	Epirubicin	chrysophsin promotes the reaction [Epirubicin results in increased expression of CASP3 mRNA]	26335193
D015251	Epirubicin	[Epirubicin analog co-treated with chrysophsin analog] results in increased expression of CASP3 mRNA	26335193
D015251	Epirubicin	Epirubicin promotes the reaction [3',4',7-trihydroxyisoflavone results in increased activity of CASP3 protein]	22914566
D015251	Epirubicin	Epirubicin promotes the reaction [3',4',7-trihydroxyisoflavone results in increased expression of CASP3 mRNA]	22914566
D015251	Epirubicin	Epirubicin promotes the reaction [chrysophsin results in increased expression of CASP3 mRNA]	26335193
D015251	Epirubicin	Epirubicin promotes the reaction [formononetin results in increased activity of CASP3 protein]	23867903
D015251	Epirubicin	Epirubicin promotes the reaction [formononetin results in increased expression of CASP3 mRNA]	23867903
D015251	Epirubicin	Epirubicin results in increased activity of and affects the localization of CASP3 protein	15996160
D015251	Epirubicin	Epirubicin results in increased activity of CASP3 protein	23867903
D015251	Epirubicin	Epirubicin results in increased expression of CASP3 mRNA	14503796; 22914566; 23867903; 26335193;
D015251	Epirubicin	formononetin promotes the reaction [Epirubicin results in increased activity of CASP3 protein]	23867903
D015251	Epirubicin	formononetin promotes the reaction [Epirubicin results in increased expression of CASP3 mRNA]	23867903
D015251	Epirubicin	Epirubicin results in increased cleavage of CASP3 protein	26646421; 29505745;
D015251	Epirubicin	paeonol inhibits the reaction [Epirubicin results in increased cleavage of CASP3 protein]	26646421; 29505745;
C046855	epostane	Dinoprost promotes the reaction [epostane results in increased expression of CASP3 mRNA]	20739670
C046855	epostane	[epostane co-treated with Dinoprost] results in increased activity of CASP3 protein	20739670
C046855	epostane	epostane promotes the reaction [Dinoprost results in increased expression of CASP3 mRNA]	20739670
C046855	epostane	epostane results in increased expression of CASP3 mRNA	20739670
C093787	epothilone A	[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA	29117515
C093787	epothilone A	epothilone A results in increased expression of CASP3 mRNA	29117515
C093787	epothilone A	Sodium Salicylate promotes the reaction [[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA]	29117515
C093787	epothilone A	triciribine promotes the reaction [[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA]	29117515
C078846	epoxomicin	epoxomicin inhibits the reaction [troxerutin inhibits the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of and results in increased activity of CASP3 protein]]	25639565
D060754	Equol	Equol results in increased activity of CASP3 protein	18973749
C048498	erdosteine	erdosteine inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	26193055
C100270	ergocristine	ergocristine results in increased activity of CASP3 protein	21295106
C100269	ergocryptine	ergocryptine results in increased activity of CASP3 protein	21295106
C030041	ergosine	ergosine results in increased activity of CASP3 protein	21295106
C549042	ergosta-7,22-dien-5-hydroxy-3,6-dione	ergosta-7,22-dien-5-hydroxy-3,6-dione results in increased activity of CASP3 protein	20100469
C036071	ergosterol-5,8-peroxide	ergosterol-5,8-peroxide results in increased activity of CASP3 protein	20100469
D004878	Ergotamine	Ergotamine results in increased activity of CASP3 protein	21295106
C529414	erigeroflavanone	erigeroflavanone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	19557877
D000069347	Erlotinib Hydrochloride	Erlotinib Hydrochloride promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	25895606
D000069347	Erlotinib Hydrochloride	Erlotinib Hydrochloride results in increased activity of CASP3 protein	25895606
D000069347	Erlotinib Hydrochloride	Erlotinib Hydrochloride results in increased cleavage of CASP3 protein	23125191
D000069347	Erlotinib Hydrochloride	Resveratrol promotes the reaction [Erlotinib Hydrochloride results in increased activity of CASP3 protein]	25895606
D000069347	Erlotinib Hydrochloride	[TWIST1 protein results in decreased susceptibility to Erlotinib Hydrochloride] which results in decreased cleavage of CASP3 protein	30171258
C075010	erucylphosphocholine	erucylphosphocholine results in increased activity of CASP3 protein	11848499
C472787	erucylphospho-N,N,N-trimethylpropylammonium	erucylphospho-N,N,N-trimethylpropylammonium results in increased cleavage of and results in increased activity of CASP3 protein	20177898
C007628	esculetin	[esculetin co-treated with Paclitaxel] results in increased cleavage of and results in increased activity of CASP3 protein	16051289
C007628	esculetin	esculetin results in increased activity of CASP3 protein	24995577; 26388407;
C007628	esculetin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [[ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate co-treated with BCL2 protein co-treated with esculetin] results in increased activity of CASP3 protein]	19786087
C007628	esculetin	[ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate co-treated with BCL2 protein co-treated with esculetin] results in increased activity of CASP3 protein	19786087
C011246	essential 303 forte	[essential 303 forte co-treated with Silymarin co-treated with Melatonin analog] affects the activity of CASP3 protein	25903262
D004958	Estradiol	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[Estradiol co-treated with LEP protein] results in decreased activity of CASP3 protein]	23850738
D004958	Estradiol	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [Estradiol results in decreased activity of CASP3 protein]	23850738
D004958	Estradiol	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [Estradiol results in decreased expression of CASP3 protein]	23850738
D004958	Estradiol	[2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one results in decreased activity of [MAPK1 protein co-treated with MAPK3 protein]] inhibits the reaction [[LEP protein co-treated with Estradiol] results in decreased expression of CASP3 protein]	23850738
D004958	Estradiol	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with Estradiol] results in decreased activity of CASP3 protein]	23850738
D004958	Estradiol	[alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide results in decreased activity of JAK2 protein] inhibits the reaction [[LEP protein co-treated with Estradiol] results in decreased expression of CASP3 protein]	23850738
D004958	Estradiol	[ESR1 protein results in increased susceptibility to Estradiol] inhibits the reaction [Fenofibrate results in decreased expression of CASP3 protein]	29134746
D004958	Estradiol	[ESR2 protein results in increased susceptibility to Estradiol] which results in increased cleavage of CASP3 protein	21732360
D004958	Estradiol	Estradiol affects the activity of CASP3 protein	31278978
D004958	Estradiol	Estradiol affects the reaction [dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein]	24954032
D004958	Estradiol	[Estradiol co-treated with LEP protein] results in decreased expression of CASP3 mRNA	23850738
D004958	Estradiol	[Estradiol co-treated with LEP protein] results in decreased expression of CASP3 protein	23850738
D004958	Estradiol	Estradiol inhibits the reaction [APP protein results in increased activity of CASP3 protein]	12963085
D004958	Estradiol	Estradiol inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	24954032
D004958	Estradiol	Estradiol promotes the reaction [LEP protein results in decreased activity of CASP3 protein]	23850738
D004958	Estradiol	Estradiol results in decreased activity of CASP3 protein	23850738
D004958	Estradiol	Estradiol results in decreased expression of CASP3 mRNA	23850738
D004958	Estradiol	Estradiol results in decreased expression of CASP3 protein	23850738
D004958	Estradiol	Estradiol results in increased activity of CASP3 protein	16924424; 19095654;
D004958	Estradiol	Estradiol results in increased cleavage of CASP3 protein	19347870; 21732360;
D004958	Estradiol	Estradiol results in increased expression of CASP3 protein modified form	20945400
D004958	Estradiol	LEP protein promotes the reaction [Estradiol results in decreased activity of CASP3 protein]	23850738
D004958	Estradiol	Okadaic Acid inhibits the reaction [Estradiol inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D004958	Estradiol	SB 203580 inhibits the reaction [[ESR2 protein results in increased susceptibility to Estradiol] which results in increased cleavage of CASP3 protein]	21732360
D004958	Estradiol	Estradiol results in increased expression of CASP3 protein	21882229
D004958	Estradiol	ABCC8 protein promotes the reaction [Estradiol results in increased activity of CASP3 protein]	19095654
D004958	Estradiol	Acetylcysteine inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D004958	Estradiol	[alpha-Tocopherol co-treated with beta-Tocopherol co-treated with gamma-Tocopherol co-treated with delta-tocopherol] affects the reaction [Estradiol affects the expression of CASP3 protein]	22389237
D004958	Estradiol	[Caspase Inhibitors results in decreased activity of CASP8 protein] inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D004958	Estradiol	Estradiol affects the expression of CASP3 protein	22389237
D004958	Estradiol	[Estradiol co-treated with Progesterone co-treated with Methylnitrosourea] results in decreased activity of CASP3 protein	22465879
D004958	Estradiol	Estradiol inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]	29625166
D004958	Estradiol	Estradiol inhibits the reaction [Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form]	29425760
D004958	Estradiol	Estradiol promotes the reaction [Testosterone inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]]	29625166
D004958	Estradiol	Estradiol results in decreased expression of CASP3 protein	15964511
D004958	Estradiol	Estradiol results in increased activity of CASP3 protein	15545282; 23788033;
D004958	Estradiol	Fulvestrant inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	23788033
D004958	Estradiol	[Methylnitrosourea co-treated with Estradiol] results in decreased expression of CASP3 mRNA	20732338
D004958	Estradiol	[Methylnitrosourea co-treated with Progesterone co-treated with Estradiol] results in decreased expression of CASP3 mRNA	20732338
D004958	Estradiol	pimagedine inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D004958	Estradiol	[Resveratrol co-treated with Estradiol] results in increased activity of CASP3 protein	24894866
D004958	Estradiol	Tamoxifen inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D004958	Estradiol	Testosterone promotes the reaction [Estradiol inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]]	29625166
C074283	estradiol 3-benzoate	estradiol 3-benzoate results in increased expression of and results in increased activity of CASP3 protein	24316378
C074283	estradiol 3-benzoate	Quercetin inhibits the reaction [estradiol 3-benzoate results in increased expression of and results in increased activity of CASP3 protein]	24316378
C007633	estragole	estragole results in increased expression of CASP3 protein modified form	29054680
D004967	Estrogens	Estrogens results in decreased expression of CASP3 protein	18486349
D004967	Estrogens	Progesterone promotes the reaction [Estrogens results in decreased expression of CASP3 protein]	18486349
D004967	Estrogens	Estrogens results in increased activity of CASP3 protein	26593444
D004966	Estrogens, Conjugated (USP)	[Estrogens, Conjugated (USP) co-treated with Medroxyprogesterone Acetate] results in decreased expression of CASP3 protein	16021059
D004970	Estrone	Estrone results in increased activity of CASP3 protein	22700542
D004970	Estrone	Palmitic Acid promotes the reaction [Estrone results in increased activity of CASP3 protein]	22700542
D004976	Ethacrynic Acid	[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein	23082001
D004976	Ethacrynic Acid	GSTP1 mutant form promotes the reaction [[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein]	23082001
D004976	Ethacrynic Acid	[MCL1 mutant form results in increased susceptibility to [Ethacrynic Acid co-treated with Arsenic Trioxide]] which results in increased cleavage of CASP3 protein	23082001
D004976	Ethacrynic Acid	pyrazolanthrone inhibits the reaction [[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein]	23082001
D000431	Ethanol	[Ascorbic Acid co-treated with Ethanol] results in decreased activity of CASP3 protein	22149461
D000431	Ethanol	Ethanol results in increased expression of CASP3 protein modified form	28919490
D000431	Ethanol	2-phenylacetylenesulfonamide inhibits the reaction [solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
D000431	Ethanol	ADIPOQ protein inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	24582693
D000431	Ethanol	ALDH2 protein inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	19429258
D000431	Ethanol	ATG5 protein promotes the reaction [ADIPOQ protein inhibits the reaction [Ethanol results in increased activity of CASP3 protein]]	24582693
D000431	Ethanol	Ethanol inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
D000431	Ethanol	Ethanol results in increased activity of CASP3 protein	17869084; 19919524; 24582693;
D000431	Ethanol	Ethanol results in increased cleavage of CASP3 protein	21410490; 24374569; 25645596;
D000431	Ethanol	Ethanol results in increased expression of CASP3 mRNA	31226463
D000431	Ethanol	Ethanol results in increased expression of CASP3 protein	31226463
D000431	Ethanol	Ethanol results in increased expression of CASP3 protein modified form	24224909
D000431	Ethanol	HBEGF protein inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	19919524
D000431	Ethanol	IGF1 protein inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	31226463
D000431	Ethanol	IGF1 protein inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	31226463
D000431	Ethanol	NFE2L2 protein inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	23994065
D000431	Ethanol	NFE2L2 protein inhibits the reaction [Ethanol results in increased expression of CASP3 protein modified form]	23994065
D000431	Ethanol	Resveratrol inhibits the reaction [Ethanol results in increased expression of CASP3 protein modified form]	24224909
D000431	Ethanol	S-Adenosylmethionine inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	17869084
D000431	Ethanol	Sirolimus inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	21410490
D000431	Ethanol	solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	25645596
D000431	Ethanol	solanesol promotes the reaction [2-tert-butylhydroquinone inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
D000431	Ethanol	tin protoporphyrin IX inhibits the reaction [solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
D000431	Ethanol	[ADH1 protein co-treated with Ethanol] results in increased activity of CASP3 protein	11981770
D000431	Ethanol	ALDH2 protein inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	19332462
D000431	Ethanol	Calcitriol inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	22892342
D000431	Ethanol	Cimetidine inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	27983966
D000431	Ethanol	dioscin inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	24146112
D000431	Ethanol	diphenyleneiodonium inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	20026259
D000431	Ethanol	Drugs, Chinese Herbal inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	27983966
D000431	Ethanol	Ethanol affects the expression of CASP3 mRNA	30319688
D000431	Ethanol	Ethanol results in increased activity of CASP3 protein	16317704; 19332462; 19429258; 20026259; 22892342; 23500890;
D000431	Ethanol	Ethanol results in increased cleavage of and results in increased activity of CASP3 protein	15977640; 22497828; 23994065;
D000431	Ethanol	Ethanol results in increased cleavage of CASP3 protein	22535522; 28962519;
D000431	Ethanol	Ethanol results in increased expression of and results in increased activity of CASP3 protein	29800586
D000431	Ethanol	Ethanol results in increased expression of CASP3 mRNA	27033740
D000431	Ethanol	Ethanol results in increased expression of CASP3 protein	24146112; 27983966;
D000431	Ethanol	Ethanol results in increased expression of CASP3 protein modified form	23994065; 27270636; 29069573;
D000431	Ethanol	MAPK14 protein promotes the reaction [Ethanol results in increased expression of CASP3 protein modified form]	27270636
D000431	Ethanol	Memantine inhibits the reaction [Ethanol results in increased expression of and results in increased activity of CASP3 protein]	29800586
D000431	Ethanol	Pentoxifylline inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	16317704
D000431	Ethanol	SIAH1 protein promotes the reaction [Ethanol results in increased expression of CASP3 protein modified form]	27270636
D000431	Ethanol	sulforafan inhibits the reaction [Ethanol results in increased expression of CASP3 protein modified form]	29069573
D000431	Ethanol	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
D000431	Ethanol	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	28962519
D000431	Ethanol	TLR4 gene mutant form inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	23500890
D000431	Ethanol	Zinc inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	27033740
D000431	Ethanol	2,6-difluoro-N-(1-(4-hydroxy-2-(trifluoromethyl)benzyl)-1H-pyrazol-3-yl)benzamide inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D000431	Ethanol	2-aminoethyl diphenylborinate inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D000431	Ethanol	acetovanillone inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
D000431	Ethanol	acetovanillone inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	26522475
D000431	Ethanol	beta-patchoulene analog inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	29339218
D000431	Ethanol	caraway oil inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	25859307
D000431	Ethanol	corosolic acid inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D000431	Ethanol	crocin affects the reaction [Ethanol results in increased expression of CASP3 mRNA]	25637687
D000431	Ethanol	crocin inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	25637687
D000431	Ethanol	[Dietary Fats co-treated with Ethanol] results in increased expression of CASP3 mRNA	30372842
D000431	Ethanol	[Ethanol co-treated with Nicotine] results in increased expression of CASP3 protein	12218695
D000431	Ethanol	Ethanol promotes the reaction [[manganese chloride results in increased abundance of Manganese] which results in increased expression of CASP3 protein]	30844427
D000431	Ethanol	Ethanol promotes the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D000431	Ethanol	Ethanol results in increased activity of CASP3 protein	12700235; 14598302; 15146544; 16237857; 21704112; 25289771; 25637687;
D000431	Ethanol	Ethanol results in increased cleavage of and results in increased activity of CASP3 protein	22497828
D000431	Ethanol	Ethanol results in increased cleavage of CASP3 protein	14741756; 24769256; 25859307; 26033013; 26747958; 29085585;
D000431	Ethanol	Ethanol results in increased expression of CASP3	23422878
D000431	Ethanol	Ethanol results in increased expression of CASP3 mRNA	19815060; 25637687; 30372842; 31226463;
D000431	Ethanol	Ethanol results in increased expression of CASP3 protein	12218695; 24146112; 26522475; 28442378; 29339218; 30844427; 31226463;
D000431	Ethanol	ginkgolide B inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	21704112
D000431	Ethanol	Go 6976 inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
D000431	Ethanol	Hemin inhibits the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D000431	Ethanol	Lansoprazole inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	29339218
D000431	Ethanol	Lanthanoid Series Elements inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D000431	Ethanol	[manganese chloride results in increased abundance of Manganese] promotes the reaction [Ethanol results in increased expression of CASP3 protein]	30844427
D000431	Ethanol	Melatonin inhibits the reaction [[Dietary Fats co-treated with Ethanol] results in increased expression of CASP3 mRNA]	30372842
D000431	Ethanol	Melatonin inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	30372842
D000431	Ethanol	Nicotine inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	16237857
D000431	Ethanol	nymphayol inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	25289771
D000431	Ethanol	Omeprazole inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	25637687
D000431	Ethanol	Omeprazole inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	25637687
D000431	Ethanol	ORAI1 protein affects the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D000431	Ethanol	[[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] co-treated with Hemin] results in increased cleavage of CASP3 protein	26747958
D000431	Ethanol	[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein	26747958
D000431	Ethanol	PRKCB protein affects the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
D000431	Ethanol	Resveratrol inhibits the reaction [Ethanol results in increased expression of CASP3]	23422878
D000431	Ethanol	salvianolic acid B inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	24769256
D000431	Ethanol	STIM1 protein affects the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
D000431	Ethanol	thymoquinone inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	29085585
D000431	Ethanol	zinc protoporphyrin promotes the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D000431	Ethanol	zingerone inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	28442378
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of CASP3 mRNA	29935216
D004997	Ethinyl Estradiol	Streptozocin inhibits the reaction [Ethinyl Estradiol results in decreased expression of CASP3 mRNA]	29935216
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of CASP3 mRNA	19815060
D004997	Ethinyl Estradiol	[Gossypol co-treated with Methyltestosterone co-treated with Ethinyl Estradiol] results in increased expression of CASP3 mRNA	15451339
D005001	Ethionine	Ethionine affects the expression of CASP3 mRNA	19483382
C456800	ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate	[alvocidib co-treated with ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate] results in increased cleavage of CASP3 protein	15634644
C456800	ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate	ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate results in increased activity of CASP3 protein	15953346
C456800	ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [[ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate co-treated with BCL2 protein co-treated with esculetin] results in increased activity of CASP3 protein]	19786087
C456800	ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate	[ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate co-treated with BCL2 protein co-treated with esculetin] results in increased activity of CASP3 protein	19786087
C004912	ethylbenzene	ethylbenzene results in increased expression of CASP3 mRNA	20156836; 21241565; 25518993;
C004912	ethylbenzene	ethylbenzene results in increased expression of CASP3 protein	20137408; 20156836; 25518993;
C495711	ethyl eicosapentaenoic acid	ethyl eicosapentaenoic acid results in decreased expression of CASP3 mRNA	20868657
C024565	ethylene dichloride	ethylene dichloride results in decreased expression of CASP3 mRNA	28189721
C024565	ethylene dichloride	ethylene dichloride results in increased cleavage of CASP3 protein	31520740
C024565	ethylene dichloride	ethylene dichloride results in increased expression of CASP3 mRNA	28973639
C024565	ethylene dichloride	ethylene dichloride results in increased expression of CASP3 protein	28973639
C002994	ethylene dimethanesulfonate	ethylene dimethanesulfonate results in increased expression of CASP3 mRNA	22711419
D005027	Ethylene Oxide	Ethylene Oxide analog affects the activity of CASP3 protein	16311010
D005038	Ethylnitrosourea	Ethylnitrosourea results in increased cleavage of CASP3 protein	28549617
D017308	Etodolac	Etodolac results in increased activity of CASP3 protein	16046235; 16104877;
D005045	Etomidate	Etomidate promotes the reaction [ALB protein modified form results in increased cleavage of and results in increased activity of CASP3 protein]	25421967
D005047	Etoposide	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	16014620
D005047	Etoposide	3',4'-dihydroxyflavone analog inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	16014620
D005047	Etoposide	Acetylcysteine inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	16014620
D005047	Etoposide	Aspirin inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	21617849
D005047	Etoposide	BCL2L1 protein inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	8840993
D005047	Etoposide	BCL2 protein inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	8840993
D005047	Etoposide	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	18056177
D005047	Etoposide	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	30890322
D005047	Etoposide	[CASP8 co-treated with TP53] affects the reaction [Etoposide results in increased cleavage of CASP3 protein]	21801448
D005047	Etoposide	CASP8 mutant form inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	21801448
D005047	Etoposide	CD40LG protein inhibits the reaction [Etoposide promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	16545138
D005047	Etoposide	CDKN1A mutant form inhibits the reaction [Aspirin inhibits the reaction [Etoposide results in increased activity of CASP3 protein]]	21617849
D005047	Etoposide	Dehydroascorbic Acid promotes the reaction [Etoposide results in increased activity of CASP3 protein]	16951922
D005047	Etoposide	Etoposide affects the expression of CASP3 protein	15215046
D005047	Etoposide	[Etoposide co-treated with Mifepristone] results in increased activity of CASP3 protein	30217652
D005047	Etoposide	Etoposide promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	16545138
D005047	Etoposide	Etoposide promotes the reaction [Gold results in increased activity of CASP3 protein]	19760634
D005047	Etoposide	Etoposide promotes the reaction [Nanotubes, Carbon results in increased activity of CASP3 protein]	19760634
D005047	Etoposide	Etoposide promotes the reaction [Silver results in increased activity of CASP3 protein]	19760634
D005047	Etoposide	Etoposide results in increased activity of CASP3 protein	10759716; 12871656; 15924153; 16364925; 16844113; 16951922; 18056177; 19047049; 19662097; 20299546; 21617849; 21801448; 22302033; 26259609; 8840993;
D005047	Etoposide	Etoposide results in increased cleavage of and results in increased activity of CASP3 protein	17935137; 25447644;
D005047	Etoposide	Etoposide results in increased cleavage of CASP3 protein	16014620; 21745461; 21745629; 21801448; 26259609; 30890322;
D005047	Etoposide	Etoposide results in increased expression of CASP3 protein	16192531; 16844113; 23144690;
D005047	Etoposide	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D005047	Etoposide	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D005047	Etoposide	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D005047	Etoposide	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D005047	Etoposide	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	21745461
D005047	Etoposide	nimesulide inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	21745461
D005047	Etoposide	Oxygen deficiency inhibits the reaction [Etoposide results in increased expression of CASP3 protein]	23144690
D005047	Etoposide	palbociclib inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	22302033
D005047	Etoposide	pifithrin promotes the reaction [Etoposide results in increased activity of CASP3 protein]	26259609
D005047	Etoposide	pifithrin promotes the reaction [Etoposide results in increased cleavage of CASP3 protein]	26259609
D005047	Etoposide	[RASSF1 co-treated with Etoposide] results in increased cleavage of CASP3 protein	21880625
D005047	Etoposide	[STAT1 protein results in increased activity of CASP3 protein] which results in increased susceptibility to Etoposide	18649362
D005047	Etoposide	Tetrachlorodibenzodioxin inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	20299546
D005047	Etoposide	TMSB4X protein inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	16364925
D005047	Etoposide	TP73 mutant form inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	21801448
D005047	Etoposide	TP73 mutant form inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	21801448
D005047	Etoposide	Wortmannin promotes the reaction [Etoposide results in increased cleavage of and results in increased activity of CASP3 protein]	17935137
D005047	Etoposide	2-tert-butylhydroquinone inhibits the reaction [Etoposide results in increased cleavage of and results in increased activity of CASP3 protein]	22275372
D005047	Etoposide	BCL2 protein affects the reaction [[Etoposide results in increased activity of GSK3B protein] which results in increased activity of CASP3 protein]	19408126
D005047	Etoposide	Etoposide results in increased activity of CASP3 protein	20573984
D005047	Etoposide	[Etoposide results in increased activity of GSK3B protein] which results in increased activity of CASP3 protein	19408126
D005047	Etoposide	Etoposide results in increased cleavage of and results in increased activity of CASP3 protein	22275372
D005047	Etoposide	HIPK2 gene mutant form promotes the reaction [Etoposide results in increased activity of CASP3 protein]	20573984
D005047	Etoposide	Etoposide results in increased activity of CASP3 protein	17516866
D005054	Eugenol	Eugenol results in increased activity of CASP3 protein	25455450
D005054	Eugenol	Eugenol results in increased expression of CASP3 mRNA	30518369
D005054	Eugenol	Eugenol inhibits the reaction [Methylnitronitrosoguanidine results in decreased expression of CASP3 mRNA]	20434464
D005054	Eugenol	Eugenol inhibits the reaction [Methylnitronitrosoguanidine results in decreased expression of CASP3 protein]	20434464
D005054	Eugenol	Eugenol results in increased cleavage of CASP3 protein	20537511
D005054	Eugenol	Eugenol results in increased expression of CASP3 protein modified form	20537511
D005054	Eugenol	Eugenol inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	21656368
C433928	EUK-134	EUK-134 inhibits the reaction [Capsaicin results in increased cleavage of CASP3 protein]	21647434
C580814	EUK-172	EUK-172 inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	23041154
D000068338	Everolimus	Everolimus results in increased cleavage of CASP3 protein	15940265
C049639	evodiamine	benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [evodiamine results in increased activity of and results in increased cleavage of CASP3 protein]	20005289
C049639	evodiamine	evodiamine results in increased activity of and results in increased cleavage of CASP3 protein	20005289
C562064	EVP 4593	EVP 4593 inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29087013
C574336	excavatolide B	excavatolide B results in decreased expression of CASP3 protein	26790859
D018683	Excitatory Amino Acid Agents	Excitatory Amino Acid Agents results in increased activity of CASP3 protein	16371440
D018683	Excitatory Amino Acid Agents	HMOX2 gene mutant form promotes the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D018683	Excitatory Amino Acid Agents	[Excitatory Amino Acid Agents co-treated with 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one] results in increased activity of CASP3 protein	21858143
D018683	Excitatory Amino Acid Agents	Excitatory Amino Acid Agents results in increased activity of CASP3 protein	21858143
D018683	Excitatory Amino Acid Agents	Bilirubin inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D018683	Excitatory Amino Acid Agents	[cobaltiprotoporphyrin results in increased expression of HMOX1 protein] inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D018683	Excitatory Amino Acid Agents	HMOX1 protein inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D018683	Excitatory Amino Acid Agents	sodium boranocarbonate inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D018683	Excitatory Amino Acid Agents	tin protoporphyrin IX inhibits the reaction [[cobaltiprotoporphyrin results in increased expression of HMOX1 protein] inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]]	16371440
D018690	Excitatory Amino Acid Agonists	MFN2 protein inhibits the reaction [Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form]	25416777
D018690	Excitatory Amino Acid Agonists	Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form	25416777
D018690	Excitatory Amino Acid Agonists	agathisflavone inhibits the reaction [Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form]	29425760
D018690	Excitatory Amino Acid Agonists	Estradiol inhibits the reaction [Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form]	29425760
D018690	Excitatory Amino Acid Agonists	Excitatory Amino Acid Agonists results in increased expression of CASP3 protein modified form	29425760
C411675	F 12509A	F 12509A results in increased cleavage of CASP3 protein	16281067
C018541	falcarinol	falcarinol results in decreased expression of and results in decreased activity of CASP3 protein	19800326
C018541	falcarinol	falcarinol results in decreased expression of CASP3 protein modified form	19800326
C060802	fangchinoline	fangchinoline results in increased cleavage of CASP3 protein	28754437
D005204	Farnesol	Farnesol results in increased activity of CASP3 protein	10733934
D005204	Farnesol	Farnesol results in decreased activity of CASP3 protein	21453689
C004808	farnesyl pyrophosphate	farnesyl pyrophosphate inhibits the reaction [Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein]	18766339
C004808	farnesyl pyrophosphate	farnesyl pyrophosphate inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	15200425
C069346	fascaplysine	fascaplysine analog results in increased cleavage of CASP3 protein	28756150
C049347	fasudil	fasudil inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17761835
C545733	fatostatin	Docetaxel promotes the reaction [[TP53 protein mutant form results in increased susceptibility to fatostatin] which results in increased cleavage of CASP3 protein]	26512780
C545733	fatostatin	fatostatin results in increased cleavage of CASP3 protein	24493696; 29436682;
C545733	fatostatin	[TP53 protein mutant form results in increased susceptibility to fatostatin] which results in increased cleavage of CASP3 protein	26512780
C545733	fatostatin	fatostatin promotes the reaction [Streptozocin results in increased cleavage of CASP3 protein]	29420703
D005230	Fatty Acids, Nonesterified	CAPN2 protein affects the reaction [Fatty Acids, Nonesterified results in increased activity of CASP3 protein]	23527285
D005230	Fatty Acids, Nonesterified	Fatty Acids, Nonesterified results in increased cleavage of and results in increased activity of CASP3 protein	23527285
D000069465	Febuxostat	Febuxostat inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26036690
D011345	Fenofibrate	[ESR1 protein results in increased susceptibility to Estradiol] inhibits the reaction [Fenofibrate results in decreased expression of CASP3 protein]	29134746
D011345	Fenofibrate	Fenofibrate results in decreased expression of CASP3 protein	29134746
D011345	Fenofibrate	Fenofibrate results in increased cleavage of CASP3 protein	20520642
D011345	Fenofibrate	Fenofibrate inhibits the reaction [ACADS protein affects the cleavage of CASP3 protein]	26989860
D011345	Fenofibrate	Fenofibrate inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	26989860
D017313	Fenretinide	4-((4-(4-ethylphenyl)-2,2-dimethyl-(2H)-thiochromen-6-yl)ethynyl)benzoic acid inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16972258
D017313	Fenretinide	AGN 193109 inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16972258
D017313	Fenretinide	Ascorbic Acid inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16124896; 16407847;
D017313	Fenretinide	Butylated Hydroxyanisole inhibits the reaction [Fenretinide results in increased activity of CASP3 protein]	16407847
D017313	Fenretinide	[Fenretinide co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	17273769
D017313	Fenretinide	Fenretinide results in decreased expression of CASP3 protein	17159502
D017313	Fenretinide	[Fenretinide results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	16124896
D017313	Fenretinide	Fenretinide results in increased activity of CASP3 protein	16124896; 16407847; 16675469; 16972258; 20022965;
D017313	Fenretinide	Fenretinide results in increased cleavage of CASP3 protein	21319187
D017313	Fenretinide	Fenretinide results in increased expression of CASP3 protein modified form	19912993
D017313	Fenretinide	NR4A1 protein affects the reaction [Fenretinide results in increased expression of CASP3 protein modified form]	19912993
D017313	Fenretinide	NR4A1 protein promotes the reaction [Fenretinide results in increased cleavage of CASP3 protein]	21319187
C017690	fenvalerate	fenvalerate affects the expression of CASP3 mRNA	20003521
C013531	ferric ammonium citrate	ferric ammonium citrate results in increased cleavage of CASP3 protein	17191120
C013531	ferric ammonium citrate	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	27481217
C013531	ferric ammonium citrate	acetylleucyl-leucyl-norleucinal inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	27481217
C013531	ferric ammonium citrate	Deferoxamine inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	26318285
C013531	ferric ammonium citrate	DNM1L protein mutant form inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	26318285
C013531	ferric ammonium citrate	ferric ammonium citrate results in increased cleavage of CASP3 protein	26318285; 27481217;
C013531	ferric ammonium citrate	N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	27481217
C024555	ferric chloride	[ferric chloride co-treated with Hydrogen Peroxide co-treated with TNF protein] results in increased activity of CASP3 protein	19900513
D005290	Ferric Compounds	Ferric Compounds results in increased expression of CASP3 mRNA	24035972
D005290	Ferric Compounds	Ferric Compounds results in increased expression of CASP3 protein	24035972
C020326	ferric nitrilotriacetate	[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased cleavage of and results in decreased expression of CASP3 protein	21907755
C020326	ferric nitrilotriacetate	[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased expression of CASP3 mRNA	21907755
C020326	ferric nitrilotriacetate	geraniol inhibits the reaction [[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased cleavage of and results in decreased expression of CASP3 protein]	21907755
C020326	ferric nitrilotriacetate	geraniol inhibits the reaction [[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased expression of CASP3 mRNA]	21907755
C000499	ferric oxide	bromotetrandrine promotes the reaction [[ferric oxide co-treated with ferrous oxide co-treated with Daunorubicin] results in increased expression of CASP3 protein]	19421372
C000499	ferric oxide	ferric oxide results in increased cleavage of CASP3 protein	26991130
D000077605	Ferric Oxide, Saccharated	Ferric Oxide, Saccharated results in increased cleavage of and results in increased activity of CASP3 protein	16957011
D000077605	Ferric Oxide, Saccharated	Ferric Oxide, Saccharated results in increased expression of CASP3 protein	16957011
D052203	Ferrosoferric Oxide	[Ferrosoferric Oxide binds to titanium dioxide] which results in increased cleavage of CASP3 protein	30098274
D052203	Ferrosoferric Oxide	[Methotrexate co-treated with [Ferrosoferric Oxide binds to polylactide-polyethylene glycol-polylactide]] results in increased expression of CASP3 mRNA	24935781
D052203	Ferrosoferric Oxide	[Methotrexate co-treated with [Ferrosoferric Oxide binds to polylactide-polyethylene glycol-polylactide]] results in increased expression of CASP3 protein modified form	24935781
C034236	ferrous oxide	bromotetrandrine promotes the reaction [[ferric oxide co-treated with ferrous oxide co-treated with Daunorubicin] results in increased expression of CASP3 protein]	19421372
C020748	ferrous sulfate	[Ascorbic Acid co-treated with ferrous sulfate] results in increased activity of CASP3 protein	17879260
C020748	ferrous sulfate	[Ascorbic Acid co-treated with ferrous sulfate] results in increased expression of CASP3 mRNA	17879260
C020748	ferrous sulfate	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased activity of CASP3 protein]	17879260
C020748	ferrous sulfate	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased expression of CASP3 mRNA]	17879260
C020748	ferrous sulfate	2-tert-butylhydroquinone inhibits the reaction [ferrous sulfate results in increased cleavage of CASP3 protein]	28583816
C020748	ferrous sulfate	ferrous sulfate results in increased cleavage of CASP3 protein	28583816
C004999	ferulic acid	ferulic acid analog inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	31029786
D018120	Finasteride	Finasteride inhibits the reaction [Testosterone results in decreased expression of CASP3 protein modified form]	27687055
D018120	Finasteride	Finasteride inhibits the reaction [Testosterone results in increased expression of CASP3 protein]	25714330
D018120	Finasteride	Finasteride results in increased expression of CASP3 mRNA	24136188
D000068876	Fingolimod Hydrochloride	3-methyladenine inhibits the reaction [Fingolimod Hydrochloride results in increased cleavage of CASP3 protein]	25939952
D000068876	Fingolimod Hydrochloride	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Fingolimod Hydrochloride results in increased cleavage of CASP3 protein]	25939952
D000068876	Fingolimod Hydrochloride	Fingolimod Hydrochloride results in increased activity of CASP3 protein	29654831
D000068876	Fingolimod Hydrochloride	Fingolimod Hydrochloride results in increased cleavage of CASP3 protein	25939952
C038628	fipexide	fipexide results in increased activity of CASP3 protein	22700542
C038628	fipexide	Palmitic Acid promotes the reaction [fipexide results in increased activity of CASP3 protein]	22700542
C082360	fipronil	fipronil results in increased activity of CASP3 protein	17084830; 21296133; 21621551; 22421270;
C082360	fipronil	kenpaullone inhibits the reaction [fipronil results in increased activity of CASP3 protein]	21296133
C082360	fipronil	Lithium Chloride inhibits the reaction [fipronil results in increased activity of CASP3 protein]	21296133
C082360	fipronil	fipronil results in increased expression of CASP3 mRNA	30777931
C082360	fipronil	Plant Extracts inhibits the reaction [fipronil results in increased expression of CASP3 mRNA]	30777931
C017875	fisetin	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [fisetin results in increased activity of CASP3 protein]	28181380
C017875	fisetin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [fisetin results in increased activity of CASP3 protein]	21964635
C017875	fisetin	[Cisplatin co-treated with fisetin] results in increased cleavage of and results in increased activity of CASP3 protein	21216935
C017875	fisetin	[fisetin co-treated with Paclitaxel] results in increased expression of CASP3 mRNA	26884726
C017875	fisetin	fisetin inhibits the reaction [Silicon Dioxide results in increased expression of CASP3 mRNA]	22931364
C017875	fisetin	fisetin results in increased activity of CASP3 protein	21964635; 28181380;
C017875	fisetin	fisetin inhibits the reaction [Lead results in increased cleavage of CASP3 protein]	31539617
C017875	fisetin	fisetin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25184746
C017875	fisetin	[bisphenol A co-treated with fisetin] results in increased expression of CASP3 mRNA	29544186
D005411	Flame Retardants	Flame Retardants results in increased activity of CASP3 protein	19356805
D005411	Flame Retardants	Flame Retardants results in increased expression of CASP3 mRNA	19356805
D005411	Flame Retardants	Flame Retardants results in increased activity of CASP3 protein	22547355
D005411	Flame Retardants	Flame Retardants results in decreased expression of and results in decreased cleavage of CASP3 protein	31241157
C028610	flavanone	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to flavanone	22056764
C028610	flavanone	flavanone results in increased cleavage of and results in increased activity of CASP3 protein	22056764
D044950	Flavanones	Flavanones results in increased cleavage of CASP3 protein	25446852
C043562	flavone	flavone results in increased activity of CASP3 protein	15289867; 15800915;
C043562	flavone	Melatonin promotes the reaction [flavone results in increased activity of CASP3 protein]	15800915
D047309	Flavones	Flavones analog results in increased activity of CASP3 protein	20674374
D005419	Flavonoids	Flavonoids results in increased activity of CASP3 protein	23063593; 24036141;
D005419	Flavonoids	Flavonoids results in increased cleavage of CASP3 protein	28811126
D005419	Flavonoids	Flavonoids inhibits the reaction [Carbon Tetrachloride results in increased expression of CASP3 protein]	23279844
D005419	Flavonoids	Flavonoids results in increased activity of CASP3 protein	24036141
D044948	Flavonols	Flavonols results in increased activity of and results in increased cleavage of CASP3 protein	28235426
D005424	Flecainide	Flecainide results in increased activity of CASP3 protein	22700542
D005424	Flecainide	Palmitic Acid promotes the reaction [Flecainide results in increased activity of CASP3 protein]	22700542
C548902	FLLL 32	FLLL 32 results in increased activity of CASP3 protein	20576164
C548902	FLLL 32	FLLL 32 results in increased cleavage of CASP3 protein	20712901
C075780	fluazinam	fluazinam results in increased activity of CASP3 protein	21907236
C024352	fludarabine	[2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with fludarabine] results in increased cleavage of CASP3 protein	15850772
C024352	fludarabine	BCL2 inhibits the reaction [fludarabine results in increased cleavage of and results in increased activity of CASP3 protein]	15516989
C024352	fludarabine	Boc-D-FMK inhibits the reaction [[fludarabine co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein]	15850772
C024352	fludarabine	[Clofarabine co-treated with fludarabine co-treated with Busulfan] results in increased cleavage of CASP3 protein	20933509
C024352	fludarabine	[fludarabine co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	12780785
C024352	fludarabine	fludarabine results in increased activity of CASP3 protein	11675354
C024352	fludarabine	fludarabine results in increased cleavage of and results in increased activity of CASP3 protein	15516989
C024352	fludarabine	[LAQ824 co-treated with fludarabine] results in increased activity of CASP3 protein	18852132
C024352	fludarabine	MAP2K1 protein inhibits the reaction [[2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with fludarabine] results in increased cleavage of CASP3 protein]	15850772
C024352	fludarabine	pyrazolanthrone inhibits the reaction [[fludarabine co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein]	15850772
C024352	fludarabine	fludarabine inhibits the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	30506661
C108339	fludioxonil	fludioxonil results in increased expression of CASP3 mRNA	22880100
C108339	fludioxonil	[pyrimethanil co-treated with cyprodinil co-treated with fludioxonil] results in increased expression of CASP3 mRNA	22880100
D005439	Flufenamic Acid	Flufenamic Acid inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	27957685
D005445	Flunitrazepam	CYP3A4 protein affects the reaction [Flunitrazepam results in increased activity of CASP3 protein]	19005028
D005459	Fluorides	Diethylnitrosamine promotes the reaction [[Sodium Fluoride results in increased abundance of Fluorides] which results in increased activity of CASP3 protein]	30920066
D005459	Fluorides	Fluorides results in increased activity of CASP3 protein	29800585
D005459	Fluorides	Fluorides results in increased expression of CASP3 mRNA	28158927
D005459	Fluorides	[Sodium Fluoride results in increased abundance of Fluorides] promotes the reaction [Diethylnitrosamine results in increased activity of CASP3 protein]	30920066
D005459	Fluorides	[Sodium Fluoride results in increased abundance of Fluorides] which results in increased activity of CASP3 protein	30920066
D005472	Fluorouracil	[10-hydroxycamptothecin co-treated with Fluorouracil co-treated with Leucovorin] results in increased activity of CASP3 protein	12934351
D005472	Fluorouracil	3-methyladenine promotes the reaction [Fluorouracil results in increased cleavage of and results in increased activity of CASP3 protein]	19116755
D005472	Fluorouracil	Apigenin promotes the reaction [Fluorouracil results in increased activity of CASP3 protein]	19885610
D005472	Fluorouracil	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Fluorouracil co-treated with olaparib] results in increased cleavage of CASP3 protein]	26544897
D005472	Fluorouracil	CA 074 methyl ester inhibits the reaction [Fluorouracil results in increased cleavage of CASP3 protein]	19816940
D005472	Fluorouracil	CASP8 affects the reaction [Fluorouracil promotes the reaction [andrographolide results in increased activity of CASP3 protein]]	19097688
D005472	Fluorouracil	Celecoxib inhibits the reaction [Fluorouracil results in increased expression of CASP3 protein]	17461495
D005472	Fluorouracil	[Doxorubicin co-treated with Paclitaxel co-treated with Fluorouracil] results in increased activity of CASP3 protein	16168113
D005472	Fluorouracil	Drugs, Chinese Herbal promotes the reaction [Fluorouracil results in increased cleavage of and results in increased expression of CASP3 protein]	21461573
D005472	Fluorouracil	FAS protein affects the reaction [Fluorouracil results in increased activity of CASP3 protein]	17056233
D005472	Fluorouracil	[Fluorouracil co-treated with aloe emodin] affects the expression of CASP3	19928967
D005472	Fluorouracil	[Fluorouracil co-treated with Cisplatin] results in increased activity of CASP3 protein	16803524
D005472	Fluorouracil	[Fluorouracil co-treated with Cisplatin] results in increased expression of CASP3 protein	16803524
D005472	Fluorouracil	[Fluorouracil co-treated with IFNB1 protein] results in increased activity of CASP3 protein	18608205
D005472	Fluorouracil	[Fluorouracil co-treated with olaparib] results in increased cleavage of CASP3 protein	26544897
D005472	Fluorouracil	[Fluorouracil co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	15120327
D005472	Fluorouracil	Fluorouracil promotes the reaction [aloe emodin results in increased expression of CASP3 protein modified form]	19928967
D005472	Fluorouracil	Fluorouracil promotes the reaction [andrographolide results in increased activity of CASP3 protein]	19097688
D005472	Fluorouracil	Fluorouracil promotes the reaction [Drugs, Chinese Herbal results in increased cleavage of and results in increased expression of CASP3 protein]	21461573
D005472	Fluorouracil	Fluorouracil promotes the reaction [gambogic acid results in decreased expression of CASP3 mRNA]	19084572
D005472	Fluorouracil	Fluorouracil promotes the reaction [Sirolimus results in increased expression of CASP3 mRNA]	19764996
D005472	Fluorouracil	Fluorouracil promotes the reaction [temsirolimus results in increased expression of CASP3 mRNA]	19764996
D005472	Fluorouracil	Fluorouracil promotes the reaction [TNFSF10 protein results in increased cleavage of and results in increased activity of CASP3 protein]	20876774
D005472	Fluorouracil	Fluorouracil results in decreased cleavage of CASP3 protein	26310874
D005472	Fluorouracil	Fluorouracil results in increased activity of and results in increased cleavage of CASP3 protein	17399942
D005472	Fluorouracil	Fluorouracil results in increased activity of CASP3 protein	10891390; 12414664; 12941601; 15685448; 16080519; 16407826; 16803524; 17056233; 17219956; 18830594; 19885610; 21036698;
D005472	Fluorouracil	Fluorouracil results in increased cleavage of and results in increased activity of CASP3 protein	15282376; 19116755; 19816940;
D005472	Fluorouracil	Fluorouracil results in increased cleavage of and results in increased expression of CASP3 protein	21461573
D005472	Fluorouracil	Fluorouracil results in increased cleavage of CASP3 protein	17498489; 18161298; 18205257; 26544897;
D005472	Fluorouracil	Fluorouracil results in increased expression of CASP3	11300326
D005472	Fluorouracil	Fluorouracil results in increased expression of CASP3 mRNA	14503796; 17589894; 19764996;
D005472	Fluorouracil	Fluorouracil results in increased expression of CASP3 protein	15585135; 16803524; 17461495; 17589894;
D005472	Fluorouracil	HK2 protein affects the reaction [Fluorouracil results in increased activity of CASP3 protein]	18772588
D005472	Fluorouracil	IFI6 protein inhibits the reaction [Fluorouracil results in increased activity of CASP3 protein]	15685448
D005472	Fluorouracil	IFNA1 protein promotes the reaction [Fluorouracil results in increased activity of CASP3 protein]	17016659
D005472	Fluorouracil	PTGS2 protein inhibits the reaction [Fluorouracil results in increased activity of CASP3 protein]	12414664
D005472	Fluorouracil	Resveratrol inhibits the reaction [Fluorouracil results in decreased cleavage of CASP3 protein]	26310874
D005472	Fluorouracil	RNF34 protein inhibits the reaction [Fluorouracil results in increased activity of CASP3 protein]	16080519; 16407826;
D005472	Fluorouracil	[S100A11 mutant form results in increased susceptibility to Fluorouracil] which results in increased activity of CASP3 protein	25940438
D005472	Fluorouracil	Sirolimus promotes the reaction [Fluorouracil results in increased expression of CASP3 mRNA]	19764996
D005472	Fluorouracil	[SM-1 compound co-treated with Fluorouracil] results in increased cleavage of CASP3 protein	28599477
D005472	Fluorouracil	temsirolimus promotes the reaction [Fluorouracil results in increased expression of CASP3 mRNA]	19764996
D005472	Fluorouracil	TNFRSF10B mutant form inhibits the reaction [Fluorouracil results in increased cleavage of CASP3 protein]	26544897
D005472	Fluorouracil	[wogonin co-treated with Fluorouracil] results in increased activity of CASP3 protein	20570612
D005472	Fluorouracil	Apigenin promotes the reaction [Fluorouracil results in increased activity of CASP3 protein]	28025107
D005472	Fluorouracil	Fluorouracil promotes the reaction [Apigenin results in increased activity of CASP3 protein]	28025107
D005472	Fluorouracil	Fluorouracil results in increased activity of CASP3 protein	28025107
D005472	Fluorouracil	Fluorouracil results in increased cleavage of and results in increased activity of CASP3 protein	19116755
D005472	Fluorouracil	Fluorouracil results in increased expression of CASP3 mRNA	29678497
D005472	Fluorouracil	Fluorouracil results in increased expression of CASP3 protein	31288002
D005472	Fluorouracil	Fluorouracil results in increased expression of CASP3 protein modified form	20844880
D005472	Fluorouracil	IL1RN protein affects the reaction [Fluorouracil results in increased expression of CASP3 protein modified form]	20844880
D005472	Fluorouracil	Fluorouracil inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	31129132
D005472	Fluorouracil	Fluorouracil inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	31129132
D005472	Fluorouracil	Fluorouracil results in decreased expression of CASP3 mRNA	19815060
D005472	Fluorouracil	Fluorouracil results in increased activity of CASP3 protein	10568827
D005473	Fluoxetine	Fluoxetine results in increased activity of CASP3 protein	22700542
D005473	Fluoxetine	Fluoxetine results in increased cleavage of CASP3 protein	18371935
D005473	Fluoxetine	Palmitic Acid promotes the reaction [Fluoxetine results in increased activity of CASP3 protein]	22700542
D005473	Fluoxetine	Fluoxetine results in increased activity of CASP3 protein	28482088
D005473	Fluoxetine	Fluoxetine inhibits the reaction [Monocrotaline results in decreased expression of CASP3 protein]	21619414
D005473	Fluoxetine	Fluoxetine promotes the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
D005473	Fluoxetine	Fluoxetine results in increased activity of CASP3 protein	19135049
D005473	Fluoxetine	Fluoxetine results in increased cleavage of CASP3 protein	19298536
D005485	Flutamide	Flutamide inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
D005485	Flutamide	Flutamide promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D005485	Flutamide	Flutamide results in increased expression of CASP3 mRNA	19299419; 24136188;
D000068298	Fluticasone	[Fluticasone co-treated with Salmeterol Xinafoate] results in increased activity of CASP3 protein	15536434
C475882	flutolanil	flutolanil results in increased activity of CASP3 protein	30942079
D000077340	Fluvastatin	Fluvastatin results in increased cleavage of and results in increased activity of CASP3 protein	24964743
D000077340	Fluvastatin	Mevalonic Acid inhibits the reaction [Fluvastatin results in increased cleavage of and results in increased activity of CASP3 protein]	24964743
D016666	Fluvoxamine	Fluvoxamine results in increased activity of CASP3 protein	22700542
D016666	Fluvoxamine	Palmitic Acid promotes the reaction [Fluvoxamine results in increased activity of CASP3 protein]	22700542
D005492	Folic Acid	Folic Acid inhibits the reaction [[APP protein mutant form co-treated with PSEN1 protein mutant form co-treated with MAPT protein mutant form] results in increased expression of CASP3 protein modified form]	29068127
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of CASP3 mRNA	20938992
D005492	Folic Acid	Folic Acid inhibits the reaction [Methotrexate results in decreased expression of CASP3 protein]	30502384
D005557	Formaldehyde	Formaldehyde results in increased activity of CASP3 protein	20347000
D005557	Formaldehyde	Formaldehyde results in increased expression of CASP3 protein modified form	24140967
D005557	Formaldehyde	PRDX2 protein inhibits the reaction [Formaldehyde results in increased activity of CASP3 protein]	20347000
D005557	Formaldehyde	[Benzene co-treated with Formaldehyde] results in increased activity of CASP3 protein	27339418
D005557	Formaldehyde	epigallocatechin gallate inhibits the reaction [Formaldehyde results in increased expression of CASP3 protein]	30395894
D005557	Formaldehyde	Formaldehyde affects the expression of CASP3 protein	29315975
D005557	Formaldehyde	Formaldehyde results in increased activity of CASP3 protein	27339418
D005557	Formaldehyde	Formaldehyde results in increased expression of CASP3 protein	30395894
D005557	Formaldehyde	Meloxicam affects the reaction [Formaldehyde affects the expression of CASP3 protein]	29315975
D005557	Formaldehyde	[Rutin co-treated with Meloxicam] affects the reaction [Formaldehyde affects the expression of CASP3 protein]	29315975
D005557	Formaldehyde	Formaldehyde results in increased activity of CASP3 protein	20448356
D005557	Formaldehyde	DDAH1 protein inhibits the reaction [Formaldehyde results in increased expression of CASP3 protein modified form]	24140967
C007768	formononetin	Acetylcysteine inhibits the reaction [formononetin results in increased expression of CASP3 mRNA]	23867903
C007768	formononetin	Epirubicin promotes the reaction [formononetin results in increased activity of CASP3 protein]	23867903
C007768	formononetin	Epirubicin promotes the reaction [formononetin results in increased expression of CASP3 mRNA]	23867903
C007768	formononetin	formononetin promotes the reaction [Epirubicin results in increased activity of CASP3 protein]	23867903
C007768	formononetin	formononetin promotes the reaction [Epirubicin results in increased expression of CASP3 mRNA]	23867903
C007768	formononetin	formononetin results in increased activity of CASP3 protein	23867903
C007768	formononetin	formononetin results in increased expression of CASP3 mRNA	23867903
C007768	formononetin	formononetin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	28414026
C067584	formosanin C	Chloroquine inhibits the reaction [formosanin C results in increased expression of and results in increased cleavage of CASP3 protein]	27180204
C067584	formosanin C	formosanin C results in increased expression of and results in increased cleavage of CASP3 protein	27180204
C502480	formylchromone	formylchromone analog inhibits the reaction [Diethylnitrosamine results in decreased activity of CASP3 protein]	24954034
C058728	fosbretabulin	[3-methyladenine co-treated with fosbretabulin] results in increased cleavage of CASP3 protein	24321340
C058728	fosbretabulin	3-methyladenine promotes the reaction [fosbretabulin results in increased cleavage of CASP3 protein]	24321340
C058728	fosbretabulin	bafilomycin A1 promotes the reaction [fosbretabulin results in increased cleavage of CASP3 protein]	24321340
C058728	fosbretabulin	fosbretabulin analog results in increased cleavage of CASP3 protein	25529822
C058728	fosbretabulin	fosbretabulin results in increased cleavage of CASP3 protein	24321340
C040313	fostriecin	fostriecin inhibits the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
C505241	FR 180204	FR 180204 promotes the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C105671	fraxetin	fraxetin results in decreased activity of CASP3 protein	15996779
D005620	Freund's Adjuvant	Celecoxib inhibits the reaction [Freund's Adjuvant results in increased activity of CASP3 protein]	24932515
D005620	Freund's Adjuvant	chrysin inhibits the reaction [Freund's Adjuvant results in increased activity of CASP3 protein]	24932515
D005620	Freund's Adjuvant	Freund's Adjuvant results in increased activity of CASP3 protein	24932515
D005620	Freund's Adjuvant	Freund's Adjuvant results in increased expression of CASP3 protein	30025850
D005620	Freund's Adjuvant	Methotrexate inhibits the reaction [Freund's Adjuvant results in increased expression of CASP3 protein]	30025850
C060796	friedelin	friedelin results in increased activity of CASP3 protein	20026015
D005632	Fructose	[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 mRNA	28916335
D005632	Fructose	[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 protein	28916335
D005632	Fructose	troxerutin inhibits the reaction [[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 mRNA]	28916335
D005632	Fructose	troxerutin inhibits the reaction [[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 protein]	28916335
D005632	Fructose	Fructose results in increased expression of CASP3 protein	29430716
D005632	Fructose	imoxin inhibits the reaction [Fructose results in increased expression of CASP3 protein]	29430716
C025164	fucoxanthin	Acetylcysteine inhibits the reaction [fucoxanthin results in increased cleavage of CASP3 protein]	20594983
C025164	fucoxanthin	fucoxanthin results in increased cleavage of CASP3 protein	20594983
C069837	fullerene C60	fullerene C60 analog results in increased cleavage of CASP3 protein	18926839
C069837	fullerene C60	fullerene C60 metabolite results in increased activity of CASP3 protein	22108244
D000077267	Fulvestrant	Fulvestrant affects the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D000077267	Fulvestrant	Fulvestrant inhibits the reaction [bisphenol A results in increased activity of CASP3 protein]	23788033
D000077267	Fulvestrant	Fulvestrant inhibits the reaction [dan-shen root extract inhibits the reaction [IGF2 protein mutant form results in increased cleavage of and results in increased activity of CASP3 protein]]	23419388
D000077267	Fulvestrant	Fulvestrant inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	23788033
C056933	fumonisin B1	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]]	29109043
C056933	fumonisin B1	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
C056933	fumonisin B1	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 protein]	29109043
C056933	fumonisin B1	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]]	29109043
C056933	fumonisin B1	deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]	29109043
C056933	fumonisin B1	[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA	29109043
C056933	fumonisin B1	[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 protein	29109043
C056933	fumonisin B1	[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
C056933	fumonisin B1	[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA	29109043
C056933	fumonisin B1	[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 protein	29109043
C056933	fumonisin B1	fumonisin B1 promotes the reaction [deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]]	29109043
C056933	fumonisin B1	fumonisin B1 promotes the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]]	29109043
C056933	fumonisin B1	Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]	29109043
D005659	Fungicides, Industrial	Fungicides, Industrial results in increased activity of CASP3 protein	24719846
D005664	Furazolidone	CDKN1A protein inhibits the reaction [Furazolidone results in increased activity of CASP3 protein]	26687534
D005664	Furazolidone	Furazolidone results in increased activity of CASP3 protein	26687534
D005665	Furosemide	Furosemide affects the expression of CASP3 mRNA	17497460
D005669	Fusaric Acid	Fusaric Acid results in decreased expression of CASP3 protein	31150628
D005669	Fusaric Acid	Glycyrrhizic Acid inhibits the reaction [Fusaric Acid results in decreased expression of CASP3 protein]	31150628
C000600490	G226 compound	G226 compound results in increased activity of CASP3 protein	25066322
D005682	Gadolinium	Gadolinium results in increased activity of CASP3 protein	20398695
D005688	Galactosamine	alpha-Tocopherol inhibits the reaction [Galactosamine results in increased cleavage of and results in increased activity of CASP3 protein]	17936189
D005688	Galactosamine	[Galactosamine co-treated with TNF protein] results in increased activity of CASP3 protein	26176423
D005688	Galactosamine	Galactosamine results in increased cleavage of and results in increased activity of CASP3 protein	17936189
D005688	Galactosamine	Ketoconazole inhibits the reaction [Galactosamine results in increased activity of CASP3 protein]	17936189
D005688	Galactosamine	Rifampin promotes the reaction [Galactosamine results in increased activity of CASP3 protein]	17936189
D005688	Galactosamine	baicalein inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form]	20850421
D005688	Galactosamine	beraprost inhibits the reaction [[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein]	28887131
D005688	Galactosamine	Biliverdine inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D005688	Galactosamine	cobaltiprotoporphyrin inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	14512878
D005688	Galactosamine	cobaltiprotoporphyrin inhibits the reaction [TNF protein promotes the reaction [Galactosamine results in increased activity of CASP3 protein]]	14512878
D005688	Galactosamine	Dithiothreitol inhibits the reaction [Nitric Oxide Donors inhibits the reaction [[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein]]	9388267
D005688	Galactosamine	[Galactosamine co-treated with Endotoxins] results in increased activity of CASP3 protein	22023962
D005688	Galactosamine	[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein	28887131
D005688	Galactosamine	[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein	17602819; 21146893;
D005688	Galactosamine	[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein	20558151
D005688	Galactosamine	[[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein	20558151
D005688	Galactosamine	[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form	20558151
D005688	Galactosamine	gentiopicroside inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein]	20558151
D005688	Galactosamine	gentiopicroside inhibits the reaction [[[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein]	20558151
D005688	Galactosamine	gentiopicroside inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form]	20558151
D005688	Galactosamine	[lipopolysaccharide, E coli O55-B5 co-treated with Galactosamine] results in increased activity of CASP3 protein	24830863
D005688	Galactosamine	[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein	14512878; 15486963;
D005688	Galactosamine	[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form	20850421
D005688	Galactosamine	Melatonin inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein]	17602819
D005688	Galactosamine	[Methylene Chloride co-treated with Biliverdine] inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D005688	Galactosamine	Methylene Chloride inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D005688	Galactosamine	[Nitric Oxide Donors results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein]	9388267
D005688	Galactosamine	ONO 1301 inhibits the reaction [[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein]	28887131
D005688	Galactosamine	Rotenone inhibits the reaction [[lipopolysaccharide, E coli O55-B5 co-treated with Galactosamine] results in increased activity of CASP3 protein]	24830863
D005688	Galactosamine	Silymarin inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form]	20850421
D005688	Galactosamine	[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein	9388267
D005688	Galactosamine	TNF protein promotes the reaction [Galactosamine results in increased activity of CASP3 protein]	14512878
D005688	Galactosamine	Ursodeoxycholic Acid analog inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein]	21146893
D005688	Galactosamine	2-Acetylaminofluorene inhibits the reaction [[lipopolysaccharide, Escherichia coli O111 B4 co-treated with Galactosamine] results in increased cleavage of CASP3 protein]	12907702
D005688	Galactosamine	Alprostadil inhibits the reaction [Galactosamine results in increased cleavage of and results in increased activity of CASP3 protein]	15565661
D005688	Galactosamine	[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 mRNA	21401295
D005688	Galactosamine	Galactosamine results in increased activity of CASP3 protein	15610455
D005688	Galactosamine	Galactosamine results in increased cleavage of and results in increased activity of CASP3 protein	15565661
D005688	Galactosamine	Galactosamine results in increased expression of CASP3 mRNA	24565947
D005688	Galactosamine	Galactosamine results in increased expression of CASP3 protein	22118634; 22310181;
D005688	Galactosamine	glycine propionyl carnitine inhibits the reaction [Galactosamine results in increased expression of CASP3 mRNA]	24565947
D005688	Galactosamine	[lipopolysaccharide, Escherichia coli O111 B4 co-treated with Galactosamine] results in increased cleavage of CASP3 protein	12907702
D005688	Galactosamine	mangiferin inhibits the reaction [Galactosamine results in increased expression of CASP3 protein]	22118634; 22310181;
D005690	Galactose	Galactose results in increased cleavage of CASP3 protein	23036742
D005690	Galactose	Phycocyanin inhibits the reaction [Galactose results in increased cleavage of CASP3 protein]	23036742
D005690	Galactose	Galactose results in increased activity of CASP3 protein	23795773
D005690	Galactose	Pioglitazone inhibits the reaction [Galactose results in increased activity of CASP3 protein]	23795773
D005690	Galactose	[Glucose deficiency co-treated with Galactose co-treated with Pyruvic Acid] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	25997894
C037032	galangin	[ATG12 mutant form co-treated with galangin] results in decreased activity of CASP3 protein	25268046
C037032	galangin	[ATG16L1 mutant form co-treated with galangin] results in decreased activity of CASP3 protein	25268046
C037032	galangin	[ATG3 mutant form co-treated with galangin] results in decreased activity of CASP3 protein	25268046
C037032	galangin	[BECN1 mutant form co-treated with galangin] results in decreased activity of CASP3 protein	25268046
C037032	galangin	galangin results in increased cleavage of CASP3 protein	25450235
D005707	Gallic Acid	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Gallic Acid results in increased cleavage of CASP3 protein]	27060209
D005707	Gallic Acid	Gallic Acid results in increased activity of CASP3 protein	24726691
D005707	Gallic Acid	Gallic Acid results in increased cleavage of CASP3 protein	27060209
D005707	Gallic Acid	Gallic Acid results in increased expression of CASP3 protein	22245431
D005707	Gallic Acid	Gallic Acid results in decreased expression of CASP3 mRNA	29205955
D005708	Gallium	Gallium results in increased activity of CASP3 protein	21194614
C027235	gallium nitrate	Bortezomib promotes the reaction [gallium nitrate results in increased activity of CASP3 protein]	17121930
C027235	gallium nitrate	gallium nitrate results in increased activity of CASP3 protein	17121930
C485338	gallium phosphide	gallium phosphide analog results in decreased activity of CASP3 protein	18632727
C052659	gambogic acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[gambogic acid co-treated with Bortezomib] results in increased activity of CASP3 protein]	24291039
C052659	gambogic acid	Fluorouracil promotes the reaction [gambogic acid results in decreased expression of CASP3 mRNA]	19084572
C052659	gambogic acid	[gambogic acid co-treated with Bortezomib] results in increased activity of CASP3 protein	24291039
C052659	gambogic acid	gambogic acid results in decreased expression of CASP3 mRNA	19084572
C052659	gambogic acid	[Verapamil co-treated with gambogic acid] results in increased cleavage of and results in increased activity of CASP3 protein	24373880
D005680	gamma-Aminobutyric Acid	gamma-Aminobutyric Acid results in decreased cleavage of CASP3 protein	29708300
D017965	gamma-Linolenic Acid	gamma-Linolenic Acid results in increased activity of CASP3 protein	16857180
C025473	gamma-sitosterol	gamma-sitosterol results in increased activity of CASP3 protein	14612938
D024504	gamma-Tocopherol	gamma-Tocopherol results in increased activity of CASP3 protein	15596715
D024504	gamma-Tocopherol	thermozymocidin inhibits the reaction [gamma-Tocopherol results in increased activity of CASP3 protein]	15596715
D024504	gamma-Tocopherol	[alpha-Tocopherol co-treated with beta-Tocopherol co-treated with gamma-Tocopherol co-treated with delta-tocopherol] affects the reaction [Estradiol affects the expression of CASP3 protein]	22389237
C026226	ganglioside, GD3	3-hydroxy-4-pentenoic acid promotes the reaction [ganglioside, GD3 results in increased cleavage of and results in increased activity of CASP3 protein]	10783138
C026226	ganglioside, GD3	Butylated Hydroxytoluene inhibits the reaction [ganglioside, GD3 results in increased cleavage of and results in increased activity of CASP3 protein]	10783138
C026226	ganglioside, GD3	ganglioside, GD3 results in increased cleavage of and results in increased activity of CASP3 protein	10783138
C556862	ganoderic acid	Acetylcysteine inhibits the reaction [ganoderic acid analog results in increased activity of CASP3 protein]	26282491
C556862	ganoderic acid	CAT protein inhibits the reaction [ganoderic acid analog results in increased activity of CASP3 protein]	26282491
C556862	ganoderic acid	diphenyleneiodonium inhibits the reaction [ganoderic acid analog results in increased activity of CASP3 protein]	26282491
C556862	ganoderic acid	ganoderic acid analog results in increased activity of CASP3 protein	26282491
C515005	ganoderic acid A	ganoderic acid A inhibits the reaction [Cyclophosphamide results in increased expression of CASP3 protein]	30506662
C550530	ganoderic acid T	Acetylcysteine inhibits the reaction [ganoderic acid T analog results in increased activity of CASP3 protein]	26282491
C550530	ganoderic acid T	Acetylcysteine inhibits the reaction [ganoderic acid T results in increased activity of CASP3 protein]	26282491
C550530	ganoderic acid T	CAT protein inhibits the reaction [ganoderic acid T analog results in increased activity of CASP3 protein]	26282491
C550530	ganoderic acid T	CAT protein inhibits the reaction [ganoderic acid T results in increased activity of CASP3 protein]	26282491
C550530	ganoderic acid T	diphenyleneiodonium inhibits the reaction [ganoderic acid T analog results in increased activity of CASP3 protein]	26282491
C550530	ganoderic acid T	diphenyleneiodonium inhibits the reaction [ganoderic acid T results in increased activity of CASP3 protein]	26282491
C550530	ganoderic acid T	ganoderic acid T analog results in increased activity of CASP3 protein	26282491
C550530	ganoderic acid T	ganoderic acid T results in increased activity of CASP3 protein	26282491
C054597	garcinol	garcinol results in increased cleavage of and results in increased activity of CASP3 protein	16052481
C000591222	gardenin B	gardenin B results in increased cleavage of and results in increased activity of CASP3 protein	27423764
C045345	gastrodin	gastrodin affects the activity of CASP3 protein	23578476
C505531	GCS-100	[GCS-100 co-treated with Dexamethasone] results in increased activity of CASP3 protein	16166312
C505531	GCS-100	GCS-100 promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21368866
C505531	GCS-100	GCS-100 results in increased cleavage of and results in increased activity of CASP3 protein	16166312
C106014	gedunin	gedunin results in increased activity of CASP3 protein	21381696
D000077156	Gefitinib	EGFR gene mutant form promotes the reaction [Gefitinib results in increased cleavage of and results in increased activity of CASP3 protein]	27639429
D000077156	Gefitinib	Gefitinib results in increased cleavage of and results in increased activity of CASP3 protein	23523951; 27639429;
D000077156	Gefitinib	Gefitinib results in increased expression of CASP3 mRNA	27084042
D000077156	Gefitinib	Gefitinib results in increased expression of CASP3 protein	27084042
C001277	geldanamycin	Acetylcysteine inhibits the reaction [geldanamycin results in increased activity of CASP3 protein]	24998639
C001277	geldanamycin	geldanamycin inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
C001277	geldanamycin	geldanamycin inhibits the reaction [Nicotine results in increased activity of CASP3 protein]	12115584
C001277	geldanamycin	geldanamycin results in increased activity of CASP3 protein	14576064; 24998639;
C056507	gemcitabine	[2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with gemcitabine] affects the activity of CASP3 protein	29782821
C056507	gemcitabine	[3-(4-methylphenylsulfonyl)-2-propenenitrile co-treated with gemcitabine] affects the activity of CASP3 protein	29782821
C056507	gemcitabine	[alvocidib co-treated with gemcitabine] results in increased cleavage of CASP3 protein	15770523
C056507	gemcitabine	[Calcitriol co-treated with gemcitabine] results in increased expression of CASP3 protein	20699664
C056507	gemcitabine	[gemcitabine co-treated with TNFRSF10B] affects the activity of CASP3 protein	18089714
C056507	gemcitabine	gemcitabine results in increased activity of CASP3 protein	12479703; 15476743; 17159604; 26050647; 29782821;
C056507	gemcitabine	gemcitabine results in increased cleavage of CASP3 protein	15726400; 20299819;
C056507	gemcitabine	gemcitabine results in increased expression of and results in increased activity of CASP3 protein	29782821
C056507	gemcitabine	licoricidin promotes the reaction [gemcitabine results in increased activity of CASP3 protein]	29782821
C056507	gemcitabine	licoricidin promotes the reaction [gemcitabine results in increased expression of and results in increased activity of CASP3 protein]	29782821
C056507	gemcitabine	Quercetin promotes the reaction [gemcitabine results in increased activity of CASP3 protein]	26050647
C056507	gemcitabine	SMG1 protein inhibits the reaction [gemcitabine results in increased activity of CASP3 protein]	21418860
C056507	gemcitabine	[Vorinostat co-treated with gemcitabine] results in increased activity of CASP3 protein	16153448
C056507	gemcitabine	[10-propargyl-10-deazaaminopterin co-treated with gemcitabine] results in increased activity of CASP3 protein	16467107
C056507	gemcitabine	[Curcumin co-treated with gemcitabine] results in decreased expression of CASP3 protein	17440100
C007834	genipin	genipin results in increased activity of CASP3 protein	22245672
C007835	geniposide	geniposide metabolite results in increased activity of CASP3 protein	22245672
C007835	geniposide	geniposide metabolite results in increased expression of CASP3 protein	22245672
C007835	geniposide	geniposide inhibits the reaction [Palmitic Acid results in increased expression of and results in increased activity of CASP3 protein]	22819839
D019833	Genistein	Arsenic Trioxide promotes the reaction [Genistein results in increased activity of CASP3 protein]	20219070
D019833	Genistein	[Genistein co-treated with Arsenic Trioxide] results in decreased expression of CASP3 protein	21078540
D019833	Genistein	[Genistein co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	19497411
D019833	Genistein	[Genistein co-treated with trichostatin A] results in increased activity of CASP3 protein	22626855
D019833	Genistein	Genistein inhibits the reaction [benzo(e)pyrene results in increased activity of CASP3 protein]	19959636
D019833	Genistein	Genistein promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	18546268; 20219070;
D019833	Genistein	Genistein promotes the reaction [trichostatin A results in increased activity of CASP3 protein]	26768552
D019833	Genistein	Genistein results in decreased expression of CASP3 mRNA	22228119
D019833	Genistein	Genistein results in decreased expression of CASP3 protein	21078540
D019833	Genistein	Genistein results in increased activity of and results in increased cleavage of CASP3 protein	24299158
D019833	Genistein	Genistein results in increased activity of CASP3 protein	12791511; 16924424; 17132221; 20219070; 24299158;
D019833	Genistein	Cycloheximide inhibits the reaction [Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]]	17295206
D019833	Genistein	Cycloheximide inhibits the reaction [Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	17295206
D019833	Genistein	Dichlororibofuranosylbenzimidazole inhibits the reaction [Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]]	17295206
D019833	Genistein	Dichlororibofuranosylbenzimidazole inhibits the reaction [Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	17295206
D019833	Genistein	Genistein inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30734460
D019833	Genistein	Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]	17295206
D019833	Genistein	Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]	17295206
D019833	Genistein	Genistein results in increased cleavage of CASP3 protein	25756279
D019833	Genistein	Genistein results in increased expression of CASP3 mRNA	17295206
D019833	Genistein	Zinc Sulfate promotes the reaction [Genistein results in increased expression of CASP3 mRNA]	17295206
D019833	Genistein	bisphenol A inhibits the reaction [Genistein results in increased cleavage of CASP3 protein]	24884420
D019833	Genistein	[Genistein co-treated with bisphenol A] results in decreased cleavage of CASP3 protein	24884420
D019833	Genistein	Genistein inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23363563
D019833	Genistein	Genistein inhibits the reaction [bisphenol A results in decreased cleavage of CASP3 protein]	24884420
D019833	Genistein	Genistein inhibits the reaction [lead acetate results in increased cleavage of CASP3 protein]	26797587
D019833	Genistein	Genistein results in decreased cleavage of CASP3 protein	24884420
D019833	Genistein	Genistein results in decreased expression of CASP3 protein	29217487
D019833	Genistein	Genistein results in increased cleavage of CASP3 protein	24884420
D005839	Gentamicins	cobaltous chloride inhibits the reaction [Gentamicins results in increased cleavage of and results in increased activity of CASP3 protein]	23145036
D005839	Gentamicins	Gentamicins results in increased cleavage of and results in increased activity of CASP3 protein	23145036
D005839	Gentamicins	Gentamicins results in increased expression of CASP3 mRNA	29992668
D005839	Gentamicins	HMOX1 protein inhibits the reaction [Gentamicins results in increased cleavage of and results in increased activity of CASP3 protein]	18842672
D005839	Gentamicins	Gentamicins results in increased activity of CASP3 protein	16239342
D005839	Gentamicins	Gentamicins results in increased expression of CASP3 mRNA	29751043
D005839	Gentamicins	Gentamicins results in increased expression of CASP3 protein	29751043
D005839	Gentamicins	HRK affects the reaction [Gentamicins results in increased activity of CASP3 protein]	16239342
D005839	Gentamicins	tauroursodeoxycholic acid inhibits the reaction [Gentamicins results in increased expression of CASP3 mRNA]	29751043
D005839	Gentamicins	tauroursodeoxycholic acid inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	29751043
D005839	Gentamicins	[candesartan co-treated with epigallocatechin gallate] inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
D005839	Gentamicins	candesartan inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
D005839	Gentamicins	Carnitine inhibits the reaction [Gentamicins results in increased cleavage of CASP3 protein]	19491382
D005839	Gentamicins	CTF1 protein inhibits the reaction [[Diatrizoate Meglumine co-treated with Gentamicins] results in increased cleavage of CASP3 protein]	23335628
D005839	Gentamicins	[Diatrizoate Meglumine co-treated with Gentamicins] results in increased cleavage of CASP3 protein	23335628
D005839	Gentamicins	epigallocatechin gallate inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	30368989
D005839	Gentamicins	Gentamicins results in increased activity of CASP3 protein	17132701; 18227104; 8160791;
D005839	Gentamicins	Gentamicins results in increased cleavage of and results in increased activity of CASP3 protein	18842672
D005839	Gentamicins	Gentamicins results in increased cleavage of CASP3 protein	19491382; 22526374;
D005839	Gentamicins	Gentamicins results in increased expression of CASP3 protein	26779593; 30368989;
D005839	Gentamicins	[KNG1 protein co-treated with KLK1] inhibits the reaction [Gentamicins results in increased activity of CASP3 protein]	8160791
D005839	Gentamicins	Melatonin inhibits the reaction [Gentamicins results in increased cleavage of CASP3 protein]	22526374
D005839	Gentamicins	Sodium Fluoride inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	26779593
D005839	Gentamicins	tetramethylpyrazine inhibits the reaction [Gentamicins results in increased activity of CASP3 protein]	17132701
C012997	gentiopicroside	gentiopicroside inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein]	20558151
C012997	gentiopicroside	gentiopicroside inhibits the reaction [[[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein]	20558151
C012997	gentiopicroside	gentiopicroside inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form]	20558151
C024603	Geraniin	Geraniin results in increased cleavage of CASP3 protein	28590547
C007836	geraniol	geraniol results in increased activity of CASP3 protein	21371438; 24875281;
C007836	geraniol	geraniol results in increased expression of CASP3 mRNA	30506710
C007836	geraniol	geraniol results in increased expression of CASP3 protein	30506710
C007836	geraniol	geraniol inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	22729742
C007836	geraniol	geraniol inhibits the reaction [lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein]	29050341
C007836	geraniol	geraniol results in increased expression of CASP3 protein modified form	26154255
C007836	geraniol	[camphene co-treated with geraniol] inhibits the reaction [nimesulide results in increased cleavage of CASP3 protein]	22509279
C007836	geraniol	geraniol inhibits the reaction [2-Acetylaminofluorene results in increased expression of CASP3 protein]	26364502
C007836	geraniol	geraniol inhibits the reaction [[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased cleavage of and results in decreased expression of CASP3 protein]	21907755
C007836	geraniol	geraniol inhibits the reaction [[ferric nitrilotriacetate co-treated with Diethylnitrosamine] results in decreased expression of CASP3 mRNA]	21907755
C007836	geraniol	geraniol inhibits the reaction [[Methionine deficiency co-treated with Choline deficiency] results in increased activity of CASP3 protein]	26695085
C007836	geraniol	geraniol inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein]	26165751
C017338	geranylgeraniol	geranylgeraniol results in increased activity of CASP3 protein	9175767
C002963	geranylgeranyl pyrophosphate	geranylgeranyl pyrophosphate inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	16470222
C002963	geranylgeranyl pyrophosphate	geranylgeranyl pyrophosphate inhibits the reaction [cerivastatin results in increased activity of CASP3 protein]	16470222
C002963	geranylgeranyl pyrophosphate	geranylgeranyl pyrophosphate inhibits the reaction [Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein]	18766339
C002963	geranylgeranyl pyrophosphate	geranylgeranyl pyrophosphate inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	16470222
C002963	geranylgeranyl pyrophosphate	geranylgeranyl pyrophosphate inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	15200425
C048393	germacrone	[germacrone results in increased susceptibility to Doxorubicin] which results in increased activity of CASP3 protein	29655913
C007845	gingerol	Acetylcysteine inhibits the reaction [[TNFSF10 protein co-treated with gingerol] results in increased cleavage of CASP3 protein]	25034532
C007845	gingerol	gingerol inhibits the reaction [Testosterone results in decreased expression of CASP3 protein]	18030663
C007845	gingerol	gingerol results in increased cleavage of CASP3 protein	28249781
C007845	gingerol	gingerol results in increased expression of CASP3 mRNA	19481070
C007845	gingerol	gingerol results in increased expression of CASP3 protein	18030663; 19481070;
C007845	gingerol	[TNFSF10 protein co-treated with gingerol] results in increased cleavage of CASP3 protein	25034532
C007845	gingerol	gingerol affects the activity of CASP3 protein	17454143
C007845	gingerol	gingerol inhibits the reaction [Chlorpyrifos results in increased activity of CASP3 protein]	28373059
C077458	ginkgetin	ginkgetin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]	25968939
C063170	Ginkgo biloba extract	Ginkgo biloba extract affects the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	19414004
C063170	Ginkgo biloba extract	Ginkgo biloba extract inhibits the reaction [APP protein results in increased cleavage of and results in increased activity of CASP3 protein]	19464278
C063170	Ginkgo biloba extract	Ginkgo biloba extract inhibits the reaction [Dexamethasone results in increased expression of CASP3 protein]	19064852
C045856	ginkgolide B	ginkgolide B inhibits the reaction [APP protein results in increased cleavage of and results in increased activity of CASP3 protein]	19464278
C045856	ginkgolide B	ginkgolide B inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	26775663
C045856	ginkgolide B	ginkgolide B inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	26775663
C045856	ginkgolide B	ginkgolide B inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	21704112
C481151	ginkgolide K	ginkgolide K results in decreased activity of CASP3 protein	22120026
C442759	ginsenoside Rb1	ginsenoside Rb1 inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	19781563
C049863	ginsenoside Rd	ginsenoside Rd inhibits the reaction [APP protein modified form results in increased expression of CASP3 protein modified form]	26111763
C049864	ginsenoside Re	ginsenoside Re inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	25523949
C049864	ginsenoside Re	3-((3,5-bis(trifluoromethyl)phenyl)methyloxy)-2-phenylpiperidine inhibits the reaction [norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]]	29467000
C049864	ginsenoside Re	ginsenoside Re inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	23102375
C049864	ginsenoside Re	ginsenoside Re inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	29467000
C049864	ginsenoside Re	ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]	29467000
C049864	ginsenoside Re	ginsenoside Re results in decreased cleavage of and results in decreased activity of CASP3 protein	15621629
C049864	ginsenoside Re	norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]	29467000
C035054	ginsenoside Rg1	ginsenoside Rg1 inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	24386346
C035054	ginsenoside Rg1	ginsenoside Rg1 results in increased activity of CASP3 protein	28371286
C026474	ginsenoside Rg2	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [ginsenoside Rg2 inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]]	28756148
C026474	ginsenoside Rg2	ginsenoside Rg2 inhibits the reaction [APP protein modified form results in increased activity of and results in increased cleavage of CASP3 protein]	28756148
C097367	ginsenoside Rg3	ginsenoside Rg3 inhibits the reaction [cagA protein, Helicobacter pylori results in decreased cleavage of CASP3 protein]	26427350
C097367	ginsenoside Rg3	ginsenoside Rg3 results in increased cleavage of CASP3 protein	22101440
C055305	ginsenoside Rh2	ginsenoside Rh2 results in increased cleavage of CASP3 protein	26482938
C472077	ginsenoside Rk1	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [ginsenoside Rk1 results in increased cleavage of CASP3 protein]	30797898
C472077	ginsenoside Rk1	ginsenoside Rk1 results in increased cleavage of CASP3 protein	30797898
D036145	Ginsenosides	[monobutyl phthalate co-treated with Ginsenosides metabolite] results in increased expression of CASP3 protein modified form	30965081
C055124	glaucocalyxin A	glaucocalyxin A results in increased activity of CASP3 protein	20851175
D005907	Gliclazide	Gliclazide inhibits the reaction [Glucose results in increased expression of CASP3 protein]	18088078
D005912	Gliotoxin	Gliotoxin results in increased activity of CASP3 protein	20958918
D005912	Gliotoxin	Gliotoxin results in increased cleavage of and results in increased activity of CASP3 protein	17466404
D005912	Gliotoxin	Mercuric Chloride inhibits the reaction [Gliotoxin results in increased activity of CASP3 protein]	20958918
D005937	Glucaric Acid	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D005937	Glucaric Acid	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D005937	Glucaric Acid	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D005937	Glucaric Acid	Glucaric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D005937	Glucaric Acid	Glucaric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D005937	Glucaric Acid	Glucaric Acid inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D005938	Glucocorticoids	Glucocorticoids results in increased activity of CASP3 protein	21811605
C030691	gluconic acid	gluconic acid promotes the reaction [Zinc Sulfate inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]]	27017951
D005944	Glucosamine	Glucosamine results in increased activity of and results in increased cleavage of CASP3 protein	22020377
D005944	Glucosamine	Glucosamine results in increased cleavage of CASP3 protein	16850161
D005944	Glucosamine	Glucosamine results in increased expression of CASP3 protein	20803707
D005947	Glucose	Glucose results in increased activity of CASP3 protein	29059224
D005947	Glucose	NTN1 protein inhibits the reaction [Glucose results in increased activity of CASP3 protein]	29059224
D005947	Glucose	asiatic acid inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
D005947	Glucose	[Carnosine co-treated with asiatic acid] inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
D005947	Glucose	Carnosine inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30802477
D005947	Glucose	Gliclazide inhibits the reaction [Glucose results in increased expression of CASP3 protein]	18088078
D005947	Glucose	[Glucose deficiency co-treated with Acetylcysteine] results in increased activity of CASP3 protein	17309078
D005947	Glucose	[Glucose deficiency co-treated with CAT] results in increased activity of CASP3 protein	17309078
D005947	Glucose	[Glucose deficiency co-treated with Tetradecanoylphorbol Acetate] results in increased activity of CASP3 protein	17309078
D005947	Glucose	Glucose results in increased activity of CASP3 protein	19767878; 19892008; 30802477;
D005947	Glucose	Glucose results in increased cleavage of CASP3 protein	30431688
D005947	Glucose	Glucose results in increased expression of CASP3 protein	18088078
D005947	Glucose	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Glucose results in increased expression of CASP3 protein]	18088078
D005947	Glucose	[Palmitic Acid co-treated with Glucose] results in increased cleavage of CASP3 protein	24451382
D005947	Glucose	Rosiglitazone inhibits the reaction [Glucose results in increased activity of CASP3 protein]	19767878
D005947	Glucose	salvianolic acid inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	30431688
D005947	Glucose	SIRT1 protein inhibits the reaction [[Palmitic Acid co-treated with Glucose] results in increased cleavage of CASP3 protein]	24451382
D005947	Glucose	FOXO3 protein promotes the reaction [Glucose results in increased cleavage of and results in increased activity of CASP3 protein]	20370652
D005947	Glucose	[Glucose deficiency co-treated with Simvastatin] results in increased cleavage of CASP3 protein	17928392
D005947	Glucose	Glucose deficiency inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	29095437
D005947	Glucose	Glucose results in increased activity of CASP3 protein	18973755
D005947	Glucose	Glucose results in increased cleavage of and results in increased activity of CASP3 protein	20370652
D005947	Glucose	Glucose results in increased cleavage of CASP3 protein	25516495; 30076216;
D005947	Glucose	MIR144 mRNA promotes the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29457851
D005947	Glucose	MIR322 affects the reaction [Glucose results in increased cleavage of CASP3 protein]	25516495
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein	25238743; 25488258; 28675767; 29457851;
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein	24682241
D005947	Glucose	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	25488258
D005947	Glucose	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein]	24682241
D005947	Glucose	SIRT7 protein inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	28675767
D005947	Glucose	TRAF3 affects the reaction [Glucose results in increased cleavage of CASP3 protein]	25516495
D005947	Glucose	TRPM7 protein affects the reaction [Glucose results in increased cleavage of CASP3 protein]	30076216
D005947	Glucose	U 0126 inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein]	24682241
D005947	Glucose	VDAC1 protein inhibits the reaction [Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	25488258
D005947	Glucose	VDAC1 protein promotes the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	25488258
D005947	Glucose	waixenicin A inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	30076216
D005947	Glucose	zinc protoporphyrin inhibits the reaction [[Glucose deficiency co-treated with Simvastatin] results in increased cleavage of CASP3 protein]	17928392
D005947	Glucose	15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic Acid inhibits the reaction [notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]]	25305180
D005947	Glucose	Acetylcysteine inhibits the reaction [Glucose results in increased activity of CASP3]	18791325
D005947	Glucose	Antigen-Antibody Complex inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29702141
D005947	Glucose	cinnamic acid inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30144576
D005947	Glucose	cobaltiprotoporphyrin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	24810525
D005947	Glucose	diallyl trisulfide inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	23453443
D005947	Glucose	diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]	25896937
D005947	Glucose	[Dithionite co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein	21803128
D005947	Glucose	[Glucose deficiency co-treated with Galactose co-treated with Pyruvic Acid] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	25997894
D005947	Glucose	Glucose results in increased activity of CASP3	18791325
D005947	Glucose	Glucose results in increased activity of CASP3 protein	20224876; 23192364; 30144576;
D005947	Glucose	Glucose results in increased cleavage of CASP3 protein	18004065; 22524206; 23453443; 24349266; 24810525; 27234048;
D005947	Glucose	Glucose results in increased expression of and results in increased cleavage of CASP3 protein	23192364
D005947	Glucose	Glucose results in increased expression of CASP3 mRNA	23192364; 23770986;
D005947	Glucose	Glucose results in increased expression of CASP3 protein modified form	23770986
D005947	Glucose	GSK3B protein inhibits the reaction [MIR135A mRNA inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	29719095
D005947	Glucose	HMOX1 protein affects the reaction [Propofol inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]]	24810525
D005947	Glucose	HMOX1 protein promotes the reaction [diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]]	25896937
D005947	Glucose	Metformin inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30144576
D005947	Glucose	MIR135A mRNA inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29719095
D005947	Glucose	naringenin inhibits the reaction [Glucose results in increased activity of CASP3 protein]	23192364
D005947	Glucose	naringenin inhibits the reaction [Glucose results in increased expression of and results in increased cleavage of CASP3 protein]	23192364
D005947	Glucose	naringenin inhibits the reaction [Glucose results in increased expression of CASP3 mRNA]	23192364
D005947	Glucose	NFE2L2 mutant form inhibits the reaction [diallyl trisulfide inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]]	23453443
D005947	Glucose	NFE2L2 protein mutant form affects the reaction [plumbagin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	20028456
D005947	Glucose	NFE2L2 protein promotes the reaction [diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]]	25896937
D005947	Glucose	notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased activity of CASP3 protein]	24720662
D005947	Glucose	notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]	25305180
D005947	Glucose	[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased activity of CASP3 protein	24720662
D005947	Glucose	[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein	25305180
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] affects the expression of and affects the activity of CASP3 protein	23637816
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein	15322300; 20028456; 29702141; 29719095;
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein	16135072
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein	23758074
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form	25896937
D005947	Glucose	plumbagin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	20028456
D005947	Glucose	Propofol inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	24810525
D005947	Glucose	Quercetin inhibits the reaction [[Dithionite co-treated with Glucose deficiency] results in increased expression of CASP3 protein]	21803128
D005947	Glucose	Quercetin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	22524206
D005947	Glucose	Quercetin inhibits the reaction [Glucose results in increased expression of CASP3 mRNA]	23770986
D005947	Glucose	Quercetin inhibits the reaction [Glucose results in increased expression of CASP3 protein modified form]	23770986
D005947	Glucose	Quercetin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein]	23758074
D005947	Glucose	sesamin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	22524206
D005947	Glucose	Simvastatin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	18004065
D005947	Glucose	STAT3 protein affects the reaction [Propofol inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]]	24810525
D005947	Glucose	STIM1 protein affects the reaction [Glucose results in increased cleavage of CASP3 protein]	27234048
D005947	Glucose	WDR35 protein affects the reaction [Glucose results in increased activity of CASP3 protein]	20224876
D005947	Glucose	Y 27632 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]	25305180
D005947	Glucose	Diltiazem inhibits the reaction [[Glucose results in increased expression of OLR1 protein] which affects the activity of CASP3 protein]	20973294
D005947	Glucose	[Glucose results in increased expression of OLR1 protein] which affects the activity of CASP3 protein	20973294
D005947	Glucose	[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein	24840287
D005947	Glucose	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	24840287
C086069	glutapyrone	glutapyrone inhibits the reaction [Zidovudine results in increased expression of CASP3 protein]	18801031
C086069	glutapyrone	glutapyrone results in increased expression of CASP3 protein	18801031
D005978	Glutathione	Glutathione results in increased expression of CASP3 mRNA	29580986
D005978	Glutathione	Glutathione results in increased expression of CASP3 protein	29580986
D005978	Glutathione	Glutathione inhibits the reaction [2'-benzoyloxycinnamaldehyde results in increased activity of CASP3 protein]	14660655
D005978	Glutathione	Glutathione inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
D005978	Glutathione	Glutathione inhibits the reaction [aristolochic acid I results in increased activity of CASP3 protein]	21300145
D005978	Glutathione	Glutathione inhibits the reaction [Curcumin results in increased activity of CASP3 protein]	17640567
D005978	Glutathione	Glutathione inhibits the reaction [Thimerosal results in increased activity of CASP3 protein]	12140745
D005978	Glutathione	[[Gold results in decreased abundance of Glutathione] which results in increased abundance of Hydrogen Peroxide] which results in increased activity of CASP3 protein	21621595
D005978	Glutathione	Glutathione inhibits the reaction [Acrolein results in increased cleavage of CASP3 protein]	24376112
D005978	Glutathione	Glutathione promotes the reaction [FAS protein results in increased activity of CASP3 protein]	10385654
D005978	Glutathione	Glutathione results in increased activity of CASP3 protein	10385654
D005978	Glutathione	Glutathione inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15683462
D005978	Glutathione	Glutathione inhibits the reaction [JP8 aviation fuel results in increased activity of CASP3 protein]	11969376
D005905	Glyburide	Glyburide inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	16310184
D005990	Glycerol	Carnitine inhibits the reaction [Iohexol promotes the reaction [Glycerol results in increased expression of CASP3 mRNA]]	26562095
D005990	Glycerol	Glycerol results in increased expression of CASP3 mRNA	26562095
D005990	Glycerol	Iohexol promotes the reaction [Glycerol results in increased expression of CASP3 mRNA]	26562095
C000588486	glycine propionyl carnitine	glycine propionyl carnitine inhibits the reaction [Galactosamine results in increased expression of CASP3 mRNA]	24565947
D005999	Glycochenodeoxycholic Acid	Acetylcysteine inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	19837105
D005999	Glycochenodeoxycholic Acid	Calcimycin inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	19837105; 20020783;
D005999	Glycochenodeoxycholic Acid	Egtazic Acid promotes the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	19837105; 20020783;
D005999	Glycochenodeoxycholic Acid	Glycochenodeoxycholic Acid results in increased activity of CASP3 protein	16322111; 19837105; 20020783;
D005999	Glycochenodeoxycholic Acid	Nitric Oxide inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	20020783
D005999	Glycochenodeoxycholic Acid	Sulfasalazine inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	16322111
D005999	Glycochenodeoxycholic Acid	Glycochenodeoxycholic Acid results in increased cleavage of CASP3 protein	25125499
D005999	Glycochenodeoxycholic Acid	lysophosphatidylethanolamine analog inhibits the reaction [Glycochenodeoxycholic Acid results in increased cleavage of CASP3 protein]	25125499
D005999	Glycochenodeoxycholic Acid	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	23300732
D005999	Glycochenodeoxycholic Acid	[AGT protein results in increased phosphorylation of and results in increased activity of MAPK1 protein] inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	23300732
D005999	Glycochenodeoxycholic Acid	[AGT protein results in increased phosphorylation of and results in increased activity of MAPK3 protein] inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	23300732
D005999	Glycochenodeoxycholic Acid	AGTR1 protein promotes the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	candesartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	Glycochenodeoxycholic Acid results in increased activity of CASP3 protein	12873810; 15767249; 23300732;
D005999	Glycochenodeoxycholic Acid	Irbesartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	Losartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	SB 203580 inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	U 0126 inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D005999	Glycochenodeoxycholic Acid	Valsartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D006002	Glycodeoxycholic Acid	[Glycodeoxycholic Acid co-treated with Ceruletide] results in decreased activity of CASP3 protein	18832452
D019695	Glycyrrhizic Acid	Glycyrrhizic Acid inhibits the reaction [Benzo(a)pyrene results in increased activity of CASP3 protein]	22051199
D019695	Glycyrrhizic Acid	Glycyrrhizic Acid inhibits the reaction [Fusaric Acid results in decreased expression of CASP3 protein]	31150628
C010974	glyphosate	[glyphosate co-treated with Herbicides] results in increased activity of CASP3 protein	19539684
C010974	glyphosate	glyphosate results in decreased expression of CASP3 protein	24073338
C010974	glyphosate	glyphosate results in increased activity of CASP3 protein	19105591
C010974	glyphosate	glyphosate results in increased activity of CASP3 protein	22546541; 22634143;
C010974	glyphosate	glyphosate results in increased cleavage of CASP3 protein	29908847
C010974	glyphosate	XAF1 protein affects the reaction [glyphosate results in increased cleavage of CASP3 protein]	29908847
C010974	glyphosate	[Surface-Active Agents co-treated with glyphosate] results in increased activity of CASP3 protein	23099315
C081021	Go 6976	Go 6976 inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
D006046	Gold	Dexamethasone promotes the reaction [Gold results in increased activity of CASP3 protein]	19760634
D006046	Gold	Etoposide promotes the reaction [Gold results in increased activity of CASP3 protein]	19760634
D006046	Gold	[Gold analog co-treated with Platinum] results in increased activity of CASP3 protein	25846798
D006046	Gold	[Gold analog co-treated with Platinum] results in increased expression of CASP3 mRNA	25846798
D006046	Gold	Gold analog results in increased cleavage of CASP3 protein	26551149
D006046	Gold	[[Gold results in decreased abundance of Glutathione] which results in increased abundance of Hydrogen Peroxide] which results in increased activity of CASP3 protein	21621595
D006046	Gold	Gold results in increased activity of CASP3 protein	19760634
D006046	Gold	Gold results in increased expression of CASP3 mRNA	22178767
D006046	Gold	[Polyethyleneimine binds to Gold] which results in increased expression of CASP3 mRNA	28433809
D006046	Gold	[Quercetin analog co-treated with Gold analog] results in increased cleavage of CASP3 protein	27470402
D006046	Gold	[Quercetin analog co-treated with Gold analog] results in increased expression of and results in increased activity of CASP3 protein	27470402
D006046	Gold	[Gold binds to NKCT1 protein, Naja kaouthia] which results in increased expression of CASP3 protein	27836789
D017612	Gold Compounds	Gold Compounds results in increased activity of CASP3 protein	20209498
C103280	goniothalamin	goniothalamin results in increased activity of CASP3 protein	20498002
C103280	goniothalamin	goniothalamin results in increased cleavage of CASP3 protein	21810437
C059922	gossypetin	gossypetin inhibits the reaction [malondialdehyde-low density lipoprotein, human results in increased cleavage of CASP3 protein]	25622137
D006072	Gossypol	Gossypol results in increased activity of CASP3 protein	19825521
D006072	Gossypol	Gossypol results in increased cleavage of CASP3 protein	18840529
D006072	Gossypol	[Zoledronic Acid co-treated with Gossypol] results in increased activity of CASP3 protein	19825521
D006072	Gossypol	[Gossypol co-treated with Methyltestosterone co-treated with Ethinyl Estradiol] results in increased expression of CASP3 mRNA	15451339
D056604	Grape Seed Extract	Grape Seed Extract inhibits the reaction [Diethylhexyl Phthalate results in increased expression of CASP3 protein]	26854921
C511402	Grape Seed Proanthocyanidins	Grape Seed Proanthocyanidins inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	25242411
C511402	Grape Seed Proanthocyanidins	[Grape Seed Proanthocyanidins co-treated with Cadmium Chloride] affects the expression of CASP3 protein	25719599
C511402	Grape Seed Proanthocyanidins	Grape Seed Proanthocyanidins inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	26462792
D006108	Graphite	[Graphite analog co-treated with Tetradecanoylphorbol Acetate] results in increased cleavage of CASP3 protein	25446327
C058858	grifolin	grifolin results in increased activity of CASP3 protein	15949805
D006118	Griseofulvin	Griseofulvin results in increased activity of CASP3 protein	23329179
C000595148	GSK2110183	GSK2110183 inhibits the reaction [MIR145 results in decreased activity of CASP3 protein]	29956747
C528328	GSK690693	GSK690693 promotes the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C004451	guaiazulene	guaiazulene results in increased activity of CASP3 protein	20854889
D006146	Guanidines	Guanidines analog results in increased cleavage of CASP3 protein	23147571
D006151	Guanosine	Guanosine inhibits the reaction [Mycophenolic Acid results in increased cleavage of CASP3 protein]	17175248
D006151	Guanosine	Guanosine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	25174304
D006170	Gum Arabic	Gum Arabic inhibits the reaction [[Water deficiency co-treated with Diclofenac] results in increased expression of CASP3 protein]	31042592
C479979	GW0742	GW0742 inhibits the reaction [Copper Sulfate results in increased activity of CASP3 protein]	21765606
C473027	GW 3965	GW 3965 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]	21209018
C000617853	GW 506033X	GW 506033X inhibits the reaction [APP protein results in increased cleavage of CASP3 protein]	21699726
C000617853	GW 506033X	GW 506033X inhibits the reaction [lipopolysaccharide, E coli O55-B5 results in increased activity of CASP3 protein]	28511573
C000617853	GW 506033X	GW 506033X inhibits the reaction [Sucrose results in increased activity of CASP3 protein]	27920257
C449302	GW 6471	GW 6471 inhibits the reaction [ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]]	20709802
C401311	GW 7845	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [GW 7845 results in increased activity of CASP3 protein]	20810541
C401311	GW 7845	GW 7845 results in increased activity of and results in increased cleavage of CASP3 protein	17400580
C401311	GW 7845	GW 7845 results in increased activity of CASP3 protein	20810541
C401311	GW 7845	KN 93 inhibits the reaction [GW 7845 results in increased activity of CASP3 protein]	20810541
C500810	GW8510	GW8510 inhibits the reaction [SNCA protein results in increased activity of CASP3 protein]	24989254
C120727	gyrophoric acid	gyrophoric acid results in increased activity of CASP3 protein	22285236
C411572	H 1356	H 1356 inhibits the reaction [Amino Acids inhibits the reaction [KL gene mutant form results in increased expression of CASP3 protein modified form]]	25309793
D006220	Haloperidol	BDNF protein inhibits the reaction [Haloperidol results in increased activity of CASP3 protein]	15168214
D006220	Haloperidol	EPO protein inhibits the reaction [Haloperidol results in increased expression of CASP3 protein]	17805306
D006220	Haloperidol	Haloperidol results in increased activity of CASP3 protein	15168214
D006220	Haloperidol	Haloperidol results in increased expression of CASP3 protein	17805306; 18590723;
C007904	harmalol	harmalol results in increased activity of CASP3 protein	27590872
C007904	harmalol	harmalol results in increased expression of CASP3 mRNA	27590872
C539481	HCV 796	HCV 796 promotes the reaction [CASP3 protein results in increased cleavage of KRT18 protein]	19098685
C539481	HCV 796	HCV 796 results in increased activity of CASP3 protein	19098685
C001329	helenalin	helenalin inhibits the reaction [CD 437 results in increased activity of CASP3 protein]	16024638
C010178	heliotrine	heliotrine results in increased activity of and results in increased cleavage of CASP3 protein	29458164
D006427	Hemin	Hemin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	27815112
D006427	Hemin	Hemin results in increased cleavage of CASP3 protein	27815112
D006427	Hemin	[SESN2 protein affects the susceptibility to Hemin] which results in decreased expression of CASP3 protein modified form	31054940
D006427	Hemin	Hemin inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	19150641
D006427	Hemin	Hemin inhibits the reaction [Carbon Monoxide results in increased cleavage of and results in increased activity of CASP3 protein]	19520142
D006427	Hemin	Hemin inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17173083
D006427	Hemin	Hemin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18845130
D006427	Hemin	Hemin inhibits the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D006427	Hemin	Hemin inhibits the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D006427	Hemin	[[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] co-treated with Hemin] results in increased cleavage of CASP3 protein	26747958
D006427	Hemin	tin protoporphyrin IX inhibits the reaction [Hemin inhibits the reaction [Carbon Monoxide results in increased cleavage of and results in increased activity of CASP3 protein]]	19520142
C042349	heminordihydroguaiaretic acid	heminordihydroguaiaretic acid results in increased activity of CASP3 protein	17393435
D006493	Heparin	Heparin results in decreased activity of CASP3 protein	16556679
D006493	Heparin	Heparin promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30377735
D006493	Heparin	Lithium Chloride inhibits the reaction [Heparin promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30377735
D006540	Herbicides	[glyphosate co-treated with Herbicides] results in increased activity of CASP3 protein	19539684
D006540	Herbicides	Herbicides results in increased activity of CASP3 protein	19105591; 22337346; 24719846;
D006540	Herbicides	insecticidal crystal protein, Bacillus Thuringiensis inhibits the reaction [Herbicides results in increased activity of CASP3 protein]	22337346
D003932	Heroin	[Heroin co-treated with Cocaine] results in increased activity of CASP3 protein	20600547
D003932	Heroin	Heroin promotes the reaction [Cocaine results in increased activity of CASP3 protein]	20600547
C013015	hesperetin	hesperetin affects the cleavage of CASP3 protein	15975156
C013015	hesperetin	hesperetin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	31153982
C013015	hesperetin	hesperetin metabolite results in increased expression of CASP3 protein modified form	22142698
C013015	hesperetin	hesperetin results in increased expression of CASP3 protein modified form	22142698
C013015	hesperetin	hesperetin analog results in increased activity of CASP3 protein	20564462
C013015	hesperetin	hesperetin analog results in increased expression of CASP3 mRNA	20564462
C013015	hesperetin	hesperetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19222219
D006569	Hesperidin	Doxorubicin promotes the reaction [Hesperidin results in increased expression of CASP3 mRNA]	29481770
D006569	Hesperidin	[Hesperidin co-treated with Doxorubicin] results in increased activity of CASP3 protein	29481770
D006569	Hesperidin	Hesperidin results in increased activity of CASP3 protein	29481770
D006569	Hesperidin	Hesperidin results in increased expression of CASP3 mRNA	29481770
D006569	Hesperidin	Hesperidin inhibits the reaction [Acetaminophen results in increased expression of CASP3 mRNA]	22093918
D006569	Hesperidin	Hesperidin inhibits the reaction [Acetaminophen results in increased expression of CASP3 protein]	22093918
D006569	Hesperidin	Hesperidin inhibits the reaction [Isoproterenol results in increased expression of CASP3 protein]	30623541
D006569	Hesperidin	Hesperidin promotes the reaction [Diethylnitrosamine results in increased expression of CASP3 protein]	30779474
D006571	Heterocyclic Compounds	Acetylcysteine inhibits the reaction [[Heterocyclic Compounds binds to Thiazoles] which results in increased activity of CASP3 protein]	19014919
D006571	Heterocyclic Compounds	[Heterocyclic Compounds binds to Thiazoles] which results in increased activity of CASP3 protein	19014919
D006575	Heterocyclic Compounds, 3-Ring	Heterocyclic Compounds, 3-Ring results in increased activity of CASP3 protein	21500194
C517828	hexabrominated diphenyl ether 153	hexabrominated diphenyl ether 153 results in increased cleavage of CASP3 protein	29935161
C517828	hexabrominated diphenyl ether 153	hexabrominated diphenyl ether 153 results in increased activity of CASP3 protein	29621559; 31029751;
C517828	hexabrominated diphenyl ether 153	hexabrominated diphenyl ether 153 results in increased expression of CASP3 mRNA	29621559; 31029751;
C089796	hexabromocyclododecane	hexabromocyclododecane results in increased activity of CASP3 protein	19356805
C089796	hexabromocyclododecane	hexabromocyclododecane results in increased expression of CASP3 mRNA	19356805
C089796	hexabromocyclododecane	hexabromocyclododecane results in decreased expression of CASP3 protein	25341744
C089796	hexabromocyclododecane	hexabromocyclododecane results in increased activity of CASP3 protein	22485137
C089796	hexabromocyclododecane	hexabromocyclododecane results in increased activity of CASP3 protein	24780359
C089796	hexabromocyclododecane	hexabromocyclododecane results in increased expression of CASP3 mRNA	27718427
C533761	hexabromodiphenyl ether 154	hexabromodiphenyl ether 154 affects the expression of CASP3 protein	27060917
D006581	Hexachlorobenzene	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Hexachlorobenzene results in increased activity of CASP3 protein]	23708402
D006581	Hexachlorobenzene	Hexachlorobenzene results in increased activity of CASP3 protein	21787832; 23708402;
D006581	Hexachlorobenzene	Hexachlorobenzene results in increased expression of CASP3 mRNA	19815060
D001556	Hexachlorocyclohexane	Hexachlorocyclohexane results in increased activity of CASP3 protein	19221147
D001556	Hexachlorocyclohexane	[Hexachlorocyclohexane co-treated with Dieldrin] results in increased activity of CASP3 protein	20036686
D001556	Hexachlorocyclohexane	Hexachlorocyclohexane results in decreased activity of CASP3 protein	19041923
D001556	Hexachlorocyclohexane	Hexachlorocyclohexane results in increased activity of CASP3 protein	22001173
D001556	Hexachlorocyclohexane	Hexachlorocyclohexane results in increased expression of CASP3 mRNA	19815060
D001556	Hexachlorocyclohexane	Hexachlorocyclohexane results in increased expression of CASP3 protein	19038305
D001556	Hexachlorocyclohexane	Ro 31-8220 inhibits the reaction [Hexachlorocyclohexane results in increased activity of CASP3 protein]	22001173
D001556	Hexachlorocyclohexane	TEMPO inhibits the reaction [Hexachlorocyclohexane results in increased activity of CASP3 protein]	22001173
C482862	heyneanol A	heyneanol A results in increased cleavage of and results in increased activity of CASP3 protein	16675471
C538724	HhAntag691	HhAntag691 results in increased cleavage of CASP3 protein	22087285
C501367	hispanolone	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [hispanolone analog results in increased activity of CASP3 protein]	25930665
C501367	hispanolone	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [TNFSF10 protein promotes the reaction [hispanolone analog results in increased activity of CASP3 protein]]	25930665
C501367	hispanolone	hispanolone analog results in increased activity of CASP3 protein	25930665
C501367	hispanolone	TNFSF10 protein promotes the reaction [hispanolone analog results in increased activity of CASP3 protein]	25930665
C070164	homocastasterone	homocastasterone results in increased expression of CASP3 protein modified form	20833159
D006710	Homocysteine	Homocysteine results in increased activity of CASP3 protein	16715183; 19343037; 21237187;
D006710	Homocysteine	Homocysteine results in increased expression of CASP3 mRNA	19343037
D006710	Homocysteine	Homocysteine results in increased expression of CASP3 protein	19343037
D006710	Homocysteine	mecobalamin inhibits the reaction [Homocysteine results in increased activity of CASP3 protein]	21237187
D006710	Homocysteine	Simvastatin inhibits the reaction [Homocysteine results in increased activity of CASP3 protein]	19343037
D006710	Homocysteine	Atorvastatin inhibits the reaction [Homocysteine results in increased activity of CASP3 protein]	20305681
D006710	Homocysteine	Homocysteine results in increased activity of CASP3 protein	20305681
C007957	homocysteine thiolactone	homocysteine thiolactone results in increased activity of CASP3 protein	16715183
D000077863	Homoharringtonine	Homoharringtonine results in increased expression of CASP3 protein	23980369
C005499	honokiol	honokiol results in increased activity of CASP3 protein	15802533; 25106108;
C503536	HS-1199	HS-1199 results in increased activity of CASP3 protein	16077913; 20396553;
C479128	HS 1200	HS 1200 results in increased activity of CASP3 protein	16077913; 20396553;
C479128	HS 1200	HS 1200 results in increased cleavage of CASP3 protein	18565645
C012351	HT-2 toxin	Bentonite inhibits the reaction [[HT-2 toxin co-treated with T-2 Toxin] results in increased expression of CASP3 mRNA]	25296281
C012351	HT-2 toxin	[HT-2 toxin co-treated with T-2 Toxin] results in increased expression of CASP3 mRNA	25296281
C012351	HT-2 toxin	HT-2 toxin results in increased activity of CASP3 protein	19428930
C062018	HU 211	HU 211 results in increased activity of CASP3 protein	19509271
D006812	Humic Substances	Humic Substances results in increased cleavage of and results in increased activity of CASP3 protein	18683188
C050426	huperzine A	huperzine A affects the expression of CASP3	15956816
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of CTNNB1 protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of ABCB1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[[[[Hyaluronic Acid binds to CD44 protein] which results in increased expression of and results in increased activity of EP300 protein] which results in increased acetylation of and results in increased activity of RELA protein] which results in increased expression of BCL2L1 protein] inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	19047049
D006820	Hyaluronic Acid	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased activity of CASP3 protein]	17879260
D006820	Hyaluronic Acid	[Hyaluronic Acid co-treated with Chondroitin Sulfates] inhibits the reaction [[Ascorbic Acid co-treated with ferrous sulfate] results in increased expression of CASP3 mRNA]	17879260
D006835	Hydrazones	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to Hydrazones	22056764
D006835	Hydrazones	Hydrazones results in increased cleavage of and results in increased activity of CASP3 protein	22056764
D006851	Hydrochloric Acid	Hydrochloric Acid results in decreased expression of CASP3 protein modified form	15046208
D006854	Hydrocortisone	Hydrocortisone inhibits the reaction [Cytarabine results in increased activity of CASP3 protein]	16581899
D006854	Hydrocortisone	Hydrocortisone results in increased activity of CASP3 protein	15086553
D006854	Hydrocortisone	Hydrocortisone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15755911
D020100	Hydrogels	[Curcumin analog co-treated with Hydrogels] inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	27288928
D006859	Hydrogen	Hydrogen inhibits the reaction [APP protein results in increased cleavage of CASP3 protein]	26271894
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 protein	21365454
D006861	Hydrogen Peroxide	2''-galloylhyperin inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	28213291
D006861	Hydrogen Peroxide	Aspirin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	14753751
D006861	Hydrogen Peroxide	bathophenanthroline disulfonic acid inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	20096349
D006861	Hydrogen Peroxide	CYP26A1 protein inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	15703382
D006861	Hydrogen Peroxide	epigallocatechin gallate inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	12672908; 15795422;
D006861	Hydrogen Peroxide	EUK-172 inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	23041154
D006861	Hydrogen Peroxide	Ginkgo biloba extract affects the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	19414004
D006861	Hydrogen Peroxide	[[Gold results in decreased abundance of Glutathione] which results in increased abundance of Hydrogen Peroxide] which results in increased activity of CASP3 protein	21621595
D006861	Hydrogen Peroxide	Hydrogen Peroxide affects the expression of CASP3 mRNA	20044591
D006861	Hydrogen Peroxide	Hydrogen Peroxide affects the expression of CASP3 protein	21179406
D006861	Hydrogen Peroxide	Hydrogen Peroxide inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	15142122
D006861	Hydrogen Peroxide	Hydrogen Peroxide inhibits the reaction [SIRT1 protein results in decreased cleavage of CASP3 protein]	24451382
D006861	Hydrogen Peroxide	Hydrogen Peroxide promotes the reaction [Rotenone results in increased activity of CASP3 protein]	12177198
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased activity of CASP3 protein	11329530; 14753751; 18385095; 19706323; 20096349; 21431366; 22063921; 22245672; 22269385; 22471522; 23041154; 23639522; 23726866; 24107596; 27317026; 28400100; 30935903; 31306736;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein	12672908; 15795422; 19414004; 9989825;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased cleavage of CASP3 protein	15703382; 22269385; 29061316; 30404999; 31173752;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of and results in increased activity of CASP3 protein	22358095
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 mRNA	20361964; 29274434;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 protein modified form	16709600; 23726866; 28213291;
D006861	Hydrogen Peroxide	IL6 protein inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	22471522
D006861	Hydrogen Peroxide	kahweol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	31306736
D006861	Hydrogen Peroxide	Liraglutide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	31173752
D006861	Hydrogen Peroxide	Melatonin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	30404999
D006861	Hydrogen Peroxide	Melatonin promotes the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	21431366
D006861	Hydrogen Peroxide	MIR126 mRNA promotes the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	24107596
D006861	Hydrogen Peroxide	myricitrin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	23639522
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	18385095
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	12672908; 15795422;
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]	20361964
D006861	Hydrogen Peroxide	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	24107596
D006861	Hydrogen Peroxide	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of and results in increased activity of CASP3 protein]	22358095
D006861	Hydrogen Peroxide	Saponins inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]	29274434
D006861	Hydrogen Peroxide	[sodium arsenite co-treated with Hydrogen Peroxide] results in increased cleavage of CASP3 protein	18977016
D006861	Hydrogen Peroxide	[sodium cyanate co-treated with Hydrogen Peroxide] results in increased activity of CASP3 protein	28400100
D006861	Hydrogen Peroxide	Stilbenes inhibits the reaction [Hydrogen Peroxide results in increased expression of and results in increased activity of CASP3 protein]	22358095
D006861	Hydrogen Peroxide	TNF protein affects the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	22471522
D006861	Hydrogen Peroxide	Wortmannin inhibits the reaction [Hydrogen Peroxide inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	15142122
D006861	Hydrogen Peroxide	Wortmannin inhibits the reaction [Liraglutide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	31173752
D006861	Hydrogen Peroxide	Zinc Sulfate inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	20096349
D006861	Hydrogen Peroxide	3-methyladenine inhibits the reaction [procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]]	27057282
D006861	Hydrogen Peroxide	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	17520061
D006861	Hydrogen Peroxide	Dinoprostone inhibits the reaction [SIRT1 mutant form promotes the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	20335659
D006861	Hydrogen Peroxide	erigeroflavanone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	19557877
D006861	Hydrogen Peroxide	[ferric chloride co-treated with Hydrogen Peroxide co-treated with TNF protein] results in increased activity of CASP3 protein	19900513
D006861	Hydrogen Peroxide	FOXO1 protein affects the reaction [procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]]	27057282
D006861	Hydrogen Peroxide	[GMFB protein co-treated with Hydrogen Peroxide] results in increased activity of CASP3 protein	12791701
D006861	Hydrogen Peroxide	Grape Seed Proanthocyanidins inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	25242411
D006861	Hydrogen Peroxide	[GSTA4 gene mutant form results in increased susceptibility to Hydrogen Peroxide] which results in increased activity of CASP3 protein	24353929
D006861	Hydrogen Peroxide	[Hydrogen Peroxide co-treated with TNF protein] results in increased activity of CASP3 protein	19900513
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased activity of CASP3 protein	11181820; 17520061; 19900513; 22138401;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein	15876423; 19557877; 25242411;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased cleavage of CASP3 protein	20335659; 20878536; 24040102;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 mRNA	27057282
D006861	Hydrogen Peroxide	NAD inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	24040102
D006861	Hydrogen Peroxide	Niacinamide promotes the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	24040102
D006861	Hydrogen Peroxide	PARP1 protein promotes the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	20878536
D006861	Hydrogen Peroxide	procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]	27057282
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	22138401
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	15876423
D006861	Hydrogen Peroxide	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	24040102
D006861	Hydrogen Peroxide	SB 203580 inhibits the reaction [[GMFB protein co-treated with Hydrogen Peroxide] results in increased activity of CASP3 protein]	12791701
D006861	Hydrogen Peroxide	SIRT1 mutant form promotes the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	20335659
D006861	Hydrogen Peroxide	SRT2183 inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	20335659
D006861	Hydrogen Peroxide	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15799720
D006861	Hydrogen Peroxide	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	17045724
D006861	Hydrogen Peroxide	2-(4-((dimethylamino)methyl)benzylidene)-5,6-dimethoxy-2,3-dihydroinden-1-one inhibits the reaction [Hydrogen Peroxide results in decreased expression of CASP3 protein]	19345205
D006861	Hydrogen Peroxide	2-(4-((dimethylamino)methyl)benzylidene)-5,6-dimethoxy-2,3-dihydroinden-1-one inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19345205
D006861	Hydrogen Peroxide	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [5-aminoisoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	23352507
D006861	Hydrogen Peroxide	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	17045724
D006861	Hydrogen Peroxide	3,4-dihydro-5-methyl-1(2H)-isoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D006861	Hydrogen Peroxide	3,5-dicaffeoylquinic acid methyl ester inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	25451577
D006861	Hydrogen Peroxide	3-aminobenzamide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D006861	Hydrogen Peroxide	3-methylquercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19222219
D006861	Hydrogen Peroxide	5-aminoisoquinolinone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	23352507
D006861	Hydrogen Peroxide	Acetylcysteine inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15683462
D006861	Hydrogen Peroxide	BACH1 protein inhibits the reaction [SIRT6 protein inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	30660577
D006861	Hydrogen Peroxide	bafilomycin A1 promotes the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
D006861	Hydrogen Peroxide	calycopterin results in decreased susceptibility to [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	22081883
D006861	Hydrogen Peroxide	calycopterin results in decreased susceptibility to [Hydrogen Peroxide results in increased expression of CASP3 modified form]	22081883
D006861	Hydrogen Peroxide	CAT protein inhibits the reaction [[Rotenone results in increased abundance of Hydrogen Peroxide] which results in increased cleavage of and results in increased activity of CASP3 protein]	25304210
D006861	Hydrogen Peroxide	Donepezil inhibits the reaction [Hydrogen Peroxide results in decreased expression of CASP3 protein]	19345205
D006861	Hydrogen Peroxide	FOXO1 mRNA inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	26354380
D006861	Hydrogen Peroxide	Glutathione inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15683462
D006861	Hydrogen Peroxide	hesperetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19222219
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in decreased expression of CASP3 protein	19345205
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased activity of CASP3 protein	12472888; 12642403; 15683462; 15799720; 15909127; 16157298; 16249675; 16362428; 16647178; 17045724; 17640472; 19146853; 19222219; 19345205; 20114059; 24437944; 25065601; 25451577; 30660577;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein	10936186; 14505808; 17570061; 26354380;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased cleavage of CASP3 protein	22081883; 23352507; 24349266; 27525270;
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 modified form	22081883
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 protein	15228596
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased expression of CASP3 protein modified form	24889822
D006861	Hydrogen Peroxide	Indomethacin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	17570061
D006861	Hydrogen Peroxide	INO 1001 inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D006861	Hydrogen Peroxide	Isoflurane inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	16249675
D006861	Hydrogen Peroxide	isosakuranetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19222219
D006861	Hydrogen Peroxide	Luteolin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	27525270
D006861	Hydrogen Peroxide	Melatonin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15683462
D006861	Hydrogen Peroxide	Methylprednisolone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	17570061
D006861	Hydrogen Peroxide	[mitoquinol co-treated with mitoquinone] inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15799720
D006861	Hydrogen Peroxide	NFE2L2 protein promotes the reaction [SIRT6 protein inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	30660577
D006861	Hydrogen Peroxide	Niacinamide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D006861	Hydrogen Peroxide	notoginsenoside R1 inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	24437944
D006861	Hydrogen Peroxide	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D006861	Hydrogen Peroxide	PBK protein inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	25065601
D006861	Hydrogen Peroxide	PLD2 protein inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	10936186
D006861	Hydrogen Peroxide	Pramipexole inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	16362428
D006861	Hydrogen Peroxide	Propofol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	17640472
D006861	Hydrogen Peroxide	[Quercetin co-treated with Hydrogen Peroxide] results in increased cleavage of CASP3 protein	27525270
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	16647178; 17045724;
D006861	Hydrogen Peroxide	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	14505808
D006861	Hydrogen Peroxide	RAB7A protein inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
D006861	Hydrogen Peroxide	RAB7A protein promotes the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
D006861	Hydrogen Peroxide	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
D006861	Hydrogen Peroxide	[Rotenone results in increased abundance of Hydrogen Peroxide] which results in increased cleavage of and results in increased activity of CASP3 protein	25304210
D006861	Hydrogen Peroxide	SIRT1 protein promotes the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
D006861	Hydrogen Peroxide	SIRT6 protein inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	30660577
D006861	Hydrogen Peroxide	sirtinol inhibits the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
D006861	Hydrogen Peroxide	sirtinol promotes the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
D006861	Hydrogen Peroxide	sodium arsenite inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	12472888
D006861	Hydrogen Peroxide	Tacrolimus inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	12642403
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in increased activity of CASP3 protein	15191356
D006861	Hydrogen Peroxide	Sodium Selenite inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15191356
D006861	Hydrogen Peroxide	CAT protein inhibits the reaction [[SOD2 protein results in increased chemical synthesis of Hydrogen Peroxide] inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased cleavage of and results in increased activity of CASP3 protein]]	16910777
D006861	Hydrogen Peroxide	KRAS protein mutant form inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	22269385
D006861	Hydrogen Peroxide	[SOD2 protein results in increased chemical synthesis of Hydrogen Peroxide] inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased cleavage of and results in increased activity of CASP3 protein]	16910777
D047348	Hydrolyzable Tannins	Hydrolyzable Tannins results in increased activity of CASP3 protein	19490839
C031927	hydroquinone	Acetylcysteine inhibits the reaction [hydroquinone results in increased activity of CASP3 protein]	15816534
C031927	hydroquinone	hydroquinone results in decreased activity of CASP3 protein	22960397
C031927	hydroquinone	hydroquinone results in decreased expression of CASP3 mRNA	15452088
C031927	hydroquinone	hydroquinone results in increased activity of CASP3 protein	15816534; 20946948; 23776099;
C031927	hydroquinone	hydroquinone results in increased cleavage of CASP3 protein	15777082; 22302391;
C031927	hydroquinone	hydroquinone results in increased expression of CASP3 protein modified form	28886972
C031927	hydroquinone	IGF1 protein inhibits the reaction [hydroquinone results in increased expression of CASP3 protein modified form]	28886972
C031927	hydroquinone	Lithium Chloride inhibits the reaction [hydroquinone results in increased expression of CASP3 protein modified form]	28886972
C031927	hydroquinone	[PARP1 protein affects the susceptibility to hydroquinone] which affects the expression of and affects the activity of CASP3 protein	28444915
C031927	hydroquinone	[hydroquinone results in increased abundance of Reactive Oxygen Species] which results in decreased activity of CASP3 protein	15337166
D006877	Hydroxamic Acids	Hydroxamic Acids results in increased cleavage of CASP3 protein	27163855
D006886	Hydroxychloroquine	FAS protein affects the reaction [Hydroxychloroquine results in increased activity of CASP3 protein]	16734620
D006886	Hydroxychloroquine	Hydroxychloroquine results in increased activity of CASP3 protein	16734620
C051414	hydroxygenkwanin	Apigenin promotes the reaction [hydroxygenkwanin results in increased activity of CASP3 protein]	24144774
C051414	hydroxygenkwanin	hydroxygenkwanin promotes the reaction [Apigenin results in increased activity of CASP3 protein]	24144774
C051414	hydroxygenkwanin	hydroxygenkwanin results in increased activity of CASP3 protein	24144774
C013038	hydroxyhydroquinone	hydroxyhydroquinone results in increased activity of CASP3 protein	23776099
D006918	Hydroxyurea	Bucladesine promotes the reaction [Hydroxyurea results in increased activity of CASP3 protein]	10697531
D006918	Hydroxyurea	Hydroxyurea promotes the reaction [Valproic Acid results in increased cleavage of CASP3 protein]	17653085
D006918	Hydroxyurea	Hydroxyurea results in increased activity of CASP3 protein	10697531
D006918	Hydroxyurea	Hydroxyurea results in increased cleavage of CASP3 protein	16005713
D006918	Hydroxyurea	Hydroxyurea results in increased cleavage of CASP3 protein	23696560; 29228353;
D006918	Hydroxyurea	Selegiline promotes the reaction [Hydroxyurea results in increased cleavage of CASP3 protein]	23696560
D006918	Hydroxyurea	TRP53 gene mutant form inhibits the reaction [Hydroxyurea results in increased cleavage of CASP3 protein]	29228353
C001654	hyperforin	hyperforin inhibits the reaction [aluminum maltolate results in increased activity of CASP3 protein]	30481499
C001654	hyperforin	hyperforin inhibits the reaction [aluminum maltolate results in increased expression of CASP3 mRNA]	30481499
C001654	hyperforin	hyperforin results in decreased expression of CASP3 mRNA	30481499
C559745	hyperforin dicyclohexylammonium	hyperforin dicyclohexylammonium results in increased cleavage of CASP3 protein	21376709
C021304	hyperoside	[Quercetin co-treated with hyperoside] results in increased cleavage of CASP3 protein	24173369; 25354548;
D019271	Hypoxanthine	[3-hydrogenkwadaphnin co-treated with Hypoxanthine] results in increased activity of CASP3 protein	21396949
D019271	Hypoxanthine	[Mycophenolic Acid co-treated with Hypoxanthine] results in increased activity of CASP3 protein	21396949
C000623387	HZ-6d compound	HZ-6d compound results in increased expression of CASP3 protein modified form	28919514
D000077557	Ibandronic Acid	Ibandronic Acid results in increased activity of CASP3 protein	11389070
D007052	Ibuprofen	Ibuprofen inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	11296547
D007052	Ibuprofen	Ibuprofen inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	24333387
D007052	Ibuprofen	Ibuprofen inhibits the reaction [Streptozocin results in increased expression of CASP3 mRNA]	24333387
C411652	IC 261	IC 261 results in increased cleavage of and results in increased activity of CASP3 protein	16027726
C531470	icotinib	EGFR gene mutant form promotes the reaction [icotinib results in increased cleavage of and results in increased activity of CASP3 protein]	27639429
C531470	icotinib	icotinib results in increased cleavage of and results in increased activity of CASP3 protein	27639429
D015255	Idarubicin	Amifostine inhibits the reaction [Idarubicin results in increased activity of CASP3 protein]	18438337
D015255	Idarubicin	Amifostine promotes the reaction [Idarubicin results in increased activity of CASP3 protein]	18438337
D015255	Idarubicin	Idarubicin results in increased activity of CASP3 protein	17965967; 18438337;
C036619	idebenone	idebenone inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
C552946	idelalisib	[palbociclib results in increased susceptibility to idelalisib] which results in increased cleavage of CASP3 protein	23676220
C404743	IDN 5109	IDN 5109 results in increased activity of CASP3 protein	16391850
D007069	Ifosfamide	Carnitine inhibits the reaction [Ifosfamide results in increased expression of CASP3 mRNA]	23213347
D007069	Ifosfamide	Ifosfamide results in increased expression of CASP3 mRNA	23213347
C467077	ilimaquinone	ilimaquinone promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	24930757
C467077	ilimaquinone	ilimaquinone results in increased cleavage of CASP3 protein	24930757
C467077	ilimaquinone	[ilimaquinone results in increased susceptibility to TNFSF10 protein] which results in increased cleavage of CASP3 protein	24930757
D000068877	Imatinib Mesylate	Arsenic Trioxide promotes the reaction [Imatinib Mesylate results in increased activity of CASP3 protein]	12135670
D000068877	Imatinib Mesylate	[BIX 01294 results in increased susceptibility to Imatinib Mesylate] which results in increased activity of CASP3 protein	25079219
D000068877	Imatinib Mesylate	[Imatinib Mesylate co-treated with alvocidib] results in increased activity of CASP3 protein	12231544
D000068877	Imatinib Mesylate	[Imatinib Mesylate co-treated with saikosaponin] results in increased cleavage of and results in increased activity of CASP3 protein	23994742
D000068877	Imatinib Mesylate	Imatinib Mesylate promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	12135670
D000068877	Imatinib Mesylate	Imatinib Mesylate promotes the reaction [ON 01910 results in increased cleavage of CASP3 protein]	26008977
D000068877	Imatinib Mesylate	Imatinib Mesylate results in increased activity of CASP3 protein	12135670; 17915318;
D000068877	Imatinib Mesylate	Imatinib Mesylate results in increased cleavage of and results in increased activity of CASP3 protein	23994742
D000068877	Imatinib Mesylate	Imatinib Mesylate results in increased cleavage of CASP3 protein	26008977
D000068877	Imatinib Mesylate	ON 01910 promotes the reaction [Imatinib Mesylate results in increased cleavage of CASP3 protein]	26008977
D000068877	Imatinib Mesylate	[platycodin D co-treated with Imatinib Mesylate] results in increased cleavage of CASP3 protein	29552859
D000068877	Imatinib Mesylate	Tretinoin promotes the reaction [Imatinib Mesylate results in increased activity of CASP3 protein]	17915318
D000068877	Imatinib Mesylate	Imatinib Mesylate results in increased cleavage of CASP3 protein	28315715
D000068877	Imatinib Mesylate	SH3BP5 protein affects the reaction [Imatinib Mesylate results in increased cleavage of CASP3 protein]	28315715
C082359	imidacloprid	imidacloprid results in increased cleavage of and results in increased expression of CASP3 protein	27444676
D007099	Imipramine	Imipramine results in increased activity of CASP3 protein	22700542
D007099	Imipramine	Imipramine results in increased cleavage of and results in increased activity of CASP3 protein	10487422
D007099	Imipramine	Palmitic Acid promotes the reaction [Imipramine results in increased activity of CASP3 protein]	22700542
D000077271	Imiquimod	Imiquimod results in increased activity of CASP3 protein	12902443
D000077271	Imiquimod	Imiquimod results in increased cleavage of CASP3 protein	20033192
C587358	imoxin	imoxin inhibits the reaction [Fructose results in increased expression of CASP3 protein]	29430716
C587358	imoxin	imoxin inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
C587358	imoxin	imoxin inhibits the reaction [Palmitic Acid results in increased expression of CASP3 protein]	30259999
D007200	Indican	Indican results in increased cleavage of CASP3 protein	25056788
C428264	indioside D	indioside D results in increased cleavage of CASP3 protein	18376857
C027185	indirubin	[arsenic disulfide co-treated with indirubin] results in increased expression of CASP3 mRNA	25789073
C016517	indole-3-carbinol	indole-3-carbinol results in increased activity of CASP3 protein	16082211
C016517	indole-3-carbinol	indole-3-carbinol results in increased cleavage of and results in increased activity of CASP3 protein	20335513
C016517	indole-3-carbinol	indole-3-carbinol results in increased cleavage of CASP3 protein	29775573
D007213	Indomethacin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one affects the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D007213	Indomethacin	2-aminoethoxydiphenyl borate inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	23022152
D007213	Indomethacin	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D007213	Indomethacin	Anisomycin promotes the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D007213	Indomethacin	[Arsenic Trioxide co-treated with Indomethacin] results in increased activity of CASP3 protein	24312908
D007213	Indomethacin	Dantrolene inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	23022152
D007213	Indomethacin	[Indomethacin co-treated with Doxorubicin] results in increased activity of CASP3 protein	15812552
D007213	Indomethacin	Indomethacin promotes the reaction [LTA protein results in increased cleavage of CASP3 protein]	17873517
D007213	Indomethacin	Indomethacin results in increased activity of CASP3 protein	12485869; 17341418; 23022152; 24312908;
D007213	Indomethacin	Indomethacin results in increased cleavage of and results in increased activity of CASP3 protein	11532860; 15804060;
D007213	Indomethacin	Indomethacin results in increased expression of and results in increased activity of CASP3 protein	15265368
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of CASP3 mRNA	28628672
D007213	Indomethacin	pyrazolanthrone inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D007213	Indomethacin	SB 203580 inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D007213	Indomethacin	U 0126 inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
D007213	Indomethacin	Indomethacin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	17570061
D007213	Indomethacin	Indomethacin results in decreased activity of CASP3 protein	19615346
D007213	Indomethacin	Indomethacin results in increased activity of CASP3 protein	10192188; 11043455; 16184425; 17657623; 18375387; 18853145; 19220725; 19251492; 22157011;
D007213	Indomethacin	Indomethacin results in increased expression of CASP3 mRNA	29523851
D007213	Indomethacin	Indomethacin results in increased expression of CASP3 protein	28648817
D007213	Indomethacin	Irbesartan inhibits the reaction [Indomethacin results in increased expression of CASP3 mRNA]	29523851
D007213	Indomethacin	Lansoprazole inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	18375387
D007213	Indomethacin	Melatonin inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	19220725
D007213	Indomethacin	Omeprazole inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	19251492
D007213	Indomethacin	Pantoprazole inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	18853145
D007213	Indomethacin	polaprezinc inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	11043455
D007213	Indomethacin	Ranitidine inhibits the reaction [Indomethacin results in increased expression of CASP3 mRNA]	29523851
D007213	Indomethacin	Ranitidine inhibits the reaction [Indomethacin results in increased expression of CASP3 protein]	28648817
D007213	Indomethacin	rebamipide inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	16184425
D007213	Indomethacin	Silymarin inhibits the reaction [Indomethacin results in increased expression of CASP3 protein]	28648817
D007213	Indomethacin	sulglicotide inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17657623
D007213	Indomethacin	tryptamine analog inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	22157011
C572449	INK128	INK128 results in increased cleavage of CASP3 protein	26536665
C491685	INO 1001	INO 1001 inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D007294	Inositol	Inositol inhibits the reaction [Copper results in increased activity of CASP3 protein]	25562835
C071861	inostamycin	inostamycin promotes the reaction [Paclitaxel results in increased expression of CASP3 protein modified form]	9818034
C030956	insecticidal crystal protein, Bacillus Thuringiensis	insecticidal crystal protein, Bacillus Thuringiensis inhibits the reaction [Herbicides results in increased activity of CASP3 protein]	22337346
D007455	Iodine	[Diatrizoate co-treated with Iodine] results in increased activity of CASP3 protein	17173243
C094023	iodopravadoline	iodopravadoline inhibits the reaction [caryophyllene inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30836069
C094023	iodopravadoline	iodopravadoline results in increased cleavage of CASP3 protein	30836069
D007472	Iohexol	Carnitine inhibits the reaction [Iohexol promotes the reaction [Glycerol results in increased expression of CASP3 mRNA]]	26562095
D007472	Iohexol	Iohexol promotes the reaction [Glycerol results in increased expression of CASP3 mRNA]	26562095
D007472	Iohexol	Iohexol results in increased activity of CASP3 protein	19452295
D007472	Iohexol	Telmisartan inhibits the reaction [Iohexol results in increased activity of CASP3 protein]	19452295
D015759	Ionomycin	Calcium deficiency inhibits the reaction [Ionomycin results in increased activity of CASP3 protein]	29803841
D015759	Ionomycin	[Ionomycin co-treated with Tetradecanoylphorbol Acetate] results in increased activity of CASP3 protein	12165276
D015759	Ionomycin	Ionomycin results in increased activity of CASP3 protein	29803841
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] affects the expression of CASP3 mRNA	25613284
C054871	ioversol	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [ioversol results in increased cleavage of CASP3 protein]	19136047
C054871	ioversol	ioversol results in increased cleavage of CASP3 protein	19136047
D009241	Ipratropium	Ipratropium results in increased cleavage of CASP3 protein	24431217
D000077405	Irbesartan	Irbesartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D000077405	Irbesartan	Irbesartan inhibits the reaction [Indomethacin results in increased expression of CASP3 mRNA]	29523851
C506002	ircinin-1	ircinin-1 results in increased cleavage of and results in increased activity of CASP3 protein	16163705
D000077146	Irinotecan	[Irinotecan co-treated with alvocidib] results in increased activity of CASP3 protein	11751522
D000077146	Irinotecan	Irinotecan promotes the reaction [AS602868 results in increased cleavage of and results in increased activity of CASP3 protein]	18182997
D000077146	Irinotecan	Irinotecan results in increased activity of CASP3 protein	16080519; 16432164; 22898888;
D000077146	Irinotecan	RNF34 protein inhibits the reaction [Irinotecan results in increased activity of CASP3 protein]	16080519
D000077146	Irinotecan	Ursodeoxycholic Acid promotes the reaction [Irinotecan results in increased activity of CASP3 protein]	16432164
D007501	Iron	[Iron co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein	16456084
D007501	Iron	Iron results in increased cleavage of and results in increased activity of CASP3 protein	16957011
D007501	Iron	Iron results in increased expression of CASP3 protein	16957011
D007501	Iron	Propranolol inhibits the reaction [[Iron co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein]	16456084
D007501	Iron	[Arachidonic Acid co-treated with Iron] results in decreased expression of CASP3 protein	19620254
D007501	Iron	[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein	27916511
D007501	Iron	[Arachidonic Acid co-treated with Iron] results in increased expression of CASP3 protein modified form	30626086
D007501	Iron	Drugs, Chinese Herbal inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein]	27916511
D007501	Iron	Plant Extracts inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein]	27916511
D007501	Iron	Plant Extracts inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased expression of CASP3 protein modified form]	30626086
D007501	Iron	Resveratrol inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in decreased expression of CASP3 protein]	19620254
D058085	Iron Compounds	Iron Compounds results in increased cleavage of CASP3 protein	28483490
D007505	Iron-Dextran Complex	[Iron-Dextran Complex co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein	16456084
D007505	Iron-Dextran Complex	Propranolol inhibits the reaction [[Iron-Dextran Complex co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein]	16456084
D007505	Iron-Dextran Complex	ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]	20709802
D007505	Iron-Dextran Complex	[ADIPOQ protein results in increased expression of BCL2L1 protein] inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]	20709802
D007505	Iron-Dextran Complex	Bilirubin inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]	20709802
D007505	Iron-Dextran Complex	dorsomorphin inhibits the reaction [ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]]	20709802
D007505	Iron-Dextran Complex	GW 6471 inhibits the reaction [ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]]	20709802
D007505	Iron-Dextran Complex	Iron-Dextran Complex results in increased activity of CASP3 protein	20709802
D007505	Iron-Dextran Complex	[pirinixic acid results in increased expression of BCL2L1 protein] inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]	20709802
D007505	Iron-Dextran Complex	tin protoporphyrin IX inhibits the reaction [ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]]	20709802
C448299	iron protoporphyrin IX	iron protoporphyrin IX results in increased cleavage of and results in increased activity of CASP3 protein	18289802
C469852	iroxanadine	iroxanadine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	15583868
C469852	iroxanadine	Quercetin inhibits the reaction [iroxanadine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]]	15583868
D007510	Isatin	[Copper binds to Isatin binds to 2-(2-aminoethyl)pyridine] which results in increased cleavage of CASP3 protein	17327230
D007510	Isatin	[Copper binds to Isatin binds to trimethylenediamine] which results in increased cleavage of CASP3 protein	17327230
C032787	isoalantolactone	isoalantolactone results in increased expression of CASP3 protein modified form	29800641
C551631	isoangustone A	isoangustone A results in increased cleavage of CASP3 protein	20229524
C549713	isocarbophos	isocarbophos results in increased cleavage of CASP3 protein	26818681
C453300	isocoumarin NM-3	isocoumarin NM-3 promotes the reaction [Dexamethasone results in increased activity of CASP3 protein]	15574755
D007529	Isoflavones	Isoflavones results in increased cleavage of CASP3 protein	25035168
D007529	Isoflavones	Isoflavones results in increased expression of CASP3 mRNA	25035168
D007530	Isoflurane	APP protein promotes the reaction [Isoflurane results in increased cleavage of and results in increased activity of CASP3 protein]	17287498
D007530	Isoflurane	Clioquinol inhibits the reaction [Isoflurane results in increased cleavage of and results in increased activity of CASP3 protein]	17287498
D007530	Isoflurane	Isoflurane results in increased cleavage of and results in increased activity of CASP3 protein	15915027; 17287498;
D007530	Isoflurane	Isoflurane results in increased cleavage of CASP3 protein	18349187
D007530	Isoflurane	Isoflurane results in increased activity of CASP3 protein	23922164
D007530	Isoflurane	Resveratrol inhibits the reaction [Isoflurane results in increased activity of CASP3 protein]	23922164
D007530	Isoflurane	Dexmedetomidine inhibits the reaction [Isoflurane results in increased expression of CASP3 protein]	19352168; 20003127;
D007530	Isoflurane	IGF1 protein inhibits the reaction [Isoflurane results in increased cleavage of CASP3 protein]	25597859
D007530	Isoflurane	Isoflurane inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	16249675
D007530	Isoflurane	Isoflurane results in decreased expression of CASP3 mRNA	16978161
D007530	Isoflurane	Isoflurane results in increased cleavage of CASP3 protein	25597859
D007530	Isoflurane	Isoflurane results in increased expression of CASP3 protein	19352168; 20003127;
D007530	Isoflurane	Isoflurane results in increased expression of CASP3 protein modified form	29289695
D007530	Isoflurane	PF-4708671 promotes the reaction [Isoflurane results in increased cleavage of CASP3 protein]	25597859
D007530	Isoflurane	pyrazolanthrone inhibits the reaction [Isoflurane results in increased expression of CASP3 protein modified form]	29289695
C425644	isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone	isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone analog inhibits the reaction [cadmium acetate results in increased activity of CASP3 protein]	15450950; 16169029;
C040920	isoliquiritigenin	20-hydroxyeicosa-5(Z),14(Z)-dienoic acid inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
C040920	isoliquiritigenin	AKT1 protein modified form inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
C040920	isoliquiritigenin	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	23747687
C040920	isoliquiritigenin	CAY 10580 inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
C040920	isoliquiritigenin	Dinoprostone inhibits the reaction [isoliquiritigenin results in increased cleavage of CASP3 protein]	25094029
C040920	isoliquiritigenin	isoliquiritigenin results in increased activity of CASP3 protein	15729620; 16158945;
C040920	isoliquiritigenin	isoliquiritigenin results in increased cleavage of and results in increased activity of CASP3 protein	23747687
C040920	isoliquiritigenin	isoliquiritigenin results in increased cleavage of CASP3 protein	23747687; 25094029;
C018326	isomalathion	isomalathion results in increased activity of CASP3 protein	24333466
C575995	isomenthone	isomenthone inhibits the reaction [TNF protein results in increased cleavage of and results in increased activity of CASP3 protein]	22796318
D007538	Isoniazid	HGF protein inhibits the reaction [[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein]	23764483
D007538	Isoniazid	[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein	21419764; 23764483;
D007538	Isoniazid	Ursodeoxycholic Acid inhibits the reaction [[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein]	21419764
D007545	Isoproterenol	Acetylcysteine inhibits the reaction [Isoproterenol results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D007545	Isoproterenol	Isoproterenol results in increased activity of and results in increased cleavage of CASP3 protein	17136323
D007545	Isoproterenol	Isoproterenol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21745194
D007545	Isoproterenol	RAPGEF3 mutant form inhibits the reaction [Isoproterenol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21745194
D007545	Isoproterenol	Apigenin inhibits the reaction [Isoproterenol results in increased expression of CASP3 protein]	30152906
D007545	Isoproterenol	Enalapril inhibits the reaction [Isoproterenol results in increased expression of CASP3 protein]	30623541
D007545	Isoproterenol	Hesperidin inhibits the reaction [Isoproterenol results in increased expression of CASP3 protein]	30623541
D007545	Isoproterenol	Isoproterenol results in increased activity of CASP3 protein	20726854
D007545	Isoproterenol	Isoproterenol results in increased cleavage of CASP3 protein	27491814
D007545	Isoproterenol	Isoproterenol results in increased expression of CASP3 mRNA	11218852; 24286936; 25794854;
D007545	Isoproterenol	Isoproterenol results in increased expression of CASP3 protein	17961425; 28266775; 30152906; 30623541;
D007545	Isoproterenol	Progesterone inhibits the reaction [Isoproterenol results in increased activity of CASP3 protein]	20726854
D007545	Isoproterenol	Vanillic Acid inhibits the reaction [Isoproterenol results in increased expression of CASP3 mRNA]	25794854
C016527	isoquercitrin	isoquercitrin affects the expression of CASP3 mRNA	30597948
C538973	isosakuranetin	isosakuranetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	19222219
D007548	Isosorbide Dinitrate	[Antimony Sodium Gluconate co-treated with Isosorbide Dinitrate] results in decreased activity of CASP3 protein	20576500
D015474	Isotretinoin	Isotretinoin results in increased cleavage of CASP3 protein	16135400; 16575387;
D015474	Isotretinoin	Isotretinoin results in increased expression of CASP3	16909596
D015474	Isotretinoin	Isotretinoin results in increased expression of CASP3 protein	16109544; 16157052;
D015474	Isotretinoin	Isotretinoin results in increased expression of CASP3	18652567
D015474	Isotretinoin	Isotretinoin results in increased expression of CASP3 mRNA	18380168
C477508	jaceosidin	jaceosidin results in increased activity of CASP3 protein	27729209
C545474	JAI-51	JAI-51 results in increased activity of CASP3 protein	24134853
C553370	JBIR-99	JBIR-99 results in increased expression of CASP3 protein	31433962
C412308	JBP 485	JBP 485 inhibits the reaction [Vancomycin results in increased cleavage of CASP3 protein]	29964132
C098607	JP8 aviation fuel	JP8 aviation fuel results in increased activity of CASP3 protein	11222085
C098607	JP8 aviation fuel	JP8 aviation fuel results in increased expression of CASP3 mRNA	12832151
C098607	JP8 aviation fuel	Acetylcysteine inhibits the reaction [JP8 aviation fuel results in increased activity of CASP3 protein]	11969376
C098607	JP8 aviation fuel	Glutathione inhibits the reaction [JP8 aviation fuel results in increased activity of CASP3 protein]	11969376
C098607	JP8 aviation fuel	JP8 aviation fuel results in increased activity of CASP3 protein	11222085; 11969376;
C561695	(+)-JQ1 compound	[EGFR gene mutant form results in increased susceptibility to (+)-JQ1 compound] which results in increased activity of CASP3 protein	26455392
C561695	(+)-JQ1 compound	(+)-JQ1 compound analog promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	26415225
C561695	(+)-JQ1 compound	(+)-JQ1 compound analog results in increased activity of CASP3 protein	25989842
C561695	(+)-JQ1 compound	[(+)-JQ1 compound co-treated with Vorinostat] results in increased cleavage of CASP3 protein	26390243
C561695	(+)-JQ1 compound	(+)-JQ1 compound promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	26415225
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in increased activity of CASP3 protein	22904298; 23403638; 24403256; 25049379; 26911376; 27006472; 27259270;
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in increased cleavage of CASP3 protein	23872705; 25944566; 27259270;
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in increased expression of CASP3 mRNA	24796395
C561695	(+)-JQ1 compound	[KRAS gene mutant form results in increased susceptibility to (+)-JQ1 compound] which results in increased activity of CASP3 protein	24045185
C561695	(+)-JQ1 compound	STK11 gene mutant form inhibits the reaction [[KRAS gene mutant form results in increased susceptibility to (+)-JQ1 compound] which results in increased activity of CASP3 protein]	24045185
C561695	(+)-JQ1 compound	[STK11 protein results in increased susceptibility to (+)-JQ1 compound] which results in increased activity of CASP3 protein	24045185
C561695	(+)-JQ1 compound	[THZ1 compound co-treated with (+)-JQ1 compound] results in increased cleavage of CASP3 protein	30127528
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in increased cleavage of CASP3 protein	23430699; 25174395; 25762632; 25944566;
C005134	juglone	[juglone co-treated with Ascorbic Acid] results in decreased expression of CASP3 protein	29992683
C534333	JZL 184	CNR1 protein affects the reaction [JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]]	26209559
C534333	JZL 184	JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]	26209559
C534333	JZL 184	Rimonabant inhibits the reaction [JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]]	26209559
C006552	kaempferol	3',4'-dihydroxyflavone analog inhibits the reaction [kaempferol results in increased cleavage of CASP3 protein]	16014620
C006552	kaempferol	kaempferol inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	20594614
C006552	kaempferol	kaempferol results in increased cleavage of CASP3 protein	16014620; 18331776; 19028473; 19397994;
C006552	kaempferol	kaempferol inhibits the reaction [propacetamol results in increased cleavage of CASP3 protein]	29574133
C006552	kaempferol	kaempferol inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	22155320
C006552	kaempferol	kaempferol promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]]	29999212
C053401	kahweol	ERBB2 protein affects the reaction [kahweol results in increased activity of and results in increased cleavage of CASP3 protein]	30205135
C053401	kahweol	kahweol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	31306736
C053401	kahweol	kahweol results in increased activity of and results in increased cleavage of CASP3 protein	30205135
C046438	kahweol acetate	[TNFSF10 protein co-treated with kahweol acetate] results in decreased expression of CASP3 protein	20403343
D007608	Kainic Acid	EPO protein inhibits the reaction [Kainic Acid results in increased expression of CASP3 protein]	18711747
D007608	Kainic Acid	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]	25453207
D007608	Kainic Acid	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione promotes the reaction [Valproic Acid inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]]	25453207
D007608	Kainic Acid	Kainic Acid results in increased activity of CASP3 protein	16469440
D007608	Kainic Acid	Kainic Acid results in increased cleavage of CASP3 protein	25453207
D007608	Kainic Acid	Minocycline inhibits the reaction [Kainic Acid results in increased activity of CASP3 protein]	16469440
D007608	Kainic Acid	Valproic Acid inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]	25453207
D007608	Kainic Acid	Kainic Acid results in increased activity of CASP3 protein	31430510
D007608	Kainic Acid	Kainic Acid results in increased expression of CASP3 mRNA	19700661
D007608	Kainic Acid	Kainic Acid results in increased expression of CASP3 protein	18711747
D007608	Kainic Acid	oridonin inhibits the reaction [Kainic Acid results in increased activity of CASP3 protein]	31430510
C468270	Kangen-karyu	Kangen-karyu results in decreased expression of CASP3 protein	22969821
C119620	kenpaullone	kenpaullone inhibits the reaction [fipronil results in increased activity of CASP3 protein]	21296133
D007649	Ketamine	Ketamine results in increased activity of CASP3 protein	19001360
D007649	Ketamine	Ketamine results in increased activity of CASP3 protein	24646706
D007649	Ketamine	Ketamine results in increased expression of CASP3 protein	17426105
D007649	Ketamine	Ketamine results in increased activity of CASP3 protein	17920787
D007649	Ketamine	Ketamine results in increased expression of CASP3 protein modified form	25937004
D007654	Ketoconazole	Ketoconazole inhibits the reaction [Galactosamine results in increased activity of CASP3 protein]	17936189
D007654	Ketoconazole	Ketoconazole results in increased activity of CASP3 protein	19631732
D007654	Ketoconazole	pyrazolanthrone inhibits the reaction [Ketoconazole results in increased activity of CASP3 protein]	19631732
C063302	KN 62	KN 62 inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	24905940
C072105	KN 93	KN 93 inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C072105	KN 93	KN 93 inhibits the reaction [bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein]	26096086
C072105	KN 93	KN 93 inhibits the reaction [GW 7845 results in increased activity of CASP3 protein]	20810541
C072105	KN 93	KN 93 inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	29883672
C072105	KN 93	KN 93 inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	26923100
C072105	KN 93	KN 93 promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
C410027	KNK 437	KNK 437 promotes the reaction [Oxygen results in increased activity of CASP3 protein]	26066050
C410027	KNK 437	KNK 437 promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	20724260
C410027	KNK 437	KNK 437 results in increased activity of CASP3 protein	19913524
C410027	KNK 437	Scorpion Venoms results in increased susceptibility to [KNK 437 results in increased activity of CASP3 protein]	19913524
C045492	kolaviron	kolaviron inhibits the reaction [Atrazine results in increased expression of CASP3 mRNA]	21333729
C045492	kolaviron	kolaviron results in increased expression of CASP3 mRNA	21333729
C045492	kolaviron	kolaviron inhibits the reaction [Atrazine affects the expression of CASP3]	21726175
C045492	kolaviron	kolaviron inhibits the reaction [Atrazine results in increased activity of CASP3 protein]	21726175
C057416	KT 5720	KT 5720 inhibits the reaction [Cilostazol results in increased activity of CASP3 protein]	20131233
C057416	KT 5720	KT 5720 inhibits the reaction [Colforsin results in increased activity of CASP3 protein]	20131233
C057416	KT 5720	KT 5720 inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C073601	KT 5823	KT 5823 inhibits the reaction [8-bromocyclic GMP inhibits the reaction [TNF protein results in increased activity of CASP3 protein]]	9388267
C572783	kuguacin J	kuguacin J results in decreased expression of CASP3 protein	22266361
C000620717	kuntai capsule	kuntai capsule results in increased cleavage of and results in increased activity of CASP3 protein	27597876
C526229	kurarinol	kurarinol results in increased activity of CASP3 protein	24997323
C526229	kurarinol	STAT3 protein inhibits the reaction [kurarinol results in increased activity of CASP3 protein]	24997323
C508711	L-161982	L-161982 inhibits the reaction [ponasterone A results in decreased activity of CASP3 protein]	16396944
C508711	L-161982	L-161982 promotes the reaction [Puromycin Aminonucleoside results in increased activity of CASP3 protein]	16396944
C410009	L 685458	L 685458 inhibits the reaction [Sevoflurane results in increased cleavage of CASP3 protein]	19433662
C096429	L 709049	L 709049 results in increased cleavage of CASP3 protein	28483490
C500368	labedipinedilol A	labedipinedilol A results in increased activity of CASP3 protein	19056458
C067713	lactacystin	calpeptin inhibits the reaction [[lactacystin results in increased activity of CASP3 protein] which results in increased cleavage of SPTAN1 protein]	21683092
C067713	lactacystin	lactacystin results in increased activity of CASP3 protein	15618349; 20649845; 21683092;
C067713	lactacystin	[lactacystin results in increased activity of CASP3 protein] which results in increased cleavage of SPTAN1 protein	21683092
C067713	lactacystin	lactacystin results in increased expression of CASP3 protein modified form	29944914
C067713	lactacystin	lactacystin results in increased activity of CASP3 protein	15618349
D019344	Lactic Acid	Lactic Acid affects the expression of CASP3 mRNA	30851411
D007792	Lactulose	Lactulose inhibits the reaction [Methamphetamine results in increased expression of CASP3 protein modified form]	30450033
C060347	lanreotide	[Diethylnitrosamine co-treated with lanreotide] results in increased activity of CASP3 protein	19874807
D064747	Lansoprazole	Lansoprazole inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
D064747	Lansoprazole	Lansoprazole inhibits the reaction [Diatrizoate Meglumine results in increased expression of CASP3 mRNA]	28412091
D064747	Lansoprazole	Lansoprazole inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	29339218
D064747	Lansoprazole	Lansoprazole inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	18375387
D028581	Lanthanoid Series Elements	Lanthanoid Series Elements inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	26033013
C028521	lanthanum chloride	lanthanum chloride results in increased expression of CASP3 protein	21793157
D000077341	Lapatinib	2-(4-nitrophenyl)-4-(4-fluorophenyl)-5-(4-pyridinyl)-1H-imidazole inhibits the reaction [Lapatinib results in increased cleavage of CASP3 protein]	29387217
D000077341	Lapatinib	Lapatinib results in increased cleavage of CASP3 protein	29387217
C477361	LAQ824	[LAQ824 co-treated with fludarabine] results in increased activity of CASP3 protein	18852132
C037067	latrunculin A	latrunculin A results in increased activity of CASP3 protein	16723733
C008259	lauryl gallate	lauryl gallate results in increased activity of CASP3 protein	21856409
D007854	Lead	[lead nitrate results in increased abundance of Lead] which results in increased activity of CASP3 protein	30738203
D007854	Lead	[lead nitrate results in increased abundance of Lead] which results in increased expression of CASP3 mRNA	30738203
D007854	Lead	titanium dioxide inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in increased activity of CASP3 protein]	30738203
D007854	Lead	titanium dioxide inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in increased expression of CASP3 mRNA]	30738203
D007854	Lead	fisetin inhibits the reaction [Lead results in increased cleavage of CASP3 protein]	31539617
D007854	Lead	Lead results in increased activity of CASP3 protein	19727529; 20466044;
D007854	Lead	Lead results in increased cleavage of CASP3 protein	31539617
D007854	Lead	Plant Extracts inhibits the reaction [Lead results in increased activity of CASP3 protein]	20466044
D007854	Lead	Lead results in increased activity of CASP3 protein	16781745
D007854	Lead	Lead results in increased cleavage of and results in increased activity of CASP3 protein	22129743
D007854	Lead	Neurotransmitter Agents promotes the reaction [Lead results in increased activity of CASP3 protein]	16781745
D007854	Lead	Plant Extracts inhibits the reaction [Lead results in increased cleavage of and results in increased activity of CASP3 protein]	22129743
D007854	Lead	Lead results in increased expression of CASP3	20390873
C008261	lead acetate	HMOX1 protein affects the reaction [lead acetate affects the expression of CASP3 protein]	26542248
C008261	lead acetate	lead acetate affects the expression of CASP3 protein	26542248
C008261	lead acetate	lead acetate results in increased activity of CASP3 protein	23318731; 26498409;
C008261	lead acetate	NFE2L2 protein inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	26498409
C008261	lead acetate	Clotrimazole inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
C008261	lead acetate	lead acetate results in increased activity of CASP3 protein	22033380; 27236077;
C008261	lead acetate	lead acetate results in increased expression of CASP3 protein	27604105
C008261	lead acetate	lead acetate results in increased expression of CASP3 protein modified form	21640820
C008261	lead acetate	MIR671 mRNA inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	27604105
C008261	lead acetate	PPARGC1A protein inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	27236077
C008261	lead acetate	[S-allylcysteine co-treated with Clotrimazole] inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
C008261	lead acetate	S-allylcysteine inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
C008261	lead acetate	Biological Factors inhibits the reaction [lead acetate results in increased expression of CASP3 mRNA]	30703413
C008261	lead acetate	Biological Factors inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30703413
C008261	lead acetate	[Cadmium Chloride co-treated with lead acetate] results in increased expression of CASP3 protein	25031709
C008261	lead acetate	Genistein inhibits the reaction [lead acetate results in increased cleavage of CASP3 protein]	26797587
C008261	lead acetate	lead acetate promotes the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	23906897
C008261	lead acetate	lead acetate results in decreased expression of CASP3 mRNA	23146751
C008261	lead acetate	lead acetate results in increased cleavage of CASP3 protein	26797587
C008261	lead acetate	lead acetate results in increased expression of CASP3 mRNA	23906897; 30703413;
C008261	lead acetate	lead acetate results in increased expression of CASP3 protein	19026729; 30251767; 30703413; 30980911;
C008261	lead acetate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [lead acetate promotes the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	23906897
C008261	lead acetate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [lead acetate results in increased expression of CASP3 mRNA]	23906897
C008261	lead acetate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite promotes the reaction [lead acetate results in increased expression of CASP3 mRNA]]	23906897
C008261	lead acetate	Plant Oils inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30251767
C008261	lead acetate	Plant Preparations inhibits the reaction [lead acetate results in increased expression of CASP3 mRNA]	30703413
C008261	lead acetate	Plant Preparations inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30703413
C008261	lead acetate	[sodium arsenite co-treated with lead acetate co-treated with Cadmium Chloride] results in increased expression of CASP3 protein modified form	23680456
C008261	lead acetate	sodium arsenite promotes the reaction [lead acetate results in increased expression of CASP3 mRNA]	23906897
C008261	lead acetate	sodium bisulfide inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30980911
C008261	lead acetate	sodium boranocarbonate inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30980911
C029891	lead chloride	lead chloride results in increased cleavage of CASP3 protein	24419708
C017461	lead nitrate	[lead nitrate results in increased abundance of Lead] which results in increased activity of CASP3 protein	30738203
C017461	lead nitrate	[lead nitrate results in increased abundance of Lead] which results in increased expression of CASP3 mRNA	30738203
C017461	lead nitrate	titanium dioxide inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in increased activity of CASP3 protein]	30738203
C017461	lead nitrate	titanium dioxide inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in increased expression of CASP3 mRNA]	30738203
C017461	lead nitrate	lead nitrate results in increased expression of CASP3 protein	23451106
C017461	lead nitrate	mangiferin inhibits the reaction [lead nitrate results in increased expression of CASP3 protein]	23451106
C017461	lead nitrate	lead nitrate results in increased activity of CASP3 protein	24505050
C017461	lead nitrate	puerarin inhibits the reaction [lead nitrate results in increased activity of CASP3 protein]	24505050
C013587	leonurine	leonurine inhibits the reaction [lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein]	31005592
C093534	leptocarpin	leptocarpin results in increased activity of CASP3 protein	26562779
D002955	Leucovorin	[10-hydroxycamptothecin co-treated with Fluorouracil co-treated with Leucovorin] results in increased activity of CASP3 protein	12934351
D016729	Leuprolide	Leuprolide results in increased expression of CASP3 protein	15965100
C523615	levistolide A	[Doxorubicin co-treated with levistolide A] results in increased activity of CASP3 protein	18358092
D007980	Levodopa	Levodopa results in increased activity of CASP3 protein	21815648
D007980	Levodopa	Levodopa results in increased cleavage of CASP3 protein	25044243
D007980	Levodopa	MAP3K5 protein affects the susceptibility to [Levodopa results in increased activity of CASP3 protein]	21815648
D007980	Levodopa	Levodopa results in increased expression of CASP3 protein	15672541
D007980	Levodopa	EPO protein inhibits the reaction [Levodopa results in increased cleavage of and results in increased activity of CASP3 protein]	21683736
D007980	Levodopa	Levodopa inhibits the reaction [Oxidopamine results in increased expression of CASP3 mRNA]	25129099
D007980	Levodopa	Levodopa results in increased activity of CASP3 protein	18387727; 20670675;
D007980	Levodopa	Levodopa results in increased cleavage of and results in increased activity of CASP3 protein	21683736
D007980	Levodopa	Levodopa results in increased cleavage of CASP3 protein	19786063
D064704	Levofloxacin	Levofloxacin results in increased cleavage of CASP3 protein	23813946
C586458	LGK974	LGK974 inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	30205152
C070840	licochalcone A	licochalcone A results in increased expression of CASP3 mRNA	30055311
C541528	licochalcone B	licochalcone B results in increased activity of CASP3 protein	24384411
C401293	licoricidin	licoricidin promotes the reaction [gemcitabine results in increased activity of CASP3 protein]	29782821
C401293	licoricidin	licoricidin promotes the reaction [gemcitabine results in increased expression of and results in increased activity of CASP3 protein]	29782821
C401293	licoricidin	licoricidin results in increased activity of CASP3 protein	29782821
C401293	licoricidin	licoricidin results in increased expression of and results in increased activity of CASP3 protein	29782821
D008012	Lidocaine	Lidocaine results in decreased expression of CASP3 protein	20194319
D008012	Lidocaine	Lidocaine results in increased activity of CASP3 protein	17585225; 21047305;
D008012	Lidocaine	Lidocaine results in decreased activity of CASP3 protein	15099683
C027820	ligustilide	ligustilide results in increased activity of CASP3 protein	30243965
C018584	linalool	linalool results in increased activity of CASP3 protein	28567457
C018584	linalool	linalool results in increased expression of CASP3 mRNA	26703569
D019787	Linoleic Acid	Linoleic Acid promotes the reaction [TNF protein results in increased activity of CASP3 protein]	10617950
D019787	Linoleic Acid	Linoleic Acid results in increased activity of CASP3 protein	10617950
D019787	Linoleic Acid	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid promotes the reaction [TNF protein results in increased activity of CASP3 protein]]	10617950
D019787	Linoleic Acid	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]	10617950
D019787	Linoleic Acid	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]	10617950
D019787	Linoleic Acid	TNF protein promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]	10617950
D019787	Linoleic Acid	Zinc Acetate inhibits the reaction [Linoleic Acid results in increased activity of CASP3 protein]	10617950
D019787	Linoleic Acid	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid promotes the reaction [TNF protein results in increased activity of CASP3 protein]]]	10617950
D019787	Linoleic Acid	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]	10617950
D019787	Linoleic Acid	Zinc Acetate promotes the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]]	10617950
D044243	Linoleic Acids, Conjugated	Linoleic Acids, Conjugated results in increased activity of CASP3 protein	20155912
C002385	linsidomine	linsidomine results in increased activity of CASP3 protein	16291239
C002385	linsidomine	linsidomine results in increased cleavage of CASP3 protein	23174672
C002385	linsidomine	linsidomine results in increased expression of CASP3 mRNA	12880480
C002385	linsidomine	linsidomine results in increased expression of CASP3 protein	12880480
C002385	linsidomine	linsidomine results in increased expression of CASP3 protein modified form	23174672
C002385	linsidomine	Melatonin inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	12880480
C002385	linsidomine	MT1A inhibits the reaction [linsidomine results in increased activity of CASP3 protein]	16291239
C002385	linsidomine	Plant Extracts inhibits the reaction [linsidomine results in increased cleavage of CASP3 protein]	23174672
C002385	linsidomine	Plant Extracts inhibits the reaction [linsidomine results in increased expression of CASP3 protein modified form]	23174672
C002385	linsidomine	Selegiline inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	12880480
C002385	linsidomine	Selegiline inhibits the reaction [linsidomine results in increased expression of CASP3 protein]	12880480
C002385	linsidomine	Ubiquinone inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	12880480
C002385	linsidomine	linsidomine results in increased activity of CASP3 protein	15686499; 19038279;
C002385	linsidomine	Melatonin inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
C002385	linsidomine	MT1A protein inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
C002385	linsidomine	Selegiline inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
C002385	linsidomine	Ubiquinone inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
D008044	Linuron	Linuron results in increased expression of CASP3 mRNA	28705778
D008055	Lipids	Lipids inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	25445725
C482199	lipopolysaccharide, E coli O55-B5	beraprost inhibits the reaction [[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein]	28887131
C482199	lipopolysaccharide, E coli O55-B5	[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein	28887131
C482199	lipopolysaccharide, E coli O55-B5	geraniol inhibits the reaction [lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein]	29050341
C482199	lipopolysaccharide, E coli O55-B5	GW 506033X inhibits the reaction [lipopolysaccharide, E coli O55-B5 results in increased activity of CASP3 protein]	28511573
C482199	lipopolysaccharide, E coli O55-B5	leonurine inhibits the reaction [lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein]	31005592
C482199	lipopolysaccharide, E coli O55-B5	[lipopolysaccharide, E coli O55-B5 co-treated with Galactosamine] results in increased activity of CASP3 protein	24830863
C482199	lipopolysaccharide, E coli O55-B5	lipopolysaccharide, E coli O55-B5 results in increased activity of CASP3 protein	28511573
C482199	lipopolysaccharide, E coli O55-B5	lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein	29050341; 31005592;
C482199	lipopolysaccharide, E coli O55-B5	ONO 1301 inhibits the reaction [[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein]	28887131
C482199	lipopolysaccharide, E coli O55-B5	Rotenone inhibits the reaction [[lipopolysaccharide, E coli O55-B5 co-treated with Galactosamine] results in increased activity of CASP3 protein]	24830863
C482199	lipopolysaccharide, E coli O55-B5	TLR4 mRNA promotes the reaction [lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein]	29050341
C482199	lipopolysaccharide, E coli O55-B5	lipopolysaccharide, E coli O55-B5 results in increased expression of CASP3 protein	31005592
C440499	lipopolysaccharide, Escherichia coli O111 B4	lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein	31158334
C440499	lipopolysaccharide, Escherichia coli O111 B4	MIR26A1 mRNA affects the reaction [notoginsenoside R1 inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]]	31158334
C440499	lipopolysaccharide, Escherichia coli O111 B4	notoginsenoside R1 inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]	31158334
C440499	lipopolysaccharide, Escherichia coli O111 B4	lipopolysaccharide, Escherichia coli O111 B4 results in increased activity of CASP3 protein	21239534
C440499	lipopolysaccharide, Escherichia coli O111 B4	[zinc chloride co-treated with pyrithione] inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased activity of CASP3 protein]	21239534
C440499	lipopolysaccharide, Escherichia coli O111 B4	2-Acetylaminofluorene inhibits the reaction [[lipopolysaccharide, Escherichia coli O111 B4 co-treated with Galactosamine] results in increased cleavage of CASP3 protein]	12907702
C440499	lipopolysaccharide, Escherichia coli O111 B4	atipamezole inhibits the reaction [Dexmedetomidine inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]]	30597158
C440499	lipopolysaccharide, Escherichia coli O111 B4	Dexmedetomidine inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]	30597158
C440499	lipopolysaccharide, Escherichia coli O111 B4	[lipopolysaccharide, Escherichia coli O111 B4 co-treated with Galactosamine] results in increased cleavage of CASP3 protein	12907702
C440499	lipopolysaccharide, Escherichia coli O111 B4	lipopolysaccharide, Escherichia coli O111 B4 results in increased activity of CASP3 protein	27432233
C440499	lipopolysaccharide, Escherichia coli O111 B4	lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein	30597158
C440499	lipopolysaccharide, Escherichia coli O111 B4	lipopolysaccharide, Escherichia coli O111 B4 results in increased expression of CASP3 mRNA	27432233
C440499	lipopolysaccharide, Escherichia coli O111 B4	SB 216763 inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]	30597158
D008070	Lipopolysaccharides	benzyloxycarbonyl-isoleucyl-glutamyl(O-tert-butyl)-alanyl-leucinal inhibits the reaction [Lipopolysaccharides results in increased ubiquitination of and results in increased degradation of and results in decreased activity of CASP3 protein]	15454145
D008070	Lipopolysaccharides	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	9755104
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased activity of CASP3 protein	21844306
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased cleavage of CASP3 protein	17929310
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased expression of CASP3 protein	19675143
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased ubiquitination of and results in increased degradation of and results in decreased activity of CASP3 protein	15454145
D008070	Lipopolysaccharides	[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	9755104
D008070	Lipopolysaccharides	Quercetin inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	17929310
D008070	Lipopolysaccharides	Resveratrol inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	17929310
D008070	Lipopolysaccharides	3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	30776389
D008070	Lipopolysaccharides	baicalein inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form]	20850421
D008070	Lipopolysaccharides	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [[triptolide co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form]	30633930
D008070	Lipopolysaccharides	Biliverdine inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D008070	Lipopolysaccharides	[CCR5 gene mutant form results in increased susceptibility to Lipopolysaccharides] which results in increased cleavage of CASP3 protein	26055553
D008070	Lipopolysaccharides	cobaltiprotoporphyrin inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	14512878
D008070	Lipopolysaccharides	Cyclosporine inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased activity of CASP3 protein]	10205001
D008070	Lipopolysaccharides	EPO protein inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	24561306
D008070	Lipopolysaccharides	[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein	17602819; 21146893;
D008070	Lipopolysaccharides	[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein	20558151
D008070	Lipopolysaccharides	[[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein	20558151
D008070	Lipopolysaccharides	[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form	20558151
D008070	Lipopolysaccharides	gentiopicroside inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein]	20558151
D008070	Lipopolysaccharides	gentiopicroside inhibits the reaction [[[Galactosamine co-treated with Lipopolysaccharides] results in increased cleavage of and results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein]	20558151
D008070	Lipopolysaccharides	gentiopicroside inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form]	20558151
D008070	Lipopolysaccharides	ginsenoside Re inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	23102375
D008070	Lipopolysaccharides	[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein	14512878; 15486963;
D008070	Lipopolysaccharides	[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form	20850421
D008070	Lipopolysaccharides	[Lipopolysaccharides co-treated with IFNG protein] results in increased activity of CASP3 protein	10205001
D008070	Lipopolysaccharides	[Lipopolysaccharides co-treated with Scutellaria baicalensis extract] results in increased cleavage of and results in increased activity of CASP3 protein	21299906
D008070	Lipopolysaccharides	[Lipopolysaccharides co-treated with Simvastatin] results in increased activity of CASP3 protein	16325779
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased activity of CASP3 protein	12878042; 23102375; 23170834; 30261164;
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased cleavage of CASP3 protein	24561306; 30776389;
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased expression of CASP3 protein modified form	23170834
D008070	Lipopolysaccharides	Melatonin inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein]	17602819
D008070	Lipopolysaccharides	[Methylene Chloride co-treated with Biliverdine] inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D008070	Lipopolysaccharides	Methylene Chloride inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D008070	Lipopolysaccharides	notoginsenoside R1 inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	23170834
D008070	Lipopolysaccharides	notoginsenoside R1 inhibits the reaction [Lipopolysaccharides results in increased expression of CASP3 protein modified form]	23170834
D008070	Lipopolysaccharides	sesamol inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	30261164
D008070	Lipopolysaccharides	Silymarin inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form]	20850421
D008070	Lipopolysaccharides	Tacrolimus inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased activity of CASP3 protein]	10205001
D008070	Lipopolysaccharides	Tetrachlorodibenzodioxin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	12878042
D008070	Lipopolysaccharides	[triptolide co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form	30633930
D008070	Lipopolysaccharides	Ursodeoxycholic Acid analog inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein]	21146893
D008070	Lipopolysaccharides	zinc protoporphyrin inhibits the reaction [sesamol inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	30261164
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased expression of CASP3 mRNA	25613284
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased activity of CASP3 protein	9755104
D008070	Lipopolysaccharides	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	9755104
D008070	Lipopolysaccharides	17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	27224288
D008070	Lipopolysaccharides	Apigenin inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	25557508
D008070	Lipopolysaccharides	Diosmin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	21477647
D008070	Lipopolysaccharides	[Galactosamine co-treated with Lipopolysaccharides] results in increased expression of CASP3 mRNA	21401295
D008070	Lipopolysaccharides	HBEGF protein inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	16567187
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased activity of and results in increased cleavage of CASP3 protein	22685622
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased activity of CASP3 protein	16567187; 21477647; 23200736; 24803807; 25738436; 27224288;
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased cleavage of CASP3 protein	12665479; 25557508;
D008070	Lipopolysaccharides	Lipopolysaccharides results in increased expression of and results in increased activity of CASP3 protein	28070109
D008070	Lipopolysaccharides	notoginsenoside R1 inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	25738436
D008070	Lipopolysaccharides	pifithrin inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	12665479
D008070	Lipopolysaccharides	Protein Kinase Inhibitors inhibits the reaction [Lipopolysaccharides results in increased expression of CASP3 protein]	28070109
D008070	Lipopolysaccharides	pyrrolidine dithiocarbamic acid inhibits the reaction [Lipopolysaccharides results in increased expression of CASP3 protein]	28070109
D008070	Lipopolysaccharides	Quercetin inhibits the reaction [17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	27224288
D008070	Lipopolysaccharides	Quercetin inhibits the reaction [Lipopolysaccharides results in increased activity of and results in increased cleavage of CASP3 protein]	22685622
D008070	Lipopolysaccharides	Tigecycline inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	23200736
D008070	Lipopolysaccharides	TNF protein affects the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	24803807
D000069450	Liraglutide	Liraglutide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	31173752
D000069450	Liraglutide	Wortmannin inhibits the reaction [Liraglutide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	31173752
D008094	Lithium	Lithium inhibits the reaction [Monensin results in increased activity of CASP3 protein]	20799912
D008094	Lithium	Lithium inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	17849503
D008094	Lithium	Lithium inhibits the reaction [Cadmium results in increased expression of CASP3 protein]	20455018
D008094	Lithium	Lithium inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	15005753
D008094	Lithium	Lithium results in decreased activity of CASP3 protein	15581403
D008094	Lithium	[Pilocarpine co-treated with Lithium] results in increased activity of CASP3 protein	20149694
D008094	Lithium	Tacrolimus inhibits the reaction [[Lithium co-treated with Pilocarpine] results in increased activity of CASP3 protein]	20149694
D016651	Lithium Carbonate	Butylated Hydroxytoluene inhibits the reaction [Lithium Carbonate results in increased activity of CASP3 protein]	27588890
D016651	Lithium Carbonate	Cyclosporine inhibits the reaction [Lithium Carbonate results in increased activity of CASP3 protein]	27588890
D016651	Lithium Carbonate	Lithium Carbonate results in increased activity of CASP3 protein	27588890
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [fipronil results in increased activity of CASP3 protein]	21296133
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [hydroquinone results in increased expression of CASP3 protein modified form]	28886972
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [quinocetone results in increased cleavage of CASP3 protein]	28343033
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	19101580
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	30377735
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [Heparin promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	30377735
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [manganese chloride results in increased activity of CASP3 protein]	24464479
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27045591
D018021	Lithium Chloride	Lithium Chloride results in decreased activity of CASP3 protein	21364661
D018021	Lithium Chloride	Lithium Chloride inhibits the reaction [Aspirin results in increased activity of CASP3 protein]	19706045
D008095	Lithocholic Acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Lithocholic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	19054763
D008095	Lithocholic Acid	[[[[[Lithocholic Acid results in increased abundance of Reactive Oxygen Species] which results in increased localization of and results in increased activity of FAS protein] which results in increased activity of CASP8 protein] which results in increased cleavage of BID protein] which results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein	19054763
D008095	Lithocholic Acid	Lithocholic Acid results in increased cleavage of and results in increased activity of CASP3 protein	19054763
D008095	Lithocholic Acid	Lithocholic Acid results in increased expression of CASP3 protein	23627780
D008095	Lithocholic Acid	TNF protein promotes the reaction [Lithocholic Acid results in increased expression of CASP3 protein]	23627780
D008095	Lithocholic Acid	1,4-bis(2-(3,5-dichloropyridyloxy))benzene inhibits the reaction [Lithocholic Acid results in increased cleavage of CASP3 protein]	19433268
D008095	Lithocholic Acid	Lithocholic Acid results in increased cleavage of CASP3 protein	19433268
D008095	Lithocholic Acid	Phenobarbital inhibits the reaction [Lithocholic Acid results in increased cleavage of CASP3 protein]	19433268
D008095	Lithocholic Acid	Pregnenolone Carbonitrile inhibits the reaction [Lithocholic Acid results in increased cleavage of CASP3 protein]	19433268
C061091	lithospermate B	lithospermate B inhibits the reaction [[IFNG protein co-treated with IL1B protein] results in increased activity of CASP3 protein]	21295052
C061091	lithospermate B	lithospermate B results in decreased cleavage of CASP3 protein	21295052
C501175	LM-1685	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [[LM-1685 co-treated with carboxyamido-triazole] results in increased cleavage of CASP3 protein]	15867384
C529490	locostatin	locostatin inhibits the reaction [didymin results in increased activity of CASP3 protein]	27899290
C115354	lonafarnib	[lonafarnib co-treated with Bortezomib] results in increased cleavage of CASP3 protein	16118318
C581034	longikaurin A	longikaurin A results in increased expression of CASP3 protein modified form	28801140
C016371	lonidamine	[Arsenic Trioxide co-treated with lonidamine] results in increased cleavage of and results in increased activity of CASP3 protein	21889928
C016371	lonidamine	[Curcumin co-treated with lonidamine] results in increased cleavage of CASP3 protein	20605902
D017336	Loratadine	Loratadine results in increased activity of CASP3 protein	20570632
D017336	Loratadine	Dasatinib promotes the reaction [Loratadine results in increased activity of CASP3 protein]	20570632
D017336	Loratadine	Loratadine results in increased activity of CASP3 protein	20570632; 22700542;
D017336	Loratadine	Loratadine results in increased cleavage of CASP3 protein	20570632
D017336	Loratadine	midostaurin promotes the reaction [Loratadine results in increased activity of CASP3 protein]	20570632
D017336	Loratadine	Palmitic Acid promotes the reaction [Loratadine results in increased activity of CASP3 protein]	22700542
D019808	Losartan	Losartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D019808	Losartan	Losartan results in decreased activity of CASP3 protein	23875703
D019808	Losartan	Losartan results in increased cleavage of CASP3 protein	12623880
D019808	Losartan	Losartan inhibits the reaction [AGT protein results in increased activity of CASP3 protein]	11959625
D008148	Lovastatin	farnesyl pyrophosphate inhibits the reaction [Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein]	18766339
D008148	Lovastatin	geranylgeranyl pyrophosphate inhibits the reaction [Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein]	18766339
D008148	Lovastatin	Lovastatin analog results in increased cleavage of CASP3 protein	26863638
D008148	Lovastatin	Lovastatin results in increased activity of CASP3 protein	11720884; 12933658; 18034278; 18766339;
D008148	Lovastatin	Lovastatin results in decreased expression of CASP3 mRNA	20493250
D008148	Lovastatin	Lovastatin results in increased activity of CASP3 protein	15180944
D008148	Lovastatin	Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein	16367743
D008148	Lovastatin	Mevalonic Acid inhibits the reaction [Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein]	16367743
C000618691	LQFM030	LQFM030 results in decreased expression of CASP3 mRNA	27350017
C000618691	LQFM030	LQFM030 results in increased activity of CASP3 protein	27350017
C109644	Lu 28-179	Lu 28-179 results in increased activity of CASP3 protein	21092190
C480546	lupane	lupane results in increased activity of CASP3 protein	20026015
C010480	lupeol	lupeol results in increased expression of CASP3 mRNA	30506710
C010480	lupeol	lupeol results in increased expression of CASP3 protein	30506710
D047311	Luteolin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Luteolin results in increased cleavage of CASP3 protein]	27474067
D047311	Luteolin	[Luteolin co-treated with Paclitaxel] results in increased cleavage of CASP3 protein	24525192
D047311	Luteolin	Luteolin promotes the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	16140950
D047311	Luteolin	Luteolin results in increased activity of CASP3 protein	21074525; 21601631; 27489195;
D047311	Luteolin	Luteolin results in increased cleavage of CASP3 protein	18331776; 19397994; 27474067;
D047311	Luteolin	Luteolin inhibits the reaction [Cisplatin results in increased cleavage of and results in increased expression of CASP3 protein]	23770416
D047311	Luteolin	Luteolin results in increased expression of CASP3 protein	31288002
D047311	Luteolin	Luteolin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	27525270
C529813	luteolin-7-O-glucoside	luteolin-7-O-glucoside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	31381935
C094099	LY 293111	LY 293111 results in increased cleavage of CASP3 protein	16151469
C520284	Ly-364947	Ly-364947 inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23542815
D000077276	Lycopene	Lycopene inhibits the reaction [Sodium Fluoride results in increased activity of CASP3 protein]	27871895
D000077276	Lycopene	Lycopene inhibits the reaction [Sodium Fluoride results in increased expression of CASP3 mRNA]	27871895
D000077276	Lycopene	Lycopene inhibits the reaction [Atrazine results in increased expression of CASP3 mRNA]	27102619
D000077276	Lycopene	Lycopene inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	31568845
D000077276	Lycopene	[S-allylcysteine co-treated with Lycopene] inhibits the reaction [[Methylnitronitrosoguanidine co-treated with Sodium Chloride] results in decreased expression of CASP3 protein]	16030430
C032881	lysophosphatidic acid	lysophosphatidic acid analog inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	23251428
C032881	lysophosphatidic acid	lysophosphatidic acid inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	23251428
C008301	lysophosphatidylethanolamine	lysophosphatidylethanolamine analog inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	25125499
C008301	lysophosphatidylethanolamine	lysophosphatidylethanolamine analog inhibits the reaction [Glycochenodeoxycholic Acid results in increased cleavage of CASP3 protein]	25125499
C018091	maduramicin	maduramicin results in increased cleavage of CASP3 protein	29128925
C018091	maduramicin	maduramicin results in increased expression of CASP3 mRNA	29128925
C018091	maduramicin	Acetylcysteine inhibits the reaction [maduramicin results in increased expression of CASP3 protein modified form]	31229567
C018091	maduramicin	JUN gene mutant form inhibits the reaction [maduramicin results in increased expression of CASP3 protein modified form]	31229567
C018091	maduramicin	maduramicin results in increased expression of CASP3 protein modified form	31229567
C018091	maduramicin	PPP5C protein inhibits the reaction [maduramicin results in increased expression of CASP3 protein modified form]	31229567
C048341	mafosfamide	BCL2 inhibits the reaction [mafosfamide results in increased activity of CASP3 protein]	11723234
C048341	mafosfamide	mafosfamide results in increased activity of CASP3 protein	11723234
D015636	Magnesium Chloride	Magnesium Chloride results in increased activity of CASP3 protein	17977900
D008277	Magnesium Oxide	Magnesium Oxide analog inhibits the reaction [Diazinon results in increased activity of CASP3 protein]	27920530
D008277	Magnesium Oxide	Magnesium Oxide analog inhibits the reaction [Diazinon results in increased expression of CASP3 mRNA]	27920530
D008277	Magnesium Oxide	[Selenium analog co-treated with Magnesium Oxide analog] inhibits the reaction [Diazinon results in increased expression of CASP3 mRNA]	27920530
C420242	magnesium tanshinoate B	magnesium tanshinoate B affects the activity of CASP3 protein	18066107
D058185	Magnetite Nanoparticles	[Arsenic Trioxide co-treated with Doxorubicin co-treated with Magnetite Nanoparticles analog] affects the expression of CASP3 mRNA	24738333
D058185	Magnetite Nanoparticles	[Arsenic Trioxide co-treated with Doxorubicin co-treated with Magnetite Nanoparticles analog] affects the expression of CASP3 protein	24738333
D058185	Magnetite Nanoparticles	bromotetrandrine promotes the reaction [[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 mRNA]	19421372
D058185	Magnetite Nanoparticles	[Daunorubicin co-treated with bromotetrandrine co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 mRNA	21720514
D058185	Magnetite Nanoparticles	[Daunorubicin co-treated with bromotetrandrine co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 protein	21720514
D058185	Magnetite Nanoparticles	[Daunorubicin co-treated with Magnetite Nanoparticles] results in increased expression of CASP3 mRNA	19918366
D058185	Magnetite Nanoparticles	[Magnetite Nanoparticles co-treated with Daunorubicin] promotes the reaction [bromotetrandrine results in increased expression of CASP3 protein]	19421372
D058185	Magnetite Nanoparticles	[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 mRNA	19421372
D058185	Magnetite Nanoparticles	[Magnetite Nanoparticles co-treated with Daunorubicin] results in increased expression of CASP3 protein	19421372
D058185	Magnetite Nanoparticles	Magnetite Nanoparticles promotes the reaction [[bromotetrandrine co-treated with Daunorubicin] results in increased expression of CASP3 mRNA]	19421372
C005498	magnolol	magnolol inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]	26756313
C465290	mahanine	mahanine results in increased cleavage of CASP3 protein	30468732
D008294	Malathion	Acetylcysteine inhibits the reaction [Malathion results in increased cleavage of CASP3 protein]	30769050
D008294	Malathion	Malathion results in increased cleavage of CASP3 protein	30769050
D008294	Malathion	Malathion results in increased activity of CASP3 protein	12505448
D008294	Malathion	Malathion results in increased expression of CASP3 mRNA	19815060; 21628957;
D008294	Malathion	[Vitamin E co-treated with Selenium] inhibits the reaction [Malathion results in increased expression of CASP3 mRNA]	21628957
C569869	malondialdehyde-low density lipoprotein, human	gossypetin inhibits the reaction [malondialdehyde-low density lipoprotein, human results in increased cleavage of CASP3 protein]	25622137
C569869	malondialdehyde-low density lipoprotein, human	malondialdehyde-low density lipoprotein, human results in increased cleavage of CASP3 protein	25622137
C030290	malonic acid	malonic acid inhibits the reaction [chelerythrine results in increased activity of CASP3 protein]	21664962
C524754	maltolyl p-coumarate	maltolyl p-coumarate inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]	17600377
C065861	malvidin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [malvidin results in increased activity of CASP3 protein]	15964118
C065861	malvidin	malvidin results in increased activity of CASP3 protein	15964118
C065861	malvidin	SB 203580 inhibits the reaction [malvidin results in increased activity of CASP3 protein]	15964118
C013099	mancozeb	mancozeb results in increased activity of CASP3 protein	22824503
C013099	mancozeb	mancozeb results in increased cleavage of and results in increased activity of CASP3 protein	22289270
C013099	mancozeb	Acetylcysteine inhibits the reaction [mancozeb results in increased cleavage of CASP3 protein]	30037311
C013099	mancozeb	mancozeb results in increased cleavage of CASP3 protein	30037311
D008344	Maneb	Maneb results in increased activity of CASP3 protein	22824503
D008345	Manganese	Manganese results in increased activity of CASP3 protein	22841634
D008345	Manganese	SNCA protein inhibits the reaction [Manganese results in increased activity of CASP3 protein]	25416158
D008345	Manganese	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Manganese results in increased activity of CASP3 protein]	21985864
D008345	Manganese	Deferoxamine inhibits the reaction [Manganese results in increased activity of CASP3 protein]	11933051
D008345	Manganese	Ethanol promotes the reaction [[manganese chloride results in increased abundance of Manganese] which results in increased expression of CASP3 protein]	30844427
D008345	Manganese	[manganese chloride results in increased abundance of Manganese] promotes the reaction [Ethanol results in increased expression of CASP3 protein]	30844427
D008345	Manganese	[manganese chloride results in increased abundance of Manganese] which results in increased cleavage of CASP3 protein	30991096
D008345	Manganese	[manganese chloride results in increased abundance of Manganese] which results in increased expression of CASP3 protein	30844427
D008345	Manganese	Manganese promotes the reaction [SP1 protein modified form binds to CASP3 promoter]	22975163
D008345	Manganese	Manganese results in increased activity of CASP3 protein	11933051; 21985864; 22427945; 25027559; 25416158;
D008345	Manganese	Manganese results in increased cleavage of CASP3 protein	16787641
D008345	Manganese	Manganese results in increased expression of and results in increased cleavage of CASP3 protein	22975163
D008345	Manganese	Manganese results in increased expression of CASP3 mRNA	16787641; 22975163;
D008345	Manganese	Manganese results in increased expression of CASP3 protein	16787641
D008345	Manganese	pyrazolanthrone inhibits the reaction [Manganese results in increased cleavage of CASP3 protein]	16787641
D008345	Manganese	pyrazolanthrone inhibits the reaction [Manganese results in increased expression of CASP3 protein]	16787641
D008345	Manganese	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [Manganese results in increased activity of CASP3 protein]	21985864
D008345	Manganese	rhodioloside inhibits the reaction [[manganese chloride results in increased abundance of Manganese] which results in increased cleavage of CASP3 protein]	30991096
D008345	Manganese	U 0126 inhibits the reaction [Manganese results in increased expression of CASP3 mRNA]	16787641
D008345	Manganese	U 0126 inhibits the reaction [Manganese results in increased expression of CASP3 protein]	16787641
D008345	Manganese	Manganese affects the reaction [CASP3 protein results in increased hydrolysis of and results in increased activity of PRKCD protein]	21310168
C025340	manganese chloride	Deferoxamine promotes the reaction [manganese chloride results in increased activity of CASP3 protein]	23764342
C025340	manganese chloride	manganese chloride results in increased activity of CASP3 protein	19815061; 23764342;
C025340	manganese chloride	manganese chloride results in increased cleavage of CASP3 protein	18178165
C025340	manganese chloride	manganese chloride results in increased methylation of CASP3 gene	27913844
C025340	manganese chloride	SNCA protein inhibits the reaction [manganese chloride results in increased activity of CASP3 protein]	25416158
C025340	manganese chloride	manganese chloride results in increased activity of CASP3 protein	17483122
C025340	manganese chloride	manganese chloride results in increased expression of CASP3 protein	26064043
C025340	manganese chloride	Plant Extracts inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	26064043
C025340	manganese chloride	PRNP protein inhibits the reaction [manganese chloride results in increased activity of CASP3 protein]	17483122
C025340	manganese chloride	Acetylcysteine inhibits the reaction [manganese chloride results in increased expression of CASP3 protein modified form]	28778520
C025340	manganese chloride	bafilomycin A1 inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	28378122
C025340	manganese chloride	CA 074 methyl ester inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	28378122
C025340	manganese chloride	Ethanol promotes the reaction [[manganese chloride results in increased abundance of Manganese] which results in increased expression of CASP3 protein]	30844427
C025340	manganese chloride	Lithium Chloride inhibits the reaction [manganese chloride results in increased activity of CASP3 protein]	24464479
C025340	manganese chloride	[manganese chloride results in increased abundance of Manganese] promotes the reaction [Ethanol results in increased expression of CASP3 protein]	30844427
C025340	manganese chloride	[manganese chloride results in increased abundance of Manganese] which results in increased cleavage of CASP3 protein	30991096
C025340	manganese chloride	[manganese chloride results in increased abundance of Manganese] which results in increased expression of CASP3 protein	30844427
C025340	manganese chloride	manganese chloride results in increased activity of CASP3 protein	24464479; 25416158; 28040552;
C025340	manganese chloride	manganese chloride results in increased cleavage of CASP3 protein	16787641; 25732873; 28378122;
C025340	manganese chloride	manganese chloride results in increased expression of CASP3 mRNA	16787641
C025340	manganese chloride	manganese chloride results in increased expression of CASP3 protein	16787641
C025340	manganese chloride	manganese chloride results in increased expression of CASP3 protein modified form	28778520
C025340	manganese chloride	pepstatin inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	28378122
C025340	manganese chloride	pyrazolanthrone inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	16787641
C025340	manganese chloride	pyrazolanthrone inhibits the reaction [manganese chloride results in increased expression of CASP3 protein]	16787641
C025340	manganese chloride	Quercetin inhibits the reaction [manganese chloride results in increased activity of CASP3 protein]	28040552
C025340	manganese chloride	rhodioloside inhibits the reaction [[manganese chloride results in increased abundance of Manganese] which results in increased cleavage of CASP3 protein]	30991096
C025340	manganese chloride	U 0126 inhibits the reaction [manganese chloride results in increased expression of CASP3 mRNA]	16787641
C025340	manganese chloride	U 0126 inhibits the reaction [manganese chloride results in increased expression of CASP3 protein]	16787641
D017895	Manganese Compounds	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Manganese Compounds results in increased cleavage of and results in increased activity of CASP3 protein]	21856324
D017895	Manganese Compounds	Manganese Compounds results in increased cleavage of and results in increased activity of CASP3 protein	21856324
C431023	manganese (III) meso-tetrakis(N-ethylpyridinium-2-yl)porphyrin	manganese (III) meso-tetrakis(N-ethylpyridinium-2-yl)porphyrin results in decreased expression of CASP3 protein modified form	20584581
C097284	manganese(III)-tetrakis(4-benzoic acid)porphyrin	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
C097284	manganese(III)-tetrakis(4-benzoic acid)porphyrin	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Glucose results in increased expression of CASP3 protein]	18088078
C097284	manganese(III)-tetrakis(4-benzoic acid)porphyrin	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [melamine results in increased cleavage of CASP3 protein]	22915474
C097284	manganese(III)-tetrakis(4-benzoic acid)porphyrin	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [[XCT790 results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein]	19464277
C097284	manganese(III)-tetrakis(4-benzoic acid)porphyrin	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	11343246
C097284	manganese(III)-tetrakis(4-benzoic acid)porphyrin	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	21846476
C013592	mangiferin	mangiferin results in increased activity of CASP3 protein	21547680; 26996543;
C013592	mangiferin	mangiferin inhibits the reaction [lead nitrate results in increased expression of CASP3 protein]	23451106
C013592	mangiferin	mangiferin inhibits the reaction [Galactosamine results in increased expression of CASP3 protein]	22118634; 22310181;
C021053	mangostin	mangostin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	26357513
D008353	Mannitol	IGF1 inhibits the reaction [Mannitol results in increased activity of CASP3 protein]	10567913
D008353	Mannitol	Mannitol inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
D008353	Mannitol	Mannitol results in increased activity of CASP3 protein	10567913; 12011046;
C054474	manumycin	Acetylcysteine inhibits the reaction [manumycin results in increased activity of CASP3]	19409983
C054474	manumycin	manumycin results in increased activity of CASP3	19409983
C054474	manumycin	[Quercetin co-treated with manumycin] results in decreased expression of CASP3 protein	14625852
D008376	Maprotiline	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Maprotiline results in increased activity of CASP3 protein]	23219590
D008376	Maprotiline	Maprotiline results in increased activity of CASP3 protein	23219590
D009637	Masoprocol	[Masoprocol co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	17645780
D009637	Masoprocol	Masoprocol results in increased activity of CASP3 protein	11470254; 15034932;
D009637	Masoprocol	Masoprocol results in increased cleavage of CASP3 protein	18645000; 19503098;
D009637	Masoprocol	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Masoprocol results in increased activity of CASP3 protein]	10653524
D009637	Masoprocol	Masoprocol inhibits the reaction [FASL protein results in increased activity of CASP3 protein]	10203695
D009637	Masoprocol	Masoprocol results in increased activity of CASP3 protein	10653524
D009637	Masoprocol	Masoprocol inhibits the reaction [pentaacetyl geniposide results in increased cleavage of and results in increased activity of CASP3 protein]	17651887
D009637	Masoprocol	Masoprocol inhibits the reaction [pentaacetyl geniposide results in increased expression of CASP3 protein]	17651887
D009637	Masoprocol	Masoprocol inhibits the reaction [[TNF protein co-treated with Cycloheximide] results in increased activity of CASP3 protein]	15950244
C034244	matrine	Arsenic Trioxide promotes the reaction [matrine results in increased cleavage of CASP3 protein]	23700110
C034244	matrine	BCL9 protein inhibits the reaction [matrine results in increased cleavage of CASP3 protein]	31112718
C034244	matrine	matrine promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	23700110
C034244	matrine	matrine results in increased cleavage of CASP3 protein	23700110; 31112718;
C577554	MC1568	MC1568 inhibits the reaction [entinostat results in increased activity of CASP3 protein]	25068794
C577554	MC1568	MC1568 inhibits the reaction [Thimerosal results in increased cleavage of and results in increased activity of CASP3 protein]	27660204
C057383	MDL 201053	MDL 201053 inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	30030080
C057383	MDL 201053	MDL 201053 inhibits the reaction [Oxidopamine results in increased expression of CASP3 protein modified form]	28802652
D008464	Mecamylamine	Mecamylamine affects the reaction [Nicotine inhibits the reaction [APP protein results in increased activity of CASP3 protein]]	14757701
D008466	Mechlorethamine	ebselen inhibits the reaction [Mechlorethamine results in increased activity of CASP3 protein]	23649643
D008466	Mechlorethamine	Mechlorethamine results in increased activity of CASP3 protein	23649643
C019476	mecobalamin	mecobalamin inhibits the reaction [Homocysteine results in increased activity of CASP3 protein]	21237187
D017258	Medroxyprogesterone Acetate	[Estrogens, Conjugated (USP) co-treated with Medroxyprogesterone Acetate] results in decreased expression of CASP3 protein	16021059
D000077485	Meglumine Antimoniate	Meglumine Antimoniate results in increased expression of CASP3 mRNA	30599190
C011907	melamine	1,2-Dihydroxybenzene-3,5-Disulfonic Acid Disodium Salt inhibits the reaction [melamine results in increased cleavage of CASP3 protein]	22915474
C011907	melamine	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [melamine results in increased cleavage of CASP3 protein]	22915474
C011907	melamine	melamine results in increased cleavage of CASP3 protein	22915474
C011907	melamine	TGFB1 protein affects the reaction [melamine results in increased cleavage of CASP3 protein]	22915474
D008549	Melarsoprol	Melarsoprol results in increased activity of CASP3 protein	15314284
D008550	Melatonin	Melatonin analog results in decreased expression of CASP3 mRNA	27233482
D008550	Melatonin	Melatonin results in decreased expression of CASP3 mRNA	27233482
D008550	Melatonin	[Doxorubicin co-treated with Melatonin] results in increased expression of CASP3 protein	20333787
D008550	Melatonin	[essential 303 forte co-treated with Silymarin co-treated with Melatonin analog] affects the activity of CASP3 protein	25903262
D008550	Melatonin	Melatonin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	30404999
D008550	Melatonin	Melatonin inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	12880480
D008550	Melatonin	Melatonin inhibits the reaction [N-Formylmethionine Leucyl-Phenylalanine results in increased activity of CASP3 protein]	20130848
D008550	Melatonin	Melatonin inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	20130848
D008550	Melatonin	Melatonin promotes the reaction [flavone results in increased activity of CASP3 protein]	15800915
D008550	Melatonin	Melatonin promotes the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	21431366
D008550	Melatonin	Melatonin promotes the reaction [Puromycin results in increased activity of CASP3 protein]	21244482
D008550	Melatonin	Melatonin results in increased activity of CASP3 protein	16879318; 19012662; 19552762;
D008550	Melatonin	Melatonin inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein]	17602819
D008550	Melatonin	Melatonin inhibits the reaction [S-Nitroso-N-Acetylpenicillamine results in increased activity of CASP3 protein]	12220328
D008550	Melatonin	Melatonin inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	29763682
D008550	Melatonin	Melatonin results in decreased activity of CASP3 protein	17910606
D008550	Melatonin	Melatonin inhibits the reaction [bisphenol A results in increased activity of CASP3 protein]	25454643
D008550	Melatonin	Melatonin inhibits the reaction [[Dietary Fats co-treated with Ethanol] results in increased expression of CASP3 mRNA]	30372842
D008550	Melatonin	Melatonin inhibits the reaction [Dietary Fats results in increased expression of CASP3 mRNA]	30372842
D008550	Melatonin	Melatonin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	29966675
D008550	Melatonin	Melatonin inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	30372842
D008550	Melatonin	Melatonin inhibits the reaction [Gentamicins results in increased cleavage of CASP3 protein]	22526374
D008550	Melatonin	Melatonin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15683462
D008550	Melatonin	Melatonin inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	19220725
D008550	Melatonin	Melatonin inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	17645694; 18715270;
D008550	Melatonin	Melatonin results in decreased activity of CASP3 protein	18571630
D008550	Melatonin	Melatonin results in decreased expression of CASP3 protein	15964511
D008550	Melatonin	Melatonin inhibits the reaction [APP protein results in increased activity of CASP3 protein]	15854745
D008550	Melatonin	Melatonin inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
D008555	Melitten	Melitten analog results in increased expression of CASP3 mRNA	29387245
D008555	Melitten	Melitten analog results in increased expression of CASP3 protein	29387245
D008555	Melitten	Melitten results in increased cleavage of and results in increased activity of CASP3 protein	21456063
D008555	Melitten	Melitten results in increased expression of CASP3 protein modified form	22027265
D008555	Melitten	Melitten inhibits the reaction [TGFB1 protein results in increased cleavage of CASP3 protein]	21871910
D008555	Melitten	Melitten promotes the reaction [[IL6 protein co-treated with IL6R protein] results in increased expression of and results in increased activity of CASP3 protein]	21354845
D008555	Melitten	Melitten promotes the reaction [[IL6 protein co-treated with IL6R protein] results in increased expression of CASP3 mRNA]	21354845
D000077239	Meloxicam	Meloxicam results in increased activity of CASP3 protein	19709125
D000077239	Meloxicam	Meloxicam affects the reaction [Formaldehyde affects the expression of CASP3 protein]	29315975
D000077239	Meloxicam	Meloxicam inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	24799355
D000077239	Meloxicam	[Rutin co-treated with Meloxicam] affects the reaction [Formaldehyde affects the expression of CASP3 protein]	29315975
D000077239	Meloxicam	Meloxicam inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
D008558	Melphalan	Melphalan results in increased activity of CASP3 protein	16951922
D008559	Memantine	Memantine inhibits the reaction [benzo(e)pyrene results in increased activity of CASP3 protein]	19959636
D008559	Memantine	Memantine inhibits the reaction [catechol results in increased activity of CASP3 protein]	20347921
D008559	Memantine	Memantine inhibits the reaction [salsolinol results in increased activity of CASP3 protein]	17996985
D008559	Memantine	Memantine inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	17996985
D008559	Memantine	Memantine inhibits the reaction [Ethanol results in increased expression of and results in increased activity of CASP3 protein]	29800586
D008559	Memantine	Memantine inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	24333387
D008559	Memantine	Memantine inhibits the reaction [Streptozocin results in increased expression of CASP3 mRNA]	24333387
C079335	menadione epoxide	Acetylcysteine inhibits the reaction [menadione epoxide results in increased cleavage of and results in increased activity of CASP3 protein]	21453688
C079335	menadione epoxide	menadione epoxide results in increased cleavage of and results in increased activity of CASP3 protein	21453688
D008610	Menthol	Menthol results in increased activity of CASP3 protein	21472860
D008610	Menthol	Menthol results in increased expression of CASP3 mRNA	26760959
D015122	Mercaptopurine	Mercaptopurine results in increased expression of CASP3 protein	22688000
C042720	mercuric bromide	mercuric bromide results in decreased activity of CASP3 protein	26272509
D008627	Mercuric Chloride	Mercuric Chloride results in increased expression of CASP3 protein	19085830
D008627	Mercuric Chloride	Mercuric Chloride inhibits the reaction [FAS affects the activity of CASP3 protein]	15585371
D008627	Mercuric Chloride	Mercuric Chloride results in decreased activity of CASP3 protein	15585371; 26272509;
D008627	Mercuric Chloride	Mercuric Chloride results in decreased expression of CASP3 mRNA	16273840
D008627	Mercuric Chloride	Mercuric Chloride results in increased activity of CASP3 protein	12504520; 12505371; 15150681; 17363214;
D008627	Mercuric Chloride	Mercuric Chloride results in increased activity of CASP3 protein	20006636
D008627	Mercuric Chloride	Acetylcysteine inhibits the reaction [[Mercuric Chloride co-treated with prolinedithiocarbamate] results in increased degradation of CASP3 protein]	22909951
D008627	Mercuric Chloride	Acetylcysteine inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	15050407
D008627	Mercuric Chloride	GSK3B protein promotes the reaction [Mercuric Chloride results in increased cleavage of CASP3 protein]	22785175
D008627	Mercuric Chloride	[Mercuric Chloride co-treated with prolinedithiocarbamate] results in increased degradation of CASP3 protein	22909951
D008627	Mercuric Chloride	Mercuric Chloride results in increased activity of CASP3 protein	15050407
D008627	Mercuric Chloride	Mercuric Chloride results in increased cleavage of CASP3 protein	22785175
D008627	Mercuric Chloride	Mercuric Chloride results in increased expression of CASP3 mRNA	23202902
D008627	Mercuric Chloride	Mercuric Chloride results in increased expression of CASP3 protein	21373768
D008627	Mercuric Chloride	SB 203580 inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	15050407
D008627	Mercuric Chloride	Silymarin inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	15050407
D008627	Mercuric Chloride	Berberine inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	25600690
D008627	Mercuric Chloride	Mercuric Chloride inhibits the reaction [Gliotoxin results in increased activity of CASP3 protein]	20958918
D008627	Mercuric Chloride	Mercuric Chloride inhibits the reaction [S-nitro-N-acetylpenicillamine inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]]	15623433
D008627	Mercuric Chloride	Mercuric Chloride results in increased activity of CASP3 protein	25600690
D008628	Mercury	Mercury results in increased activity of CASP3 protein	16823075
D008628	Mercury	Mercury results in increased expression of CASP3 protein	21186712
D019804	Mesalamine	Mesalamine inhibits the reaction [Acetic Acid results in increased expression of CASP3 mRNA]	29518435
D019804	Mesalamine	Mesalamine inhibits the reaction [Thioacetamide affects the expression of CASP3 protein]	29738702
C527236	metacept-1	[metacept-1 co-treated with Azacitidine] results in increased expression of CASP3	19148494
C527236	metacept-1	metacept-1 results in increased expression of CASP3	19148494
D008687	Metformin	Cisplatin promotes the reaction [Metformin results in increased activity of CASP3 protein]	21388661
D008687	Metformin	[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA	29117515
D008687	Metformin	Metformin inhibits the reaction [Sunitinib results in increased cleavage of CASP3 protein]	21906609
D008687	Metformin	Metformin results in decreased activity of CASP3 protein	15531508
D008687	Metformin	Metformin results in increased activity of CASP3 protein	21388661
D008687	Metformin	Metformin results in increased expression of CASP3 mRNA	29117515
D008687	Metformin	Sodium Salicylate promotes the reaction [[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA]	29117515
D008687	Metformin	Sodium Salicylate promotes the reaction [Metformin results in increased expression of CASP3 mRNA]	29117515
D008687	Metformin	triciribine promotes the reaction [[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA]	29117515
D008687	Metformin	Deoxyglucose promotes the reaction [Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]]	29095437
D008687	Metformin	Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	29095437
D008687	Metformin	Metformin inhibits the reaction [Dietary Fats results in increased expression of and results in increased cleavage of CASP3 protein]	27551045
D008687	Metformin	Metformin inhibits the reaction [Glucose results in increased activity of CASP3 protein]	30144576
D008694	Methamphetamine	ATF4 protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	27323860
D008694	Methamphetamine	ATF6 protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	27323860
D008694	Methamphetamine	BBC3 protein affects the reaction [Methamphetamine results in decreased cleavage of CASP3 protein]	26524635
D008694	Methamphetamine	DDIT3 protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	27323860
D008694	Methamphetamine	EIF2AK3 protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	27323860
D008694	Methamphetamine	ERN1 protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	27323860
D008694	Methamphetamine	ginsenoside Re inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	25523949
D008694	Methamphetamine	Methamphetamine results in decreased cleavage of CASP3 protein	26524635
D008694	Methamphetamine	Methamphetamine results in increased cleavage of CASP3 protein	25523949; 31059759;
D008694	Methamphetamine	Methamphetamine results in increased expression of and results in increased cleavage of CASP3 protein	27323860
D008694	Methamphetamine	PRKCD protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	25523949
D008694	Methamphetamine	RELA protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	27323860
D008694	Methamphetamine	SNCA protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	31059759
D008694	Methamphetamine	3-((3,5-bis(trifluoromethyl)phenyl)methyloxy)-2-phenylpiperidine inhibits the reaction [norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]]	29467000
D008694	Methamphetamine	ginsenoside Re inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	29467000
D008694	Methamphetamine	ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]	29467000
D008694	Methamphetamine	JUN protein affects the reaction [Methamphetamine results in increased activity of CASP3 protein]	12391261
D008694	Methamphetamine	Methamphetamine affects the cleavage of CASP3 protein	23933405
D008694	Methamphetamine	[Methamphetamine co-treated with tin protoporphyrin IX] results in increased cleavage of CASP3 protein	23933405
D008694	Methamphetamine	Methamphetamine results in increased activity of CASP3 protein	12391261
D008694	Methamphetamine	Methamphetamine results in increased cleavage of CASP3 protein	29467000
D008694	Methamphetamine	norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]	29467000
D008694	Methamphetamine	PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	29467000
D008694	Methamphetamine	CASP4 protein alternative form affects the reaction [Methamphetamine results in increased cleavage of and results in increased activity of CASP3 protein]	25631491
D008694	Methamphetamine	CEBPB protein affects the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	31059759
D008694	Methamphetamine	DDIT4 protein promotes the reaction [Methamphetamine results in increased expression of CASP3 protein modified form]	26825372
D008694	Methamphetamine	diadenosine tetraphosphate inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	19442829
D008694	Methamphetamine	IGFBP5 mutant form inhibits the reaction [Methamphetamine results in increased activity of CASP3 protein]	25127757
D008694	Methamphetamine	KN 93 inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	26923100
D008694	Methamphetamine	Lactulose inhibits the reaction [Methamphetamine results in increased expression of CASP3 protein modified form]	30450033
D008694	Methamphetamine	Methamphetamine results in increased activity of CASP3 protein	25127757
D008694	Methamphetamine	Methamphetamine results in increased cleavage of and results in increased activity of CASP3 protein	25631491
D008694	Methamphetamine	Methamphetamine results in increased cleavage of CASP3 protein	19442829; 26923100; 31059759;
D008694	Methamphetamine	Methamphetamine results in increased expression of CASP3 mRNA	19149911
D008694	Methamphetamine	Methamphetamine results in increased expression of CASP3 protein modified form	26825372; 28341135; 30450033;
D008694	Methamphetamine	Nifedipine inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	26923100
D008694	Methamphetamine	W 7 inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	26923100
D008694	Methamphetamine	wedelolactone inhibits the reaction [Methamphetamine results in increased cleavage of and results in increased activity of CASP3 protein]	25631491
D008694	Methamphetamine	Methamphetamine results in increased activity of CASP3 protein	12050851
D008701	Methapyrilene	Methapyrilene results in increased activity of CASP3 protein	19523481
D008701	Methapyrilene	Methapyrilene results in increased cleavage of CASP3 protein	26558467
D008701	Methapyrilene	Methapyrilene results in increased expression of CASP3 mRNA	30467583
D008713	Methimazole	Methimazole inhibits the reaction [IGF1 protein results in decreased expression of CASP3 mRNA]	29990518
D008713	Methimazole	Methimazole results in increased expression of CASP3 mRNA	29990518
D008713	Methimazole	Methimazole results in increased cleavage of and results in increased activity of CASP3 protein	17171702
D008713	Methimazole	Methimazole results in increased expression of CASP3 mRNA	17403546
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of CASP3 mRNA	20938992
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency] results in increased expression of CASP3 protein modified form	28100771
D008715	Methionine	geraniol inhibits the reaction [[Methionine deficiency co-treated with Choline deficiency] results in increased activity of CASP3 protein]	26695085
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency] results in increased activity of CASP3 protein	26695085
D008727	Methotrexate	Aspirin inhibits the reaction [Methotrexate results in decreased expression of CASP3 protein]	23799623
D008727	Methotrexate	[Methotrexate co-treated with [Ferrosoferric Oxide binds to polylactide-polyethylene glycol-polylactide]] results in increased expression of CASP3 mRNA	24935781
D008727	Methotrexate	[Methotrexate co-treated with [Ferrosoferric Oxide binds to polylactide-polyethylene glycol-polylactide]] results in increased expression of CASP3 protein modified form	24935781
D008727	Methotrexate	Methotrexate results in decreased expression of CASP3 protein	23799623
D008727	Methotrexate	Methotrexate results in increased cleavage of CASP3 protein	18483502
D008727	Methotrexate	Methotrexate results in increased expression of CASP3 mRNA	24935781; 25330300;
D008727	Methotrexate	Methotrexate results in increased expression of CASP3 protein	25330300
D008727	Methotrexate	Methotrexate results in increased expression of CASP3 protein modified form	24935781
D008727	Methotrexate	SOD2 protein polymorphism affects the reaction [Methotrexate results in increased expression of CASP3 mRNA]	25330300
D008727	Methotrexate	SOD2 protein polymorphism affects the reaction [Methotrexate results in increased expression of CASP3 protein]	25330300
D008727	Methotrexate	Methotrexate results in increased cleavage of CASP3 protein	23836430
D008727	Methotrexate	Methotrexate results in increased expression of CASP3 mRNA	23836430
D008727	Methotrexate	[Aspartame co-treated with Methotrexate] results in increased expression of CASP3 mRNA	25009784
D008727	Methotrexate	[Aspartame co-treated with Methotrexate] results in increased expression of CASP3 protein modified form	25009784
D008727	Methotrexate	Chlorogenic Acid inhibits the reaction [Methotrexate results in increased activity of CASP3 protein]	28479099
D008727	Methotrexate	DHFR protein inhibits the reaction [Methotrexate results in decreased expression of CASP3 protein]	30502384
D008727	Methotrexate	Folic Acid inhibits the reaction [Methotrexate results in decreased expression of CASP3 protein]	30502384
D008727	Methotrexate	Methotrexate inhibits the reaction [Freund's Adjuvant results in increased expression of CASP3 protein]	30025850
D008727	Methotrexate	Methotrexate results in decreased expression of CASP3 protein	30502384
D008727	Methotrexate	Methotrexate results in increased activity of CASP3 protein	28479099
D008727	Methotrexate	Methotrexate results in increased expression of CASP3 protein modified form	23406595
D008730	Methoxsalen	BHLHE40 protein inhibits the reaction [Methoxsalen results in increased activity of and results in decreased expression of CASP3 protein]	22796345
D008730	Methoxsalen	Methoxsalen inhibits the reaction [Aflatoxin B1 results in increased cleavage of CASP3 protein]	22743290
D008730	Methoxsalen	Methoxsalen inhibits the reaction [aflatoxin G1 results in increased expression of CASP3 protein modified form]	23907605
D008730	Methoxsalen	Methoxsalen results in decreased expression of and results in increased activity of CASP3 protein	22796345
C013598	methoxyacetic acid	methoxyacetic acid results in increased activity of CASP3 protein	16829022
C013598	methoxyacetic acid	[1-aminomethylphosphonic acid co-treated with methoxyacetic acid] results in increased cleavage of and results in increased activity of CASP3 protein	26006246
C013598	methoxyacetic acid	methoxyacetic acid results in increased activity of CASP3 protein	12220648
D008731	Methoxychlor	ESR1 gene mutant form promotes the reaction [Methoxychlor results in increased activity of CASP3 protein]	22306526
D008731	Methoxychlor	[ESR1 gene mutant form results in increased susceptibility to Methoxychlor] which results in decreased expression of CASP3 protein	22306526
D008731	Methoxychlor	Methoxychlor affects the expression of CASP3 mRNA	20829426
D008731	Methoxychlor	Methoxychlor results in decreased expression of CASP3 mRNA	23000595
D008731	Methoxychlor	Methoxychlor results in increased activity of CASP3 protein	20568958; 22306526;
D008731	Methoxychlor	Methoxychlor results in increased expression of CASP3 protein modified form	20829426
D008731	Methoxychlor	Methoxychlor results in increased expression of CASP3 protein	20227399
D008731	Methoxychlor	Methoxychlor results in increased expression of CASP3 protein modified form	20227399
C587228	methyl 3-hydroxyimino-11-oxoolean-12-en-28-oate	methyl 3-hydroxyimino-11-oxoolean-12-en-28-oate results in increased activity of CASP3 protein	24291674
C555027	methyl 5-chloro-4,5-didehydrojasmonate	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [methyl 5-chloro-4,5-didehydrojasmonate results in increased activity of CASP3 protein]	20696234
C555027	methyl 5-chloro-4,5-didehydrojasmonate	methyl 5-chloro-4,5-didehydrojasmonate results in increased activity of and results in increased cleavage of CASP3 protein	20696234
C553655	methyl antcinate A	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to methyl antcinate A	20557081
C553655	methyl antcinate A	methyl antcinate A results in increased activity of CASP3 protein	20557081
C108732	methyl-beta-cyclodextrin	methyl-beta-cyclodextrin inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
C108732	methyl-beta-cyclodextrin	methyl-beta-cyclodextrin inhibits the reaction [1-nitropyrene results in increased activity of CASP3 protein]	21872649
C108732	methyl-beta-cyclodextrin	methyl-beta-cyclodextrin inhibits the reaction [Cholesterol results in increased activity of CASP3 protein]	21872649
C042405	methyl caffeate	methyl caffeate results in increased activity of CASP3 protein	26415618
C005219	methyl cellosolve	methyl cellosolve metabolite results in increased activity of CASP3 protein	12502240
D008748	Methylcholanthrene	Methylcholanthrene results in increased expression of CASP3 mRNA	20713471
D008748	Methylcholanthrene	Methylcholanthrene inhibits the reaction [3-amino-1,4-dimethyl-5H-pyrido(4,3-b)indole results in increased cleavage of and results in increased activity of CASP3 protein]	11999409
D008748	Methylcholanthrene	Methylcholanthrene results in increased expression of CASP3 mRNA	11323195
D008752	Methylene Chloride	[Methylene Chloride co-treated with Biliverdine] inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
D008752	Methylene Chloride	Methylene Chloride inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased activity of CASP3 protein]	15486963
C005223	methyleugenol	methyleugenol results in increased activity of CASP3 protein	28818686
C005223	methyleugenol	methyleugenol results in increased cleavage of CASP3 protein	26011634
C000614724	methyleugenol-2',3'-epoxide	methyleugenol-2',3'-epoxide results in increased activity of CASP3 protein	28818686
C072239	methyl jasmonate	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] inhibits the reaction [methyl jasmonate metabolite results in increased susceptibility to TNFSF10 protein]	22079975
C072239	methyl jasmonate	methyl jasmonate metabolite promotes the reaction [TNFSF10 protein results in decreased expression of CASP3 protein]	22079975
C072239	methyl jasmonate	methyl jasmonate metabolite promotes the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	22079975
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of CASP3 mRNA	27041665
C004925	methylmercuric chloride	methylmercuric chloride results in decreased activity of CASP3 protein	26272509
C004925	methylmercuric chloride	Acetylcysteine inhibits the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
C004925	methylmercuric chloride	AKT1 protein mutant form inhibits the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
C004925	methylmercuric chloride	ATG5 promotes the reaction [methylmercuric chloride results in increased cleavage of CASP3 protein]	27667695
C004925	methylmercuric chloride	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [methylmercuric chloride results in increased activity of CASP3 protein]	31330229
C004925	methylmercuric chloride	DDIT3 protein promotes the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
C004925	methylmercuric chloride	HSP90B1 protein promotes the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
C004925	methylmercuric chloride	HSPA5 protein promotes the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
C004925	methylmercuric chloride	methylmercuric chloride results in increased activity of CASP3 protein	27178136; 31330229;
C004925	methylmercuric chloride	methylmercuric chloride results in increased cleavage of CASP3 protein	27667695
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of CASP3 mRNA	23202902
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of CASP3 protein modified form	31330229
C004925	methylmercuric chloride	XBP1 protein promotes the reaction [methylmercuric chloride results in increased expression of CASP3 protein modified form]	31330229
C004925	methylmercuric chloride	methylmercuric chloride results in increased activity of CASP3 protein	17760861
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of CASP3 protein modified form	28821999
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased activity of CASP3 protein	15150681; 18597911; 20153410;
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased cleavage of CASP3 protein	26610923
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased expression of CASP3 protein	31400064
D008767	Methylmercury Compounds	Acetylcysteine inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	16918248
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased activity of CASP3 protein	16918248
D008767	Methylmercury Compounds	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21549813
D008767	Methylmercury Compounds	Acetylcysteine inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21549813
D008767	Methylmercury Compounds	Acetylcysteine inhibits the reaction [Methylmercury Compounds results in increased expression of CASP3 mRNA]	21549813
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased activity of CASP3 protein	21549813; 22634143;
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased cleavage of CASP3 protein	21549813
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased expression of CASP3 mRNA	20153410; 21549813;
D008767	Methylmercury Compounds	SB 203580 inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21549813
D008767	Methylmercury Compounds	ebselen inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21300091
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased activity of CASP3 protein	21300091; 25545984;
C030957	methylmercury II	[Benzene co-treated with methylmercury II co-treated with Trichloroethylene] results in increased expression of CASP3 mRNA	17905399
D008741	Methyl Methanesulfonate	Methyl Methanesulfonate results in increased activity of CASP3 protein	16019050
D008769	Methylnitronitrosoguanidine	Methylnitronitrosoguanidine results in increased activity of CASP3 protein	15589979
D008769	Methylnitronitrosoguanidine	Eugenol inhibits the reaction [Methylnitronitrosoguanidine results in decreased expression of CASP3 mRNA]	20434464
D008769	Methylnitronitrosoguanidine	Eugenol inhibits the reaction [Methylnitronitrosoguanidine results in decreased expression of CASP3 protein]	20434464
D008769	Methylnitronitrosoguanidine	Methylnitronitrosoguanidine results in decreased expression of CASP3 mRNA	20434464
D008769	Methylnitronitrosoguanidine	Methylnitronitrosoguanidine results in decreased expression of CASP3 protein	20434464
D008769	Methylnitronitrosoguanidine	Methylnitronitrosoguanidine results in increased activity of CASP3 protein	16019050
D008769	Methylnitronitrosoguanidine	[Methylnitronitrosoguanidine co-treated with Sodium Chloride] results in decreased expression of CASP3 protein	16030430
D008769	Methylnitronitrosoguanidine	[S-allylcysteine co-treated with Lycopene] inhibits the reaction [[Methylnitronitrosoguanidine co-treated with Sodium Chloride] results in decreased expression of CASP3 protein]	16030430
D008770	Methylnitrosourea	MGMT protein affects the reaction [Methylnitrosourea results in increased activity of CASP3 protein]	13679151
D008770	Methylnitrosourea	MLH1 affects the reaction [MGMT protein affects the reaction [Methylnitrosourea results in increased activity of CASP3 protein]]	13679151
D008770	Methylnitrosourea	[Estradiol co-treated with Progesterone co-treated with Methylnitrosourea] results in decreased activity of CASP3 protein	22465879
D008770	Methylnitrosourea	[Methylnitrosourea co-treated with Estradiol] results in decreased expression of CASP3 mRNA	20732338
D008770	Methylnitrosourea	[Methylnitrosourea co-treated with Progesterone co-treated with Estradiol] results in decreased expression of CASP3 mRNA	20732338
D008770	Methylnitrosourea	[Methylnitrosourea co-treated with Progesterone] results in decreased expression of CASP3 mRNA	20732338
C400939	methylone	methylone results in increased activity of CASP3 protein	27255387
D008775	Methylprednisolone	Methylprednisolone inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	17570061
C425324	methyl protodioscin	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [methyl protodioscin results in increased expression of CASP3 protein]	31271762
C425324	methyl protodioscin	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [methyl protodioscin results in increased expression of CASP3 protein]	31271762
C425324	methyl protodioscin	methyl protodioscin results in increased expression of CASP3 mRNA	31271762
C425324	methyl protodioscin	methyl protodioscin results in increased expression of CASP3 protein	31271762
C008493	methylselenic acid	methylselenic acid results in increased cleavage of CASP3 protein	28161410
C008493	methylselenic acid	methylselenic acid results in increased cleavage of and results in increased activity of CASP3 protein	19276161
D008777	Methyltestosterone	[Gossypol co-treated with Methyltestosterone co-treated with Ethinyl Estradiol] results in increased expression of CASP3 mRNA	15451339
D014290	Metipranolol	Metipranolol inhibits the reaction [Zinc results in increased cleavage of CASP3 protein]	16799065
D014290	Metipranolol	Metipranolol inhibits the reaction [Zinc Sulfate results in increased cleavage of CASP3 protein]	16799065
D008790	Metoprolol	Metoprolol results in increased cleavage of CASP3 protein	19106745
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	16470222
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [cerivastatin results in increased activity of CASP3 protein]	16470222
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Fluvastatin results in increased cleavage of and results in increased activity of CASP3 protein]	24964743
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	16470222; 17428261; 20427495;
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Simvastatin results in increased expression of CASP3 protein]	15949312
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	18339080
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Lovastatin results in increased activity of and results in increased cleavage of CASP3 protein]	16367743
D008798	Mevalonic Acid	Mevalonic Acid inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	16698853
C059539	midostaurin	midostaurin promotes the reaction [Loratadine results in increased activity of CASP3 protein]	20570632
C059539	midostaurin	midostaurin promotes the reaction [Terfenadine results in increased activity of CASP3 protein]	20570632
D015735	Mifepristone	[Etoposide co-treated with Mifepristone] results in increased activity of CASP3 protein	30217652
D015735	Mifepristone	[Mifepristone co-treated with NFE2L2 protein] inhibits the reaction [Paraquat results in increased expression of CASP3 mRNA]	22736252
D015735	Mifepristone	Mifepristone inhibits the reaction [Dexamethasone inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]]	17070682
D015735	Mifepristone	Mifepristone inhibits the reaction [Rifampin inhibits the reaction [FAS protein results in increased activity of CASP3 protein]]	12645856
D015735	Mifepristone	Mifepristone results in decreased expression of CASP3 protein	16525653
D015735	Mifepristone	Mifepristone results in increased activity of CASP3 protein	16525653
D015735	Mifepristone	Mifepristone inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	16644695
D015735	Mifepristone	Mifepristone inhibits the reaction [Corticosterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	15755911; 26915917;
D015735	Mifepristone	Mifepristone inhibits the reaction [Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	20726854; 26915917;
D008898	Mimosine	Mimosine results in increased cleavage of and results in increased activity of CASP3 protein	18058236
D008911	Minocycline	Minocycline results in decreased activity of CASP3 protein	17872917
D008911	Minocycline	Minocycline inhibits the reaction [Kainic Acid results in increased activity of CASP3 protein]	16469440
D008911	Minocycline	Minocycline results in decreased activity of and results in decreased cleavage of CASP3 protein	15564845
D008911	Minocycline	Minocycline results in decreased activity of CASP3 protein	12930891
D008911	Minocycline	Minocycline inhibits the reaction [HTT protein mutant form results in increased activity of CASP3 protein]	12930891
D008911	Minocycline	Minocycline inhibits the reaction [Morphine results in increased activity of CASP3 protein]	20711699
D008911	Minocycline	Minocycline inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	22245251
D008911	Minocycline	Minocycline inhibits the reaction [Sodium Azide results in increased activity of CASP3 protein]	15004018
D008911	Minocycline	Minocycline results in decreased activity of CASP3 protein	14588118; 15304547;
D008911	Minocycline	Minocycline results in decreased expression of and results in decreased activity of CASP3 protein	14998631
D008911	Minocycline	Minocycline results in decreased expression of CASP3 mRNA	14998631
D008911	Minocycline	Minocycline results in decreased activity of CASP3 protein	15159491
C000596409	mirabijalone E	mirabijalone E results in increased cleavage of CASP3 protein	24882730
D016595	Misoprostol	Misoprostol inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	18602972
D016685	Mitomycin	CDKN1A mutant form inhibits the reaction [Chloramphenicol inhibits the reaction [Mitomycin results in increased activity of CASP3 protein]]	15905168
D016685	Mitomycin	Chloramphenicol inhibits the reaction [Mitomycin results in increased activity of CASP3 protein]	15905168
D016685	Mitomycin	[Mitomycin co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	15120327
D016685	Mitomycin	Mitomycin promotes the reaction [CASP3 protein results in increased cleavage of PRKCD protein]	10960761
D016685	Mitomycin	Mitomycin results in increased activity of CASP3 protein	10960761; 15905168; 16186332; 17094455; 17530733; 19834285; 29458164;
D016685	Mitomycin	Mitomycin results in increased cleavage of CASP3 protein	16019139; 17021654;
C019215	mitonafide	mitonafide analog results in increased cleavage of CASP3 protein	19954251
C429015	mitoquinol	[diphenyleneiodonium co-treated with mitoquinol co-treated with mitoquinone] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
C429015	mitoquinol	[mitoquinol co-treated with mitoquinone] inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15799720
C429014	mitoquinone	[diphenyleneiodonium co-treated with mitoquinol co-treated with mitoquinone] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15799720
C429014	mitoquinone	[mitoquinol co-treated with mitoquinone] inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15799720
D008939	Mitotane	Mitotane results in increased activity of CASP3 protein	23254310
D008939	Mitotane	Mitotane results in increased expression of CASP3 mRNA	23485034
C555916	MitoTEMPO	MitoTEMPO inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein]	26435000
D008942	Mitoxantrone	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Mitoxantrone results in increased activity of CASP3 protein]	16215684
D008942	Mitoxantrone	Mitoxantrone results in increased activity of CASP3 protein	16215684
D008942	Mitoxantrone	BCL2L1 protein inhibits the reaction [Mitoxantrone results in increased activity of CASP3 protein]	8840993
D008942	Mitoxantrone	BCL2 protein inhibits the reaction [Mitoxantrone results in increased activity of CASP3 protein]	8840993
D008942	Mitoxantrone	Mitoxantrone results in increased activity of CASP3 protein	12948851; 22700542; 8840993;
D008942	Mitoxantrone	Palmitic Acid promotes the reaction [Mitoxantrone results in increased activity of CASP3 protein]	22700542
C570834	MK0626	MK0626 inhibits the reaction [Tacrolimus results in increased activity of CASP3 protein]	24959755
C548887	MK 2206	[MK 2206 co-treated with platycodin D] results in increased activity of CASP3 protein	27897231
C548887	MK 2206	MK 2206 inhibits the reaction [Soot analog results in increased expression of CASP3 protein]	30240709
C548887	MK 2206	MK 2206 results in increased cleavage of CASP3 protein	22885370
C548887	MK 2206	MK 2206 inhibits the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	30878453
C015765	MK 473	MK 473 inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15482374; 18164246;
C060893	MK-886	MK-886 inhibits the reaction [Nicotine results in decreased expression of CASP3 protein]	20061081
C060893	MK-886	MK-886 inhibits the reaction [aristolochic acid I results in increased cleavage of and results in increased activity of CASP3 protein]	21658425
C070571	ML 7	FADD protein affects the reaction [[ML 7 results in decreased activity of MYLK protein] which results in increased activity of CASP3 protein]	16723733
C070571	ML 7	[ML 7 results in decreased activity of MYLK protein] which results in increased activity of CASP3 protein	16723733
C056218	ML 9	FADD protein affects the reaction [[ML 9 results in decreased activity of MYLK protein] which results in increased activity of CASP3 protein]	16723733
C056218	ML 9	[ML 9 results in decreased activity of MYLK protein] which results in increased activity of CASP3 protein	16723733
C502230	Mn(III) 5,10,15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin	Mn(III) 5,10,15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	30185695
C554645	molibresib	molibresib results in increased activity of CASP3 protein	26911376
D008982	Molybdenum	Molybdenum analog results in increased activity of CASP3 protein	26391003
D008985	Monensin	Lithium inhibits the reaction [Monensin results in increased activity of CASP3 protein]	20799912
D008985	Monensin	Monensin results in increased activity of CASP3 protein	20799912
C016599	mono-(2-ethylhexyl)phthalate	2,2-bis(4-glycidyloxyphenyl)propane inhibits the reaction [PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]]	12927354
C016599	mono-(2-ethylhexyl)phthalate	2-chloro-5-nitrobenzanilide inhibits the reaction [PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]]	12927354
C016599	mono-(2-ethylhexyl)phthalate	mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein	12927354; 23360888; 24706461;
C016599	mono-(2-ethylhexyl)phthalate	mono-(2-ethylhexyl)phthalate results in increased expression of CASP3 protein	19165384
C016599	mono-(2-ethylhexyl)phthalate	PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]	12927354
C016599	mono-(2-ethylhexyl)phthalate	Rosiglitazone promotes the reaction [PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]]	12927354
C016599	mono-(2-ethylhexyl)phthalate	mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein	19720108
C016599	mono-(2-ethylhexyl)phthalate	mono-(2-ethylhexyl)phthalate results in increased cleavage of CASP3 protein	30476341
C028577	monobutyl phthalate	[monobutyl phthalate co-treated with Ginsenosides metabolite] results in increased expression of CASP3 protein modified form	30965081
C028577	monobutyl phthalate	monobutyl phthalate results in increased expression of CASP3 protein modified form	30965081
D016686	Monocrotaline	Fluoxetine inhibits the reaction [Monocrotaline results in decreased expression of CASP3 protein]	21619414
D016686	Monocrotaline	Monocrotaline results in decreased expression of CASP3 protein	21619414
D016686	Monocrotaline	Monocrotaline results in increased expression of CASP3 mRNA	22022327
D016686	Monocrotaline	Simvastatin inhibits the reaction [Monocrotaline results in increased expression of CASP3 mRNA]	22022327
C014114	monocrotaline pyrrole	[LGALS1 protein binds to monocrotaline pyrrole] which results in increased activity of CASP3 protein	20695460
D008999	Monocrotophos	Monocrotophos results in increased expression of CASP3 mRNA	20957986; 21445290; 23833438;
D008999	Monocrotophos	Monocrotophos results in increased expression of CASP3 protein	21445290; 23833438;
D008999	Monocrotophos	Monocrotophos results in increased expression of CASP3 protein modified form	20957986
D008999	Monocrotophos	Resveratrol inhibits the reaction [Monocrotophos results in increased expression of CASP3 mRNA]	23833438
D008999	Monocrotophos	Resveratrol inhibits the reaction [Monocrotophos results in increased expression of CASP3 protein]	23833438
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	18163546; 23376091;
C091888	monoisoamyl-2,3-dimercaptosuccinate	Succimer promotes the reaction [monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	18163546; 23376091;
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	23681673
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	19615344
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate results in decreased expression of CASP3 mRNA	19615344
C091888	monoisoamyl-2,3-dimercaptosuccinate	[Calcium co-treated with Zinc] affects the reaction [monoisoamyl-2,3-dimercaptosuccinate affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	24184500
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [lead acetate promotes the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	23906897
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [lead acetate results in increased expression of CASP3 mRNA]	23906897
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite promotes the reaction [lead acetate results in increased expression of CASP3 mRNA]]	23906897
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	21513725
C091888	monoisoamyl-2,3-dimercaptosuccinate	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	23906897
C020300	monomethylarsonic acid	[sodium arsenite co-treated with monomethylarsonic acid co-treated with Cacodylic Acid] affects the expression of CASP3 mRNA	23192986
C020300	monomethylarsonic acid	CASP3 protein affects the susceptibility to monomethylarsonic acid	15963344
C020300	monomethylarsonic acid	[monomethylarsonic acid co-treated with Buthionine Sulfoximine] results in increased activity of CASP3 protein	15963344
C020300	monomethylarsonic acid	monomethylarsonic acid results in increased expression of CASP3 mRNA	17481689
C406082	monomethylarsonous acid	Acetylcysteine inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
C406082	monomethylarsonous acid	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	29774349
C406082	monomethylarsonous acid	[monomethylarsonous acid co-treated with dimethylarsinous acid co-treated with Arsenic Trioxide] results in increased activity of and results in increased cleavage of CASP3 protein	29774349
C406082	monomethylarsonous acid	monomethylarsonous acid results in increased activity of CASP3 protein	19167414; 19465042;
C406082	monomethylarsonous acid	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [monomethylarsonous acid results in increased activity of CASP3 protein]	17520061
C406082	monomethylarsonous acid	monomethylarsonous acid results in increased activity of CASP3 protein	17520061
C035359	monorden	monorden inhibits the reaction [Demecolcine results in increased activity of CASP3 protein]	12530016
C093875	montelukast	montelukast results in increased expression of CASP3 protein	14633444
C093875	montelukast	montelukast inhibits the reaction [Streptozocin results in increased expression of CASP3 protein modified form]	27702591
C093875	montelukast	montelukast inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	28902463
C093875	montelukast	montelukast inhibits the reaction [Prednisolone results in increased expression of CASP3 protein]	30276927
C093875	montelukast	montelukast inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	30222980
C008548	morin	morin results in increased activity of CASP3 protein	24726691
C008548	morin	morin inhibits the reaction [Acetaminophen results in increased activity of CASP3 protein]	26767949
C008548	morin	morin inhibits the reaction [Acetaminophen results in increased cleavage of CASP3 protein]	26767949
C008548	morin	morin inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	19931519
C008548	morin	morin inhibits the reaction [titanium dioxide results in increased expression of CASP3 mRNA]	28844848
D009020	Morphine	Morphine inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17542780
D009020	Morphine	Morphine results in increased activity of and results in increased cleavage of CASP3 protein	19292871
D009020	Morphine	Morphine results in increased activity of CASP3 protein	10534122; 19070643; 21483469;
D009020	Morphine	[[Morphine results in increased expression of BAX protein] co-treated with [Morphine results in decreased expression of BCL2 protein]] results in increased activity of CASP3 protein	10534122
D009020	Morphine	PDGFB protein inhibits the reaction [Morphine results in increased activity of CASP3 protein]	21483469
D009020	Morphine	Morphine results in increased activity of CASP3 protein	11590188; 20600172;
D009020	Morphine	Morphine results in increased expression of CASP3 protein	18756534
D009020	Morphine	Morphine results in increased expression of CASP3 protein alternative form	18832014; 20600172;
D009020	Morphine	Naloxone inhibits the reaction [Morphine results in increased activity of CASP3 protein]	20600172
D009020	Morphine	Naloxone inhibits the reaction [Morphine results in increased expression of CASP3 protein alternative form]	20600172
D009020	Morphine	SB 203580 inhibits the reaction [Morphine results in increased activity of CASP3 protein]	20600172
D009020	Morphine	Minocycline inhibits the reaction [Morphine results in increased activity of CASP3 protein]	20711699
D009020	Morphine	Morphine results in increased activity of CASP3 protein	20711699
D009020	Morphine	Morphine results in increased expression of CASP3 protein	12196588; 16102899;
C036083	morphinone	morphinone results in increased activity of CASP3 protein	17094451
C437683	motexafin gadolinium	motexafin gadolinium results in decreased expression of CASP3 mRNA	16357179
C437683	motexafin gadolinium	[Zinc Acetate co-treated with motexafin gadolinium] results in decreased expression of CASP3 mRNA	16357179
C523799	MRK 003	MRK 003 affects the reaction [Resveratrol results in increased cleavage of CASP3 protein]	21743969
C523799	MRK 003	MRK 003 results in increased activity of CASP3 protein	19775282
C568376	MT19c compound	MT19c compound results in increased cleavage of and results in increased activity of CASP3 protein	21803404
D009151	Mustard Gas	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Mustard Gas results in increased activity of CASP3 protein]	20226831
D009151	Mustard Gas	CALM1 protein promotes the reaction [Mustard Gas results in increased cleavage of and results in increased activity of CASP3 protein]	16935404
D009151	Mustard Gas	CASP3 protein affects the reaction [Mustard Gas results in increased phosphorylation of LIG1 protein]	16906506
D009151	Mustard Gas	Cyclosporine inhibits the reaction [Mustard Gas results in increased cleavage of and results in increased activity of CASP3 protein]	16935404
D009151	Mustard Gas	FADD protein affects the reaction [Mustard Gas results in increased cleavage of CASP3 protein]	12482751
D009151	Mustard Gas	Mustard Gas promotes the reaction [CASP3 protein results in increased cleavage of CASP7 protein]	12482751
D009151	Mustard Gas	Mustard Gas promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	12482751
D009151	Mustard Gas	Mustard Gas results in decreased cleavage of CASP3 protein	25448276
D009151	Mustard Gas	Mustard Gas results in increased activity of CASP3 protein	12482751; 16738803; 20226831; 9665388;
D009151	Mustard Gas	Mustard Gas results in increased cleavage of and results in increased activity of CASP3 protein	11428642; 16935404; 18161513;
D009151	Mustard Gas	Mustard Gas results in increased expression of CASP3 protein	19748996
D009151	Mustard Gas	N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide inhibits the reaction [Mustard Gas results in increased cleavage of and results in increased activity of CASP3 protein]	16935404
D009151	Mustard Gas	PARP1 protein affects the reaction [Mustard Gas affects the activity of CASP3 protein]	11886524
D009151	Mustard Gas	pifithrin inhibits the reaction [Mustard Gas results in decreased cleavage of CASP3 protein]	25448276
D009151	Mustard Gas	Mustard Gas results in increased activity of CASP3 protein	11886524; 19560481;
D009151	Mustard Gas	PARP1 protein inhibits the reaction [Mustard Gas results in increased activity of CASP3 protein]	11886524
D009151	Mustard Gas	Mustard Gas results in increased activity of CASP3 protein	20226831
D009151	Mustard Gas	Mustard Gas results in increased cleavage of CASP3 protein	20659490
D009151	Mustard Gas	Mustard Gas results in increased expression of CASP3 mRNA	18988085
D009173	Mycophenolic Acid	[Mycophenolic Acid co-treated with Hypoxanthine] results in increased activity of CASP3 protein	21396949
D009173	Mycophenolic Acid	Mycophenolic Acid results in increased activity of CASP3 protein	16059982; 16505121;
D009173	Mycophenolic Acid	Guanosine inhibits the reaction [Mycophenolic Acid results in increased cleavage of CASP3 protein]	17175248
D009173	Mycophenolic Acid	Mycophenolic Acid results in increased cleavage of CASP3 protein	17175248
C040015	myricetin	myricetin results in increased activity of CASP3 protein	15748703
C040015	myricetin	myricetin results in increased cleavage of CASP3 protein	19397994; 29698783;
C008577	myricitrin	myricitrin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	23639522
C008577	myricitrin	myricitrin inhibits the reaction [APOE gene mutant form results in increased activity of CASP3 protein]	23639522
C005246	myristicin	myristicin results in increased activity of CASP3 protein	24792648
C455139	myrtucommulone A	myrtucommulone A results in decreased expression of CASP3 mRNA	26032814
C531525	N-(1,3-benzodioxol-5-ylmethyl)-2,6-dichlorobenzamide	N-(1,3-benzodioxol-5-ylmethyl)-2,6-dichlorobenzamide inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	25263579
C092756	N-(1-methyl-5-indolyl)-N'-(3-methyl-5-isothiazolyl)urea	N-(1-methyl-5-indolyl)-N'-(3-methyl-5-isothiazolyl)urea inhibits the reaction [Norepinephrine results in increased expression of CASP3 protein]	20374255
C558729	N1-(n-butyl)-7-azaisoindigo	N1-(n-butyl)-7-azaisoindigo results in increased cleavage of CASP3 protein	20865757
C545493	N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-N-butyl-6-decyl-1,3,5-triazine-2,4-diamine	N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-N-butyl-6-decyl-1,3,5-triazine-2,4-diamine inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]	20359466
C545493	N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-N-butyl-6-decyl-1,3,5-triazine-2,4-diamine	N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-N-butyl-6-decyl-1,3,5-triazine-2,4-diamine inhibits the reaction [APP protein results in increased activity of CASP3 protein]	19631265
C562237	N-(2-(2-(4-(4-(2-hydroxypropyl)piperazin-1-yl)-2-methoxyphenylamino)pyrrolo(2,1-f)(1,2,4)triazin-7-yl)phenyl)-N-methylmethanesulfonamide	[ALK protein modified form results in increased susceptibility to N-(2-(2-(4-(4-(2-hydroxypropyl)piperazin-1-yl)-2-methoxyphenylamino)pyrrolo(2,1-f)(1,2,4)triazin-7-yl)phenyl)-N-methylmethanesulfonamide] which results in increased activity of CASP3 protein	21859094
C469937	N(2)-(2-aminocyclohexyl)-N(6)-(3-chlorophenyl)-9-ethyl-9H-purine-2,6-diamine	N(2)-(2-aminocyclohexyl)-N(6)-(3-chlorophenyl)-9-ethyl-9H-purine-2,6-diamine results in increased activity of CASP3 protein	16140939
C090413	N-(2-(4-(2-methoxyphenyl)-1-piperazinyl)ethyl)-N-(2-pyridinyl)cyclohexanecarboxamide	N-(2-(4-(2-methoxyphenyl)-1-piperazinyl)ethyl)-N-(2-pyridinyl)cyclohexanecarboxamide inhibits the reaction [8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein]	30366073
C063509	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C504153	N-(2-aminoethyl)-4-(5-(4-tolyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide	N-(2-aminoethyl)-4-(5-(4-tolyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide results in increased activity of CASP3 protein	15870389
C080955	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	21745461
C080955	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide results in increased activity of CASP3 protein	12414664
C080955	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide	PTGS2 protein inhibits the reaction [N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide results in increased activity of CASP3 protein]	12414664
C080955	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [cadmium sulfate results in increased activity of CASP3 protein]	14687664
C080955	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C558357	N2,N4-dibenzylquinazoline-2,4-diamine	N2,N4-dibenzylquinazoline-2,4-diamine results in increased activity of CASP3 protein	27434122
C568512	N-(3-aminopropyl)-N-(1-(5-benzyl-3-methyl-4-oxo-(1,2)thiazolo(5,4-d)pyrimidin-6-yl)-2-methylpropyl)-4-methylbenzamide	N-(3-aminopropyl)-N-(1-(5-benzyl-3-methyl-4-oxo-(1,2)thiazolo(5,4-d)pyrimidin-6-yl)-2-methylpropyl)-4-methylbenzamide results in increased cleavage of CASP3 protein	21899292
C477659	N-(3-methoxyphenyl)-4-chlorocinnamanilide	N-(3-methoxyphenyl)-4-chlorocinnamanilide inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C109860	N-(3-oxododecanoyl)homoserine lactone	N-(3-oxododecanoyl)homoserine lactone results in increased activity of CASP3 protein	25627690
C056614	N-(3-phenoxycinnamyl)acetohydroxamic acid	N-(3-phenoxycinnamyl)acetohydroxamic acid results in increased cleavage of CASP3 protein	19503098
C068250	N-(3-propylcarbamoyloxirane-2-carbonyl)-isoleucyl-proline	N-(3-propylcarbamoyloxirane-2-carbonyl)-isoleucyl-proline inhibits the reaction [biphosphinic palladacycle complex results in increased activity of CASP3 protein]	19026616
C033772	N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide	N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide inhibits the reaction [Mustard Gas results in increased cleavage of and results in increased activity of CASP3 protein]	16935404
C033772	N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide	N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide inhibits the reaction [ferric ammonium citrate results in increased cleavage of CASP3 protein]	27481217
C479831	N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea	[N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea results in decreased activity of GSK3B protein] results in increased susceptibility to [Troglitazone results in increased expression of CASP3 protein]	20540935
C479831	N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea	N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	20300959
C084956	N(6)-(3-iodobenzyl)-5'-N-methylcarboxamidoadenosine	N(6)-(3-iodobenzyl)-5'-N-methylcarboxamidoadenosine results in increased expression of CASP3 protein	16025880
C027513	N(6)-cyclohexyladenosine	N(6)-cyclohexyladenosine results in increased activity of CASP3 protein	16469385
C488176	N-acetyl-S-(alpha-methyl-4-(2-methylpropyl)benzeneacetyl)cysteine 4-(nitrooxy)butyl ester	N-acetyl-S-(alpha-methyl-4-(2-methylpropyl)benzeneacetyl)cysteine 4-(nitrooxy)butyl ester results in increased expression of CASP3 protein	15201807
C488176	N-acetyl-S-(alpha-methyl-4-(2-methylpropyl)benzeneacetyl)cysteine 4-(nitrooxy)butyl ester	N-acetyl-S-(alpha-methyl-4-(2-methylpropyl)benzeneacetyl)cysteine 4-(nitrooxy)butyl ester results in increased cleavage of CASP3 protein	21097689
C064769	N-acetylsphingosine	BCL2 protein inhibits the reaction [N-acetylsphingosine results in increased cleavage of and results in increased activity of CASP3 protein]	16215670
C064769	N-acetylsphingosine	N-acetylsphingosine results in increased activity of CASP3 protein	21259059
C064769	N-acetylsphingosine	N-acetylsphingosine results in increased cleavage of and results in increased activity of CASP3 protein	16215670
C064769	N-acetylsphingosine	N-acetylsphingosine results in increased activity of CASP3 protein	10919278
D009243	NAD	NAD inhibits the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D009243	NAD	NAD inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	24491677
D009243	NAD	NAD inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	24040102
D009270	Naloxone	Naloxone inhibits the reaction [Morphine results in increased activity of CASP3 protein]	20600172
D009270	Naloxone	Naloxone inhibits the reaction [Morphine results in increased expression of CASP3 protein alternative form]	20600172
D000077603	Nandrolone Decanoate	Nandrolone Decanoate results in increased expression of CASP3 protein	25542992
D000077603	Nandrolone Decanoate	Taurine inhibits the reaction [Nandrolone Decanoate results in increased expression of CASP3 protein]	25542992
D037742	Nanotubes, Carbon	Dexamethasone promotes the reaction [Nanotubes, Carbon results in increased activity of CASP3 protein]	19760634
D037742	Nanotubes, Carbon	Etoposide promotes the reaction [Nanotubes, Carbon results in increased activity of CASP3 protein]	19760634
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased activity of CASP3 protein	19760634; 28673683;
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of CASP3 mRNA	23634900
D037742	Nanotubes, Carbon	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to Nanotubes, Carbon	22664788
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in decreased expression of CASP3 mRNA	25620056
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in decreased expression of CASP3 mRNA	25620056
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased cleavage of CASP3 protein	24664304
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of CASP3 mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of CASP3 mRNA	26146619
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in increased activity of CASP3 protein	19827037
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased activity of CASP3 protein	22020378
D037742	Nanotubes, Carbon	Vitamin E inhibits the reaction [Nanotubes, Carbon results in increased activity of CASP3 protein]	22020378
C031721	naphthalene	[naphthalene co-treated with anthracene co-treated with phenanthrene co-treated with pyrene] results in increased expression of CASP3 protein	28803881
D053644	Naphthalimides	Acetylcysteine inhibits the reaction [[Naphthalimides co-treated with Spermidine] results in increased activity of CASP3 protein]	21349322
D053644	Naphthalimides	[Naphthalimides co-treated with Spermidine] results in increased activity of CASP3 protein	21349322
C073873	naphtho(1,2-b)furan-4,5-dione	naphtho(1,2-b)furan-4,5-dione results in increased activity of CASP3 protein	19747539; 20197088;
D009285	Naphthoquinones	[Naphthoquinones co-treated with necrostatin-1] results in increased cleavage of and results in increased activity of CASP3 protein	23811387
D009285	Naphthoquinones	Naphthoquinones results in increased activity of CASP3 protein	20695460
D009285	Naphthoquinones	Naphthoquinones results in increased cleavage of and results in increased activity of CASP3 protein	23811387
D009285	Naphthoquinones	Naphthoquinones analog inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	19497415
C005273	naringenin	naringenin inhibits the reaction [Pyruvaldehyde results in increased activity of CASP3 protein]	31254498
C005273	naringenin	naringenin results in increased activity of CASP3 protein	19124070; 22692793;
C005273	naringenin	naringenin results in increased expression of CASP3 protein modified form	27838343
C005273	naringenin	naringenin inhibits the reaction [Glucose results in increased activity of CASP3 protein]	23192364
C005273	naringenin	naringenin inhibits the reaction [Glucose results in increased expression of and results in increased cleavage of CASP3 protein]	23192364
C005273	naringenin	naringenin inhibits the reaction [Glucose results in increased expression of CASP3 mRNA]	23192364
C005274	naringin	naringin inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	28422390
C005274	naringin	naringin results in increased expression of CASP3 mRNA	22847135
C005274	naringin	naringin inhibits the reaction [Dexamethasone results in increased cleavage of CASP3 protein]	30878453
C005274	naringin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
C005274	naringin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
C005274	naringin	[naringin co-treated with Pioglitazone] inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
C005274	naringin	naringin inhibits the reaction [3-nitropropionic acid results in increased cleavage of CASP3 protein]	21945202
C005274	naringin	naringin inhibits the reaction [Cisplatin results in increased expression of CASP3 mRNA]	26612654
C005274	naringin	naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]	25773745
C005274	naringin	naringin inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
C005274	naringin	rottlerin inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
C528561	navitoclax	[navitoclax co-treated with Vorinostat] results in increased activity of CASP3 protein	21652541
C528561	navitoclax	navitoclax results in increased cleavage of CASP3 protein	21562047
C576077	N-benzoyl-12-nitrodehydroabietylamine-7-one	N-benzoyl-12-nitrodehydroabietylamine-7-one results in increased activity of CASP3 protein	22743618
C101954	N-caproylsphingosine	N-caproylsphingosine promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	10811113
C101954	N-caproylsphingosine	N-caproylsphingosine results in increased activity of CASP3 protein	10811113
C101954	N-caproylsphingosine	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [N-caproylsphingosine promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	10811113
C101954	N-caproylsphingosine	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [N-caproylsphingosine results in increased activity of CASP3 protein]	10811113
C112341	NCQ 344	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [NCQ 344 results in increased activity of CASP3 protein]	10996300
C112341	NCQ 344	NCQ 344 results in increased activity of CASP3 protein	10996300
C084325	NCQ 436	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [NCQ 436 results in increased activity of CASP3 protein]	10996300
C084325	NCQ 436	NCQ 436 results in increased activity of CASP3 protein	10996300
C498045	NCX 4040	Acetylcysteine inhibits the reaction [NCX 4040 results in increased cleavage of and results in increased activity of CASP3 protein]	16282376
C498045	NCX 4040	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [NCX 4040 results in increased cleavage of and results in increased activity of CASP3 protein]	16282376
C498045	NCX 4040	NCX 4040 results in increased activity of CASP3 protein	15567157
C498045	NCX 4040	NCX 4040 results in increased cleavage of and results in increased activity of CASP3 protein	16282376
C498045	NCX 4040	NCX 4040 results in increased cleavage of and results in increased localization of CASP3 protein	16282376
C546012	N-(cyanomethyl)-4-(2-((4-(4-morpholinyl)phenyl)amino)-4-pyrimidinyl)benzamide	N-(cyanomethyl)-4-(2-((4-(4-morpholinyl)phenyl)amino)-4-pyrimidinyl)benzamide results in increased cleavage of CASP3 protein	27470402
C546012	N-(cyanomethyl)-4-(2-((4-(4-morpholinyl)phenyl)amino)-4-pyrimidinyl)benzamide	N-(cyanomethyl)-4-(2-((4-(4-morpholinyl)phenyl)amino)-4-pyrimidinyl)benzamide results in increased expression of and results in increased activity of CASP3 protein	27470402
C507699	necrostatin-1	[Drugs, Chinese Herbal co-treated with necrostatin-1] results in increased cleavage of and results in increased activity of CASP3 protein	23811387
C507699	necrostatin-1	[Naphthoquinones co-treated with necrostatin-1] results in increased cleavage of and results in increased activity of CASP3 protein	23811387
C524653	nectandrin-B	nectandrin-B inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	27511913
C002443	neem oil	CASP9 protein affects the reaction [neem oil results in increased cleavage of and results in increased activity of CASP3 protein]	22915764
C002443	neem oil	neem oil results in increased cleavage of and results in increased activity of CASP3 protein	22915764
C051752	nefazodone	nefazodone results in increased activity of CASP3 protein	22700542; 27288927;
C051752	nefazodone	Palmitic Acid promotes the reaction [nefazodone results in increased activity of CASP3 protein]	22700542
C051752	nefazodone	nefazodone results in increased expression of CASP3 mRNA	24136188
C057222	neferine	FGFR2 protein inhibits the reaction [neferine results in increased cleavage of CASP3 protein]	31207222
C057222	neferine	MIR374A mRNA inhibits the reaction [neferine results in increased cleavage of CASP3 protein]	31207222
C057222	neferine	neferine results in increased cleavage of CASP3 protein	31207222
C057222	neferine	neferine inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	30423403
C057222	neferine	neferine inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	30423403
D019888	Nelfinavir	Nelfinavir results in increased activity of CASP3 protein	20105315
C002701	neocuproine	neocuproine inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
C002701	neocuproine	bathocuproine sulfonate inhibits the reaction [[Copper binds to neocuproine] which results in increased activity of CASP3 protein]	18056745
C002701	neocuproine	[Copper binds to neocuproine] which results in increased activity of CASP3 protein	18056745
C002701	neocuproine	neocuproine results in increased activity of CASP3 protein	18056745
C045863	neo-gambogic acid	neo-gambogic acid inhibits the reaction [Silicon Dioxide results in increased cleavage of CASP3 protein]	27616297
C013613	neohesperidin dihydrochalcone	neohesperidin dihydrochalcone inhibits the reaction [Carbon Tetrachloride results in increased expression of CASP3 protein]	24530446
D009355	Neomycin	BIX 01294 affects the reaction [Neomycin affects the cleavage of CASP3 protein]	23429292
D009355	Neomycin	Neomycin affects the cleavage of CASP3 protein	23429292
D009355	Neomycin	Neomycin results in increased expression of CASP3 mRNA	29292089
D009355	Neomycin	Neomycin results in increased expression of CASP3 protein modified form	29292089
D009355	Neomycin	peoniflorin inhibits the reaction [Neomycin results in increased expression of CASP3 mRNA]	29292089
D009355	Neomycin	peoniflorin inhibits the reaction [Neomycin results in increased expression of CASP3 protein modified form]	29292089
C016009	neosolaniol	neosolaniol results in increased activity of CASP3 protein	19428930
C011947	neoxanthin	neoxanthin results in increased cleavage of and results in increased activity of CASP3 protein	17186379
D009414	Nerve Growth Factors	Nerve Growth Factors deficiency results in increased activity of CASP3 protein	10428045
D009414	Nerve Growth Factors	PAWR protein promotes the reaction [Nerve Growth Factors deficiency results in increased activity of CASP3 protein]	10428045
C552435	N-ethoxymethyl-3-amino-1,2,4-benzotriazine-1,4-dioxide	N-ethoxymethyl-3-amino-1,2,4-benzotriazine-1,4-dioxide promotes the reaction [Oxygen deficiency results in increased cleavage of CASP3 protein]	20530905
D009498	Neurotoxins	Neurotoxins results in increased activity of CASP3 protein	15190125
D009498	Neurotoxins	tauroursodeoxycholic acid inhibits the reaction [Neurotoxins results in increased activity of CASP3 protein]	15190125
D018377	Neurotransmitter Agents	Neurotransmitter Agents promotes the reaction [Lead results in increased activity of CASP3 protein]	16781745
D009240	N-Formylmethionine Leucyl-Phenylalanine	Melatonin inhibits the reaction [N-Formylmethionine Leucyl-Phenylalanine results in increased activity of CASP3 protein]	20130848
D009240	N-Formylmethionine Leucyl-Phenylalanine	N-Formylmethionine Leucyl-Phenylalanine results in increased activity of CASP3 protein	20130848
C026385	n-hexane	n-hexane metabolite results in increased expression of CASP3 protein	17492505
D009536	Niacinamide	[Berberine co-treated with Niacinamide] results in increased cleavage of CASP3 protein	26712469
D009536	Niacinamide	Niacinamide results in increased cleavage of CASP3 protein	24962570; 26712469;
D009536	Niacinamide	Resveratrol inhibits the reaction [Niacinamide results in increased cleavage of CASP3 protein]	24962570
D009536	Niacinamide	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D009536	Niacinamide	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D009536	Niacinamide	[Butyric Acid co-treated with Niacinamide co-treated with Glucaric Acid] inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D009536	Niacinamide	Niacinamide inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased activity of CASP3 protein]	25478867
D009536	Niacinamide	Niacinamide inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	25478867
D009536	Niacinamide	Niacinamide inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	25478867
D009536	Niacinamide	Niacinamide promotes the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D009536	Niacinamide	Niacinamide promotes the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	24040102
D009536	Niacinamide	Niacinamide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
D009536	Niacinamide	Niacinamide inhibits the reaction [Thiotepa results in increased activity of CASP3 protein]	22164206
D009532	Nickel	Nickel analog results in increased activity of CASP3 protein	23776134
D009532	Nickel	[Nickel co-treated with austenitic steel analog] results in increased expression of CASP3 mRNA	23638002
D009532	Nickel	Nickel results in increased activity of CASP3 protein	21376802
D009532	Nickel	Nickel results in increased cleavage of and results in increased activity of CASP3 protein	24068677
D009532	Nickel	Nickel results in increased cleavage of CASP3 protein	24840272
D009532	Nickel	[Quercetin analog co-treated with Nickel] results in increased activity of CASP3 protein	20577783
D009532	Nickel	TP53 protein affects the reaction [Nickel results in increased cleavage of and results in increased activity of CASP3 protein]	24068677
D009532	Nickel	Nickel analog results in increased expression of CASP3 mRNA	27257140
D009532	Nickel	[Tungsten co-treated with Nickel co-treated with Cobalt] results in decreased activity of CASP3 protein	20934443
C119536	nickel acetate	[MUC1 mutant form results in increased susceptibility to nickel acetate] which results in increased cleavage of CASP3 protein	25053108
C119536	nickel acetate	nickel acetate results in increased activity of CASP3 protein	22245127
C022838	nickel chloride	nickel chloride results in increased expression of CASP3 mRNA	24184595; 26585591;
C022838	nickel chloride	nickel chloride results in increased expression of CASP3 protein	24184595; 26585591;
C022838	nickel chloride	cobaltous chloride promotes the reaction [nickel chloride results in increased cleavage of CASP3 protein]	22172632
C022838	nickel chloride	nickel chloride promotes the reaction [cobaltous chloride results in increased cleavage of CASP3 protein]	22172632
C022838	nickel chloride	nickel chloride results in increased cleavage of CASP3 protein	21828359; 22172632;
C022838	nickel chloride	nickel chloride results in increased expression of CASP3 mRNA	26378417
C022838	nickel chloride	nickel chloride results in increased expression of CASP3 protein modified form	28552779
C022838	nickel chloride	[TP53 mutant form inhibits the reaction [nickel chloride results in increased activity of CASP9 protein]] which results in decreased cleavage of CASP3 protein	23566959
C022838	nickel chloride	nickel chloride affects the expression of CASP3 mRNA	22546817
C022838	nickel chloride	nickel chloride results in increased activity of CASP3 protein	21843586
C022838	nickel chloride	pyrazolanthrone inhibits the reaction [nickel chloride results in increased activity of CASP3 protein]	21843586
C550717	nickel ferrite	nickel ferrite analog results in increased activity of CASP3 protein	25966046
C550717	nickel ferrite	nickel ferrite analog results in increased expression of CASP3 mRNA	25966046
C550717	nickel ferrite	nickel ferrite results in increased activity of CASP3 protein	21382431
C550717	nickel ferrite	nickel ferrite results in increased expression of CASP3 mRNA	21382431
C028007	nickel monoxide	nickel monoxide analog results in increased activity of CASP3 protein	22273695; 24139157;
C028007	nickel monoxide	nickel monoxide analog results in increased expression of CASP3 mRNA	24139157
C028007	nickel monoxide	nickel monoxide results in increased cleavage of CASP3 protein	21828359
C028007	nickel monoxide	nickel monoxide results in increased expression of CASP3 protein	28945320
C029938	nickel sulfate	nickel sulfate results in increased activity of CASP3 protein	24394944
C029938	nickel sulfate	nickel sulfate inhibits the reaction [Potassium Dichromate results in increased cleavage of and results in increased activity of CASP3 protein]	20493934
C029938	nickel sulfate	nickel sulfate results in increased cleavage of and results in increased activity of CASP3 protein	20493934
C029938	nickel sulfate	Potassium Dichromate inhibits the reaction [nickel sulfate results in increased cleavage of and results in increased activity of CASP3 protein]	20493934
C029938	nickel sulfate	nickel sulfate results in increased cleavage of CASP3 protein	23317420
C029938	nickel sulfate	sesamin inhibits the reaction [nickel sulfate results in increased cleavage of CASP3 protein]	23317420
C029938	nickel sulfate	Acetylcysteine inhibits the reaction [nickel sulfate results in increased expression of CASP3 protein]	28296042
C029938	nickel sulfate	nickel sulfate results in increased expression of CASP3 protein	28296042
C029938	nickel sulfate	TEMPO inhibits the reaction [nickel sulfate results in increased expression of CASP3 protein]	28296042
D009534	Niclosamide	7-methyl-5-(1-((3-(trifluoromethyl)phenyl)acetyl)-2,3-dihydro-1H-indol-5-yl)-7H-pyrrolo(2,3-d)pyrimidin-4-amine inhibits the reaction [Niclosamide results in increased cleavage of CASP3 protein]	26917416
D009534	Niclosamide	ATF3 protein affects the reaction [Niclosamide results in increased cleavage of CASP3 protein]	26917416
D009534	Niclosamide	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Niclosamide results in increased cleavage of CASP3 protein]	21871175
D009534	Niclosamide	[Niclosamide binds to Polyethyleneimine] which results in increased expression of CASP3 mRNA	25988281
D009534	Niclosamide	Niclosamide results in decreased expression of CASP3 protein	20215516; 25634333;
D009534	Niclosamide	Niclosamide results in increased cleavage of CASP3 protein	21871175; 24750999; 25174399; 26703449; 26917416; 30258081;
D009534	Niclosamide	Niclosamide results in increased expression of CASP3 protein modified form	26116531; 29031202;
D009534	Niclosamide	TP53 gene mutant form promotes the reaction [Niclosamide results in increased cleavage of CASP3 protein]	30258081
D009534	Niclosamide	WNT7A protein affects the reaction [Niclosamide results in increased cleavage of CASP3 protein]	25174399
D009534	Niclosamide	Niclosamide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 protein modified form]	28824321
D009534	Niclosamide	[TP53 protein mutant form results in increased susceptibility to Niclosamide] which results in increased expression of CASP3 protein modified form	30258081
D009538	Nicotine	geldanamycin inhibits the reaction [Nicotine results in increased activity of CASP3 protein]	12115584
D009538	Nicotine	MK-886 inhibits the reaction [Nicotine results in decreased expression of CASP3 protein]	20061081
D009538	Nicotine	Nicotine inhibits the reaction [Aflatoxin B1 results in increased cleavage of CASP3 protein]	22743290
D009538	Nicotine	Nicotine inhibits the reaction [aflatoxin G1 results in increased expression of CASP3 protein modified form]	23907605
D009538	Nicotine	Nicotine inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	20106947
D009538	Nicotine	Nicotine inhibits the reaction [Paclitaxel results in increased activity of CASP3 protein]	20106947
D009538	Nicotine	Nicotine results in decreased activity of CASP3 protein	11701223
D009538	Nicotine	Nicotine results in decreased expression of CASP3 protein	20061081
D009538	Nicotine	Nicotine results in increased activity of CASP3 protein	12115584
D009538	Nicotine	Nicotine results in increased expression of CASP3	20383341
D009538	Nicotine	Nicotine results in increased expression of CASP3 mRNA	16949557
D009538	Nicotine	Nicotine results in increased expression of CASP3 protein	20457658
D009538	Nicotine	[Nicotine co-treated with Polylactic Acid-Polyglycolic Acid Copolymer] inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 protein]	23933227
D009538	Nicotine	Nicotine inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 protein]	23933227
D009538	Nicotine	Nicotine results in decreased expression of CASP3 mRNA	17135361
D009538	Nicotine	Nicotine results in decreased expression of CASP3 protein	17135361
D009538	Nicotine	Nicotine results in increased activity of CASP3 protein	15831280
D009538	Nicotine	Nicotine results in increased expression of CASP3 mRNA	22687363; 30896085;
D009538	Nicotine	Nicotine results in increased expression of CASP3 protein modified form	15831280
D009538	Nicotine	Resveratrol inhibits the reaction [Nicotine results in increased expression of CASP3 mRNA]	22687363
D009538	Nicotine	royal jelly inhibits the reaction [Nicotine results in increased expression of CASP3 mRNA]	30896085
D009538	Nicotine	[Ethanol co-treated with Nicotine] results in increased expression of CASP3 protein	12218695
D009538	Nicotine	Nicotine affects the expression of CASP3 mRNA	20426880
D009538	Nicotine	Nicotine inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	16237857
D009538	Nicotine	Nicotine results in increased activity of CASP3 protein	18203686
D009538	Nicotine	Nicotine results in increased activity of CASP3 protein alternative form	20447445
D009538	Nicotine	Nicotine results in increased cleavage of CASP3 protein	30959089
D009538	Nicotine	Nicotine results in increased expression of CASP3 mRNA	19815060
D009538	Nicotine	Nicotine results in increased expression of CASP3 protein	12218695
D009538	Nicotine	Mecamylamine affects the reaction [Nicotine inhibits the reaction [APP protein results in increased activity of CASP3 protein]]	14757701
D009538	Nicotine	Nicotine inhibits the reaction [APP protein results in increased activity of CASP3 protein]	14757701
D009543	Nifedipine	Nifedipine inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D009543	Nifedipine	Nifedipine inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	26923100
D009544	Niflumic Acid	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein]	21067863
D009544	Niflumic Acid	DDIT3 mutant form inhibits the reaction [[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein]	21067863
D009544	Niflumic Acid	[Niflumic Acid co-treated with ciglitazone] results in increased cleavage of CASP3 protein	21067863
C042198	nimbolide	nimbolide promotes the reaction [U 0126 results in increased expression of CASP3 protein modified form]	28383207
C042198	nimbolide	nimbolide results in increased cleavage of CASP3 protein	29778718
C042198	nimbolide	nimbolide results in increased expression of CASP3 mRNA	20429769
C042198	nimbolide	nimbolide results in increased expression of CASP3 protein	20429769
C042198	nimbolide	nimbolide results in increased expression of CASP3 protein modified form	28383207; 29962003;
C042198	nimbolide	U 0126 inhibits the reaction [nimbolide results in increased expression of CASP3 protein modified form]	29962003
C042198	nimbolide	U 0126 promotes the reaction [nimbolide results in increased expression of CASP3 protein modified form]	28383207
C012655	nimesulide	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [nimesulide results in increased cleavage of and results in increased activity of CASP3 protein]	19360361
C012655	nimesulide	nimesulide inhibits the reaction [Etoposide results in increased cleavage of CASP3 protein]	21745461
C012655	nimesulide	nimesulide results in increased cleavage of and results in increased activity of CASP3 protein	19360361
C012655	nimesulide	nimesulide results in increased expression of CASP3 mRNA	21176579
C012655	nimesulide	nimesulide results in increased expression of CASP3 protein	21176579
C012655	nimesulide	[camphene co-treated with geraniol] inhibits the reaction [nimesulide results in increased cleavage of CASP3 protein]	22509279
C012655	nimesulide	nimesulide inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	11296547
C012655	nimesulide	nimesulide results in increased activity of CASP3 protein	19772912
C012655	nimesulide	nimesulide results in increased cleavage of CASP3 protein	22509279
C012655	nimesulide	nimesulide results in increased expression of CASP3 mRNA	24136188
C012655	nimesulide	Silymarin inhibits the reaction [nimesulide results in increased cleavage of CASP3 protein]	22509279
C002714	nimetazepam	CYP3A4 protein affects the reaction [nimetazepam results in increased activity of CASP3 protein]	19005028
D009553	Nimodipine	Nimodipine results in increased activity of CASP3 protein	22700542
D009553	Nimodipine	Palmitic Acid promotes the reaction [Nimodipine results in increased activity of CASP3 protein]	22700542
D015376	Nimustine	Nimustine results in increased cleavage of CASP3 protein	26418950
D009567	Nitrazepam	CYP3A4 protein affects the reaction [Nitrazepam results in increased activity of CASP3 protein]	19005028
D009569	Nitric Oxide	Nitric Oxide inhibits the reaction [Cadmium results in increased expression of CASP3 mRNA]	25490952
D009569	Nitric Oxide	Dithiothreitol inhibits the reaction [Nitric Oxide results in decreased activity of CASP3 protein]	9388267
D009569	Nitric Oxide	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	9755104
D009569	Nitric Oxide	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein]	9706149
D009569	Nitric Oxide	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] which results in increased metabolism of CASP3 protein]	9706149
D009569	Nitric Oxide	Nitric Oxide inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	20020783
D009569	Nitric Oxide	Nitric Oxide results in decreased activity of CASP3 protein	9388267
D009569	Nitric Oxide	Nitric Oxide results in decreased cleavage of CASP3 protein	10222263
D009569	Nitric Oxide	Nitric Oxide results in increased activity of CASP3 protein	15126337; 20179380;
D009569	Nitric Oxide	[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	9755104
D009569	Nitric Oxide	[NOS2 protein results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein	9706149
D009569	Nitric Oxide	[NOS2 protein results in increased abundance of Nitric Oxide] which results in increased metabolism of CASP3 protein	9706149
D009569	Nitric Oxide	[S-Nitrosoglutathione results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein	10828028
D009569	Nitric Oxide	[S-Nitrosoglutathione results in increased abundance of Nitric Oxide] which results in increased metabolism of CASP3 protein	10828028
D009569	Nitric Oxide	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [N-caproylsphingosine promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	10811113
D009569	Nitric Oxide	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [N-caproylsphingosine results in increased activity of CASP3 protein]	10811113
D009569	Nitric Oxide	[Nitric Oxide Donors results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein]	9388267
D009569	Nitric Oxide	Nitric Oxide results in decreased activity of CASP3 protein	14634119
D009569	Nitric Oxide	Nitric Oxide results in increased activity of CASP3 protein	12606818
D009569	Nitric Oxide	[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein	22878015
D009569	Nitric Oxide	SB 203580 inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein]	22878015
D009569	Nitric Oxide	U 0126 inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein]	22878015
D009569	Nitric Oxide	[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of and results in increased activity of CASP3 protein	22293420
D009569	Nitric Oxide	[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of CASP3 mRNA	22293420
D009569	Nitric Oxide	pyrazolanthrone inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of and results in increased activity of CASP3 protein]	22293420
D009569	Nitric Oxide	pyrazolanthrone inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of CASP3 mRNA]	22293420
D009569	Nitric Oxide	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	9755104
D009569	Nitric Oxide	Cyclic GMP affects the reaction [Nitric Oxide results in decreased activity of CASP3 protein]	9388267
D009569	Nitric Oxide	Dithiothreitol inhibits the reaction [1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one inhibits the reaction [[Nitric Oxide Donors results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein]]	9388267
D009569	Nitric Oxide	Nitric Oxide affects the activity of and affects the cleavage of CASP3 protein	10728388
D009569	Nitric Oxide	[Nitric Oxide Donors results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein	9388267
D009569	Nitric Oxide	Nitric Oxide results in decreased cleavage of and results in decreased activity of CASP3 protein	10358093
D009569	Nitric Oxide	Nitric Oxide results in increased metabolism of CASP3 protein	9388267
D009569	Nitric Oxide	Dithiothreitol inhibits the reaction [[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Dactinomycin] results in increased activity of CASP3 protein]]	9706149
D009569	Nitric Oxide	Nitric Oxide affects the reaction [[XDH protein co-treated with Xanthine] results in increased activity of and results in increased cleavage of CASP3 protein]	10073970
D009569	Nitric Oxide	[NOS2 protein results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Dactinomycin] results in increased activity of CASP3 protein]	9706149
D020030	Nitric Oxide Donors	Dithiothreitol inhibits the reaction [Nitric Oxide Donors inhibits the reaction [[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein]]	9388267
D020030	Nitric Oxide Donors	[Nitric Oxide Donors results in increased abundance of Nitric Oxide] inhibits the reaction [[TNF protein co-treated with Galactosamine] results in increased activity of CASP3 protein]	9388267
D020030	Nitric Oxide Donors	1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one inhibits the reaction [Nitric Oxide Donors results in decreased activity of CASP3 protein]	9388267
D020030	Nitric Oxide Donors	Dithiothreitol inhibits the reaction [1H-(1,2,3)oxadiazolo(4,4-a)quinoxalin-1-one inhibits the reaction [[Nitric Oxide Donors results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein]]	9388267
D020030	Nitric Oxide Donors	[Nitric Oxide Donors results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein	9388267
C102148	nitroaspirin	nitroaspirin results in increased activity of CASP3 protein	17244951
C102148	nitroaspirin	nitroaspirin results in decreased expression of CASP3 mRNA	15345513
C007350	nitrofen	Acetylcysteine inhibits the reaction [nitrofen results in increased cleavage of CASP3 protein]	15582350
C007350	nitrofen	nitrofen results in increased cleavage of CASP3 protein	15582350
D009589	Nitrogen Oxides	Nitrogen Oxides inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	16041517
D005996	Nitroglycerin	Nitroglycerin results in decreased expression of CASP3 protein modified form	17322376
D005996	Nitroglycerin	Nitroglycerin results in increased cleavage of and results in increased activity of CASP3 protein	12105852
D009599	Nitroprusside	epigallocatechin gallate inhibits the reaction [Nitroprusside binds to and results in increased activity of CASP3 protein]	23665936
D009599	Nitroprusside	Nitroprusside binds to and results in increased activity of CASP3 protein	23665936
D009599	Nitroprusside	Nitroprusside inhibits the reaction [Deferoxamine results in increased activity of CASP3 protein]	16374551
D009599	Nitroprusside	Nitroprusside inhibits the reaction [MIR135B mRNA inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of CASP3 protein]]	28484287
D009599	Nitroprusside	Nitroprusside results in increased activity of CASP3 protein	22178905
D009599	Nitroprusside	Nitroprusside results in increased expression of CASP3 mRNA	15708893
D009599	Nitroprusside	Ursodeoxycholic Acid inhibits the reaction [Nitroprusside results in increased activity of CASP3 protein]	22178905
D009599	Nitroprusside	MIR1A-2 mRNA affects the reaction [Nitroprusside results in increased activity of CASP3 protein]	25678843
D009599	Nitroprusside	[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein	22878015
D009599	Nitroprusside	Nitroprusside results in increased activity of CASP3 protein	25678843
D009599	Nitroprusside	SB 203580 inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein]	22878015
D009599	Nitroprusside	U 0126 inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein]	22878015
D009599	Nitroprusside	Acetylcysteine inhibits the reaction [Nitroprusside results in increased activity of CASP3]	19725096
D009599	Nitroprusside	[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of and results in increased activity of CASP3 protein	22293420
D009599	Nitroprusside	[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of CASP3 mRNA	22293420
D009599	Nitroprusside	Nitroprusside results in increased activity of CASP3	19725096
D009599	Nitroprusside	pyrazolanthrone inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of and results in increased activity of CASP3 protein]	22293420
D009599	Nitroprusside	pyrazolanthrone inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of CASP3 mRNA]	22293420
D009599	Nitroprusside	Cilostazol inhibits the reaction [Nitroprusside results in increased activity of CASP3 protein]	18311796
D009599	Nitroprusside	Nitroprusside results in increased activity of CASP3 protein	18311796; 20559625;
D009599	Nitroprusside	Nitroprusside results in increased expression of CASP3 protein modified form	29353218
D009599	Nitroprusside	GHRL protein inhibits the reaction [Nitroprusside results in increased cleavage of and results in increased activity of CASP3 protein]	17543279
D009599	Nitroprusside	Nitroprusside results in increased cleavage of and results in increased activity of CASP3 protein	17543279
C014707	nitrosobenzylmethylamine	nitrosobenzylmethylamine results in increased expression of CASP3 mRNA	17616710
C088437	nitrosonium tetrafluoroborate	nitrosonium tetrafluoroborate results in decreased activity of CASP3 protein	9441900
C088437	nitrosonium tetrafluoroborate	nitrosonium tetrafluoroborate results in increased metabolism of CASP3 protein	9441900
C088437	nitrosonium tetrafluoroborate	nitrosonium tetrafluoroborate inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	9441900
C039900	nitroxyl	3-aminobenzamide inhibits the reaction [[oxyhyponitrite results in increased abundance of nitroxyl] which results in increased activity of CASP3 protein]	11744336
C039900	nitroxyl	[oxyhyponitrite results in increased abundance of nitroxyl] which results in increased activity of CASP3 protein	11744336
C038405	nivalenol	nivalenol results in increased cleavage of CASP3 protein	19410639
C000591546	NKCT1 protein, Naja kaouthia	[Gold binds to NKCT1 protein, Naja kaouthia] which results in increased expression of CASP3 protein	27836789
C000591546	NKCT1 protein, Naja kaouthia	NKCT1 protein, Naja kaouthia results in increased expression of CASP3 protein	27836789
D018817	N-Methyl-3,4-methylenedioxyamphetamine	[N-Methyl-3,4-methylenedioxyamphetamine co-treated with N-Methyl-3,4-methylenedioxyamphetamine metabolite] results in increased activity of CASP3 protein	24101030
D018817	N-Methyl-3,4-methylenedioxyamphetamine	N-Methyl-3,4-methylenedioxyamphetamine results in increased expression of CASP3 mRNA	20188158
D018817	N-Methyl-3,4-methylenedioxyamphetamine	N-Methyl-3,4-methylenedioxyamphetamine results in increased activity of CASP3 protein	22983118; 27255387;
C047330	N-methylisoindigotin	N-methylisoindigotin results in increased cleavage of CASP3 protein	26887594
C000623013	NMS-873	NMS-873 results in increased activity of CASP3 protein	27434122; 29693262;
C000623013	NMS-873	NMS-873 results in increased cleavage of CASP3 protein	23892893
C419410	N-(N-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester	N-(N-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester results in increased expression of and results in increased activity of CASP3 protein	21209419
C037740	N,N'-bis(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid	N,N'-bis(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
C542681	N,N-dimethylphytosphingosine	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [N,N-dimethylphytosphingosine results in increased cleavage of and results in increased activity of CASP3 protein]	19481559
C542681	N,N-dimethylphytosphingosine	N,N-dimethylphytosphingosine results in increased activity of CASP3 protein	19481559
C061800	N,N-dimethylsphingosine	[Bortezomib co-treated with N,N-dimethylsphingosine] results in increased cleavage of and results in increased activity of CASP3 protein	21195056
C081306	N,N-di-n-hexyl-2-(4-fluorophenyl)indole-3-acetamide	N,N-di-n-hexyl-2-(4-fluorophenyl)indole-3-acetamide results in increased activity of CASP3 protein	15519653
C002741	N-nitrosomorpholine	N-nitrosomorpholine results in increased expression of CASP3 mRNA	19716841
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	[IFNG protein co-treated with TNF protein co-treated with N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine] results in increased activity of CASP3 protein	16844947
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	15966574
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine inhibits the reaction [SLC39A6 mutant form inhibits the reaction [trichostatin A results in increased cleavage of CASP3 protein]]	19887557
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine results in decreased expression of CASP3 mRNA	20957409
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine results in increased activity of CASP3 protein	17169355; 17979179;
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine results in increased expression of CASP3 protein	18778698
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Zinc inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine inhibits the reaction [SLC39A6 mutant form inhibits the reaction [trichostatin A results in increased cleavage of CASP3 protein]]]	19887557
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine results in increased activity of CASP3 protein	21239534
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Zinc inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine results in increased activity of CASP3 protein]	21239534
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid promotes the reaction [TNF protein results in increased activity of CASP3 protein]]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein results in increased activity of CASP3 protein]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid promotes the reaction [TNF protein results in increased activity of CASP3 protein]]]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein results in increased activity of CASP3 protein]]	10617950
C044387	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Zinc Acetate promotes the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]]	10617950
D015739	Nocodazole	Nocodazole analog results in decreased expression of CASP3 protein	28412508
D015739	Nocodazole	Nocodazole results in increased cleavage of CASP3 protein	21903591
C025256	nonylphenol	Acetylcysteine affects the reaction [nonylphenol results in increased cleavage of CASP3 protein]	23677851
C025256	nonylphenol	nonylphenol results in increased cleavage of CASP3 protein	23677851
C025256	nonylphenol	U 0126 inhibits the reaction [nonylphenol results in increased cleavage of CASP3 protein]	23677851
C025256	nonylphenol	nonylphenol results in decreased expression of CASP3 protein	27832966
C025256	nonylphenol	nonylphenol results in increased expression of CASP3 protein modified form	17065434; 27832966;
C051844	norbinaltorphimine	3-((3,5-bis(trifluoromethyl)phenyl)methyloxy)-2-phenylpiperidine inhibits the reaction [norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]]	29467000
C051844	norbinaltorphimine	norbinaltorphimine inhibits the reaction [ginsenoside Re inhibits the reaction [PDYN gene mutant form promotes the reaction [Methamphetamine results in increased cleavage of CASP3 protein]]]	29467000
C069741	norcantharidin	norcantharidin results in increased activity of CASP3 protein	20040369; 21266192;
C069741	norcantharidin	norcantharidin results in increased expression of CASP3 protein modified form	29193574
C069741	norcantharidin	U 0126 inhibits the reaction [norcantharidin results in increased expression of CASP3 protein modified form]	29193574
D009638	Norepinephrine	Acetylcysteine inhibits the reaction [Norepinephrine results in increased activity of and results in increased cleavage of CASP3 protein]	17136323
D009638	Norepinephrine	Norepinephrine results in increased activity of and results in increased cleavage of CASP3 protein	17136323
D009638	Norepinephrine	Acetylcysteine inhibits the reaction [Norepinephrine results in increased activity of CASP3 protein]	15158148; 17041759;
D009638	Norepinephrine	Ascorbic Acid inhibits the reaction [Norepinephrine results in increased activity of CASP3 protein]	15158148
D009638	Norepinephrine	N-(1-methyl-5-indolyl)-N'-(3-methyl-5-isothiazolyl)urea inhibits the reaction [Norepinephrine results in increased expression of CASP3 protein]	20374255
D009638	Norepinephrine	Norepinephrine inhibits the reaction [Okadaic Acid results in increased activity of CASP3 protein]	11099166
D009638	Norepinephrine	Norepinephrine results in increased activity of CASP3 protein	14732211; 15158148; 17041759; 18675472;
D009638	Norepinephrine	Norepinephrine results in increased cleavage of CASP3 protein	16338971
D009638	Norepinephrine	Norepinephrine results in increased expression of CASP3 protein	20374255
D009638	Norepinephrine	NGF protein inhibits the reaction [Norepinephrine results in increased cleavage of CASP3 protein]	16338971
D009661	Nortriptyline	Nortriptyline results in increased activity of CASP3 protein	22700542
D009661	Nortriptyline	Palmitic Acid promotes the reaction [Nortriptyline results in increased activity of CASP3 protein]	22700542
D009661	Nortriptyline	Nortriptyline results in decreased activity of CASP3 protein	17686041; 18174477;
D009665	Noscapine	[Noscapine co-treated with Cisplatin] results in increased cleavage of CASP3 protein	20674069
D009665	Noscapine	Noscapine promotes the reaction [Cisplatin results in increased expression of and results in increased cleavage of CASP3 protein]	20674069
D009665	Noscapine	Noscapine results in increased activity of CASP3 protein	22848370
D009665	Noscapine	Noscapine results in increased expression of and results in increased cleavage of CASP3 protein	20674069
C072936	notoginsenoside R1	MIR26A1 mRNA affects the reaction [notoginsenoside R1 inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]]	31158334
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]	31158334
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	23170834
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [Lipopolysaccharides results in increased expression of CASP3 protein modified form]	23170834
C072936	notoginsenoside R1	15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic Acid inhibits the reaction [notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]]	25305180
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [APP protein modified form results in increased cleavage of CASP3 protein]	24975829
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	24437944
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	25738436
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased activity of CASP3 protein]	24720662
C072936	notoginsenoside R1	notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]	25305180
C434926	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride	[N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride affects the susceptibility to Oxygen deficiency] which results in increased expression of CASP3 protein	17131054
C434926	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	16505238
C487513	NSC 23766	NSC 23766 inhibits the reaction [[CD47 protein binds to SIRPA protein] inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]]	28268219
C514334	NSC606985	Bortezomib promotes the reaction [NSC606985 results in increased activity of CASP3 protein]	19662097
C514334	NSC606985	NSC606985 results in increased activity of CASP3 protein	19662097
C514334	NSC606985	NSC606985 results in increased cleavage of and results in increased activity of CASP3 protein	19747914
C514334	NSC606985	rottlerin inhibits the reaction [NSC606985 results in increased activity of CASP3 protein]	19662097
C404397	NSC 680410	NSC 680410 results in increased cleavage of and results in increased activity of CASP3 protein	14647418
C404397	NSC 680410	NSC 680410 results in increased cleavage of CASP3 protein	16481037
C558013	NSC 689534	[NSC 689534 binds to Copper] which results in increased activity of CASP3 protein	20971185
C558013	NSC 689534	NSC 689534 results in increased activity of CASP3 protein	20971185
C520337	NSC 74859	[NSC 74859 results in decreased activity of STAT3 protein] which results in increased activity of CASP3 protein	24090995
C520337	NSC 74859	NSC 74859 results in decreased expression of CASP3 protein	24525192
C520337	NSC 74859	Paclitaxel promotes the reaction [NSC 74859 results in decreased expression of CASP3 protein]	24525192
C482205	nutlin 3	[nutlin 3 co-treated with Bortezomib] results in increased activity of CASP3 protein	20850924
C482205	nutlin 3	nutlin 3 results in increased activity of CASP3 protein	22260869
C482205	nutlin 3	nutlin 3 results in increased cleavage of and results in increased activity of CASP3 protein	16014563; 21109480;
C482205	nutlin 3	TP53 mutant form inhibits the reaction [nutlin 3 results in increased activity of CASP3 protein]	22260869
C571178	NVP-BKM120	NVP-BKM120 promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	30316766
C571178	NVP-BKM120	NVP-BKM120 results in increased activity of CASP3 protein	30316766
C000594859	nymphayol	nymphayol inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	25289771
C474958	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate	ATF3 mutant form inhibits the reaction [O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate results in increased cleavage of CASP3 protein]	22003962
C474958	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate analog results in increased cleavage of CASP3 protein	22003962
C474958	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate	[O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate co-treated with Buthionine Sulfoximine] results in increased cleavage of CASP3 protein	20962031
C474958	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate results in increased activity of CASP3 protein	21849924
C474958	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate	O(2)-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate results in increased cleavage of CASP3 protein	20962031
C107010	O(2)-vinyl-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate	O(2)-vinyl-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate inhibits the reaction [Acetaminophen results in increased expression of CASP3 protein]	12540782
C107010	O(2)-vinyl-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate	O(2)-vinyl-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate inhibits the reaction [Cadmium results in increased expression of CASP3 mRNA]	15010501
C067207	obacunone	obacunone results in decreased expression of CASP3 protein	21333732
C067207	obacunone	obacunone results in increased activity of CASP3 protein	21333732
C067207	obacunone	obacunone results in increased cleavage of and results in increased activity of CASP3 protein	25592883
C411188	obacunone glucoside	obacunone glucoside results in increased cleavage of and results in increased activity of CASP3 protein	25592883
C464660	obeticholic acid	obeticholic acid inhibits the reaction [Dietary Fats results in increased expression of CASP3 protein]	26655953
C464660	obeticholic acid	obeticholic acid promotes the reaction [Cycloheximide results in increased activity of CASP3 protein]	15860571
C408162	oblimersen	[Bortezomib co-treated with oblimersen co-treated with Cyclophosphamide] results in increased activity of CASP3 protein	16675587
C025589	ochratoxin A	Citrinin inhibits the reaction [ochratoxin A results in increased activity of CASP3 protein]	29673704
C025589	ochratoxin A	ochratoxin A analog results in increased activity of CASP3 protein	27422291
C025589	ochratoxin A	ochratoxin A results in decreased expression of CASP3 mRNA	17316727; 24755393;
C025589	ochratoxin A	ochratoxin A results in increased activity of CASP3 protein	15056805; 25002221; 27193732; 27422291; 29673704;
C025589	ochratoxin A	ochratoxin A results in increased cleavage of and results in increased activity of CASP3 protein	19367635; 20549612;
C025589	ochratoxin A	ochratoxin A results in increased cleavage of CASP3 protein	20060447
C025589	ochratoxin A	U 0126 inhibits the reaction [ochratoxin A results in increased activity of CASP3 protein]	25002221
C025589	ochratoxin A	Wortmannin promotes the reaction [ochratoxin A results in increased activity of CASP3 protein]	25002221
C025589	ochratoxin A	ochratoxin A results in decreased expression of CASP3 mRNA	12700408; 19815060;
C025589	ochratoxin A	ochratoxin A results in increased expression of CASP3 mRNA	30120945
C025589	ochratoxin A	ochratoxin A results in increased expression of CASP3 protein	30120945
C025589	ochratoxin A	SLC22A2 protein affects the reaction [ochratoxin A results in increased expression of CASP3 mRNA]	30120945
C025589	ochratoxin A	SLC22A2 protein promotes the reaction [ochratoxin A results in increased expression of CASP3 protein]	30120945
C025589	ochratoxin A	3-methyladenine promotes the reaction [ochratoxin A results in increased cleavage of CASP3 protein]	30287338
C025589	ochratoxin A	ATG5 protein affects the reaction [ochratoxin A results in increased cleavage of CASP3 protein]	30287338
C025589	ochratoxin A	BECN1 protein affects the reaction [ochratoxin A results in increased cleavage of CASP3 protein]	30287338
C025589	ochratoxin A	Chloroquine promotes the reaction [ochratoxin A results in increased cleavage of CASP3 protein]	30287338
C025589	ochratoxin A	ochratoxin A results in increased cleavage of CASP3 protein	30287338
C014138	octachlorostyrene	octachlorostyrene results in increased activity of CASP3 protein	18036774
D015282	Octreotide	Octreotide results in increased activity of CASP3 protein	16601281
D015282	Octreotide	[Octreotide results in increased activity of SSTR2 protein] which results in increased activity of CASP3 protein	16954443
C016627	octyl gallate	octyl gallate results in increased activity of CASP3 protein	21856409
C474055	octylphenol	[Streptozocin co-treated with octylphenol] results in increased expression of CASP3 mRNA	29935216
C080077	oenothein B	oenothein B results in increased cleavage of CASP3 protein	30452899
D015242	Ofloxacin	Ofloxacin results in increased activity of CASP3 protein	21903125; 23067722;
D019319	Okadaic Acid	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Okadaic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	19084044
D019319	Okadaic Acid	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Okadaic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	19084044
D019319	Okadaic Acid	Okadaic Acid inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D019319	Okadaic Acid	Okadaic Acid inhibits the reaction [Estradiol inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D019319	Okadaic Acid	Okadaic Acid inhibits the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D019319	Okadaic Acid	Okadaic Acid results in increased cleavage of and results in increased activity of CASP3 protein	19084044
D019319	Okadaic Acid	Okadaic Acid results in increased cleavage of CASP3 protein	27050422
D019319	Okadaic Acid	Quercetin inhibits the reaction [Okadaic Acid results in increased cleavage of CASP3 protein]	27050422
D019319	Okadaic Acid	Norepinephrine inhibits the reaction [Okadaic Acid results in increased activity of CASP3 protein]	11099166
D019319	Okadaic Acid	Okadaic Acid results in increased activity of CASP3 protein	11099166; 23335626; 26732598;
C531550	olaparib	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Fluorouracil co-treated with olaparib] results in increased cleavage of CASP3 protein]	26544897
C531550	olaparib	[Fluorouracil co-treated with olaparib] results in increased cleavage of CASP3 protein	26544897
C013168	olaquindox	CDKN1A protein affects the reaction [olaquindox results in increased cleavage of CASP3 protein]	28757460
C013168	olaquindox	olaquindox results in increased cleavage of CASP3 protein	28757460
C021065	oleandrin	oleandrin results in increased activity of CASP3 protein	24172227
C021065	oleandrin	oleandrin results in decreased cleavage of CASP3 protein	28438630
D009828	Oleanolic Acid	Ascorbic Acid inhibits the reaction [Oleanolic Acid results in increased cleavage of CASP3 protein]	22678527
D009828	Oleanolic Acid	Oleanolic Acid analog results in decreased expression of CASP3 protein	26612655
D009828	Oleanolic Acid	Oleanolic Acid results in increased activity of CASP3 protein	20005942
D009828	Oleanolic Acid	Oleanolic Acid results in increased cleavage of CASP3 protein	22678527
D009828	Oleanolic Acid	Oleanolic Acid results in increased expression of CASP3 protein	20726234
C522838	olesoxime	olesoxime results in decreased expression of CASP3 protein	30784942
C029407	oleylamide	oleylamide inhibits the reaction [[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]]	23747833
D009840	Oligomycins	[Rotenone co-treated with Oligomycins] inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D009842	Oligopeptides	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Oligopeptides analog results in increased cleavage of CASP3 protein]	24875536
D009842	Oligopeptides	Oligopeptides analog results in increased cleavage of CASP3 protein	24875536
D009842	Oligopeptides	Oligopeptides inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	25868679
D000069463	Olive Oil	Olive Oil results in increased activity of CASP3 protein	15309441
C437965	olmesartan	olmesartan results in decreased expression of and results in decreased activity of CASP3 protein	17208988
D000068557	Olmesartan Medoxomil	Olmesartan Medoxomil inhibits the reaction [Acetic Acid results in increased expression of CASP3 protein]	30594690
C083855	omega-agatoxin-Aa4b	omega-agatoxin-Aa4b inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D009853	Omeprazole	Omeprazole analog results in increased activity of CASP3 protein	18336733
D009853	Omeprazole	Omeprazole inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	30452898
D009853	Omeprazole	Omeprazole results in increased activity of CASP3 protein	18336733
D009853	Omeprazole	Omeprazole results in increased cleavage of CASP3 protein	15461867
D009853	Omeprazole	Omeprazole affects the expression of CASP3 mRNA	19483382
D009853	Omeprazole	Omeprazole inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	25637687
D009853	Omeprazole	Omeprazole inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	25637687
D009853	Omeprazole	Omeprazole inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	19251492
C507134	ON 01910	Imatinib Mesylate promotes the reaction [ON 01910 results in increased cleavage of CASP3 protein]	26008977
C507134	ON 01910	ON 01910 promotes the reaction [Imatinib Mesylate results in increased cleavage of CASP3 protein]	26008977
C507134	ON 01910	ON 01910 results in increased activity of CASP3 protein	21812421; 24471873;
C507134	ON 01910	ON 01910 results in increased cleavage of CASP3 protein	19198627; 25316768; 25472472; 26008977;
C105488	ONO 1301	ONO 1301 inhibits the reaction [[Galactosamine co-treated with lipopolysaccharide, E coli O55-B5] results in increased cleavage of CASP3 protein]	28887131
C009618	O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate	O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate results in increased activity of CASP3 protein	22634143
C016340	o,p'-DDT	o,p'-DDT analog results in increased expression of CASP3 protein	22937105
C016340	o,p'-DDT	o,p'-DDT results in increased expression of CASP3 mRNA	22937105
C016340	o,p'-DDT	o,p'-DDT results in increased expression of CASP3 protein	22937105
D009942	Organometallic Compounds	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Organometallic Compounds results in increased activity of CASP3 protein]	24781711
D009942	Organometallic Compounds	Organometallic Compounds affects the activity of CASP3 protein	24946146
D009942	Organometallic Compounds	Organometallic Compounds results in increased activity of CASP3	18760261
D009942	Organometallic Compounds	Organometallic Compounds results in increased activity of CASP3 protein	21194614; 21501578; 24781711; 26391003;
D009942	Organometallic Compounds	Organometallic Compounds results in increased cleavage of and results in increased activity of CASP3 protein	17210701
D009942	Organometallic Compounds	Organometallic Compounds results in increased cleavage of CASP3 protein	24905917
D009942	Organometallic Compounds	Organometallic Compounds results in decreased activity of CASP3 protein	18571097
D009944	Organoplatinum Compounds	Organoplatinum Compounds analog results in increased activity of CASP3 protein	15603970
D016566	Organoselenium Compounds	Organoselenium Compounds results in increased cleavage of CASP3 protein	24905917
C011959	oridonin	oridonin results in increased cleavage of CASP3 protein	16019488
C011959	oridonin	oridonin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	31430510
C011959	oridonin	oridonin inhibits the reaction [Kainic Acid results in increased activity of CASP3 protein]	31430510
D000077403	Orlistat	Orlistat results in increased activity of CASP3 protein	21723078
D000077403	Orlistat	Orlistat results in increased cleavage of CASP3 protein	17283163
D000077403	Orlistat	Orlistat results in increased activity of CASP3 protein	20805790
C000596361	osimertinib	Acetylcysteine inhibits the reaction [osimertinib results in increased expression of CASP3 protein modified form]	28237877
C000596361	osimertinib	CAT protein inhibits the reaction [osimertinib results in increased expression of CASP3 protein modified form]	28237877
C000596361	osimertinib	osimertinib results in increased expression of CASP3 protein modified form	28237877
C000596361	osimertinib	Vitamin E inhibits the reaction [osimertinib results in increased expression of CASP3 protein modified form]	28237877
C046627	osthol	osthol results in increased cleavage of CASP3 protein	29319219
C106408	OSW 1	OSW 1 analog results in increased activity of CASP3 protein	21438635
D010042	Ouabain	Ouabain results in increased activity of CASP3 protein	20435043
D010042	Ouabain	Ouabain results in increased activity of CASP3 protein	11435898; 18247327;
D010042	Ouabain	Ouabain results in increased expression of CASP3 protein	17096883
D010042	Ouabain	Ouabain results in decreased cleavage of CASP3 protein	28438630
D010047	Ovalbumin	[MYD88 gene mutant form affects the susceptibility to [Antigens, Bacterial co-treated with Ovalbumin]] which affects the expression of CASP3 mRNA	29067999
D000077150	Oxaliplatin	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Oxaliplatin results in increased activity of CASP3 protein]	20708607
D000077150	Oxaliplatin	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
D000077150	Oxaliplatin	[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein	19728331
D000077150	Oxaliplatin	Oxaliplatin results in increased activity of CASP3 protein	20708607
D000077150	Oxaliplatin	pifithrin inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
D000077150	Oxaliplatin	[pifithrin results in decreased activity of TP53 protein] results in decreased susceptibility to [Oxaliplatin results in increased activity of CASP3 protein]	20708607
D000077150	Oxaliplatin	[S100A11 mutant form results in increased susceptibility to Oxaliplatin] which results in increased activity of CASP3 protein	25940438
D000077150	Oxaliplatin	TP53 mutant form inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
D000077150	Oxaliplatin	Acetylcysteine inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D000077150	Oxaliplatin	Oxaliplatin results in increased expression of CASP3 protein	24908156
D000077150	Oxaliplatin	Quercetin inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D000077150	Oxaliplatin	Resveratrol inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D000077150	Oxaliplatin	Rutin inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D000077150	Oxaliplatin	Oxaliplatin results in increased activity of CASP3 protein	30254294
C015407	oxalomalic acid	oxalomalic acid promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	16785314
C015407	oxalomalic acid	oxalomalic acid promotes the reaction [Cadmium results in increased cleavage of CASP3 protein]	16785314
D000077431	Oxaprozin	Oxaprozin inhibits the reaction [CD40LG protein results in decreased activity of CASP3 protein]	19672323
C552952	oxazolinodaunorubicin	oxazolinodaunorubicin affects the expression of CASP3 mRNA	27780733
D010081	Oxazolone	Oxazolone results in increased activity of CASP3 protein	24055189
C011030	oxfendazole	oxfendazole results in increased cleavage of CASP3 protein	26558467
D016627	Oxidopamine	Caffeine inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	18201823
D016627	Oxidopamine	ginsenoside Rb1 inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	19781563
D016627	Oxidopamine	GSTP1 mutant form inhibits the reaction [salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]]	25271104
D016627	Oxidopamine	Oxidopamine results in increased activity of CASP3 protein	18201823; 18675900; 19443200; 19780897; 19781563; 20040370;
D016627	Oxidopamine	Oxidopamine results in increased cleavage of CASP3 protein	25271104; 25446857; 30707903;
D016627	Oxidopamine	PINK1 protein affects the reaction [salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]]	30707903
D016627	Oxidopamine	pinostilbene inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	19443200
D016627	Oxidopamine	Plant Extracts inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	20040370
D016627	Oxidopamine	puag-haad inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	18675900
D016627	Oxidopamine	pyrazolanthrone inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25446857
D016627	Oxidopamine	Resveratrol inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	18675900; 19443200;
D016627	Oxidopamine	salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25271104; 25446857; 30707903;
D016627	Oxidopamine	SB 203580 inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25446857
D016627	Oxidopamine	sulforafan inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	19780897
D016627	Oxidopamine	Oxidopamine results in increased activity of CASP3 protein	23518299
D016627	Oxidopamine	sulforafan inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	23518299
D016627	Oxidopamine	3-methyladenine inhibits the reaction [Oxidopamine results in increased expression of CASP3 protein modified form]	28802652
D016627	Oxidopamine	5,10,15,20-tetrakis(4-sulfonatophenyl)porphyrinato iron(III) chloride inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	21397656
D016627	Oxidopamine	Levodopa inhibits the reaction [Oxidopamine results in increased expression of CASP3 mRNA]	25129099
D016627	Oxidopamine	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	21846476
D016627	Oxidopamine	MDL 201053 inhibits the reaction [Oxidopamine results in increased expression of CASP3 protein modified form]	28802652
D016627	Oxidopamine	Oxidopamine results in increased activity of CASP3 protein	21397656; 21846476;
D016627	Oxidopamine	Oxidopamine results in increased cleavage of CASP3 protein	25446857
D016627	Oxidopamine	Oxidopamine results in increased expression of CASP3 mRNA	25129099
D016627	Oxidopamine	Oxidopamine results in increased expression of CASP3 protein modified form	28802652
D016627	Oxidopamine	Rutin inhibits the reaction [Oxidopamine results in increased expression of CASP3 mRNA]	25129099
D016627	Oxidopamine	salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25446857
C029341	oxophenylarsine	oxophenylarsine results in increased activity of CASP3 protein	10515888; 19465042;
C005290	oxybenzone	oxybenzone results in increased activity of CASP3 protein	30099065
C005290	oxybenzone	oxybenzone results in increased expression of and results in increased activity of CASP3 protein	31368502
D010100	Oxygen	HSPA1B protein inhibits the reaction [Oxygen results in increased activity of CASP3 protein]	26066050
D010100	Oxygen	KNK 437 promotes the reaction [Oxygen results in increased activity of CASP3 protein]	26066050
D010100	Oxygen	Oxygen results in increased activity of CASP3 protein	26066050
D010100	Oxygen	cyanidin 3-O-glucoside inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	24518827
D010100	Oxygen	iroxanadine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	15583868
D010100	Oxygen	N-ethoxymethyl-3-amino-1,2,4-benzotriazine-1,4-dioxide promotes the reaction [Oxygen deficiency results in increased cleavage of CASP3 protein]	20530905
D010100	Oxygen	Oxygen deficiency affects the reaction [Acetylcysteine results in increased activity of CASP3 protein]	17468103
D010100	Oxygen	[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of CASP3 protein	24557422
D010100	Oxygen	Oxygen deficiency inhibits the reaction [Etoposide results in increased expression of CASP3 protein]	23144690
D010100	Oxygen	Oxygen deficiency promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]	29690507
D010100	Oxygen	Oxygen deficiency promotes the reaction [Cisplatin promotes the reaction [2-hydroxymethyl-2-methoxymethylazabicyclo(2.2.2)octan-3-one results in increased cleavage of CASP3 protein]]	29690507
D010100	Oxygen	Oxygen deficiency promotes the reaction [HBEGF protein mutant form results in increased activity of CASP3 protein]	19193634
D010100	Oxygen	Oxygen deficiency promotes the reaction [HIF1A mutant form results in increased activity of CASP3 protein]	24860939
D010100	Oxygen	Oxygen deficiency results in increased activity of CASP3 protein	15583868; 24518827;
D010100	Oxygen	Oxygen deficiency results in increased cleavage of CASP3 protein	20530905
D010100	Oxygen	pyrazolanthrone inhibits the reaction [Oxygen deficiency promotes the reaction [HBEGF protein mutant form results in increased activity of CASP3 protein]]	19193634
D010100	Oxygen	Quercetin inhibits the reaction [iroxanadine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]]	15583868
D010100	Oxygen	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of CASP3 protein]	24557422
D010100	Oxygen	salvin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of CASP3 protein]	24557422
D010100	Oxygen	SIRT1 mutant form promotes the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of CASP3 protein]	24557422
D010100	Oxygen	[Butylated Hydroxytoluene co-treated with Oxygen] results in increased cleavage of CASP3 protein	16272459
D010100	Oxygen	MIR144 mRNA promotes the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29457851
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein	25238743; 25488258; 28675767; 29457851;
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein	24682241
D010100	Oxygen	Oxygen deficiency results in increased cleavage of CASP3 protein	24680926
D010100	Oxygen	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	25488258
D010100	Oxygen	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein]	24682241
D010100	Oxygen	SIRT7 protein inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	28675767
D010100	Oxygen	U 0126 inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein]	24682241
D010100	Oxygen	VDAC1 protein inhibits the reaction [Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	25488258
D010100	Oxygen	VDAC1 protein promotes the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	25488258
D010100	Oxygen	zAsp(Ome)-Arg-His-Asp(Ome)-fluoromethyl ketone inhibits the reaction [[Butylated Hydroxytoluene co-treated with Oxygen] results in increased cleavage of CASP3 protein]	16272459
D010100	Oxygen	15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic Acid inhibits the reaction [notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]]	25305180
D010100	Oxygen	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
D010100	Oxygen	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
D010100	Oxygen	4-phenylbutyric acid inhibits the reaction [Oxygen deficiency results in increased expression of CASP3 protein]	25450231
D010100	Oxygen	Antigen-Antibody Complex inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29702141
D010100	Oxygen	[Blood Glucose deficiency co-treated with Oxygen deficiency] results in increased cleavage of CASP3 protein	27693381
D010100	Oxygen	[Blood Glucose deficiency co-treated with Oxygen deficiency] results in increased expression of CASP3 mRNA	25322861
D010100	Oxygen	Capsaicin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased activity of CASP3 protein]	19011674
D010100	Oxygen	diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]	25896937
D010100	Oxygen	Ethanol promotes the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D010100	Oxygen	GSK3B protein inhibits the reaction [MIR135A mRNA inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	29719095
D010100	Oxygen	Hemin inhibits the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D010100	Oxygen	Hemin inhibits the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D010100	Oxygen	HMOX1 protein promotes the reaction [diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]]	25896937
D010100	Oxygen	MIR135A mRNA inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	29719095
D010100	Oxygen	naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]	25773745
D010100	Oxygen	NFE2L2 mutant form promotes the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]	25773745
D010100	Oxygen	NFE2L2 protein mutant form affects the reaction [plumbagin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	20028456
D010100	Oxygen	NFE2L2 protein promotes the reaction [diallyl trisulfide inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form]]	25896937
D010100	Oxygen	notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased activity of CASP3 protein]	24720662
D010100	Oxygen	notoginsenoside R1 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]	25305180
D010100	Oxygen	[N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride affects the susceptibility to Oxygen deficiency] which results in increased expression of CASP3 protein	17131054
D010100	Oxygen	[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased activity of CASP3 protein	24720662
D010100	Oxygen	[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein	25305180
D010100	Oxygen	[[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] co-treated with Hemin] results in increased cleavage of CASP3 protein	26747958
D010100	Oxygen	[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein	26747958
D010100	Oxygen	[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein	26747958
D010100	Oxygen	[Oxygen deficiency co-treated with Blood Glucose deficiency] results in increased expression of CASP3 protein modified form	24058562
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] affects the expression of and affects the activity of CASP3 protein	23637816
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein	15322300; 20028456; 29702141; 29719095;
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein	16135072
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein	23758074
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein modified form	25896937
D010100	Oxygen	[Oxygen deficiency co-treated with Oxygen] results in increased activity of CASP3 protein	19011674
D010100	Oxygen	[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein	25773745
D010100	Oxygen	Oxygen deficiency results in increased activity of CASP3 protein	11042672; 11526447; 12892836; 18541227;
D010100	Oxygen	Oxygen deficiency results in increased expression of and results in increased cleavage of CASP3 protein	29139225
D010100	Oxygen	Oxygen deficiency results in increased expression of CASP3 mRNA	25937560
D010100	Oxygen	Oxygen deficiency results in increased expression of CASP3 protein	25450231
D010100	Oxygen	panaxydol inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	18541227
D010100	Oxygen	Phenylephrine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	11042672
D010100	Oxygen	plumbagin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	20028456
D010100	Oxygen	Quercetin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein]	23758074
D010100	Oxygen	rottlerin inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
D010100	Oxygen	sodium bisulfide inhibits the reaction [[Oxygen deficiency co-treated with Blood Glucose deficiency] results in increased expression of CASP3 protein modified form]	24058562
D010100	Oxygen	Tacrolimus inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	12892836
D010100	Oxygen	Tea inhibits the reaction [Oxygen deficiency results in increased expression of and results in increased cleavage of CASP3 protein]	29139225
D010100	Oxygen	Trimetazidine inhibits the reaction [Oxygen deficiency results in increased expression of CASP3 mRNA]	25937560
D010100	Oxygen	Y 27632 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]	25305180
D010100	Oxygen	zinc protoporphyrin promotes the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
D010100	Oxygen	zinc protoporphyrin promotes the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D010100	Oxygen	[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein	24840287
D010100	Oxygen	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	24840287
C021229	oxyhyponitrite	3-aminobenzamide inhibits the reaction [[oxyhyponitrite results in increased abundance of nitroxyl] which results in increased activity of CASP3 protein]	11744336
C021229	oxyhyponitrite	[oxyhyponitrite results in increased abundance of nitroxyl] which results in increased activity of CASP3 protein	11744336
D010126	Ozone	[Ozone co-treated with Chlorine] affects the expression of CASP3 mRNA	18636392
D017239	Paclitaxel	[4-(6-cyclohexylmethoxy-9H-purin-2-ylamino)-N,N-diethylbenzamide co-treated with Paclitaxel] results in increased activity of CASP3 protein	16170024
D017239	Paclitaxel	[6-((3-chloro)anilino)-2-(isopropyl-2-hydroxyethylamino)-9-isopropylpurine co-treated with Paclitaxel] results in increased activity of CASP3 protein	16170024
D017239	Paclitaxel	AKT1 protein affects the reaction [Paclitaxel results in increased activity of CASP3 protein]	10075725
D017239	Paclitaxel	alvocidib promotes the reaction [Paclitaxel results in increased activity of CASP3 protein]	10430095
D017239	Paclitaxel	ARHGDIA mRNA affects the reaction [Paclitaxel results in increased activity of CASP3 protein]	17264767
D017239	Paclitaxel	CD40LG protein inhibits the reaction [Paclitaxel promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	16545138
D017239	Paclitaxel	CXCL8 inhibits the reaction [Paclitaxel results in increased activity of CASP3 protein]	21742513
D017239	Paclitaxel	[Doxorubicin co-treated with Paclitaxel co-treated with Fluorouracil] results in increased activity of CASP3 protein	16168113
D017239	Paclitaxel	[Doxorubicin co-treated with Paclitaxel] results in increased activity of CASP3 protein	16168113
D017239	Paclitaxel	[esculetin co-treated with Paclitaxel] results in increased cleavage of and results in increased activity of CASP3 protein	16051289
D017239	Paclitaxel	[fisetin co-treated with Paclitaxel] results in increased expression of CASP3 mRNA	26884726
D017239	Paclitaxel	inostamycin promotes the reaction [Paclitaxel results in increased expression of CASP3 protein modified form]	9818034
D017239	Paclitaxel	[Luteolin co-treated with Paclitaxel] results in increased cleavage of CASP3 protein	24525192
D017239	Paclitaxel	MAP2K4 protein affects the reaction [Paclitaxel results in increased activity of CASP3 protein]	10075725
D017239	Paclitaxel	MAP3K5 protein affects the reaction [Paclitaxel results in increased activity of CASP3 protein]	10075725
D017239	Paclitaxel	MAPK8 protein affects the reaction [Paclitaxel results in increased activity of CASP3 protein]	10075725
D017239	Paclitaxel	Nicotine inhibits the reaction [Paclitaxel results in increased activity of CASP3 protein]	20106947
D017239	Paclitaxel	[Paclitaxel co-treated with Cisplatin] results in increased activity of CASP3 protein	12709826
D017239	Paclitaxel	Paclitaxel promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	16545138
D017239	Paclitaxel	Paclitaxel promotes the reaction [NSC 74859 results in decreased expression of CASP3 protein]	24525192
D017239	Paclitaxel	Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein	10516758; 17399942;
D017239	Paclitaxel	Paclitaxel results in increased activity of CASP3 protein	10075725; 10430095; 10733772; 10822281; 11716366; 11774260; 12086014; 12709826; 17264767; 17701358; 18098270; 20106947; 21742513; 22302033; 28987329;
D017239	Paclitaxel	Paclitaxel results in increased cleavage of and results in increased activity of CASP3 protein	18521433; 19815708; 24126434;
D017239	Paclitaxel	Paclitaxel results in increased cleavage of CASP3 protein	15492279; 18071906; 27664577;
D017239	Paclitaxel	Paclitaxel results in increased expression of and results in increased activity of CASP3 protein	16140185
D017239	Paclitaxel	Paclitaxel results in increased expression of CASP3 mRNA	16140185; 26884726;
D017239	Paclitaxel	Paclitaxel results in increased expression of CASP3 protein	18098270; 31433962;
D017239	Paclitaxel	Paclitaxel results in increased expression of CASP3 protein modified form	9818034
D017239	Paclitaxel	palbociclib inhibits the reaction [Paclitaxel results in increased activity of CASP3 protein]	22302033
D017239	Paclitaxel	[PD168393 co-treated with Paclitaxel] results in increased cleavage of and results in increased activity of CASP3 protein	16413505
D017239	Paclitaxel	[pifithrin co-treated with Paclitaxel] results in increased cleavage of and results in increased activity of CASP3 protein	18516295
D017239	Paclitaxel	[Sirolimus co-treated with Paclitaxel] results in increased cleavage of CASP3 protein	15753396
D017239	Paclitaxel	[tipifarnib co-treated with Paclitaxel] results in increased activity of CASP3 protein	15728126
D017239	Paclitaxel	[Tretinoin co-treated with Paclitaxel] results in increased activity of CASP3 protein	17701358
D017239	Paclitaxel	TYMP mutant form promotes the reaction [Paclitaxel results in increased cleavage of CASP3 protein]	15492279
D017239	Paclitaxel	APAF1 protein affects the reaction [Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein]	17652622
D017239	Paclitaxel	[BAK1 protein mutant form co-treated with BAX protein mutant form] inhibits the reaction [Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein]	17652622
D017239	Paclitaxel	CASP9 protein affects the reaction [Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein]	17652622
D017239	Paclitaxel	Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein	17652622
D017239	Paclitaxel	Paclitaxel results in increased expression of CASP3 mRNA	17449502; 26091902;
D017239	Paclitaxel	BCL2L1 protein inhibits the reaction [Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein]	10516758
D017239	Paclitaxel	bryostatin 1 inhibits the reaction [BCL2L1 protein inhibits the reaction [Paclitaxel results in increased activity of and results in increased cleavage of CASP3 protein]]	10516758
C000588809	paederosidic acid	MAPK8 protein affects the reaction [paederosidic acid results in increased cleavage of CASP3 protein]	28185768
C000588809	paederosidic acid	paederosidic acid results in increased cleavage of CASP3 protein	28185768
C013638	paeonol	paeonol inhibits the reaction [Epirubicin results in increased cleavage of CASP3 protein]	26646421; 29505745;
C500026	palbociclib	palbociclib inhibits the reaction [Camptothecin results in increased activity of CASP3 protein]	22302033
C500026	palbociclib	palbociclib inhibits the reaction [Carboplatin results in increased activity of CASP3 protein]	22302033
C500026	palbociclib	palbociclib inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22302033
C500026	palbociclib	palbociclib inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	22751436
C500026	palbociclib	palbociclib inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	22302033
C500026	palbociclib	palbociclib inhibits the reaction [Paclitaxel results in increased activity of CASP3 protein]	22302033
C500026	palbociclib	palbociclib results in decreased cleavage of CASP3 protein	22751436
C500026	palbociclib	palbociclib results in increased cleavage of CASP3 protein	27099147
C500026	palbociclib	[palbociclib results in increased susceptibility to idelalisib] which results in increased cleavage of CASP3 protein	23676220
C500026	palbociclib	[CDKN2A gene mutant form results in increased susceptibility to palbociclib] which affects the activity of CASP3 protein	24098593
D010168	Palmitates	Corticosterone inhibits the reaction [Palmitates results in increased activity of CASP3 protein]	15755911
D010168	Palmitates	GPAM protein affects the reaction [Palmitates results in increased cleavage of CASP3 protein]	21209018
D010168	Palmitates	GPAM protein affects the reaction [TO-901317 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]]	21209018
D010168	Palmitates	GW 3965 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]	21209018
D010168	Palmitates	Palmitates results in increased activity of CASP3 protein	15755911; 20726854; 21209018;
D010168	Palmitates	Palmitates results in increased cleavage of CASP3 protein	21209018
D010168	Palmitates	Palmitates results in increased expression of CASP3 protein modified form	21209018
D010168	Palmitates	Progesterone inhibits the reaction [Palmitates results in increased activity of CASP3 protein]	20726854
D010168	Palmitates	SREBF1 protein affects the reaction [Palmitates results in increased cleavage of CASP3 protein]	21209018
D010168	Palmitates	SREBF1 protein affects the reaction [TO-901317 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]]	21209018
D010168	Palmitates	TO-901317 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]	21209018
D019308	Palmitic Acid	[Palmitic Acid co-treated with Glucose] results in increased cleavage of CASP3 protein	24451382
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [alpidem results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Clomipramine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Clozapine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Cyclosporine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Dipyridamole results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Estrone results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [fipexide results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Flecainide results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Fluoxetine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Fluvoxamine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Imipramine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Loratadine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Mitoxantrone results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [nefazodone results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Nimodipine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Nortriptyline results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Phentolamine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Propranolol results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Pyrimethamine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Riluzole results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Risperidone results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Spironolactone results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Ticlopidine results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [Troglitazone results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	Palmitic Acid promotes the reaction [zileuton results in increased activity of CASP3 protein]	22700542
D019308	Palmitic Acid	SIRT1 protein inhibits the reaction [[Palmitic Acid co-treated with Glucose] results in increased cleavage of CASP3 protein]	24451382
D019308	Palmitic Acid	Palmitic Acid results in decreased expression of and results in increased cleavage of CASP3 protein	21687928
D019308	Palmitic Acid	pyrrolidine dithiocarbamic acid inhibits the reaction [Palmitic Acid results in decreased expression of and results in increased cleavage of CASP3 protein]	21687928
D019308	Palmitic Acid	Acetylcysteine inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
D019308	Palmitic Acid	geniposide inhibits the reaction [Palmitic Acid results in increased expression of and results in increased activity of CASP3 protein]	22819839
D019308	Palmitic Acid	imoxin inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
D019308	Palmitic Acid	imoxin inhibits the reaction [Palmitic Acid results in increased expression of CASP3 protein]	30259999
D019308	Palmitic Acid	Palmitic Acid results in increased activity of CASP3 protein	17194744
D019308	Palmitic Acid	Palmitic Acid results in increased cleavage of and results in increased activity of CASP3 protein	22413010
D019308	Palmitic Acid	Palmitic Acid results in increased expression of and results in increased activity of CASP3 protein	22819839
D019308	Palmitic Acid	Palmitic Acid results in increased expression of CASP3 mRNA	30259999
D019308	Palmitic Acid	Palmitic Acid results in increased expression of CASP3 protein	30259999
D019308	Palmitic Acid	parthenolide inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
D019308	Palmitic Acid	pyrazolanthrone inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
D019308	Palmitic Acid	pyrazolanthrone inhibits the reaction [Palmitic Acid results in increased expression of CASP3 protein]	30259999
D019308	Palmitic Acid	SCD1 protein inhibits the reaction [Palmitic Acid results in increased activity of CASP3 protein]	22413010
D019308	Palmitic Acid	[TO-901317 co-treated with Alitretinoin] promotes the reaction [Palmitic Acid results in increased activity of CASP3 protein]	17194744
D019308	Palmitic Acid	TO-901317 promotes the reaction [Palmitic Acid results in increased activity of CASP3 protein]	17194744
D000077268	Pamidronate	Pamidronate results in increased cleavage of and results in increased activity of CASP3 protein	15346059
D000077268	Pamidronate	Pamidronate results in increased cleavage of CASP3 protein	16298452
C055778	panaxydol	panaxydol inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	18541227
C044997	pancratistatin	pancratistatin results in increased activity of CASP3 protein	15726366
C482884	panduratin A	panduratin A results in increased cleavage of CASP3 protein	16497706
D000077767	Panobinostat	[Resveratrol co-treated with Panobinostat] results in increased cleavage of CASP3 protein	22923501
D000077402	Pantoprazole	Pantoprazole inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	18853145
D010261	Paraoxon	Cyclosporine inhibits the reaction [Paraoxon results in increased activity of CASP3 protein]	11032765
D010261	Paraoxon	Paraoxon results in increased activity of CASP3 protein	11032765
D010261	Paraoxon	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Paraoxon results in increased cleavage of and results in increased activity of CASP3 protein]	12831782
D010261	Paraoxon	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane analog inhibits the reaction [Paraoxon results in increased cleavage of and results in increased activity of CASP3 protein]	12831782
D010261	Paraoxon	Paraoxon results in increased cleavage of and results in increased activity of CASP3 protein	12831782
D010261	Paraoxon	Paraoxon results in increased activity of CASP3 protein	17561261
D010261	Paraoxon	Ro 31-8220 inhibits the reaction [Paraoxon results in increased activity of CASP3 protein]	17561261
D010269	Paraquat	Paraquat results in increased activity of CASP3 protein	29107372
D010269	Paraquat	HSPA1L protein inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	24887138
D010269	Paraquat	Paraquat results in increased cleavage of CASP3 protein	24887138
D010269	Paraquat	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [salvin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]]	26686574
D010269	Paraquat	3-methyladenine promotes the reaction [Paraquat results in increased activity of CASP3 protein]	17341480
D010269	Paraquat	Acetylcysteine inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	31381934
D010269	Paraquat	ATG5 protein promotes the reaction [Paraquat results in increased cleavage of and results in increased activity of CASP3 protein]	23997112
D010269	Paraquat	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	22987761
D010269	Paraquat	CAT protein inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	24866057
D010269	Paraquat	GHRL protein inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	31381934
D010269	Paraquat	LGK974 inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	30205152
D010269	Paraquat	[Mifepristone co-treated with NFE2L2 protein] inhibits the reaction [Paraquat results in increased expression of CASP3 mRNA]	22736252
D010269	Paraquat	Mn(III) 5,10,15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	30185695
D010269	Paraquat	Paraquat promotes the reaction [Trientine results in increased activity of CASP3 protein]	11369509
D010269	Paraquat	Paraquat results in decreased expression of CASP3 mRNA	26468117
D010269	Paraquat	Paraquat results in increased activity of CASP3 protein	11369509; 17018646; 17341480; 18056701; 18253895; 19735704; 20929985; 22987761; 23807224; 24060684; 24130211; 24866057; 26686574; 28986289; 30144575; 30185695; 31381934;
D010269	Paraquat	Paraquat results in increased cleavage of and results in increased activity of CASP3 protein	23997112
D010269	Paraquat	Paraquat results in increased cleavage of CASP3 protein	22043816; 28428137; 30205152;
D010269	Paraquat	Paraquat results in increased expression of CASP3 mRNA	18836921; 22736252;
D010269	Paraquat	Paraquat results in increased expression of CASP3 protein	30698896; 31400064;
D010269	Paraquat	Paraquat results in increased expression of CASP3 protein modified form	28363843; 28414160; 28474156;
D010269	Paraquat	PRKN protein inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	30144575
D010269	Paraquat	PTGDS mutant form promotes the reaction [Paraquat results in increased cleavage of CASP3 protein]	22043816
D010269	Paraquat	[PTGDS protein results in decreased susceptibility to Paraquat] which results in decreased cleavage of CASP3 protein	22043816
D010269	Paraquat	pyrazolanthrone inhibits the reaction [Paraquat results in increased expression of CASP3 protein modified form]	28474156
D010269	Paraquat	salubrinal inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	19735704; 20929985; 28986289;
D010269	Paraquat	salvin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	26686574
D010269	Paraquat	SB 203580 inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	31381934
D010269	Paraquat	TLR9 protein promotes the reaction [Paraquat results in increased expression of CASP3 protein modified form]	28363843
D010269	Paraquat	AKT1 protein affects the reaction [Paraquat results in increased activity of CASP3 protein]	28115273
D010269	Paraquat	GPX1 protein affects the reaction [Paraquat results in increased activity of CASP3 protein]	12654481
D010269	Paraquat	GPX1 protein affects the reaction [Paraquat results in increased expression of CASP3 protein]	12654481
D010269	Paraquat	Paraquat results in increased activity of CASP3 protein	28115273
D010269	Paraquat	Paraquat results in increased cleavage of CASP3 protein	21300143; 28428137;
D010269	Paraquat	Paraquat results in increased expression of CASP3 mRNA	17215068
D010269	Paraquat	Paraquat results in increased expression of CASP3 protein	29054699
D010269	Paraquat	Paraquat results in increased expression of CASP3 protein modified form	27442881; 29054699;
D010269	Paraquat	PARK7 protein affects the reaction [Paraquat results in increased cleavage of CASP3 protein]	21300143
D010269	Paraquat	Silymarin inhibits the reaction [Paraquat results in increased expression of CASP3 protein modified form]	29054699
D010269	Paraquat	Acetylcysteine inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D010269	Paraquat	calpeptin inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D010269	Paraquat	Cyclosporine inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D010269	Paraquat	Dibucaine inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D010269	Paraquat	diphenyleneiodonium inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D010269	Paraquat	Edaravone inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D010269	Paraquat	epigallocatechin gallate inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	17936647
D010269	Paraquat	Minocycline inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	22245251
D010269	Paraquat	NFE2L2 mutant form inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	22678742
D010269	Paraquat	Paraquat results in increased activity of CASP3 protein	16310883; 17324951; 17561093; 17936647; 21777615; 22678742; 24912633;
D010269	Paraquat	Paraquat results in increased cleavage of CASP3 protein	22245251; 25947082;
D010269	Paraquat	Paraquat results in increased expression of CASP3 protein modified form	30967525
D010269	Paraquat	Sodium Salicylate inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	17561093
D010269	Paraquat	U 74389F inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
C412914	parasporin	parasporin results in increased expression of CASP3 mRNA	30708936
D010278	Parathion	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Parathion results in increased activity of CASP3 protein]	11032765
D010278	Parathion	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [Parathion results in increased activity of CASP3 protein]	11032765
D010278	Parathion	Cyclosporine inhibits the reaction [Parathion results in increased activity of CASP3 protein]	11032765
D010278	Parathion	Parathion results in increased activity of CASP3 protein	11032765
D017374	Paroxetine	Paroxetine results in increased activity of and results in increased cleavage of CASP3 protein	17174998
D017374	Paroxetine	Paroxetine results in increased activity of CASP3 protein	28482088
C022097	parthenin	parthenin analog results in increased activity of CASP3 protein	25196075
C002669	parthenolide	parthenolide inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
D052638	Particulate Matter	ARG2 protein affects the reaction [Particulate Matter results in increased activity of CASP3 protein]	26989813
D052638	Particulate Matter	Particulate Matter results in increased activity of CASP3 protein	17680010; 19573573; 22273695; 24139157; 26989813; 28189646;
D052638	Particulate Matter	Particulate Matter results in increased expression of CASP3 mRNA	24139157; 26856867; 30716388;
D052638	Particulate Matter	Particulate Matter results in increased expression of CASP3 protein	19675143
D052638	Particulate Matter	Particulate Matter results in increased cleavage of CASP3 protein	27187980; 30698894;
D052638	Particulate Matter	Particulate Matter results in increased expression of CASP3 protein	29540651
D052638	Particulate Matter	Vitamin D inhibits the reaction [Particulate Matter results in increased cleavage of CASP3 protein]	30698894
D052638	Particulate Matter	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one promotes the reaction [Particulate Matter results in increased cleavage of CASP3 protein]	26472149
D052638	Particulate Matter	Particulate Matter results in increased cleavage of CASP3 protein	26472149
D052638	Particulate Matter	Particulate Matter results in increased expression of CASP3 mRNA	24216475
D010365	Patulin	Patulin results in increased activity of CASP3 protein	25577197
D010365	Patulin	Patulin results in increased activity of CASP3 protein	19000704; 26095701;
C000610380	p-carboxymethylphenyl 1,1-bis(3'-indolyl)-1-(p-carboxymethylphenyl)methane	p-carboxymethylphenyl 1,1-bis(3'-indolyl)-1-(p-carboxymethylphenyl)methane results in increased cleavage of CASP3 protein	26035713
C410127	PCB 180	[2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of CASP3 protein	21291966
C410127	PCB 180	PCB 180 results in increased cleavage of CASP3 protein	21291966; 25659934;
C410127	PCB 180	PCB 180 results in increased expression of CASP3 protein	21291966
D020245	p-Chloromercuribenzoic Acid	p-Chloromercuribenzoic Acid results in decreased activity of CASP3 protein	26272509
C100442	PD 150606	PD 150606 inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21368866
C100442	PD 150606	PD 150606 inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
C100442	PD 150606	PD 150606 inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	16597613
C100442	PD 150606	PD 150606 inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	14527821
C509204	PD168393	[PD168393 co-treated with Paclitaxel] results in increased cleavage of and results in increased activity of CASP3 protein	16413505
C070619	pedicularioside A	pedicularioside A inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA]	18035349
C546733	pekinenal	pekinenal results in increased activity of CASP3 protein	30710624
C030856	pendimethalin	pendimethalin results in increased expression of CASP3 mRNA	30459330
D010396	Penicillamine	Penicillamine inhibits the reaction [APP protein results in increased activity of CASP3 protein]	12963085
D010396	Penicillamine	Penicillamine results in increased cleavage of CASP3 protein	19722195; 22843330;
D010396	Penicillamine	andrographolide promotes the reaction [Penicillamine inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]]	20946909
D010396	Penicillamine	Penicillamine inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]	20946909
D010396	Penicillamine	Penicillamine promotes the reaction [andrographolide inhibits the reaction [Copper Sulfate results in increased cleavage of CASP3 protein]]	20946909
C074968	pentaacetyl geniposide	Masoprocol inhibits the reaction [pentaacetyl geniposide results in increased cleavage of and results in increased activity of CASP3 protein]	17651887
C074968	pentaacetyl geniposide	Masoprocol inhibits the reaction [pentaacetyl geniposide results in increased expression of CASP3 protein]	17651887
C074968	pentaacetyl geniposide	pentaacetyl geniposide results in increased cleavage of and results in increased activity of CASP3 protein	17651887
C074968	pentaacetyl geniposide	pentaacetyl geniposide results in increased expression of CASP3 protein	17651887
C074968	pentaacetyl geniposide	pentaacetyl geniposide results in increased activity of CASP3 protein	15975050
C086401	pentabromodiphenyl ether	pentabromodiphenyl ether results in increased activity of CASP3 protein	18453545
C086401	pentabromodiphenyl ether	pentabromodiphenyl ether results in increased expression of CASP3 mRNA	23948077
D010416	Pentachlorophenol	Acetylcysteine inhibits the reaction [[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein]	30590774
D010416	Pentachlorophenol	[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein	30590774
D010416	Pentachlorophenol	Pentachlorophenol results in decreased activity of CASP3 protein	19766705
D010416	Pentachlorophenol	XIAP protein inhibits the reaction [[Pentachlorophenol co-treated with copper-1,10-phenanthroline] results in increased activity of CASP3 protein]	30590774
D010416	Pentachlorophenol	Pentachlorophenol results in increased expression of CASP3 protein	16823072
D010416	Pentachlorophenol	Pentachlorophenol results in increased expression of CASP3 mRNA	19442831
C572410	pentedrone	pentedrone results in increased activity of CASP3 protein	27255387
D004369	Pentetic Acid	Pentetic Acid results in increased activity of CASP3 protein	17169355
D010426	Pentosan Sulfuric Polyester	Pentosan Sulfuric Polyester results in increased expression of CASP3 mRNA	28973697
D010431	Pentoxifylline	Pentoxifylline results in increased activity of CASP3 protein	18851957
D010431	Pentoxifylline	Pentoxifylline inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	16317704
C480521	peonidin 3-glucoside	peonidin 3-glucoside results in decreased expression of CASP3 mRNA	30597948
C015423	peoniflorin	peoniflorin inhibits the reaction [Neomycin results in increased expression of CASP3 mRNA]	29292089
C015423	peoniflorin	peoniflorin inhibits the reaction [Neomycin results in increased expression of CASP3 protein modified form]	29292089
C015423	peoniflorin	peoniflorin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	27053303
C031375	pepstatin	pepstatin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	31226464
C031375	pepstatin	pepstatin affects the reaction [thallium nitrate results in increased activity of CASP3 protein]	22669516
C031375	pepstatin	pepstatin inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	28378122
C031375	pepstatin	pepstatin inhibits the reaction [thallium nitrate analog results in increased activity of CASP3 protein]	22669516
C494474	perchlorate	perchlorate results in increased activity of CASP3 protein	11834455
C494474	perchlorate	Sodium Iodide promotes the reaction [perchlorate results in increased activity of CASP3 protein]	11834455
C494474	perchlorate	perchlorate results in increased expression of CASP3 mRNA	17403546
C101816	perfluoro-n-nonanoic acid	perfluoro-n-nonanoic acid results in decreased cleavage of CASP3 protein	19878704
C101816	perfluoro-n-nonanoic acid	perfluoro-n-nonanoic acid results in decreased expression of CASP3 protein	19878704
C076994	perfluorooctane sulfonic acid	3-methyladenine inhibits the reaction [perfluorooctane sulfonic acid results in increased activity of CASP3 protein]	27413105
C076994	perfluorooctane sulfonic acid	MIR155 mRNA promotes the reaction [perfluorooctane sulfonic acid results in increased cleavage of CASP3 protein]	26844784
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in increased activity of CASP3 protein	22976841; 27413105;
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in increased cleavage of CASP3 protein	26844784
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in increased expression of CASP3 mRNA	21115943
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in increased cleavage of CASP3 protein	21467747; 26844784;
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in increased expression of CASP3 mRNA	24616003
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in increased expression of CASP3 protein	24616003; 27825932;
C076994	perfluorooctane sulfonic acid	perfluorooctane sulfonic acid results in decreased expression of CASP3 mRNA	18424238
C011272	perfosfamide	perfosfamide results in increased activity of CASP3	17434952
C011272	perfosfamide	perfosfamide promotes the reaction [TNF results in increased activity of CASP3 protein]	16488414
C105905	perifosine	[perifosine co-treated with Butyrates] results in increased activity of CASP3 protein	15781658
C105905	perifosine	[perifosine co-treated with trichostatin A] results in increased activity of CASP3 protein	15781658
C105905	perifosine	[perifosine co-treated with Vorinostat] results in increased activity of CASP3 protein	15781658
C105905	perifosine	perifosine results in decreased expression of CASP3 protein	25416439
D030421	Peroxynitrous Acid	Peroxynitrous Acid results in increased cleavage of CASP3 protein	21782928
D030421	Peroxynitrous Acid	demethoxycurcumin inhibits the reaction [Peroxynitrous Acid results in increased activity of CASP3 protein]	19188863
D030421	Peroxynitrous Acid	[Dithiothreitol co-treated with Peroxynitrous Acid] results in increased metabolism of CASP3 protein	9441900
D030421	Peroxynitrous Acid	Peroxynitrous Acid results in decreased activity of CASP3 protein	9441900
D030421	Peroxynitrous Acid	Peroxynitrous Acid results in increased activity of CASP3 protein	19188863
D030421	Peroxynitrous Acid	Curcumin inhibits the reaction [Peroxynitrous Acid results in increased cleavage of and results in increased activity of CASP3 protein]	20869986
D030421	Peroxynitrous Acid	Curcumin inhibits the reaction [Peroxynitrous Acid results in increased expression of CASP3 mRNA]	20869986
D030421	Peroxynitrous Acid	Peroxynitrous Acid results in increased cleavage of and results in increased activity of CASP3 protein	20869986
D030421	Peroxynitrous Acid	Peroxynitrous Acid results in increased expression of CASP3 mRNA	20869986
D030421	Peroxynitrous Acid	Peroxynitrous Acid inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	9441900
D010575	Pesticides	Pesticides results in increased cleavage of CASP3 protein	21987380
D010578	Petroleum	Petroleum results in increased expression of CASP3 protein	24106129
C539933	pevonedistat	pevonedistat results in increased cleavage of and results in increased activity of CASP3 protein	22110742
C539933	pevonedistat	Tretinoin promotes the reaction [pevonedistat results in increased cleavage of and results in increased activity of CASP3 protein]	22110742
C552719	PF-4708671	PF-4708671 promotes the reaction [Isoflurane results in increased cleavage of CASP3 protein]	25597859
C526145	Phellinus linteus extract	[Doxorubicin co-treated with Phellinus linteus extract] results in increased cleavage of and results in increased activity of CASP3 protein	16868541
C031181	phenanthrene	[naphthalene co-treated with anthracene co-treated with phenanthrene co-treated with pyrene] results in increased expression of CASP3 protein	28803881
C031181	phenanthrene	phenanthrene results in increased expression of CASP3 protein	28803881
D010622	Phencyclidine	6-Cyano-7-nitroquinoxaline-2,3-dione inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D010622	Phencyclidine	alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]	24995437
D010622	Phencyclidine	Cadmium Chloride inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D010622	Phencyclidine	Nifedipine inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D010622	Phencyclidine	omega-agatoxin-Aa4b inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
D010622	Phencyclidine	Phencyclidine results in increased activity of CASP3 protein	24995437
D010622	Phencyclidine	staurosporine aglycone inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
C058305	phenethyl isothiocyanate	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [phenethyl isothiocyanate results in increased activity of CASP3 protein]	16054126
C058305	phenethyl isothiocyanate	phenethyl isothiocyanate results in increased activity of CASP3 protein	16054126
C058305	phenethyl isothiocyanate	Vitamin E inhibits the reaction [phenethyl isothiocyanate results in increased activity of CASP3 protein]	16054126
D010634	Phenobarbital	Phenobarbital affects the expression of CASP3 mRNA	19159669
D010634	Phenobarbital	Phenobarbital inhibits the reaction [Lithocholic Acid results in increased cleavage of CASP3 protein]	19433268
D010634	Phenobarbital	Phenobarbital results in increased expression of CASP3 mRNA	19270015
D010634	Phenobarbital	Phenobarbital inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	10200566
D010634	Phenobarbital	Phenobarbital results in decreased activity of CASP3 protein	10200566
D010634	Phenobarbital	Phenobarbital results in increased expression of CASP3 mRNA	19815060
D019800	Phenol	Phenol results in increased activity of CASP3 protein	23776099
D010646	Phentolamine	Palmitic Acid promotes the reaction [Phentolamine results in increased activity of CASP3 protein]	22700542
D010646	Phentolamine	Phentolamine results in increased activity of CASP3 protein	22700542
D010656	Phenylephrine	Phenylephrine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	11042672
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in decreased activity of CASP3 protein	26272509
D010664	Phenylmethylsulfonyl Fluoride	Phenylmethylsulfonyl Fluoride inhibits the reaction [phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein]	11032765
D010664	Phenylmethylsulfonyl Fluoride	Phenylmethylsulfonyl Fluoride inhibits the reaction [tri-o-cresyl phosphate results in increased activity of CASP3 protein]	11032765
C046357	phenylsaligenin cyclic phosphate	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein]	11032765
C046357	phenylsaligenin cyclic phosphate	acetyl-isoleucyl-glutamyl-threonyl-aspartyl-aldehyde inhibits the reaction [phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein]	11032765
C046357	phenylsaligenin cyclic phosphate	Phenylmethylsulfonyl Fluoride inhibits the reaction [phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein]	11032765
C046357	phenylsaligenin cyclic phosphate	phenylsaligenin cyclic phosphate results in increased activity of CASP3 protein	11032765
D010696	Phloroglucinol	Phloroglucinol results in decreased expression of CASP3 protein modified form	20188716
D010696	Phloroglucinol	Phloroglucinol analog results in increased cleavage of CASP3 protein	23178381
D010696	Phloroglucinol	Phloroglucinol metabolite results in increased cleavage of CASP3 protein	22796323
D010702	Phorate	Phorate results in increased expression of CASP3 mRNA	22197610
D010702	Phorate	Phorate results in increased expression of CASP3 protein	22197610
C100823	phorbol 12-phenylacetate 13-acetate 20-homovanillate	phorbol 12-phenylacetate 13-acetate 20-homovanillate results in increased activity of CASP3 protein	10903936
D010713	Phosphatidylcholines	[rubitecan co-treated with Phosphatidylcholines] results in increased expression of CASP3 protein	21695227
C030090	phosphoramide mustard	phosphoramide mustard results in increased expression of CASP3 protein	26708502
C107448	phthalocyanine Pc 4	phthalocyanine Pc 4 results in increased cleavage of and results in increased activity of CASP3 protein	16007152
D010798	Phycocyanin	Phycocyanin inhibits the reaction [Galactose results in increased cleavage of CASP3 protein]	23036742
D010798	Phycocyanin	Phycocyanin inhibits the reaction [tributyltin results in increased activity of CASP3 protein]	21477642
D010798	Phycocyanin	Phycocyanin inhibits the reaction [tributyltin results in increased expression of CASP3 protein modified form]	26079211
D010833	Phytic Acid	Phytic Acid inhibits the reaction [Asbestos, Amosite results in increased activity of CASP3 protein]	11329530
D064209	Phytochemicals	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Phytochemicals results in increased expression of CASP3 protein modified form]	25305377
D064209	Phytochemicals	Phytochemicals results in increased expression of CASP3 protein modified form	25305377
D064209	Phytochemicals	pyrazolanthrone inhibits the reaction [Phytochemicals results in increased expression of CASP3 protein modified form]	25305377
D064209	Phytochemicals	Phytochemicals inhibits the reaction [Bleomycin results in increased expression of CASP3 mRNA]	26093215
D010836	Phytol	Phytol inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 protein]	30520250
C012491	phytosphingosine	3,4-dihydro-5-(4-(1-piperidinyl)butoxy)-1(2H)-isoquinolinone inhibits the reaction [[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein]	17237268
C012491	phytosphingosine	[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein	17237268
C012491	phytosphingosine	SB 203580 inhibits the reaction [[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein]	17237268
C522973	PI103	BCL2 protein inhibits the reaction [PI103 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
C522973	PI103	PI103 promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	23300809
C522973	PI103	PI103 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	20856197
C522973	PI103	TP53 protein promotes the reaction [PI103 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]]	20856197
C030614	picolinic acid	picolinic acid results in decreased activity of CASP3 protein	19853652
C030614	picolinic acid	picolinic acid results in increased activity of CASP3 protein	19853652
C121565	pifithrin	[pifithrin co-treated with Paclitaxel] results in increased cleavage of and results in increased activity of CASP3 protein	18516295
C121565	pifithrin	[pifithrin co-treated with thiocholchicine] results in increased cleavage of and results in increased activity of CASP3 protein	18516295
C121565	pifithrin	[pifithrin co-treated with Vinorelbine] results in increased cleavage of and results in increased activity of CASP3 protein	18516295
C121565	pifithrin	pifithrin inhibits the reaction [2,3,5-trichloro-6-phenyl-(1,4)benzoquinone results in decreased cleavage of CASP3 protein]	26451628
C121565	pifithrin	pifithrin inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C121565	pifithrin	pifithrin inhibits the reaction [5-Methoxypsoralen results in increased cleavage of CASP3 protein]	30576070
C121565	pifithrin	pifithrin inhibits the reaction [Mustard Gas results in decreased cleavage of CASP3 protein]	25448276
C121565	pifithrin	pifithrin inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
C121565	pifithrin	pifithrin inhibits the reaction [PSEN2 protein mutant form promotes the reaction [Staurosporine results in increased activity of CASP3 protein]]	12556443
C121565	pifithrin	pifithrin inhibits the reaction [Pyrroles analog results in increased expression of CASP3 protein modified form]	30543781
C121565	pifithrin	pifithrin inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	26884717
C121565	pifithrin	pifithrin inhibits the reaction [Silicon Dioxide results in increased expression of CASP3 protein modified form]	31082419
C121565	pifithrin	pifithrin inhibits the reaction [Silybin results in increased cleavage of and results in increased activity of CASP3 protein]	16777994
C121565	pifithrin	pifithrin promotes the reaction [Etoposide results in increased activity of CASP3 protein]	26259609
C121565	pifithrin	pifithrin promotes the reaction [Etoposide results in increased cleavage of CASP3 protein]	26259609
C121565	pifithrin	[pifithrin results in decreased activity of TP53 protein] results in decreased susceptibility to [Oxaliplatin results in increased activity of CASP3 protein]	20708607
C121565	pifithrin	pifithrin results in increased cleavage of CASP3 protein	28483490
C121565	pifithrin	[pifithrin results in increased susceptibility to Plant Preparations] which results in increased cleavage of CASP3 protein	29698619
C121565	pifithrin	pifithrin inhibits the reaction [6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]]	21593185
C121565	pifithrin	pifithrin inhibits the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15976193
C121565	pifithrin	pifithrin inhibits the reaction [Vehicle Emissions results in increased activity of CASP3 protein]	18940243
C121565	pifithrin	pifithrin promotes the reaction [Topotecan results in increased activity of CASP3 protein]	19812371
C121565	pifithrin	pifithrin inhibits the reaction [AGT protein modified form results in increased cleavage of CASP3 protein]	19808082
C121565	pifithrin	pifithrin inhibits the reaction [cyanoginosin LR results in increased cleavage of CASP3 protein]	31157505
C121565	pifithrin	pifithrin inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
C121565	pifithrin	pifithrin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18775851
C121565	pifithrin	pifithrin inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	16687611
C121565	pifithrin	pifithrin inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	12665479
C121565	pifithrin	pifithrin inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30009776
C121565	pifithrin	pifithrin results in decreased activity of CASP3 protein	16687611
C121565	pifithrin	pifithrin results in decreased expression of CASP3 protein	15144874; 18364113;
D010862	Pilocarpine	1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
D010862	Pilocarpine	1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
D010862	Pilocarpine	1-(6-((3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-2,5-dione inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
D010862	Pilocarpine	Pilocarpine results in increased activity of CASP3 protein	19927300
D010862	Pilocarpine	Verapamil inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
D010862	Pilocarpine	Pilocarpine results in increased activity of CASP3 protein	19631748
D010862	Pilocarpine	Pilocarpine results in increased cleavage of CASP3 protein	18815271
D010862	Pilocarpine	Pilocarpine results in increased expression of CASP3 protein modified form	18708038
D010862	Pilocarpine	ZFP110 protein mutant form inhibits the reaction [Pilocarpine results in increased cleavage of CASP3 protein]	18815271
D010862	Pilocarpine	Acetylcysteine inhibits the reaction [Pilocarpine results in increased cleavage of CASP3 protein]	22824136
D010862	Pilocarpine	Dizocilpine Maleate inhibits the reaction [Pilocarpine results in increased cleavage of CASP3 protein]	22824136
D010862	Pilocarpine	[Pilocarpine co-treated with Lithium] results in increased activity of CASP3 protein	20149694
D010862	Pilocarpine	Pilocarpine results in increased activity of CASP3 protein	21062633
D010862	Pilocarpine	Pilocarpine results in increased cleavage of and results in increased activity of CASP3 protein	12097334
D010862	Pilocarpine	Pilocarpine results in increased cleavage of CASP3 protein	19429016; 22824136;
D010862	Pilocarpine	Tacrolimus inhibits the reaction [[Lithium co-treated with Pilocarpine] results in increased activity of CASP3 protein]	20149694
D010862	Pilocarpine	Thioctic Acid inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	21062633
D010862	Pilocarpine	GHRL protein inhibits the reaction [Pilocarpine results in increased cleavage of CASP3 protein]	19429016
C004479	pimagedine	pimagedine inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D020110	Pinacidil	Pinacidil results in decreased expression of CASP3 mRNA	17612592
C522997	pinostilbene	pinostilbene inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	19443200
D000077205	Pioglitazone	Pioglitazone inhibits the reaction [Galactose results in increased activity of CASP3 protein]	23795773
D000077205	Pioglitazone	[naringin co-treated with Pioglitazone] inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
D000077205	Pioglitazone	Pioglitazone inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
C032727	piperidine	piperidine inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	17706638
C008922	piperine	piperine inhibits the reaction [Curcumin results in decreased expression of CASP3 protein]	30935902
C008922	piperine	piperine results in increased cleavage of CASP3 protein	28341137
C008922	piperine	piperine inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	16780805
C498077	piperlonguminine	[Doxorubicin co-treated with piperlonguminine] results in increased cleavage of CASP3 protein	30611789
C498077	piperlonguminine	piperlonguminine analog results in increased cleavage of CASP3 protein	31518571
D010882	Piperonyl Butoxide	Piperonyl Butoxide results in increased expression of CASP3 mRNA	22484513
C006253	pirinixic acid	pirinixic acid results in decreased expression of CASP3 mRNA	17426115; 18445702; 20813756;
C006253	pirinixic acid	[pirinixic acid results in increased expression of BCL2L1 protein] inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]	20709802
C006253	pirinixic acid	pirinixic acid affects the activity of CASP3 protein	16912651
C006253	pirinixic acid	pirinixic acid affects the expression of CASP3 protein	16912651
C006253	pirinixic acid	pirinixic acid affects the expression of CASP3 mRNA	19483382
C006253	pirinixic acid	pirinixic acid results in increased expression of CASP3 mRNA	19162173
C037850	PK 11195	PK 11195 results in increased activity of CASP3 protein	15519653
D010936	Plant Extracts	[Arsenic Trioxide co-treated with Plant Extracts] results in increased cleavage of CASP3 protein	26160715
D010936	Plant Extracts	Plant Extracts inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased cleavage of CASP3 protein]	27916511
D010936	Plant Extracts	Plant Extracts inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in increased expression of CASP3 protein modified form]	30626086
D010936	Plant Extracts	Plant Extracts inhibits the reaction [linsidomine results in increased cleavage of CASP3 protein]	23174672
D010936	Plant Extracts	Plant Extracts inhibits the reaction [linsidomine results in increased expression of CASP3 protein modified form]	23174672
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	20040370
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	21515038
D010936	Plant Extracts	Plant Extracts inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	20971099
D010936	Plant Extracts	Plant Extracts results in decreased expression of CASP3 mRNA	30597948
D010936	Plant Extracts	Plant Extracts results in decreased expression of CASP3 protein	16962711; 24021570;
D010936	Plant Extracts	Plant Extracts results in increased activity of CASP3 protein	17935706; 18070620; 19497419; 20600805; 20670616; 22705325; 22982777; 23911803; 24021570; 30935903;
D010936	Plant Extracts	Plant Extracts results in increased cleavage of and results in increased activity of CASP3 protein	17619071; 24534064;
D010936	Plant Extracts	Plant Extracts results in increased cleavage of CASP3 protein	20229524; 21920417; 23996930; 25449198; 25770932; 26122529; 26160715; 28811126; 30905866;
D010936	Plant Extracts	Plant Extracts results in increased expression of and results in increased activity of CASP3 protein	24677778
D010936	Plant Extracts	Plant Extracts results in increased expression of CASP3 mRNA	26122529
D010936	Plant Extracts	Plant Extracts inhibits the reaction [[9,10-Dimethyl-1,2-benzanthracene co-treated with Croton Oil] results in increased cleavage of and results in increased activity of CASP3 protein]	16517061
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Benzo(a)pyrene results in increased expression of CASP3 protein]	28032951
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Carbon Tetrachloride results in increased expression of CASP3 protein]	23279844
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Dextran Sulfate results in increased cleavage of CASP3 protein]	21989142
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Lead results in increased activity of CASP3 protein]	20466044
D010936	Plant Extracts	Plant Extracts inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	26064043
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Scopolamine results in increased expression of CASP3 mRNA]	26434561
D010936	Plant Extracts	Plant Extracts inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]	27723467
D010936	Plant Extracts	Plant Extracts results in decreased expression of CASP3 protein	23994094
D010936	Plant Extracts	Plant Extracts results in increased activity of CASP3 protein	19329757; 24991116;
D010936	Plant Extracts	Plant Extracts results in increased cleavage of CASP3 protein	23993977
D010936	Plant Extracts	Plant Extracts results in increased expression of CASP3 protein	20869020
D010936	Plant Extracts	salvianolic acid A inhibits the reaction [Plant Extracts results in increased expression of CASP3 protein]	23993977
D010936	Plant Extracts	TRP53 protein promotes the reaction [Plant Extracts inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]]	27723467
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Acetic Acid results in increased expression of CASP3 mRNA]	29518435
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Acetic Acid results in increased expression of CASP3 protein]	29518435
D010936	Plant Extracts	Plant Extracts inhibits the reaction [APP protein alternative form results in increased activity of CASP3 protein]	16406021
D010936	Plant Extracts	Plant Extracts inhibits the reaction [cobaltous chloride results in increased expression of CASP3 protein]	30551423
D010936	Plant Extracts	Plant Extracts inhibits the reaction [fipronil results in increased expression of CASP3 mRNA]	30777931
D010936	Plant Extracts	Plant Extracts inhibits the reaction [Lead results in increased cleavage of and results in increased activity of CASP3 protein]	22129743
D010936	Plant Extracts	Plant Extracts inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19772912
D010936	Plant Extracts	Plant Extracts results in decreased cleavage of CASP3 protein	29708300
D010936	Plant Extracts	Plant Extracts results in decreased expression of and results in decreased activity of CASP3 protein	16041641
D010936	Plant Extracts	Plant Extracts results in increased expression of CASP3 mRNA	30777931
D010938	Plant Oils	Plant Oils inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	22393308
D010938	Plant Oils	Plant Oils inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein modified form]	22393308
D010938	Plant Oils	Plant Oils inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30251767
D028321	Plant Preparations	[pifithrin results in increased susceptibility to Plant Preparations] which results in increased cleavage of CASP3 protein	29698619
D028321	Plant Preparations	Plant Preparations results in increased cleavage of and results in increased activity of CASP3 protein	15369734
D028321	Plant Preparations	Plant Preparations results in increased cleavage of CASP3 protein	29698619
D028321	Plant Preparations	Plant Preparations affects the expression of CASP3 mRNA	16046712
D028321	Plant Preparations	Plant Preparations results in increased expression of CASP3 mRNA	29643811
D028321	Plant Preparations	Plant Preparations results in increased expression of CASP3 protein	29643811
D028321	Plant Preparations	pristimerin inhibits the reaction [Plant Preparations results in increased expression of CASP3 mRNA]	29643811
D028321	Plant Preparations	pristimerin inhibits the reaction [Plant Preparations results in increased expression of CASP3 protein]	29643811
D028321	Plant Preparations	Plant Preparations inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	24875324
D028321	Plant Preparations	Plant Preparations inhibits the reaction [lead acetate results in increased expression of CASP3 mRNA]	30703413
D028321	Plant Preparations	Plant Preparations inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30703413
D028321	Plant Preparations	Plant Preparations results in decreased expression of CASP3 protein modified form	18283038
D028321	Plant Preparations	Plant Preparations results in increased expression of CASP3 mRNA	24973489
D010984	Platinum	[Gold analog co-treated with Platinum] results in increased activity of CASP3 protein	25846798
D010984	Platinum	[Gold analog co-treated with Platinum] results in increased expression of CASP3 mRNA	25846798
C108953	platycodin D	Acetylcysteine inhibits the reaction [platycodin D results in increased activity of CASP3 protein]	18804340
C108953	platycodin D	[MK 2206 co-treated with platycodin D] results in increased activity of CASP3 protein	27897231
C108953	platycodin D	[platycodin D co-treated with Imatinib Mesylate] results in increased cleavage of CASP3 protein	29552859
C108953	platycodin D	platycodin D results in increased activity of CASP3 protein	16631160; 18804340;
C108953	platycodin D	platycodin D results in increased cleavage of CASP3 protein	23236765; 24048756; 25532840;
C108953	platycodin D	platycodin D results in increased activity of CASP3 protein	26184636
C014758	plumbagin	plumbagin results in increased activity of CASP3 protein	20576514
C014758	plumbagin	NFE2L2 protein mutant form affects the reaction [plumbagin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	20028456
C014758	plumbagin	plumbagin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	20028456
C422648	pluronic block copolymer p85	pluronic block copolymer p85 promotes the reaction [Doxorubicin results in increased expression of CASP3 mRNA]	15939500
C422648	pluronic block copolymer p85	pluronic block copolymer p85 results in increased expression of CASP3 mRNA	15939500
D011034	Podophyllotoxin	Podophyllotoxin results in increased activity of CASP3 protein	21916509
C061957	polaprezinc	polaprezinc inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	11043455
D020442	Poloxamer	carvacrol inhibits the reaction [Poloxamer results in increased expression of CASP3 protein]	29071762
D020442	Poloxamer	carvacrol inhibits the reaction [Simvastatin promotes the reaction [Poloxamer results in increased expression of CASP3 protein]]	29071762
D020442	Poloxamer	Poloxamer results in increased expression of CASP3 protein	29071762
D020442	Poloxamer	Simvastatin promotes the reaction [Poloxamer results in increased expression of CASP3 protein]	29071762
C531249	Poly(amidoamine)	Poly(amidoamine) results in increased cleavage of CASP3 protein	19643170
D011084	Polycyclic Aromatic Hydrocarbons	Polycyclic Aromatic Hydrocarbons results in increased activity of CASP3 protein	28710019
D011084	Polycyclic Aromatic Hydrocarbons	Polycyclic Aromatic Hydrocarbons results in increased cleavage of CASP3 protein	21132278
D011092	Polyethylene Glycols	[Silver analog co-treated with Polyethylene Glycols] results in increased expression of CASP3 mRNA	27021274
D011094	Polyethyleneimine	[Niclosamide binds to Polyethyleneimine] which results in increased expression of CASP3 mRNA	25988281
D011094	Polyethyleneimine	[Polyethyleneimine binds to Gold] which results in increased expression of CASP3 mRNA	28433809
C034380	polygodial	polygodial results in increased activity of CASP3 protein	30935903
C060540	polyhexamethyleneguanidine	polyhexamethyleneguanidine results in increased cleavage of CASP3 protein	29309811
D011070	Poly I-C	Poly I-C results in increased activity of CASP3 protein	19563882
D011070	Poly I-C	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Poly I-C results in increased activity of CASP3 protein]]	21418039
D011070	Poly I-C	Acetylcysteine inhibits the reaction [Poly I-C promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	21418039
D011070	Poly I-C	Arsenic Trioxide promotes the reaction [Poly I-C results in increased activity of CASP3 protein]	21418039
D011070	Poly I-C	Poly I-C promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	21418039
D011070	Poly I-C	Poly I-C results in increased activity of CASP3 protein	21418039
D000077182	Polylactic Acid-Polyglycolic Acid Copolymer	[Polylactic Acid-Polyglycolic Acid Copolymer co-treated with Apigenin] results in increased expression of CASP3 mRNA	24070738
D000077182	Polylactic Acid-Polyglycolic Acid Copolymer	[Polylactic Acid-Polyglycolic Acid Copolymer co-treated with Apigenin] results in increased expression of CASP3 protein	24070738
D000077182	Polylactic Acid-Polyglycolic Acid Copolymer	[Nicotine co-treated with Polylactic Acid-Polyglycolic Acid Copolymer] inhibits the reaction [1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in increased expression of CASP3 protein]	23933227
C507889	polylactide-polyethylene glycol-polylactide	[Methotrexate co-treated with [Ferrosoferric Oxide binds to polylactide-polyethylene glycol-polylactide]] results in increased expression of CASP3 mRNA	24935781
C507889	polylactide-polyethylene glycol-polylactide	[Methotrexate co-treated with [Ferrosoferric Oxide binds to polylactide-polyethylene glycol-polylactide]] results in increased expression of CASP3 protein modified form	24935781
C505150	poly(N-vinylpyrrolidine)	[Silver analog co-treated with poly(N-vinylpyrrolidine)] results in increased cleavage of CASP3 protein	26028148
D059808	Polyphenols	[Polyphenols co-treated with Bleomycin] results in increased expression of CASP3 mRNA	26800624
D059808	Polyphenols	Polyphenols results in decreased expression of CASP3 protein	24021570
D059808	Polyphenols	Polyphenols results in increased activity of CASP3 protein	12481898; 19490839; 24021570;
D059808	Polyphenols	Polyphenols results in increased expression of CASP3 mRNA	30529121
D059808	Polyphenols	Polyphenols results in increased expression of CASP3 protein	30529121
D059808	Polyphenols	Polyphenols inhibits the reaction [Diethylnitrosamine results in increased activity of CASP3 protein]	19602430
D059808	Polyphenols	Polyphenols results in decreased activity of CASP3 protein	19602430
C472086	polyphenon E	polyphenon E results in increased cleavage of CASP3 protein	23285096
C556217	polyphyllin I	3-methyladenine inhibits the reaction [polyphyllin I results in increased expression of CASP3 protein modified form]	31421117
C556217	polyphyllin I	polyphyllin I results in increased expression of CASP3 protein modified form	26821882; 31421117;
C556217	polyphyllin I	pyrazolanthrone inhibits the reaction [polyphyllin I results in increased expression of CASP3 protein modified form]	31421117
D011134	Polysaccharides	Polysaccharides results in increased activity of CASP3 protein	23911803
D011134	Polysaccharides	Polysaccharides inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	24875324
D011134	Polysaccharides	Polysaccharides inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	31163222
C467566	pomalidomide	[afuresertib co-treated with pomalidomide co-treated with Dexamethasone] results in increased cleavage of CASP3 protein	29928335
C008999	ponasterone A	L-161982 inhibits the reaction [ponasterone A results in decreased activity of CASP3 protein]	16396944
C008999	ponasterone A	ponasterone A results in decreased activity of CASP3 protein	16396944
C545373	ponatinib	ponatinib results in increased cleavage of CASP3 protein	29341879
D011166	Porphyrins	Porphyrins results in increased expression of CASP3 mRNA	26468117
D011188	Potassium	2-iodomelatonin inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]	14962062
D011188	Potassium	4-phenyl-2-propionamidotetraline inhibits the reaction [2-iodomelatonin inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]]	14962062
D011188	Potassium	Potassium deficiency results in increased activity of CASP3 protein	11750908; 12654341; 14962062;
D011188	Potassium	Troglitazone inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]	11750908
C027373	potassium chromate(VI)	epigallocatechin gallate inhibits the reaction [potassium chromate(VI) results in increased cleavage of and results in increased activity of CASP3 protein]	22079256
C027373	potassium chromate(VI)	potassium chromate(VI) results in increased cleavage of and results in increased activity of CASP3 protein	22079256
D011192	Potassium Dichromate	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	14572611
D011192	Potassium Dichromate	CAT protein inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	14572611
D011192	Potassium Dichromate	nickel sulfate inhibits the reaction [Potassium Dichromate results in increased cleavage of and results in increased activity of CASP3 protein]	20493934
D011192	Potassium Dichromate	Plant Extracts inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	21515038
D011192	Potassium Dichromate	Potassium Dichromate inhibits the reaction [nickel sulfate results in increased cleavage of and results in increased activity of CASP3 protein]	20493934
D011192	Potassium Dichromate	Potassium Dichromate results in increased activity of CASP3 protein	14572611; 21515038;
D011192	Potassium Dichromate	Potassium Dichromate results in increased cleavage of and results in increased activity of CASP3 protein	20493934
D011192	Potassium Dichromate	[Cadmium Chloride co-treated with Potassium Dichromate] results in increased activity of CASP3 protein	25409916
D011192	Potassium Dichromate	[Cadmium Chloride co-treated with Potassium Dichromate] results in increased expression of CASP3 mRNA	25409916
D011192	Potassium Dichromate	Potassium Dichromate results in increased expression of CASP3 mRNA	25409916
D011192	Potassium Dichromate	Potassium Dichromate results in increased expression of CASP3 protein	19219935
D011192	Potassium Dichromate	Acetylcysteine inhibits the reaction [Potassium Dichromate results in increased activity of CASP3 protein]	18547707
D011192	Potassium Dichromate	Ascorbic Acid inhibits the reaction [Potassium Dichromate results in increased cleavage of CASP3 protein]	21262251
D011192	Potassium Dichromate	Carvedilol inhibits the reaction [Potassium Dichromate results in increased cleavage of CASP3 protein]	25245570
D011192	Potassium Dichromate	Potassium Dichromate results in increased activity of CASP3 protein	18547707
D011192	Potassium Dichromate	Potassium Dichromate results in increased cleavage of CASP3 protein	21262251; 25245570;
D011192	Potassium Dichromate	Potassium Dichromate results in increased expression of CASP3 protein modified form	26348139
C009006	potassium perchlorate	potassium perchlorate results in decreased expression of CASP3 mRNA	29673971
D011205	Povidone	[Silver co-treated with Povidone] affects the expression of CASP3 protein	27387714
D011205	Povidone	[Silver co-treated with Povidone] results in decreased expression of CASP3 mRNA	27387714
D045542	PQQ Cofactor	PQQ Cofactor inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	31226464
D045542	PQQ Cofactor	PQQ Cofactor inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27108097
C432807	pramanicin	pramanicin analog results in increased activity of CASP3 protein	23441183
D000077487	Pramipexole	Pramipexole inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	16362428
D017035	Pravastatin	[LDLR gene mutant form results in increased susceptibility to Pravastatin] which results in increased cleavage of CASP3 protein	26875785
D017035	Pravastatin	Pravastatin inhibits the reaction [Carboplatin results in increased expression of CASP3 protein]	20368269
D017035	Pravastatin	Pravastatin inhibits the reaction [Carboplatin results in increased expression of CASP3 protein]	18483861; 20368269;
D017035	Pravastatin	Pravastatin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	20368269
D017035	Pravastatin	Pravastatin results in increased cleavage of CASP3 protein	26875785
D011239	Prednisolone	montelukast inhibits the reaction [Prednisolone results in increased expression of CASP3 protein]	30276927
D011239	Prednisolone	Prednisolone results in increased expression of CASP3 protein	30276927
D000069583	Pregabalin	Pregabalin affects the expression of CASP3 protein	21394310
C023617	pregna-4,17-diene-3,16-dione	pregna-4,17-diene-3,16-dione results in increased activity of CASP3 protein	17475222
D011285	Pregnenolone Carbonitrile	Pregnenolone Carbonitrile inhibits the reaction [Lithocholic Acid results in increased cleavage of CASP3 protein]	19433268
D011285	Pregnenolone Carbonitrile	Pregnenolone Carbonitrile results in increased expression of CASP3 mRNA	19162173
C009043	pristimerin	pristimerin inhibits the reaction [Plant Preparations results in increased expression of CASP3 mRNA]	29643811
C009043	pristimerin	pristimerin inhibits the reaction [Plant Preparations results in increased expression of CASP3 protein]	29643811
D011335	Proadifen	Proadifen results in increased activity of CASP3 protein	22683934
D044945	Proanthocyanidins	Proanthocyanidins results in increased cleavage of CASP3 protein	29654773
D044945	Proanthocyanidins	Proanthocyanidins results in increased expression of CASP3 mRNA	29654773
D044945	Proanthocyanidins	Proanthocyanidins results in decreased expression of CASP3 mRNA	29205955
C479580	procyanidin B2	procyanidin B2 inhibits the reaction [MFGE8 protein results in increased expression of CASP3 protein modified form]	21505870
C479580	procyanidin B2	procyanidin B2 results in decreased expression of CASP3 protein modified form	21505870
C479580	procyanidin B2	3-methyladenine inhibits the reaction [procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]]	27057282
C479580	procyanidin B2	FOXO1 protein affects the reaction [procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]]	27057282
C479580	procyanidin B2	procyanidin B2 inhibits the reaction [Diquat results in increased expression of CASP3 mRNA]	27057282
C479580	procyanidin B2	procyanidin B2 inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]	27057282
D011353	Prodigiosin	Prodigiosin results in increased cleavage of CASP3 protein	15746575
C024273	profenofos	[cypermethrin co-treated with Chlorpyrifos co-treated with profenofos] results in increased cleavage of CASP3 protein	21987380
D011374	Progesterone	Progesterone results in increased expression of CASP3 mRNA	23012394
D011374	Progesterone	Progesterone results in increased activity of CASP3 protein	21933904
D011374	Progesterone	Progesterone promotes the reaction [Estrogens results in decreased expression of CASP3 protein]	18486349
D011374	Progesterone	CALB1 protein inhibits the reaction [Progesterone results in increased expression of CASP3 protein]	21882229
D011374	Progesterone	[CCN2 gene mutant form results in increased abundance of Progesterone] which results in increased expression of CASP3 mRNA	21868453
D011374	Progesterone	Progesterone results in increased expression of CASP3 protein	21882229
D011374	Progesterone	S100G protein inhibits the reaction [Progesterone results in increased expression of CASP3 protein]	21882229
D011374	Progesterone	Progesterone results in increased expression of CASP3 mRNA	19690047
D011374	Progesterone	BCL2L1 mRNA affects the reaction [Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	20726854
D011374	Progesterone	[Estradiol co-treated with Progesterone co-treated with Methylnitrosourea] results in decreased activity of CASP3 protein	22465879
D011374	Progesterone	[Methylnitrosourea co-treated with Progesterone co-treated with Estradiol] results in decreased expression of CASP3 mRNA	20732338
D011374	Progesterone	[Methylnitrosourea co-treated with Progesterone] results in decreased expression of CASP3 mRNA	20732338
D011374	Progesterone	Mifepristone inhibits the reaction [Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	20726854; 26915917;
D011374	Progesterone	Progesterone inhibits the reaction [Dicumarol promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]]	21947872
D011374	Progesterone	Progesterone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	20726854; 21947872; 26915917;
D011374	Progesterone	Progesterone inhibits the reaction [Isoproterenol results in increased activity of CASP3 protein]	20726854
D011374	Progesterone	Progesterone inhibits the reaction [Palmitates results in increased activity of CASP3 protein]	20726854
D011374	Progesterone	[Arsenic results in increased activity of CASP3 protein] which results in increased abundance of Progesterone	22963862
D011374	Progesterone	CASP3 protein affects the reaction [FSHB protein results in increased abundance of Progesterone]	22963862
C066229	prolinedithiocarbamate	[prolinedithiocarbamate analog co-treated with cupric chloride] results in increased activity of CASP3 protein	21035945
C066229	prolinedithiocarbamate	Acetylcysteine inhibits the reaction [[Mercuric Chloride co-treated with prolinedithiocarbamate] results in increased degradation of CASP3 protein]	22909951
C066229	prolinedithiocarbamate	[Mercuric Chloride co-treated with prolinedithiocarbamate] results in increased degradation of CASP3 protein	22909951
D011398	Promethazine	Promethazine results in decreased cleavage of CASP3 protein	26011634
C063776	propacetamol	kaempferol inhibits the reaction [propacetamol results in increased cleavage of CASP3 protein]	29574133
C063776	propacetamol	propacetamol results in increased cleavage of CASP3 protein	29574133
D011405	Propafenone	Propafenone results in increased activity of CASP3 protein	22700542
C045950	propiconazole	carvacrol inhibits the reaction [propiconazole results in increased expression of CASP3 protein]	29852196
C045950	propiconazole	propiconazole results in increased expression of CASP3 protein	29852196
C029658	propionic acid	Bee Venoms inhibits the reaction [propionic acid results in increased expression of CASP3 mRNA]	26048086
C029658	propionic acid	propionic acid results in increased expression of CASP3 mRNA	26048086
D015742	Propofol	Acetylcysteine inhibits the reaction [Propofol results in increased cleavage of CASP3 protein]	28804952
D015742	Propofol	Propofol results in increased cleavage of CASP3 protein	28804952
D015742	Propofol	Propofol results in increased activity of CASP3 protein	21786383
D015742	Propofol	HMOX1 protein affects the reaction [Propofol inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]]	24810525
D015742	Propofol	Propofol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22015447
D015742	Propofol	Propofol inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	24810525
D015742	Propofol	Propofol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	17640472
D015742	Propofol	Propofol inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	24810525
D015742	Propofol	Propofol results in decreased expression of CASP3	23353162
D015742	Propofol	Propofol results in increased expression of CASP3 protein modified form	26254736
D015742	Propofol	[Resveratrol co-treated with Propofol] results in decreased expression of CASP3	23353162
D015742	Propofol	STAT3 protein affects the reaction [Propofol inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]]	24810525
D011429	Propolis	Propolis results in increased activity of CASP3 protein	26367700
D011429	Propolis	Propolis inhibits the reaction [Doxorubicin results in increased expression of and results in increased activity of CASP3 protein]	24593989
D011433	Propranolol	Propranolol inhibits the reaction [[Iron co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein]	16456084
D011433	Propranolol	Propranolol inhibits the reaction [[Iron-Dextran Complex co-treated with dihydroxyfumarate] results in increased activity of CASP3 protein]	16456084
D011433	Propranolol	Palmitic Acid promotes the reaction [Propranolol results in increased activity of CASP3 protein]	22700542
D011433	Propranolol	Propranolol results in increased activity of CASP3 protein	22700542
D011433	Propranolol	Propranolol results in increased cleavage of CASP3 protein	19106745
D011433	Propranolol	Propranolol results in decreased expression of CASP3 mRNA	11218852
C006068	propylparaben	propylparaben results in increased expression of CASP3 mRNA	24481588
D011441	Propylthiouracil	Propylthiouracil results in increased expression of and affects the localization of CASP3 protein	16059974
D011441	Propylthiouracil	Propylthiouracil affects the expression of CASP3 mRNA	19483382
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of CASP3 mRNA	17403546
D015230	Prostaglandin D2	Prostaglandin D2 results in increased activity of CASP3 protein	15843042
D015230	Prostaglandin D2	Prostaglandin D2 results in increased cleavage of CASP3 protein	23973622
C518978	prostaglandin E2 glyceryl ester	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [prostaglandin E2 glyceryl ester results in increased cleavage of and results in increased activity of CASP3 protein]	17539917
C518978	prostaglandin E2 glyceryl ester	prostaglandin E2 glyceryl ester results in increased cleavage of and results in increased activity of CASP3 protein	17539917
C518978	prostaglandin E2 glyceryl ester	SB 239063 inhibits the reaction [prostaglandin E2 glyceryl ester results in increased cleavage of and results in increased activity of CASP3 protein]	17539917
D047428	Protein Kinase Inhibitors	Protein Kinase Inhibitors inhibits the reaction [MAP3K20 protein results in increased expression of CASP3 protein modified form]	29105997
D047428	Protein Kinase Inhibitors	Protein Kinase Inhibitors results in increased cleavage of CASP3 protein	21878655
D047428	Protein Kinase Inhibitors	Protein Kinase Inhibitors results in increased expression of CASP3 protein modified form	29105997
D047428	Protein Kinase Inhibitors	Protein Kinase Inhibitors inhibits the reaction [cobaltous chloride results in increased expression of CASP3 protein modified form]	21925238
D047428	Protein Kinase Inhibitors	Protein Kinase Inhibitors inhibits the reaction [Lipopolysaccharides results in increased expression of CASP3 protein]	28070109
C009091	protocatechuic acid	protocatechuic acid inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	18082360
C531013	protocatechuic acid methyl ester	protocatechuic acid methyl ester inhibits the reaction [Sodium Fluoride results in increased expression of CASP3 protein modified form]	29758312
C095781	protolichesterinic acid	protolichesterinic acid results in increased activity of CASP3 protein	22063921
C028025	protoporphyrin IX	protoporphyrin IX results in decreased activity of CASP3 protein	16051694
C028025	protoporphyrin IX	Doxorubicin promotes the reaction [protoporphyrin IX results in increased activity of CASP3 protein]	18845130
C028025	protoporphyrin IX	protoporphyrin IX results in increased activity of CASP3 protein	18845130
C456319	PS1145	PS1145 inhibits the reaction [sodium arsenite results in increased cleavage of and results in increased activity of CASP3 protein]	19616567
C107773	pterostilbene	2-tert-butylhydroquinone inhibits the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
C107773	pterostilbene	Acetylcysteine inhibits the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
C107773	pterostilbene	Buthionine Sulfoximine promotes the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
C107773	pterostilbene	CAT protein inhibits the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
C107773	pterostilbene	pterostilbene results in increased activity of CASP3 protein	20152895; 25341683;
C107773	pterostilbene	pterostilbene results in increased cleavage of CASP3 protein	23313376
C107773	pterostilbene	pterostilbene results in increased expression of CASP3 mRNA	20152895; 24936659;
C107773	pterostilbene	Thapsigargin promotes the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
C107773	pterostilbene	pterostilbene results in increased cleavage of CASP3 protein	20681671
C015047	p-tert-butyl catechol	p-tert-butyl catechol results in increased activity of CASP3 protein	30461186
C034912	puag-haad	puag-haad inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	18675900
C034912	puag-haad	puag-haad inhibits the reaction [tert-Butylhydroperoxide results in decreased expression of CASP3 protein]	26102008
C033607	puerarin	Arsenic Trioxide promotes the reaction [puerarin results in increased expression of CASP3 protein]	20416161
C033607	puerarin	puerarin results in increased activity of CASP3 protein	16055262
C033607	puerarin	puerarin results in increased expression of CASP3 protein	20416161
C033607	puerarin	puerarin inhibits the reaction [cadmium acetate results in increased activity of CASP3 protein]	27717697
C033607	puerarin	puerarin inhibits the reaction [lead nitrate results in increased activity of CASP3 protein]	24505050
C033607	puerarin	puerarin results in decreased expression of and results in decreased activity of CASP3 protein	16041641
C526689	punarnavine	punarnavine results in increased expression of CASP3 mRNA	20192578
C115642	punicalagin	punicalagin results in increased expression of CASP3 protein	28709945
D011691	Puromycin	Melatonin promotes the reaction [Puromycin results in increased activity of CASP3 protein]	21244482
D011691	Puromycin	Puromycin results in increased activity of CASP3 protein	21244482
D011691	Puromycin	Puromycin results in increased activity of CASP3 protein	14502240
D011692	Puromycin Aminonucleoside	Colforsin inhibits the reaction [Puromycin Aminonucleoside results in increased activity of CASP3 protein]	16396944
D011692	Puromycin Aminonucleoside	Dinoprostone inhibits the reaction [Puromycin Aminonucleoside results in increased activity of CASP3 protein]	16396944
D011692	Puromycin Aminonucleoside	L-161982 promotes the reaction [Puromycin Aminonucleoside results in increased activity of CASP3 protein]	16396944
D011692	Puromycin Aminonucleoside	Puromycin Aminonucleoside results in increased activity of CASP3 protein	16396944
D011700	Putrescine	Putrescine results in increased expression of CASP3 protein	17606387
C572726	pycnidione	pycnidione results in increased activity of and results in increased cleavage of CASP3 protein	22450442
C024070	pycnogenols	pycnogenols inhibits the reaction [APP protein results in increased activity of CASP3]	12117551
C024070	pycnogenols	pycnogenols results in increased activity of CASP3 protein	15146544
D011718	Pyrazinamide	Pyrazinamide results in increased cleavage of CASP3 protein	28063906
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [2,5-diaziridinyl-3-(hydroxymethyl)-6-methyl-1,4-benzoquinone analog results in decreased expression of CASP3 protein]	26630137
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [2-aminodiphenyl results in increased activity of CASP3 protein]	23836369
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [5-((4-methylphenyl)methylene)-2-(phenylamino)-4(5H)-thiazolone results in increased cleavage of CASP3 protein]	15831436
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [6-(N,N-dimethylamino)-2-(naphthalene-1-yl)-4-quinazolinone results in increased expression of CASP3 protein]	23212307
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [8-bromo-7-methoxychrysin results in increased activity of CASP3 protein]	20632440
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[Arsenic Trioxide co-treated with Ethacrynic Acid] results in increased cleavage of CASP3 protein]	23082001
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Bortezomib results in increased activity of CASP3 protein]	16357177
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Bortezomib results in increased cleavage of CASP3 protein]	12393500
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein modified form]	23416140
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Citrinin results in increased activity of CASP3 protein]	18767140; 19361540;
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [coronarin D results in increased expression of CASP3 protein modified form]	29968959
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [dehydroxymethylepoxyquinomicin results in increased cleavage of CASP3 protein]	15501958
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	16843435
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[fludarabine co-treated with 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] results in increased cleavage of CASP3 protein]	15850772
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Ketoconazole results in increased activity of CASP3 protein]	19631732
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25446857
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Oxygen deficiency promotes the reaction [HBEGF protein mutant form results in increased activity of CASP3 protein]]	19193634
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Paraquat results in increased expression of CASP3 protein modified form]	28474156
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Phytochemicals results in increased expression of CASP3 protein modified form]	25305377
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [polyphyllin I results in increased expression of CASP3 protein modified form]	31421117
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	21165570
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[Sirolimus co-treated with 7-hydroxystaurosporine] results in increased cleavage of CASP3 protein]	15767555
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	18281123
C432165	pyrazolanthrone	pyrazolanthrone promotes the reaction [dihydromyricetin results in increased cleavage of CASP3 protein]	27539140
C432165	pyrazolanthrone	pyrazolanthrone promotes the reaction [FAS protein results in increased cleavage of and results in increased activity of CASP3 protein]	16061660
C432165	pyrazolanthrone	pyrazolanthrone promotes the reaction [usnic acid results in increased activity of CASP3 protein]	25078063
C432165	pyrazolanthrone	pyrazolanthrone results in decreased activity of CASP3 protein	15095415
C432165	pyrazolanthrone	pyrazolanthrone results in increased activity of CASP3 protein	15034932
C432165	pyrazolanthrone	pyrazolanthrone results in increased expression of CASP3 protein modified form	28383207
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	16322078
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	24157283
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	15254339
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Sodium Fluoride results in increased activity of CASP3 protein]	23578390
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [TEMPO results in increased activity of CASP3 protein]	25882087
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16712891
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Daunorubicin results in increased cleavage of CASP3 protein]	22252735
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of and results in increased activity of CASP3 protein]	22293420
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased expression of CASP3 mRNA]	22293420
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [bakuchiol results in increased activity of and results in increased cleavage of CASP3 protein]	17292878
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	24577723; 25043952;
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	18703135
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	23405080; 24111524;
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Carmustine results in increased activity of and results in increased cleavage of CASP3 protein]	21600974
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased cleavage of CASP3 protein]	20920558
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30928397
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [[IFNG protein co-treated with IL1B protein] results in increased activity of CASP3 protein]	21295052
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Isoflurane results in increased expression of CASP3 protein modified form]	29289695
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [manganese chloride results in increased cleavage of CASP3 protein]	16787641
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [manganese chloride results in increased expression of CASP3 protein]	16787641
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Manganese results in increased cleavage of CASP3 protein]	16787641
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Manganese results in increased expression of CASP3 protein]	16787641
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [nickel chloride results in increased activity of CASP3 protein]	21843586
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Palmitic Acid results in increased expression of CASP3 mRNA]	30259999
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Palmitic Acid results in increased expression of CASP3 protein]	30259999
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [satratoxin H results in increased cleavage of CASP3 protein]	22863859
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	20830294
C432165	pyrazolanthrone	pyrazolanthrone inhibits the reaction [Vitamin K 3 results in increased cleavage of CASP3 protein]	16310883
C432165	pyrazolanthrone	pyrazolanthrone promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
C432165	pyrazolanthrone	Taurine promotes the reaction [pyrazolanthrone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	20830294
C014175	pyrazolo(3,4-d)pyrimidine	pyrazolo(3,4-d)pyrimidine analog affects the expression of CASP3 mRNA	21152443
C030984	pyrene	[naphthalene co-treated with anthracene co-treated with phenanthrene co-treated with pyrene] results in increased expression of CASP3 protein	28803881
C030984	pyrene	pyrene results in increased expression of CASP3 protein	28803881
C030984	pyrene	pyrene results in increased activity of CASP3 protein	31368503
C030984	pyrene	pyrene results in increased expression of CASP3 mRNA	19815060
D011722	Pyrethrins	Pyrethrins results in increased activity of CASP3 protein	27939866
D011729	Pyridostigmine Bromide	Pyridostigmine Bromide results in decreased expression of CASP3 mRNA	31175926
D011729	Pyridostigmine Bromide	Pyridostigmine Bromide results in decreased expression of CASP3 protein	31175926
D011729	Pyridostigmine Bromide	SOD2 protein SNP affects the reaction [Pyridostigmine Bromide results in decreased expression of CASP3 mRNA]	31175926
D011729	Pyridostigmine Bromide	SOD2 protein SNP affects the reaction [Pyridostigmine Bromide results in decreased expression of CASP3 protein]	31175926
D011739	Pyrimethamine	Palmitic Acid promotes the reaction [Pyrimethamine results in increased activity of CASP3 protein]	22700542
D011739	Pyrimethamine	[Pyrimethamine co-treated with Temozolomide] results in increased cleavage of CASP3 protein	19435820
D011739	Pyrimethamine	Pyrimethamine results in increased activity of CASP3 protein	22700542
C108337	pyrimethanil	pyrimethanil affects the expression of CASP3 mRNA	22880100
C108337	pyrimethanil	[pyrimethanil co-treated with cyprodinil co-treated with fludioxonil] results in increased expression of CASP3 mRNA	22880100
C009131	pyrimidin-2-one beta-ribofuranoside	pyrimidin-2-one beta-ribofuranoside results in increased cleavage of CASP3 protein	19459041
C008704	pyrithione	[zinc chloride co-treated with pyrithione] inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased activity of CASP3 protein]	21239534
C010423	pyrithione zinc	pyrithione zinc results in increased activity of CASP3 protein	20151177; 21557991;
D011748	Pyrogallol	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Pyrogallol results in increased activity of CASP3 protein]	20191265
D011748	Pyrogallol	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Pyrogallol results in increased activity of CASP3 protein]	19000662
D011748	Pyrogallol	Pyrogallol results in increased activity of CASP3 protein	19000662; 20191265;
D011748	Pyrogallol	SB 203580 inhibits the reaction [Pyrogallol results in increased activity of CASP3 protein]	20191265
C005719	pyrovalerone	Acetylcysteine inhibits the reaction [pyrovalerone analog results in increased activity of CASP3 protein]	28578026
C005719	pyrovalerone	pyrovalerone analog results in increased activity of CASP3 protein	28578026
D011758	Pyrroles	pifithrin inhibits the reaction [Pyrroles analog results in increased expression of CASP3 protein modified form]	30543781
D011758	Pyrroles	Pyrroles analog results in increased activity of CASP3 protein	30543781
D011758	Pyrroles	Pyrroles analog results in increased expression of CASP3 protein modified form	30543781
C020972	pyrrolidine dithiocarbamic acid	[pyrrolidine dithiocarbamic acid binds to Copper] which results in increased activity of CASP3 protein	18671963
C020972	pyrrolidine dithiocarbamic acid	pyrrolidine dithiocarbamic acid inhibits the reaction [Palmitic Acid results in decreased expression of and results in increased cleavage of CASP3 protein]	21687928
C020972	pyrrolidine dithiocarbamic acid	Acetylcysteine inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
C020972	pyrrolidine dithiocarbamic acid	Acetylcysteine inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased cleavage of CASP3 protein]	22085843
C020972	pyrrolidine dithiocarbamic acid	bathocuproine sulfonate inhibits the reaction [[pyrrolidine dithiocarbamic acid co-treated with Copper] results in increased activity of CASP3 protein]	10941151
C020972	pyrrolidine dithiocarbamic acid	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
C020972	pyrrolidine dithiocarbamic acid	[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein	22085843
C020972	pyrrolidine dithiocarbamic acid	[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased cleavage of CASP3 protein	22085843
C020972	pyrrolidine dithiocarbamic acid	[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased cleavage of CASP3 protein	20920558
C020972	pyrrolidine dithiocarbamic acid	MAPK1 protein affects the reaction [[Copper co-treated with pyrrolidine dithiocarbamic acid] results in increased activity of CASP3 protein]	22085843
C020972	pyrrolidine dithiocarbamic acid	MAPK8 protein promotes the reaction [[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased activity of CASP3 protein]	20920558
C020972	pyrrolidine dithiocarbamic acid	pyrazolanthrone inhibits the reaction [[cupric chloride binds to pyrrolidine dithiocarbamic acid] which results in increased cleavage of CASP3 protein]	20920558
C020972	pyrrolidine dithiocarbamic acid	[pyrrolidine dithiocarbamic acid co-treated with Copper] results in increased activity of CASP3 protein	10941151
C020972	pyrrolidine dithiocarbamic acid	pyrrolidine dithiocarbamic acid inhibits the reaction [Lipopolysaccharides results in increased expression of CASP3 protein]	28070109
D011763	Pyrrolizidine Alkaloids	Pyrrolizidine Alkaloids results in increased activity of CASP3 protein	24641316
D011765	Pyruvaldehyde	naringenin inhibits the reaction [Pyruvaldehyde results in increased activity of CASP3 protein]	31254498
D011765	Pyruvaldehyde	Pyruvaldehyde results in increased activity of CASP3 protein	25933243; 31254498;
D011765	Pyruvaldehyde	Pyruvaldehyde results in increased cleavage of CASP3 protein	18565324
D011765	Pyruvaldehyde	Pyruvaldehyde results in increased expression of CASP3 protein	26577515
D011765	Pyruvaldehyde	salvin inhibits the reaction [Pyruvaldehyde results in increased expression of CASP3 protein]	26577515
D011765	Pyruvaldehyde	sulforafan inhibits the reaction [Pyruvaldehyde results in increased activity of CASP3 protein]	25933243
D011765	Pyruvaldehyde	Telmisartan inhibits the reaction [Pyruvaldehyde results in increased cleavage of CASP3 protein]	18565324
D011765	Pyruvaldehyde	Pyruvaldehyde results in increased activity of CASP3 protein	21793156
D011765	Pyruvaldehyde	Resveratrol inhibits the reaction [Pyruvaldehyde results in increased activity of CASP3 protein]	21793156
D011765	Pyruvaldehyde	Pyruvaldehyde results in increased expression of CASP3 protein modified form	20621070
D019289	Pyruvic Acid	[Glucose deficiency co-treated with Galactose co-treated with Pyruvic Acid] inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	25997894
D011791	Quartz	Quartz results in increased expression of CASP3 protein	29729927
D011794	Quercetin	Quercetin inhibits the reaction [cyanoginosin LR results in increased expression of CASP3 protein]	24594009
D011794	Quercetin	Quercetin promotes the reaction [Dichlorvos results in increased activity of CASP3 protein]	17640809
D011794	Quercetin	Quercetin inhibits the reaction [Cadmium Chloride affects the localization of CASP3 protein]	21262342
D011794	Quercetin	Quercetin inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	21262342
D011794	Quercetin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	14688022; 21165570;
D011794	Quercetin	2-Methoxyestradiol promotes the reaction [Quercetin results in increased cleavage of CASP3 protein]	26011145
D011794	Quercetin	AR protein affects the reaction [[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein]	27132804
D011794	Quercetin	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Quercetin co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein]	20096292
D011794	Quercetin	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	14688022
D011794	Quercetin	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Quercetin results in increased susceptibility to TNFSF10 protein] promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]]	21933852
D011794	Quercetin	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	24647664
D011794	Quercetin	[bicalutamide co-treated with Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein	27132804
D011794	Quercetin	[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein	27132804
D011794	Quercetin	DDIT3 protein affects the reaction [[TNFSF10 protein co-treated with Quercetin] results in increased cleavage of CASP3 protein]	24612139
D011794	Quercetin	Dihydrotestosterone inhibits the reaction [[Curcumin co-treated with Quercetin] results in increased expression of CASP3 protein]	27132804
D011794	Quercetin	EP300 protein affects the reaction [Quercetin promotes the reaction [trichostatin A results in increased activity of CASP3 protein]]	30958996
D011794	Quercetin	EP300 protein affects the reaction [Quercetin promotes the reaction [Vorinostat results in increased activity of CASP3 protein]]	30958996
D011794	Quercetin	[ESR1 protein results in increased susceptibility to Quercetin] which results in increased cleavage of CASP3 protein	19194971
D011794	Quercetin	[ESR2 protein results in increased susceptibility to Quercetin] which results in increased cleavage of CASP3 protein	21732360
D011794	Quercetin	HSPA5 protein inhibits the reaction [Quercetin results in increased expression of CASP3 protein modified form]	19017364
D011794	Quercetin	MCL1 protein inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	21138867
D011794	Quercetin	MIR34A mRNA affects the reaction [Quercetin results in increased cleavage of CASP3 protein]	25896587
D011794	Quercetin	NFE2L2 protein inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	25896339
D011794	Quercetin	pyrazolanthrone inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	21165570
D011794	Quercetin	Quercetin affects the cleavage of CASP3 protein	15975156
D011794	Quercetin	[Quercetin analog co-treated with Gold analog] results in increased cleavage of CASP3 protein	27470402
D011794	Quercetin	[Quercetin analog co-treated with Gold analog] results in increased expression of and results in increased activity of CASP3 protein	27470402
D011794	Quercetin	[Quercetin analog co-treated with Nickel] results in increased activity of CASP3 protein	20577783
D011794	Quercetin	Quercetin analog results in increased cleavage of CASP3 protein	25289772
D011794	Quercetin	Quercetin analog results in increased expression of CASP3 mRNA	25289772
D011794	Quercetin	[Quercetin co-treated with Cisplatin] results in increased activity of CASP3 protein	27514524
D011794	Quercetin	[Quercetin co-treated with hyperoside] results in increased cleavage of CASP3 protein	24173369; 25354548;
D011794	Quercetin	[Quercetin co-treated with manumycin] results in decreased expression of CASP3 protein	14625852
D011794	Quercetin	[Quercetin co-treated with Temozolomide] results in increased activity of CASP3 protein	20654599
D011794	Quercetin	[Quercetin co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein	18980244; 20096292;
D011794	Quercetin	Quercetin inhibits the reaction [5-methylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
D011794	Quercetin	Quercetin inhibits the reaction [5-phenylselenylmethyl-2'-deoxyuridine results in increased cleavage of and results in increased activity of CASP3 protein]	22002103
D011794	Quercetin	Quercetin inhibits the reaction [APP protein results in increased cleavage of and results in increased activity of CASP3 protein]	19464278
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	18385095
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	12672908; 15795422;
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]	20361964
D011794	Quercetin	Quercetin inhibits the reaction [iroxanadine inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]]	15583868
D011794	Quercetin	Quercetin inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	17929310
D011794	Quercetin	Quercetin inhibits the reaction [zearalenol results in increased activity of CASP3 protein]	26584763
D011794	Quercetin	Quercetin metabolite results in increased activity of CASP3 protein	16280456
D011794	Quercetin	Quercetin metabolite results in increased cleavage of CASP3 protein	19138980
D011794	Quercetin	Quercetin metabolite results in increased expression of CASP3 protein	16280456
D011794	Quercetin	Quercetin promotes the reaction [2-Methoxyestradiol results in increased cleavage of CASP3 protein]	26011145
D011794	Quercetin	Quercetin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	25611565
D011794	Quercetin	Quercetin promotes the reaction [gemcitabine results in increased activity of CASP3 protein]	26050647
D011794	Quercetin	Quercetin promotes the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	18377872; 23711929;
D011794	Quercetin	Quercetin promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	17876056
D011794	Quercetin	Quercetin promotes the reaction [TNFSF10 protein results in increased expression of CASP3 protein modified form]	17548900
D011794	Quercetin	Quercetin promotes the reaction [trichostatin A results in increased activity of CASP3 protein]	30958996
D011794	Quercetin	Quercetin promotes the reaction [Vorinostat results in increased activity of CASP3 protein]	30958996
D011794	Quercetin	Quercetin results in decreased expression of CASP3 mRNA	21632981
D011794	Quercetin	Quercetin results in decreased expression of CASP3 protein	19112469
D011794	Quercetin	Quercetin results in increased activity of and results in increased cleavage of CASP3 protein	23918355; 24299158;
D011794	Quercetin	Quercetin results in increased activity of CASP3 protein	14750173; 16158945; 17234771; 18563345; 19623560; 20386985; 20658310; 21138867; 22431435; 22555976; 22983795; 23711929; 24368982; 24647664; 24726691; 24849437; 25084985; 25293876; 26050647; 30935903;
D011794	Quercetin	Quercetin results in increased cleavage of and results in increased activity of CASP3 protein	12874837
D011794	Quercetin	Quercetin results in increased cleavage of CASP3 protein	14688022; 15741050; 18331776; 18455702; 18787224; 19138980; 19397994; 21165570; 21732360; 23727915; 24535669; 25611565; 25830055; 25896339; 25896587; 26011145; 27175602; 28811126;
D011794	Quercetin	Quercetin results in increased expression of and results in increased activity of CASP3 protein	30152185
D011794	Quercetin	Quercetin results in increased expression of CASP3 protein	14767529; 16049707; 25339540;
D011794	Quercetin	Quercetin results in increased expression of CASP3 protein modified form	19017364; 22222411; 22983795; 27041924; 28251795; 30639267;
D011794	Quercetin	[Quercetin results in increased susceptibility to ABT-737] which results in increased activity of CASP3 protein	23353698
D011794	Quercetin	[Quercetin results in increased susceptibility to Cisplatin] which results in increased activity of CASP3 protein	25611565
D011794	Quercetin	[Quercetin results in increased susceptibility to TNFSF10 protein] promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	21933852
D011794	Quercetin	[Resveratrol co-treated with Quercetin] results in increased cleavage of CASP3 protein	23530649
D011794	Quercetin	SB 203580 inhibits the reaction [[ESR1 protein results in increased susceptibility to Quercetin] which results in increased cleavage of CASP3 protein]	19194971
D011794	Quercetin	SB 203580 inhibits the reaction [[ESR2 protein results in increased susceptibility to Quercetin] which results in increased cleavage of CASP3 protein]	21732360
D011794	Quercetin	tauroursodeoxycholic acid inhibits the reaction [Quercetin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]]	25611565
D011794	Quercetin	[Temozolomide co-treated with Quercetin] results in increased activity of CASP3 protein	24126416
D011794	Quercetin	[TNFSF10 protein co-treated with Quercetin] results in increased cleavage of CASP3 protein	24612139
D011794	Quercetin	U 0126 inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	14688022
D011794	Quercetin	Quercetin inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	21294050
D011794	Quercetin	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	12826665
D011794	Quercetin	Doxorubicin inhibits the reaction [Quercetin results in increased activity of CASP3 protein]	15538571
D011794	Quercetin	Quercetin inhibits the reaction [4-nitro-3-cresol results in increased activity of CASP3 protein]	22467373
D011794	Quercetin	Quercetin inhibits the reaction [4-nitrophenol results in increased activity of CASP3 protein]	23997041
D011794	Quercetin	Quercetin inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	21337715
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	22138401
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	15876423
D011794	Quercetin	Quercetin inhibits the reaction [Okadaic Acid results in increased cleavage of CASP3 protein]	27050422
D011794	Quercetin	Quercetin inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D011794	Quercetin	Quercetin inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	26887929
D011794	Quercetin	Quercetin results in increased activity of CASP3 protein	12826665; 15538571; 25543474;
D011794	Quercetin	Quercetin results in increased cleavage of CASP3 protein	26076811
D011794	Quercetin	Quercetin results in increased expression of and results in increased activity of CASP3 protein	17039455
D011794	Quercetin	Quercetin results in increased expression of CASP3 protein	18586010
D011794	Quercetin	Tetradecanoylphorbol Acetate promotes the reaction [Quercetin results in increased activity of CASP3 protein]	15538571
D011794	Quercetin	[1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-methoxy-poly(ethylene glycol 2000) co-treated with Quercetin] results in increased expression of CASP3 protein	23529952
D011794	Quercetin	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	17045724
D011794	Quercetin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	17045724
D011794	Quercetin	alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide inhibits the reaction [Quercetin analog results in increased activity of CASP3 protein]	23907460
D011794	Quercetin	Quercetin analog results in increased activity of CASP3 protein	23907460
D011794	Quercetin	[Quercetin co-treated with Hydrogen Peroxide] results in increased cleavage of CASP3 protein	27525270
D011794	Quercetin	[Quercetin co-treated with Tretinoin] results in increased cleavage of CASP3 protein	25203460
D011794	Quercetin	Quercetin inhibits the reaction [17-(dimethylaminoethylamino)-17-demethoxygeldanamycin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	27224288
D011794	Quercetin	Quercetin inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein]	19466539
D011794	Quercetin	Quercetin inhibits the reaction [aluminum lactate results in increased expression of CASP3 protein modified form]	26944603
D011794	Quercetin	Quercetin inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	27389774
D011794	Quercetin	Quercetin inhibits the reaction [[Dietary Carbohydrates co-treated with Dietary Fats] results in decreased cleavage of CASP3 protein]	22535755
D011794	Quercetin	Quercetin inhibits the reaction [[Dithionite co-treated with Glucose deficiency] results in increased expression of CASP3 protein]	21803128
D011794	Quercetin	Quercetin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	25411067
D011794	Quercetin	Quercetin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein modified form]	24902966
D011794	Quercetin	Quercetin inhibits the reaction [estradiol 3-benzoate results in increased expression of and results in increased activity of CASP3 protein]	24316378
D011794	Quercetin	Quercetin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	22524206
D011794	Quercetin	Quercetin inhibits the reaction [Glucose results in increased expression of CASP3 mRNA]	23770986
D011794	Quercetin	Quercetin inhibits the reaction [Glucose results in increased expression of CASP3 protein modified form]	23770986
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	16647178; 17045724;
D011794	Quercetin	Quercetin inhibits the reaction [Hydrogen Peroxide results in increased cleavage of and results in increased activity of CASP3 protein]	14505808
D011794	Quercetin	Quercetin inhibits the reaction [Lipopolysaccharides results in increased activity of and results in increased cleavage of CASP3 protein]	22685622
D011794	Quercetin	Quercetin inhibits the reaction [manganese chloride results in increased activity of CASP3 protein]	28040552
D011794	Quercetin	Quercetin inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased expression of CASP3 protein]	23758074
D011794	Quercetin	Quercetin inhibits the reaction [[TNF protein co-treated with IL1B protein co-treated with IFNG protein] results in increased expression of CASP3 protein]	23138875
D011794	Quercetin	Quercetin inhibits the reaction [triptolide results in increased activity of CASP3 protein]	26277538
D011794	Quercetin	Quercetin inhibits the reaction [[Xanthine co-treated with XDH protein] results in increased cleavage of CASP3 protein]	26374991
D011794	Quercetin	Quercetin results in increased cleavage of CASP3 protein	22535755
D011794	Quercetin	Quercetin results in increased expression of CASP3 protein	25411067
D011794	Quercetin	Quercetin results in increased activity of CASP3 protein	24126416
C523166	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside inhibits the reaction [25-hydroxycholesterol results in increased activity of CASP3 protein]	25845326
C523166	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	25845326
C523166	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside	quercetin 3-O-beta-(2''-galloyl)-rhamnopyranoside inhibits the reaction [TNFSF10 protein results in increased activity of CASP3 protein]	23711929
C110310	quercetin 4'-O-glucopyranoside	[VEGFA protein co-treated with quercetin 4'-O-glucopyranoside analog] results in increased cleavage of CASP3 protein	22348123
C012526	quercitrin	quercitrin results in increased activity of CASP3 protein	25193878
C012526	quercitrin	quercitrin inhibits the reaction [[TNF protein co-treated with IL1B protein co-treated with IFNG protein] results in increased expression of CASP3 protein]	23138875
C035739	Quin2	Quin2 inhibits the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	27461142
D011796	Quinacrine	GSK3B protein affects the reaction [Quinacrine results in increased activity of CASP3 protein]	28720477
D011796	Quinacrine	Quinacrine results in increased activity of CASP3 protein	28720477
D011796	Quinacrine	Quinacrine results in increased cleavage of CASP3 protein	28867437
C502851	quinocetone	4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [quinocetone results in increased cleavage of CASP3 protein]	28343033
C502851	quinocetone	Curcumin inhibits the reaction [quinocetone results in increased activity of CASP3 protein]	27375190
C502851	quinocetone	Lithium Chloride inhibits the reaction [quinocetone results in increased cleavage of CASP3 protein]	28343033
C502851	quinocetone	quinocetone results in increased activity of CASP3 protein	27375190
C502851	quinocetone	quinocetone results in increased cleavage of CASP3 protein	28343033
C502851	quinocetone	zinc protoporphyrin inhibits the reaction [Curcumin inhibits the reaction [quinocetone results in increased activity of CASP3 protein]]	27375190
C502851	quinocetone	zinc protoporphyrin promotes the reaction [quinocetone results in increased activity of CASP3 protein]	27375190
C037219	quinoline	quinoline analog results in increased cleavage of and results in increased activity of CASP3 protein	18645022
D011804	Quinolines	Quinolines analog results in increased activity of CASP3 protein	15826604
C468548	quinoline-val-asp(OMe)-CH2-OPH	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
C468548	quinoline-val-asp(OMe)-CH2-OPH	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	26124276
C468548	quinoline-val-asp(OMe)-CH2-OPH	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
C468548	quinoline-val-asp(OMe)-CH2-OPH	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [Manganese results in increased activity of CASP3 protein]	21985864
D017378	Quinolinic Acid	[naringin co-treated with Pioglitazone] inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
D017378	Quinolinic Acid	naringin inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
D017378	Quinolinic Acid	Pioglitazone inhibits the reaction [Quinolinic Acid results in increased expression of CASP3 mRNA]	30130594
D017378	Quinolinic Acid	Quinolinic Acid results in increased expression of CASP3 mRNA	30130594
C004532	quinone	[quinone results in increased metabolism of CYCS protein] inhibits the reaction [CYCS protein results in increased activity of CASP3 protein]	21527774
C004532	quinone	quinone results in decreased activity of CASP3 protein	17051661; 22960397;
C004532	quinone	quinone results in increased activity of CASP3 protein	20499891
C004532	quinone	[quinone results in increased abundance of Reactive Oxygen Species] which results in decreased activity of CASP3 protein	15337166
D020849	Raloxifene Hydrochloride	Raloxifene Hydrochloride results in increased expression of CASP3 protein modified form	20945400
D011899	Ranitidine	Ranitidine inhibits the reaction [Rotenone results in increased cleavage of and results in increased activity of CASP3 protein]	19723537
D011899	Ranitidine	Ranitidine inhibits the reaction [Aspirin results in increased expression of CASP3 mRNA]	30885738
D011899	Ranitidine	Ranitidine inhibits the reaction [Aspirin results in increased expression of CASP3 protein]	30885738
D011899	Ranitidine	Ranitidine inhibits the reaction [Indomethacin results in increased expression of CASP3 mRNA]	29523851
D011899	Ranitidine	Ranitidine inhibits the reaction [Indomethacin results in increased expression of CASP3 protein]	28648817
D011929	Razoxane	Razoxane results in increased activity of CASP3 protein	10487526
D011929	Razoxane	[Doxorubicin co-treated with Razoxane] results in increased activity of CASP3 protein	12714334
D011929	Razoxane	Razoxane results in increased activity of CASP3 protein	12714334
D017382	Reactive Oxygen Species	Acetylcysteine inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	22710416
D017382	Reactive Oxygen Species	Acetylcysteine inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein]	17888894
D017382	Reactive Oxygen Species	Ascorbic Acid inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	16124896
D017382	Reactive Oxygen Species	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein]	17888894
D017382	Reactive Oxygen Species	Cyclosporine inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	26884717
D017382	Reactive Oxygen Species	[Eosine I Bluish results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	22440610
D017382	Reactive Oxygen Species	[Fenretinide results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	16124896
D017382	Reactive Oxygen Species	[[[[[Lithocholic Acid results in increased abundance of Reactive Oxygen Species] which results in increased localization of and results in increased activity of FAS protein] which results in increased activity of CASP8 protein] which results in increased cleavage of BID protein] which results in increased activity of CASP9 protein] which results in increased activity of CASP3 protein	19054763
D017382	Reactive Oxygen Species	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [[XCT790 results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein]	19464277
D017382	Reactive Oxygen Species	pifithrin inhibits the reaction [Reactive Oxygen Species results in increased activity of CASP3 protein]	26884717
D017382	Reactive Oxygen Species	Reactive Oxygen Species results in increased activity of CASP3 protein	16124896; 22710416; 26884717;
D017382	Reactive Oxygen Species	[sanguinarine results in increased chemical synthesis of Reactive Oxygen Species] which results in increased activity of CASP3 protein	23660334
D017382	Reactive Oxygen Species	[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	17888894
D017382	Reactive Oxygen Species	[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein	17888894
D017382	Reactive Oxygen Species	[Vorinostat results in increased activity of CASP3 protein] which results in increased abundance of Reactive Oxygen Species	21652541
D017382	Reactive Oxygen Species	[XCT790 results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	19464277
D017382	Reactive Oxygen Species	[Acetylcysteine results in decreased abundance of Reactive Oxygen Species] inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29454061
D017382	Reactive Oxygen Species	CASP3 protein results in increased abundance of Reactive Oxygen Species	16728380
D017382	Reactive Oxygen Species	[hydroquinone results in increased abundance of Reactive Oxygen Species] which results in decreased activity of CASP3 protein	15337166
D017382	Reactive Oxygen Species	[quinone results in increased abundance of Reactive Oxygen Species] which results in decreased activity of CASP3 protein	15337166
D017382	Reactive Oxygen Species	Reactive Oxygen Species results in increased cleavage of and results in increased activity of CASP3 protein	16412576
C052785	rebamipide	rebamipide inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	16184425
C000591895	reevesioside A	reevesioside A results in decreased cleavage of CASP3 protein	28438630
C585486	reevesioside F	reevesioside F results in decreased cleavage of CASP3 protein	28438630
C559147	regorafenib	regorafenib results in increased activity of CASP3 protein	30801954
C559147	regorafenib	regorafenib results in increased cleavage of CASP3 protein	29341879
D012110	Reserpine	IAPP protein inhibits the reaction [Reserpine results in increased activity of CASP3 protein]	19463876
D012110	Reserpine	Reserpine results in increased activity of CASP3 protein	19463876
D012116	Resins, Plant	Resins, Plant results in increased activity of CASP3 protein	27268964
D000077185	Resveratrol	Resveratrol inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of CASP3 mRNA]	15536054
D000077185	Resveratrol	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	19827268
D000077185	Resveratrol	Acetylcysteine inhibits the reaction [Arsenic Trioxide promotes the reaction [Resveratrol results in increased expression of CASP3 protein]]	26772155
D000077185	Resveratrol	Acetylcysteine inhibits the reaction [Resveratrol promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]]	26772155
D000077185	Resveratrol	Acetylcysteine inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	26549478
D000077185	Resveratrol	Acetylcysteine inhibits the reaction [Resveratrol results in increased expression of CASP3 protein]	26772155
D000077185	Resveratrol	Arsenic Trioxide promotes the reaction [Resveratrol results in increased expression of CASP3 protein]	26772155
D000077185	Resveratrol	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] promotes the reaction [[tyrosyl-valyl-alanyl-aspartal results in decreased activity of CASP1 protein] which results in decreased susceptibility to Resveratrol]	9680369
D000077185	Resveratrol	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol	9680369
D000077185	Resveratrol	ATF3 protein promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	21205742
D000077185	Resveratrol	BCL2L1 protein affects the reaction [[Clofarabine co-treated with Resveratrol] results in increased activity of CASP3 protein]	25408576
D000077185	Resveratrol	BCL2 protein inhibits the reaction [Resveratrol promotes the reaction [[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline]]	11577002
D000077185	Resveratrol	BCL2 protein inhibits the reaction [Resveratrol results in decreased expression of CASP3 protein]	11577002
D000077185	Resveratrol	BCL2 protein inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	11577002
D000077185	Resveratrol	BCL2 protein inhibits the reaction [Resveratrol results in increased cleavage of and results in increased activity of CASP3 protein]	19631782
D000077185	Resveratrol	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Resveratrol results in increased cleavage of CASP3 protein]	24264887
D000077185	Resveratrol	[benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol	15827328
D000077185	Resveratrol	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Resveratrol results in increased activity of CASP8 protein] which results in increased activity of CASP3 protein]	19423619
D000077185	Resveratrol	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Resveratrol results in increased cleavage of CASP3 protein]	24264887
D000077185	Resveratrol	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[Resveratrol co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein]	18222423
D000077185	Resveratrol	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [[Resveratrol co-treated with Clofarabine] promotes the reaction [MCL1 mutant form results in increased activity of CASP3 protein]]	24924397
D000077185	Resveratrol	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [[Resveratrol co-treated with Clofarabine] results in increased activity of CASP3 protein]	24924397
D000077185	Resveratrol	Capsaicin promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	19846903
D000077185	Resveratrol	[Clofarabine co-treated with Resveratrol] promotes the reaction [BCL2L1 mutant form results in increased activity of CASP3 protein]	25408576
D000077185	Resveratrol	[Clofarabine co-treated with Resveratrol] promotes the reaction [BCL2L1 mutant form results in increased cleavage of CASP3 protein]	25408576
D000077185	Resveratrol	[Clofarabine co-treated with Resveratrol] results in increased activity of CASP3 protein	25408576
D000077185	Resveratrol	CTSD protein affects the reaction [Resveratrol results in increased activity of CASP3 protein]	17116725
D000077185	Resveratrol	Erlotinib Hydrochloride promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	25895606
D000077185	Resveratrol	MCL1 mutant form promotes the reaction [[Resveratrol co-treated with Clofarabine] results in increased cleavage of CASP3 protein]	24924397
D000077185	Resveratrol	MIR126 mRNA promotes the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]]	24107596
D000077185	Resveratrol	MRK 003 affects the reaction [Resveratrol results in increased cleavage of CASP3 protein]	21743969
D000077185	Resveratrol	Resveratrol affects the expression of CASP3 protein modified form	24218232
D000077185	Resveratrol	Resveratrol analog results in increased activity of CASP3 protein	18776917; 21851083; 24398169;
D000077185	Resveratrol	Resveratrol analog results in increased expression of CASP3 protein	25776512
D000077185	Resveratrol	[Resveratrol co-treated with Clofarabine] promotes the reaction [MCL1 mutant form results in increased activity of CASP3 protein]	24924397
D000077185	Resveratrol	[Resveratrol co-treated with Clofarabine] results in increased cleavage of and results in increased activity of CASP3 protein	24924397
D000077185	Resveratrol	[Resveratrol co-treated with Clofarabine] results in increased expression of CASP3 protein modified form	24239893
D000077185	Resveratrol	[Resveratrol co-treated with Panobinostat] results in increased cleavage of CASP3 protein	22923501
D000077185	Resveratrol	[Resveratrol co-treated with Quercetin] results in increased cleavage of CASP3 protein	23530649
D000077185	Resveratrol	[Resveratrol co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	15763656
D000077185	Resveratrol	[Resveratrol co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	18222423
D000077185	Resveratrol	[Resveratrol co-treated with Vorinostat] results in increased cleavage of CASP3 protein	22923501
D000077185	Resveratrol	Resveratrol inhibits the reaction [[Arachidonic Acid co-treated with Iron] results in decreased expression of CASP3 protein]	19620254
D000077185	Resveratrol	Resveratrol inhibits the reaction [benzo(e)pyrene results in increased activity of CASP3 protein]	19959636
D000077185	Resveratrol	Resveratrol inhibits the reaction [cudraflavone B results in increased activity of CASP3 protein]	23881456
D000077185	Resveratrol	Resveratrol inhibits the reaction [Dopamine results in increased cleavage of and results in increased activity of CASP3 protein]	17603292
D000077185	Resveratrol	Resveratrol inhibits the reaction [Ethanol results in increased expression of CASP3 protein modified form]	24224909
D000077185	Resveratrol	Resveratrol inhibits the reaction [Fluorouracil results in decreased cleavage of CASP3 protein]	26310874
D000077185	Resveratrol	Resveratrol inhibits the reaction [GBA protein mutant form results in increased cleavage of CASP3 protein]	26027833
D000077185	Resveratrol	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	24107596
D000077185	Resveratrol	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of and results in increased activity of CASP3 protein]	22358095
D000077185	Resveratrol	Resveratrol inhibits the reaction [IL1B protein results in increased activity of CASP3 protein]	17404069; 17959154;
D000077185	Resveratrol	Resveratrol inhibits the reaction [Lipopolysaccharides results in increased cleavage of CASP3 protein]	17929310
D000077185	Resveratrol	Resveratrol inhibits the reaction [MFGE8 protein results in increased expression of CASP3 protein modified form]	21505870
D000077185	Resveratrol	Resveratrol inhibits the reaction [Niacinamide results in increased cleavage of CASP3 protein]	24962570
D000077185	Resveratrol	Resveratrol inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	18675900; 19443200;
D000077185	Resveratrol	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of CASP3 protein]	24557422
D000077185	Resveratrol	Resveratrol inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	21778691
D000077185	Resveratrol	Resveratrol inhibits the reaction [[SOD1 protein results in increased susceptibility to Thimerosal] which results in increased cleavage of CASP3 protein]	30503815
D000077185	Resveratrol	Resveratrol promotes the reaction [2,3-N-octanoylsphingosine results in increased activity of CASP3 protein]	20401667
D000077185	Resveratrol	Resveratrol promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	26772155
D000077185	Resveratrol	Resveratrol promotes the reaction [Capsaicin results in increased activity of CASP3 protein]	19846903
D000077185	Resveratrol	Resveratrol promotes the reaction [[CASP3 protein results in increased cleavage of aspartyl-glutamyl-valyl-aspartyl-p-nitroanilide] which results in increased chemical synthesis of 4-nitroaniline]	11577002
D000077185	Resveratrol	Resveratrol promotes the reaction [CASP3 protein results in increased degradation of CTNNB1 protein]	26040106
D000077185	Resveratrol	Resveratrol promotes the reaction [Erlotinib Hydrochloride results in increased activity of CASP3 protein]	25895606
D000077185	Resveratrol	Resveratrol promotes the reaction [Sorafenib results in increased cleavage of CASP3 protein]	26911335
D000077185	Resveratrol	Resveratrol promotes the reaction [TNFSF10 protein results in increased cleavage of CASP3 protein]	17823925
D000077185	Resveratrol	Resveratrol promotes the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]	20060927
D000077185	Resveratrol	Resveratrol results in decreased activity of CASP3 protein	12925042; 16095586;
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3 mRNA	12002526
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3 protein	11577002; 20198347;
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3 protein modified form	21505870
D000077185	Resveratrol	Resveratrol results in increased activity of and results in increased cleavage of CASP3 protein	24299158
D000077185	Resveratrol	Resveratrol results in increased activity of CASP3 protein	11481417; 11577002; 11681415; 12689943; 15827328; 16087638; 17007014; 17050787; 17116725; 18276737; 18429957; 18675900; 19423619; 19549761; 19561642; 19738051; 19827268; 19846903; 20028382; 20484155; 20536388; 20697895; 20717957; 21179458; 21205742; 21304978; 21740780; 21980390; 22644961; 23536519; 24299158; 24535223; 24603648; 24726691; 25875864; 25895606; 26040106; 26055805; 26189302; 26549478;
D000077185	Resveratrol	[Resveratrol results in increased activity of CASP3 protein] which affects the activity of SLC4A1 protein	20536388
D000077185	Resveratrol	[Resveratrol results in increased activity of CASP3 protein] which results in increased cleavage of GSN protein	19423619
D000077185	Resveratrol	[Resveratrol results in increased activity of CASP3 protein] which results in increased cleavage of PARP1 protein	19561642
D000077185	Resveratrol	[Resveratrol results in increased activity of CASP8 protein] which results in increased activity of CASP3 protein	19423619
D000077185	Resveratrol	Resveratrol results in increased cleavage of and results in increased activity of CASP3 protein	12902349; 16617056; 17044934; 17164350; 17636462; 18222423; 19631782; 20097879;
D000077185	Resveratrol	Resveratrol results in increased cleavage of CASP3 protein	12689943; 18347188; 19321006; 21184191; 21743969; 22923501; 23594881; 24090995; 24264887; 25619392; 26310874; 26537190; 26911335; 27064016;
D000077185	Resveratrol	Resveratrol results in increased expression of CASP3	23495037
D000077185	Resveratrol	Resveratrol results in increased expression of CASP3 mRNA	12002526; 12569576;
D000077185	Resveratrol	Resveratrol results in increased expression of CASP3 protein	19738051; 23314035; 25776512; 26772155;
D000077185	Resveratrol	Resveratrol results in increased expression of CASP3 protein modified form	22029423; 24331535;
D000077185	Resveratrol	SB 203580 promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	22644961
D000077185	Resveratrol	SH-6 compound promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	19827268
D000077185	Resveratrol	sirtinol inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	20697895
D000077185	Resveratrol	[tyrosyl-valyl-alanyl-aspartal results in decreased activity of CASP1 protein] promotes the reaction [[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol]	9680369
D000077185	Resveratrol	Vorinostat inhibits the reaction [BCL2 protein inhibits the reaction [Resveratrol results in increased cleavage of and results in increased activity of CASP3 protein]]	19631782
D000077185	Resveratrol	ZBTB7A protein inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	25875864
D000077185	Resveratrol	Resveratrol promotes the reaction [[Dietary Fats co-treated with Dietary Sucrose] results in decreased expression of CASP3 protein modified form]	27070252
D000077185	Resveratrol	Resveratrol results in increased activity of CASP3 protein	24319332
D000077185	Resveratrol	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Resveratrol results in decreased expression of CASP3 protein modified form]	25891866
D000077185	Resveratrol	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]	21593185
D000077185	Resveratrol	6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	25665036; 26450947;
D000077185	Resveratrol	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Resveratrol results in increased cleavage of CASP3 protein]	22137261
D000077185	Resveratrol	BIRC5 protein affects the reaction [Resveratrol results in increased cleavage of CASP3 protein]	22137261
D000077185	Resveratrol	CASP3 protein affects the reaction [Resveratrol results in decreased expression of SLC9A1 mRNA]	18951995
D000077185	Resveratrol	CASP3 protein affects the reaction [Resveratrol results in decreased expression of SLC9A1 protein]	18951995
D000077185	Resveratrol	NFE2L2 protein affects the reaction [Resveratrol inhibits the reaction [Dietary Fats results in increased activity of CASP3 protein]]	20418481
D000077185	Resveratrol	pifithrin inhibits the reaction [6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide inhibits the reaction [Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]]]	21593185
D000077185	Resveratrol	PRKAA2 protein affects the reaction [Resveratrol results in increased cleavage of CASP3 protein]	25603053
D000077185	Resveratrol	Resveratrol inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	16322078
D000077185	Resveratrol	Resveratrol inhibits the reaction [Acetylcysteine results in increased expression of CASP3 protein modified form]	25891866
D000077185	Resveratrol	Resveratrol inhibits the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
D000077185	Resveratrol	Resveratrol inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	18332854
D000077185	Resveratrol	Resveratrol inhibits the reaction [CDK5R1 protein results in increased cleavage of CASP3 protein]	17581637
D000077185	Resveratrol	Resveratrol inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	21593185
D000077185	Resveratrol	Resveratrol inhibits the reaction [Dietary Fats results in increased activity of CASP3 protein]	20418481
D000077185	Resveratrol	Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	22763982; 25665036; 26450947;
D000077185	Resveratrol	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	24040102
D000077185	Resveratrol	Resveratrol inhibits the reaction [Isoflurane results in increased activity of CASP3 protein]	23922164
D000077185	Resveratrol	Resveratrol inhibits the reaction [Nicotine results in increased expression of CASP3 mRNA]	22687363
D000077185	Resveratrol	Resveratrol inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D000077185	Resveratrol	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	25488258
D000077185	Resveratrol	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein]	24682241
D000077185	Resveratrol	Resveratrol inhibits the reaction [Pyruvaldehyde results in increased activity of CASP3 protein]	21793156
D000077185	Resveratrol	Resveratrol inhibits the reaction [Sodium Fluoride results in increased cleavage of CASP3 protein]	24296261
D000077185	Resveratrol	Resveratrol inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	20424226
D000077185	Resveratrol	Resveratrol results in decreased activity of CASP3 protein	20940732; 23227865; 25116358;
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3 protein modified form	25891866
D000077185	Resveratrol	[Resveratrol results in increased activity of SIRT1 protein] which results in decreased cleavage of and results in decreased activity of CASP3 protein	20370652
D000077185	Resveratrol	Resveratrol results in increased cleavage of and results in increased activity of CASP3 protein	16675471; 18791811;
D000077185	Resveratrol	Resveratrol results in increased cleavage of CASP3 protein	17872969; 18201729; 21980390; 22137261; 25505154; 25603053;
D000077185	Resveratrol	SIRT1 protein affects the reaction [Resveratrol results in increased cleavage of CASP3 protein]	22137261
D000077185	Resveratrol	sirtinol inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	25665036; 26450947;
D000077185	Resveratrol	VDAC1 protein inhibits the reaction [Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]]	25488258
D000077185	Resveratrol	Wortmannin promotes the reaction [Resveratrol results in increased cleavage of CASP3 protein]	25603053
D000077185	Resveratrol	zinc protoporphyrin inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	22763982
D000077185	Resveratrol	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Resveratrol results in decreased expression of CASP3 protein modified form]	24602480
D000077185	Resveratrol	RAB7A protein promotes the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
D000077185	Resveratrol	Resveratrol affects the expression of CASP3 mRNA	17959022
D000077185	Resveratrol	[Resveratrol co-treated with Estradiol] results in increased activity of CASP3 protein	24894866
D000077185	Resveratrol	[Resveratrol co-treated with Propofol] results in decreased expression of CASP3	23353162
D000077185	Resveratrol	Resveratrol inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased cleavage of and results in increased activity of CASP3 protein]	19466539
D000077185	Resveratrol	Resveratrol inhibits the reaction [Doxorubicin results in increased expression of CASP3]	24939721
D000077185	Resveratrol	Resveratrol inhibits the reaction [Ethanol results in increased expression of CASP3]	23422878
D000077185	Resveratrol	Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
D000077185	Resveratrol	Resveratrol inhibits the reaction [Monocrotophos results in increased expression of CASP3 mRNA]	23833438
D000077185	Resveratrol	Resveratrol inhibits the reaction [Monocrotophos results in increased expression of CASP3 protein]	23833438
D000077185	Resveratrol	Resveratrol inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27016191
D000077185	Resveratrol	Resveratrol inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	26499206
D000077185	Resveratrol	Resveratrol inhibits the reaction [Testosterone results in increased expression of CASP3 protein]	25714330
D000077185	Resveratrol	Resveratrol inhibits the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]	18424637
D000077185	Resveratrol	Resveratrol results in decreased activity of CASP3 protein	20861279; 22246136; 23284668;
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3	23353162
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3 protein	21111721; 21850487;
D000077185	Resveratrol	Resveratrol results in decreased expression of CASP3 protein modified form	24040416; 24602480;
D000077185	Resveratrol	Resveratrol results in increased activity of CASP3 protein	24534837; 24669252; 24894866;
D000077185	Resveratrol	[Resveratrol results in increased activity of SIRT1 protein] which results in decreased expression of CASP3 protein modified form	23479127
D000077185	Resveratrol	Resveratrol results in increased cleavage of CASP3 protein	24304514
D000077185	Resveratrol	Resveratrol results in increased expression of and results in increased cleavage of and results in increased activity of CASP3 protein	18951995
D000077185	Resveratrol	[Sirolimus co-treated with Resveratrol] results in increased cleavage of CASP3 protein	24304514
D000077185	Resveratrol	SIRT1 protein promotes the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
D000077185	Resveratrol	SIRT1 protein promotes the reaction [Resveratrol inhibits the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]]	18424637
D000077185	Resveratrol	sirtinol inhibits the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
D000077185	Resveratrol	Acetylcysteine inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	26849945
D000077185	Resveratrol	Resveratrol results in increased activity of CASP3 protein	26849945
D000077185	Resveratrol	Resveratrol results in increased cleavage of CASP3 protein	23065251
D000077185	Resveratrol	[Resveratrol co-treated with Curcumin] inhibits the reaction [IL1B protein results in increased expression of CASP3 protein modified form]	19889203
D000077185	Resveratrol	Resveratrol inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	26146868
D000077185	Resveratrol	Resveratrol inhibits the reaction [IL1B protein results in increased activity of CASP3 protein]	18606398
D000077185	Resveratrol	Resveratrol inhibits the reaction [IL1B protein results in increased cleavage of CASP3 protein]	22936809
D000077185	Resveratrol	Resveratrol inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased activity of CASP3 protein]	24840287
C540615	retigeric acid B	retigeric acid B results in decreased expression of CASP3 protein	20692244
C540615	retigeric acid B	retigeric acid B results in increased activity of and results in increased cleavage of CASP3 protein	20692244
D012172	Retinaldehyde	Retinaldehyde results in increased activity of CASP3 protein	25331497
C009172	rhodioloside	rhodioloside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	28851138
C009172	rhodioloside	sirtinol inhibits the reaction [rhodioloside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]]	28851138
C009172	rhodioloside	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rhodioloside inhibits the reaction [Colistin results in increased activity of and results in increased cleavage of CASP3 protein]]	28465020
C009172	rhodioloside	rhodioloside inhibits the reaction [Colistin results in increased activity of and results in increased cleavage of CASP3 protein]	28465020
C009172	rhodioloside	rhodioloside inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	24072175
C009172	rhodioloside	rhodioloside inhibits the reaction [[manganese chloride results in increased abundance of Manganese] which results in increased cleavage of CASP3 protein]	30991096
C072026	rhodostomin	rhodostomin results in increased activity of CASP3 protein	16197920
D012254	Ribavirin	Ribavirin promotes the reaction [FAS protein results in increased activity of CASP3 protein]	12760867
D012254	Ribavirin	Ribavirin results in increased activity of CASP3 protein	12760867
D012256	Riboflavin	Riboflavin analog results in increased activity of CASP3 protein	20688149
D012266	Ribose	[Creatine co-treated with Ribose] results in decreased activity of CASP3 protein	21220914
D012293	Rifampin	Mifepristone inhibits the reaction [Rifampin inhibits the reaction [FAS protein results in increased activity of CASP3 protein]]	12645856
D012293	Rifampin	Rifampin inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	26775663
D012293	Rifampin	Rifampin inhibits the reaction [FAS protein results in increased activity of CASP3 protein]	11958592; 12645856;
D012293	Rifampin	Rifampin inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	26775663
D012293	Rifampin	Rifampin promotes the reaction [Galactosamine results in increased activity of CASP3 protein]	17936189
D012293	Rifampin	HGF protein inhibits the reaction [[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein]	23764483
D012293	Rifampin	[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein	21419764; 23764483;
D012293	Rifampin	Ursodeoxycholic Acid inhibits the reaction [[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein]	21419764
D019782	Riluzole	Palmitic Acid promotes the reaction [Riluzole results in increased activity of CASP3 protein]	22700542
D019782	Riluzole	Riluzole results in increased activity of CASP3 protein	19528481; 22700542;
D000077285	Rimonabant	Rimonabant inhibits the reaction [XLR-11 results in increased activity of CASP3 protein]	29410032
D000077285	Rimonabant	Rimonabant inhibits the reaction [JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]]	26209559
D000068296	Risedronic Acid	Risedronic Acid results in increased activity of CASP3 protein	19505369
D018967	Risperidone	Palmitic Acid promotes the reaction [Risperidone results in increased activity of CASP3 protein]	22700542
D018967	Risperidone	Risperidone results in increased activity of CASP3 protein	22700542
D019438	Ritonavir	Ritonavir results in decreased activity of CASP3 protein	10551732
C064758	Ro 31-8220	Ro 31-8220 results in increased activity of CASP3 protein	18054255
C064758	Ro 31-8220	Ro 31-8220 inhibits the reaction [Hexachlorocyclohexane results in increased activity of CASP3 protein]	22001173
C064758	Ro 31-8220	Ro 31-8220 inhibits the reaction [Paraoxon results in increased activity of CASP3 protein]	17561261
C064758	Ro 31-8220	TNF protein promotes the reaction [Ro 31-8220 results in increased activity of CASP3 protein]	18054255
C087123	romidepsin	alvocidib promotes the reaction [romidepsin results in increased activity of CASP3 protein]	15014036
C087123	romidepsin	Bortezomib promotes the reaction [romidepsin results in increased cleavage of CASP3 protein]	18223231
C087123	romidepsin	romidepsin results in increased activity of CASP3 protein	15014036
C087123	romidepsin	romidepsin results in increased cleavage of CASP3 protein	18223231
C046649	ropinirole	ropinirole inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	18242171
D000077212	Ropivacaine	BCL2 protein inhibits the reaction [Ropivacaine results in increased cleavage of CASP3 protein]	15538973
D000077212	Ropivacaine	CLU protein inhibits the reaction [Ropivacaine results in increased expression of CASP3 protein]	15538973
D000077212	Ropivacaine	Ropivacaine results in decreased expression of CASP3 protein	20194319
D000077212	Ropivacaine	Ropivacaine results in increased cleavage of CASP3 protein	15538973
D000077546	Roscovitine	Roscovitine inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	18501396
D000077546	Roscovitine	Roscovitine results in increased activity of CASP3 protein	16140939
D000077546	Roscovitine	Roscovitine inhibits the reaction [Ammonium Chloride results in increased activity of CASP3 protein]	18722528
C530393	rosemarinic acid	rosemarinic acid inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	20966113
C530393	rosemarinic acid	rosemarinic acid inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21526214
D000077154	Rosiglitazone	Rosiglitazone inhibits the reaction [1-Methyl-4-phenylpyridinium results in decreased expression of CASP3 protein]	17266988
D000077154	Rosiglitazone	Rosiglitazone inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	27553674
D000077154	Rosiglitazone	Rosiglitazone inhibits the reaction [Glucose results in increased activity of CASP3 protein]	19767878
D000077154	Rosiglitazone	Rosiglitazone promotes the reaction [Chlorpyrifos results in increased cleavage of CASP3 protein]	24793810
D000077154	Rosiglitazone	Rosiglitazone promotes the reaction [PPARG protein promotes the reaction [mono-(2-ethylhexyl)phthalate results in increased activity of CASP3 protein]]	12927354
D000077154	Rosiglitazone	Rosiglitazone results in decreased activity of CASP3 protein	17255338
D000077154	Rosiglitazone	Rosiglitazone results in decreased expression of CASP3 mRNA	17639046
D000077154	Rosiglitazone	Rosiglitazone results in increased activity of CASP3 protein	17506947; 19467017; 19731824;
D000077154	Rosiglitazone	Rosiglitazone results in increased cleavage of CASP3 protein	19482836
D000077154	Rosiglitazone	Tretinoin promotes the reaction [Rosiglitazone results in increased activity of CASP3 protein]	19467017; 19731824;
D000077154	Rosiglitazone	Rosiglitazone inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	21599458
D000077154	Rosiglitazone	Rosiglitazone results in decreased expression of CASP3 protein	19626998
D000077154	Rosiglitazone	Rosiglitazone results in increased activity of CASP3 protein	11218074
C041376	rosmarinic acid	rosmarinic acid inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	23548128
C041376	rosmarinic acid	rosmarinic acid inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	28815802
D000068718	Rosuvastatin Calcium	Rosuvastatin Calcium results in increased activity of CASP3 protein	21478229
D012402	Rotenone	[Rotenone co-treated with Oligomycins] inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D012402	Rotenone	3-Hydroxybutyric Acid inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	16917840
D012402	Rotenone	ALDH2 protein inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	25263579
D012402	Rotenone	Hydrogen Peroxide promotes the reaction [Rotenone results in increased activity of CASP3 protein]	12177198
D012402	Rotenone	kaempferol inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	20594614
D012402	Rotenone	MIR384 mRNA promotes the reaction [Rotenone results in increased activity of CASP3 protein]	26864693
D012402	Rotenone	MT1B protein inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	16402917
D012402	Rotenone	MT2A protein inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	16402917
D012402	Rotenone	N-(1,3-benzodioxol-5-ylmethyl)-2,6-dichlorobenzamide inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	25263579
D012402	Rotenone	ND1 gene mutant form inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	29991444
D012402	Rotenone	Ranitidine inhibits the reaction [Rotenone results in increased cleavage of and results in increased activity of CASP3 protein]	19723537
D012402	Rotenone	Resveratrol inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	21778691
D012402	Rotenone	ropinirole inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	18242171
D012402	Rotenone	Rotenone inhibits the reaction [TNF protein results in increased cleavage of CASP3 protein]	10973919
D012402	Rotenone	Rotenone results in increased activity of CASP3 protein	12177198; 12496265; 14976342; 16402917; 16917840; 25263579; 26864693; 29991444;
D012402	Rotenone	Rotenone results in increased cleavage of and results in increased activity of CASP3 protein	19539006; 19723537;
D012402	Rotenone	Rotenone results in increased cleavage of CASP3 protein	18178165; 18242171; 19682553; 20594614; 21778691;
D012402	Rotenone	Rotenone results in increased expression of CASP3 mRNA	23963993; 29955902;
D012402	Rotenone	Rotenone results in increased expression of CASP3 protein	23963993
D012402	Rotenone	Rotenone results in increased secretion of CASP3 protein	26963176
D012402	Rotenone	Sirolimus inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	19682553
D012402	Rotenone	SNCA protein promotes the reaction [Rotenone results in increased secretion of CASP3 protein]	26963176
D012402	Rotenone	Tranexamic Acid inhibits the reaction [Rotenone results in increased cleavage of and results in increased activity of CASP3 protein]	19539006
D012402	Rotenone	carnosol inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	17047462
D012402	Rotenone	CASP2 protein affects the reaction [Rotenone results in increased cleavage of and results in increased activity of CASP3 protein]	21216964
D012402	Rotenone	MAPK10 mutant form inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	25496994
D012402	Rotenone	[Rotenone co-treated with Chloroquine] results in increased cleavage of CASP3 protein	26847702
D012402	Rotenone	[Rotenone co-treated with Wortmannin] results in increased cleavage of CASP3 protein	26847702
D012402	Rotenone	Rotenone inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	29095437
D012402	Rotenone	Rotenone inhibits the reaction [[lipopolysaccharide, E coli O55-B5 co-treated with Galactosamine] results in increased activity of CASP3 protein]	24830863
D012402	Rotenone	Rotenone results in increased activity of CASP3 protein	17047462; 19857556; 25496994;
D012402	Rotenone	Rotenone results in increased cleavage of and results in increased activity of CASP3 protein	21216964
D012402	Rotenone	Rotenone results in increased cleavage of CASP3 protein	20594614; 26031332;
D012402	Rotenone	Rotenone results in increased expression of CASP3	25481089
D012402	Rotenone	Rotenone results in increased expression of CASP3 mRNA	22526376; 25428620;
D012402	Rotenone	salubrinal inhibits the reaction [Rotenone results in increased expression of CASP3 mRNA]	25428620
D012402	Rotenone	SESN2 protein inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	26031332
D012402	Rotenone	SNCAIP protein inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	19857556
D012402	Rotenone	1-(1-acetyl-piperidine-4-yl)-3-adamantan-1-yl-urea inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	30472438
D012402	Rotenone	ADCYAP1 protein modified form inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	16004991
D012402	Rotenone	baicalin inhibits the reaction [Rotenone affects the expression of CASP3 protein]	25423838
D012402	Rotenone	Bibenzyls inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	27180985
D012402	Rotenone	CAT protein inhibits the reaction [[Rotenone results in increased abundance of Hydrogen Peroxide] which results in increased cleavage of and results in increased activity of CASP3 protein]	25304210
D012402	Rotenone	Curcumin analog inhibits the reaction [Rotenone results in increased expression of CASP3 protein modified form]	27535828
D012402	Rotenone	GAPDH mutant form inhibits the reaction [Rotenone results in increased expression of and results in increased activity of CASP3 protein]	25725130
D012402	Rotenone	GHRL protein inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	29174113
D012402	Rotenone	GHSR protein affects the reaction [GHRL protein inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	29174113
D012402	Rotenone	Lithium Chloride inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27045591
D012402	Rotenone	montelukast inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	30222980
D012402	Rotenone	PQQ Cofactor inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27108097
D012402	Rotenone	protocatechuic acid inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	18082360
D012402	Rotenone	Resveratrol inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27016191
D012402	Rotenone	Rotenone affects the expression of CASP3 protein	25423838
D012402	Rotenone	Rotenone inhibits the reaction [chelerythrine results in increased activity of CASP3 protein]	21664962
D012402	Rotenone	Rotenone inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	14732287
D012402	Rotenone	[Rotenone results in increased abundance of Hydrogen Peroxide] which results in increased cleavage of and results in increased activity of CASP3 protein	25304210
D012402	Rotenone	Rotenone results in increased activity of CASP3 protein	11078377; 11078378; 14622122; 16004991; 17367952; 17555550; 18082360; 25263579; 27016191; 27045591; 27108097; 30222980;
D012402	Rotenone	Rotenone results in increased cleavage of CASP3 protein	27180985; 29174113; 30472438;
D012402	Rotenone	Rotenone results in increased expression of and results in increased activity of CASP3 protein	25725130
D012402	Rotenone	Rotenone results in increased expression of CASP3 mRNA	26446018
D012402	Rotenone	Rotenone results in increased expression of CASP3 protein	16787641; 23098804; 25446674; 25502462;
D012402	Rotenone	Rotenone results in increased expression of CASP3 protein modified form	27535828
D012402	Rotenone	salubrinal inhibits the reaction [Rotenone results in increased expression of CASP3 mRNA]	26446018
D012402	Rotenone	saxagliptin inhibits the reaction [Rotenone results in increased expression of CASP3 protein]	25446674
D012402	Rotenone	SB 216763 inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27045591
D012402	Rotenone	Ursodeoxycholic Acid inhibits the reaction [Rotenone results in increased expression of CASP3 protein]	25502462
D012402	Rotenone	echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	23189969
D012402	Rotenone	Rotenone results in increased cleavage of CASP3 protein	23189969
D012402	Rotenone	staurosporine aglycone inhibits the reaction [echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	23189969
D012402	Rotenone	U 0126 inhibits the reaction [echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	23189969
C085746	rottlerin	rottlerin inhibits the reaction [NSC606985 results in increased activity of CASP3 protein]	19662097
C085746	rottlerin	rottlerin inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
C085746	rottlerin	rottlerin results in increased activity of CASP3 protein	22410117
C085746	rottlerin	rottlerin results in increased cleavage of CASP3 protein	22902833
C085746	rottlerin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rottlerin inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]]	25895139
C085746	rottlerin	rottlerin inhibits the reaction [8-Hydroxy-2-(di-n-propylamino)tetralin results in increased cleavage of CASP3 protein]	30366073
C085746	rottlerin	rottlerin inhibits the reaction [Cocaine results in increased cleavage of CASP3 protein]	30393195
C085746	rottlerin	rottlerin inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]	25895139
C085746	rottlerin	rottlerin inhibits the reaction [2-methylcyclopentadienyl manganese tricarbonyl results in increased activity of CASP3 protein]	11880503
C085746	rottlerin	rottlerin inhibits the reaction [Dieldrin results in increased activity of CASP3 protein]	12831855
C085746	rottlerin	rottlerin inhibits the reaction [naringin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of and results in increased activity of CASP3 protein]]	25773745
C085746	rottlerin	rottlerin results in decreased activity of CASP3 protein	11880503
C058787	royal jelly	royal jelly inhibits the reaction [Nicotine results in increased expression of CASP3 mRNA]	30896085
C101044	RTKI cpd	RTKI cpd promotes the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	19233221
C046245	rubimaillin	BCL2L1 protein inhibits the reaction [rubimaillin results in increased activity of CASP3 protein]	19716835
C046245	rubimaillin	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone affects the reaction [rubimaillin results in increased activity of CASP3 protein]	19716835
C046245	rubimaillin	rubimaillin results in increased activity of CASP3 protein	19716835
C079905	rubitecan	[rubitecan co-treated with Phosphatidylcholines] results in increased expression of CASP3 protein	21695227
C079905	rubitecan	rubitecan results in increased expression of CASP3 protein	21695227
C028632	rutecarpine	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C028632	rutecarpine	KN 93 inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C028632	rutecarpine	N-(3-methoxyphenyl)-4-chlorocinnamanilide inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C028632	rutecarpine	rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	28025122
C028632	rutecarpine	zinc protoporphyrin inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
D012428	Ruthenium	Ruthenium results in increased cleavage of and results in increased activity of CASP3 protein	17210701
D017975	Ruthenium Compounds	Ruthenium Compounds results in increased cleavage of and results in increased activity of CASP3 protein	17210701
D012430	Ruthenium Red	Ruthenium Red inhibits the reaction [allyl isothiocyanate results in decreased cleavage of CASP3 protein]	23219522
D012430	Ruthenium Red	[Verapamil co-treated with Ruthenium Red co-treated with 2-aminoethoxydiphenyl borate] inhibits the reaction [Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein]	19631781
D012431	Rutin	Rutin affects the cleavage of CASP3 protein	15975156
D012431	Rutin	Rutin results in increased activity of CASP3 protein	24726691
D012431	Rutin	Rutin results in increased cleavage of CASP3 protein	28811126
D012431	Rutin	[Rutin binds to Zinc] which results in increased expression of CASP3 mRNA	26091902
D012431	Rutin	[Rutin co-treated with Meloxicam] affects the reaction [Formaldehyde affects the expression of CASP3 protein]	29315975
D012431	Rutin	Rutin inhibits the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]	29522708
D012431	Rutin	Rutin inhibits the reaction [Oxaliplatin results in increased expression of CASP3 protein]	24908156
D012431	Rutin	Rutin results in increased expression of CASP3 mRNA	26091902
D012431	Rutin	Rutin inhibits the reaction [Cholesterol, Dietary results in increased cleavage of CASP3 protein]	27239252
D012431	Rutin	Rutin inhibits the reaction [Cholesterol, Dietary results in increased expression of CASP3 mRNA]	27239252
D012431	Rutin	Rutin inhibits the reaction [Oxidopamine results in increased expression of CASP3 mRNA]	25129099
D012433	Ryanodine	[Ryanodine co-treated with Thioctic Acid] results in decreased activity of CASP3 protein	17079870
D012433	Ryanodine	Ryanodine inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17079870
C039961	S-(1,2-dichlorovinyl)cysteine	alpha-Tocopherol inhibits the reaction [S-(1,2-dichlorovinyl)cysteine results in increased activity of CASP3 protein]	29129777
C039961	S-(1,2-dichlorovinyl)cysteine	S-(1,2-dichlorovinyl)cysteine results in increased activity of CASP3 protein	29129777
C079198	S 1 (combination)	[S 1 (combination) co-treated with Sirolimus] results in increased expression of CASP3 protein	19764996
C079198	S 1 (combination)	[S 1 (combination) co-treated with temsirolimus] results in increased expression of CASP3 protein	19764996
D012436	S-Adenosylmethionine	S-Adenosylmethionine inhibits the reaction [Ethanol results in increased activity of CASP3 protein]	17869084
D012436	S-Adenosylmethionine	S-Adenosylmethionine results in decreased activity of CASP3 protein	18571630
D012451	Safrole	Safrole results in increased activity of CASP3 protein	21591240
D012451	Safrole	Safrole results in increased expression of CASP3 mRNA	21591240
C025759	saikosaponin	[Imatinib Mesylate co-treated with saikosaponin] results in increased cleavage of and results in increased activity of CASP3 protein	23994742
C025759	saikosaponin	saikosaponin promotes the reaction [SB 203580 results in increased cleavage of and results in increased activity of CASP3 protein]	23994742
C025759	saikosaponin	saikosaponin results in increased cleavage of and results in increased activity of CASP3 protein	23994742
C025759	saikosaponin	saikosaponin results in increased expression of CASP3 protein modified form	23994742
C413684	salicylaldehyde isonicotinoyl hydrazone	salicylaldehyde isonicotinoyl hydrazone analog results in increased activity of CASP3 protein	22521999
C000687	salicyl hydrazide	salicyl hydrazide analog results in increased activity of CASP3 protein	25684395
C010327	salinomycin	salinomycin results in increased activity of CASP3 protein	29331652
C010327	salinomycin	salinomycin results in increased expression of CASP3 mRNA	29331652
C010327	salinomycin	salinomycin results in increased cleavage of CASP3 protein	30273566
C065299	S-allylcysteine	S-allylcysteine results in increased cleavage of CASP3 protein	17155983
C065299	S-allylcysteine	[S-allylcysteine co-treated with Clotrimazole] inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
C065299	S-allylcysteine	S-allylcysteine inhibits the reaction [lead acetate results in increased activity of CASP3 protein]	22033380
C065299	S-allylcysteine	[S-allylcysteine co-treated with Lycopene] inhibits the reaction [[Methylnitronitrosoguanidine co-treated with Sodium Chloride] results in decreased expression of CASP3 protein]	16030430
D000068299	Salmeterol Xinafoate	[Fluticasone co-treated with Salmeterol Xinafoate] results in increased activity of CASP3 protein	15536434
C036617	salsolinol	Memantine inhibits the reaction [salsolinol results in increased activity of CASP3 protein]	17996985
C036617	salsolinol	salsolinol results in increased activity of CASP3 protein	17996985
C036617	salsolinol	salsolinol results in increased cleavage of CASP3 protein	23261589
C496827	salubrinal	salubrinal inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	21809093
C496827	salubrinal	salubrinal inhibits the reaction [MAP3K5 protein results in increased activity of CASP3 protein]	20929985
C496827	salubrinal	salubrinal inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	19735704; 20929985; 28986289;
C496827	salubrinal	salubrinal inhibits the reaction [decamethrin results in increased cleavage of and results in increased activity of CASP3 protein]	30247739
C496827	salubrinal	salubrinal inhibits the reaction [Rotenone results in increased expression of CASP3 mRNA]	25428620
C496827	salubrinal	salubrinal promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21616140
C496827	salubrinal	salubrinal promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	21616140
C496827	salubrinal	salubrinal inhibits the reaction [Rotenone results in increased expression of CASP3 mRNA]	26446018
C496827	salubrinal	salubrinal inhibits the reaction [Tetrachlorodibenzodioxin results in increased cleavage of CASP3 protein]	24932542
C568740	salvianolic acid	salvianolic acid inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	30431688
C066201	salvianolic acid A	salvianolic acid A inhibits the reaction [Plant Extracts results in increased expression of CASP3 protein]	23993977
C066201	salvianolic acid A	salvianolic acid A inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
C066201	salvianolic acid A	salvianolic acid A inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	17244260
C076944	salvianolic acid B	salvianolic acid B inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	20686228
C076944	salvianolic acid B	salvianolic acid B inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 protein modified form]	20686228
C076944	salvianolic acid B	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [salvianolic acid B inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	23201927
C076944	salvianolic acid B	salvianolic acid B inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23201927
C076944	salvianolic acid B	salvianolic acid B inhibits the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	28495616
C076944	salvianolic acid B	salvianolic acid B inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	24769256
C018381	salvin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [salvin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]]	26686574
C018381	salvin	Acetylcysteine inhibits the reaction [salvin results in increased cleavage of CASP3 protein]	28918123
C018381	salvin	GSTP1 mutant form inhibits the reaction [salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]]	25271104
C018381	salvin	PINK1 protein affects the reaction [salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]]	30707903
C018381	salvin	salvin inhibits the reaction [Acrylamide results in increased expression of CASP3 mRNA]	28159594
C018381	salvin	salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25271104; 25446857; 30707903;
C018381	salvin	salvin inhibits the reaction [[Oxygen deficiency co-treated with Oxygen] results in increased cleavage of CASP3 protein]	24557422
C018381	salvin	salvin inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	26686574
C018381	salvin	salvin inhibits the reaction [Pyruvaldehyde results in increased expression of CASP3 protein]	26577515
C018381	salvin	salvin results in increased cleavage of CASP3 protein	28918123
C018381	salvin	salvin inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	29854073
C018381	salvin	salvin inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25446857
C040256	SAN 58035	SAN 58035 promotes the reaction [Cholesterol Esters results in increased cleavage of CASP3 protein]	28275691
C005705	sanguinarine	[sanguinarine co-treated with Arsenic Trioxide co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	24345465
C005705	sanguinarine	[sanguinarine co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	24345465
C005705	sanguinarine	[sanguinarine co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	24345465
C005705	sanguinarine	sanguinarine results in decreased expression of CASP3 protein alternative form	19135517
C005705	sanguinarine	sanguinarine results in increased activity of CASP3 protein	19135517; 19346183; 20150630; 22215411;
C005705	sanguinarine	[sanguinarine results in increased chemical synthesis of Reactive Oxygen Species] which results in increased activity of CASP3 protein	23660334
D012503	Saponins	Saponins inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 mRNA]	29274434
D012503	Saponins	Saponins results in increased cleavage of CASP3 protein	28088315
D012503	Saponins	Saponins results in increased metabolism of CASP3 protein	12856725
D012503	Saponins	Saponins results in decreased expression of CASP3 protein	23994094
C044363	sappanchalcone	sappanchalcone results in increased activity of CASP3 protein	21963806
C000607554	SAR7334	SAR7334 inhibits the reaction [conocarpan results in increased cleavage of CASP3 protein]	31054997
C028268	satratoxin G	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [satratoxin G results in increased activity of CASP3 protein]	18535002
C028268	satratoxin G	satratoxin G results in increased activity of CASP3 protein	18535002
C014184	satratoxin H	pyrazolanthrone inhibits the reaction [satratoxin H results in increased cleavage of CASP3 protein]	22863859
C014184	satratoxin H	satratoxin H results in increased cleavage of CASP3 protein	22863859
C014184	satratoxin H	SB 203580 inhibits the reaction [satratoxin H results in increased cleavage of CASP3 protein]	22863859
C410958	sauchinone	sauchinone results in decreased expression of CASP3 protein	27871897
C502994	saxagliptin	saxagliptin inhibits the reaction [Rotenone results in increased expression of CASP3 protein]	25446674
C093642	SB 203580	saikosaponin promotes the reaction [SB 203580 results in increased cleavage of and results in increased activity of CASP3 protein]	23994742
C093642	SB 203580	SB 203580 inhibits the reaction [1,4-naphthoquinone analog results in increased cleavage of CASP3 protein]	30871965
C093642	SB 203580	SB 203580 inhibits the reaction [3-oxo-29-noroleana-1,9(11),12-trien-2,20-dicarbonitrile results in increased cleavage of CASP3 protein]	24036456
C093642	SB 203580	SB 203580 inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	14722101
C093642	SB 203580	SB 203580 inhibits the reaction [[Arsenic Trioxide co-treated with phytosphingosine] results in increased activity of CASP3 protein]	17237268
C093642	SB 203580	SB 203580 inhibits the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
C093642	SB 203580	SB 203580 inhibits the reaction [cantharidic acid results in increased cleavage of CASP3 protein]	29159945
C093642	SB 203580	SB 203580 inhibits the reaction [Chlorpyrifos results in increased expression of CASP3 protein modified form]	23416140
C093642	SB 203580	SB 203580 inhibits the reaction [DDT results in increased activity of CASP3 protein]	15603917
C093642	SB 203580	SB 203580 inhibits the reaction [Emodin results in increased cleavage of CASP3 protein]	27032576
C093642	SB 203580	SB 203580 inhibits the reaction [[ESR1 protein results in increased susceptibility to Quercetin] which results in increased cleavage of CASP3 protein]	19194971
C093642	SB 203580	SB 203580 inhibits the reaction [[ESR2 protein results in increased susceptibility to Estradiol] which results in increased cleavage of CASP3 protein]	21732360
C093642	SB 203580	SB 203580 inhibits the reaction [[ESR2 protein results in increased susceptibility to Quercetin] which results in increased cleavage of CASP3 protein]	21732360
C093642	SB 203580	SB 203580 inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
C093642	SB 203580	SB 203580 inhibits the reaction [malvidin results in increased activity of CASP3 protein]	15964118
C093642	SB 203580	SB 203580 inhibits the reaction [Oxidopamine results in increased cleavage of CASP3 protein]	25446857
C093642	SB 203580	SB 203580 inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	31381934
C093642	SB 203580	SB 203580 inhibits the reaction [Pyrogallol results in increased activity of CASP3 protein]	20191265
C093642	SB 203580	SB 203580 inhibits the reaction [Thimerosal results in increased activity of CASP3 protein]	17698513
C093642	SB 203580	SB 203580 promotes the reaction [Cadmium results in increased activity of and results in increased cleavage of CASP3 protein]	24824807
C093642	SB 203580	SB 203580 promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	22644961
C093642	SB 203580	SB 203580 results in increased cleavage of and results in increased activity of CASP3 protein	23994742
C093642	SB 203580	SB 203580 results in increased expression of CASP3 protein modified form	23994742; 28383207;
C093642	SB 203580	SB 203580 inhibits the reaction [chloroacetic acid results in increased activity of CASP3 protein]	23103613
C093642	SB 203580	SB 203580 inhibits the reaction [deoxynivalenol results in increased activity of CASP3 protein]	15976193
C093642	SB 203580	SB 203580 inhibits the reaction [[GMFB protein co-treated with Hydrogen Peroxide] results in increased activity of CASP3 protein]	12791701
C093642	SB 203580	SB 203580 inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	15050407
C093642	SB 203580	SB 203580 inhibits the reaction [Methylmercury Compounds results in increased activity of CASP3 protein]	21549813
C093642	SB 203580	SB 203580 inhibits the reaction [Morphine results in increased activity of CASP3 protein]	20600172
C093642	SB 203580	SB 203580 inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein]	22878015
C093642	SB 203580	SB 203580 inhibits the reaction [Uranyl Nitrate results in increased activity of CASP3 protein]	26529667
C093642	SB 203580	SB 203580 inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
C093642	SB 203580	SB 203580 inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
C093642	SB 203580	SB 203580 inhibits the reaction [Arsenic Trioxide results in increased expression of CASP3 protein]	28391263
C093642	SB 203580	SB 203580 inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C093642	SB 203580	SB 203580 inhibits the reaction [Cocaine results in increased activity of CASP3 protein]	15365088
C093642	SB 203580	SB 203580 inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C093642	SB 203580	SB 203580 inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	30928397
C093642	SB 203580	SB 203580 inhibits the reaction [[IFNG protein co-treated with IL1B protein] results in increased activity of CASP3 protein]	21295052
C093642	SB 203580	SB 203580 inhibits the reaction [satratoxin H results in increased cleavage of CASP3 protein]	22863859
C093642	SB 203580	SB 203580 inhibits the reaction [tributyltin results in increased expression of CASP3 protein]	23743147
C093642	SB 203580	SB 203580 promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	19578154
C417521	SB 216763	SB 216763 inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	17849503
C417521	SB 216763	SB 216763 inhibits the reaction [Colchicine results in increased activity of CASP3 protein]	20300959
C417521	SB 216763	SB 216763 inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased cleavage of CASP3 protein]	30597158
C417521	SB 216763	SB 216763 inhibits the reaction [Rotenone results in increased activity of CASP3 protein]	27045591
C417521	SB 216763	SB 216763 inhibits the reaction [Aspirin results in increased activity of CASP3 protein]	19706045
C406525	SB 239063	SB 239063 inhibits the reaction [prostaglandin E2 glyceryl ester results in increased cleavage of and results in increased activity of CASP3 protein]	17539917
C115461	SC 560	SC 560 results in increased activity of CASP3 protein	16391822
C115461	SC 560	SC 560 promotes the reaction [Carbon Tetrachloride results in increased cleavage of CASP3 protein]	25432964
C534628	SCH 23390	SCH 23390 inhibits the reaction [1-(2-thienyl)-2-(methylamino)propane results in increased cleavage of CASP3 protein]	30922767
C499748	SCIO-469	SCIO-469 promotes the reaction [Bortezomib results in increased cleavage of CASP3 protein]	16617327
C499748	SCIO-469	[SCIO-469 co-treated with Bortezomib] results in increased activity of CASP3 protein	16617327
D012601	Scopolamine	Plant Extracts inhibits the reaction [Scopolamine results in increased expression of CASP3 mRNA]	26434561
D012601	Scopolamine	Scopolamine results in increased expression of CASP3 mRNA	26434561
D012601	Scopolamine	Scopolamine results in increased expression of CASP3 protein	17120751
D012604	Scorpion Venoms	Scorpion Venoms results in increased activity of CASP3 protein	19913524; 21945044;
D012604	Scorpion Venoms	Scorpion Venoms results in increased expression of CASP3	19913524
D012604	Scorpion Venoms	Scorpion Venoms results in increased susceptibility to [KNK 437 results in increased activity of CASP3 protein]	19913524
D012604	Scorpion Venoms	Scorpion Venoms results in increased susceptibility to [tanespimycin results in increased activity of CASP3 protein]	19913524
C410733	scriptaid	NR4A1 protein promotes the reaction [scriptaid results in increased cleavage of CASP3 protein]	21319187
C410733	scriptaid	scriptaid results in increased cleavage of CASP3 protein	21319187
C499814	Scutellaria baicalensis extract	[Lipopolysaccharides co-treated with Scutellaria baicalensis extract] results in increased cleavage of and results in increased activity of CASP3 protein	21299906
C524947	Scutellaria barbata extract	Scutellaria barbata extract results in increased cleavage of and results in increased activity of CASP3 protein	15369734
C484876	scutellarin	scutellarin inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	18442013
D012642	Selegiline	Selegiline inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of CASP3 mRNA]	14724376
D012642	Selegiline	Selegiline inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	12880480
D012642	Selegiline	Selegiline inhibits the reaction [linsidomine results in increased expression of CASP3 protein]	12880480
D012642	Selegiline	Selegiline promotes the reaction [Hydroxyurea results in increased cleavage of CASP3 protein]	23696560
D012642	Selegiline	Selegiline inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
D064586	Selenic Acid	Selenic Acid results in increased activity of CASP3 protein	21215776
D012643	Selenium	Selenium inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 mRNA]	25035189
D012643	Selenium	Selenium inhibits the reaction [Cadmium results in increased expression of CASP3]	25805271
D012643	Selenium	[Selenium analog co-treated with Magnesium Oxide analog] inhibits the reaction [Diazinon results in increased expression of CASP3 mRNA]	27920530
D012643	Selenium	Selenium results in decreased activity of CASP3 protein	17997286
D012643	Selenium	Selenium results in increased activity of CASP3 protein	15318939
D012643	Selenium	Selenium deficiency promotes the reaction [T-2 Toxin results in increased expression of CASP3 protein modified form]	30629952
D012643	Selenium	Selenium inhibits the reaction [arsenite results in increased expression of CASP3 protein]	29324385
D012643	Selenium	[Vitamin E co-treated with Selenium] inhibits the reaction [Malathion results in increased expression of CASP3 mRNA]	21628957
D012643	Selenium	Selenium inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	17383151
D012643	Selenium	Selenium inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	19135140
D012645	Selenomethionine	Selenomethionine results in increased activity of CASP3 protein	21215776
C002979	selenomethylselenocysteine	BMF protein promotes the reaction [selenomethylselenocysteine metabolite results in increased expression of CASP3 protein modified form]	25321483
C002979	selenomethylselenocysteine	selenomethylselenocysteine metabolite results in increased expression of CASP3 protein modified form	25321483
C002979	selenomethylselenocysteine	selenomethylselenocysteine results in increased activity of CASP3 protein	15318939
C009237	senecionine	senecionine results in increased activity of and results in increased cleavage of CASP3 protein	29458164
C009238	senkirkine	senkirkine results in increased cleavage of CASP3 protein	29458164
C078903	seocalcitol	seocalcitol results in increased activity of CASP3 protein	12446453
C016727	sepiapterin	sepiapterin inhibits the reaction [4-hydroxy-2-nonenal results in increased activity of CASP3 protein]	17872449
D012701	Serotonin	Serotonin inhibits the reaction [7-ketocholesterol results in increased activity of CASP3 protein]	24650663
D020280	Sertraline	4-phenylbutyric acid inhibits the reaction [Sertraline results in increased activity of CASP3 protein]	24865413
D020280	Sertraline	Sertraline results in increased activity of CASP3 protein	24865413
D020280	Sertraline	Sertraline results in increased cleavage of and results in increased activity of CASP3 protein	24194395
C054125	sesamin	sesamin inhibits the reaction [nickel sulfate results in increased cleavage of CASP3 protein]	23317420
C054125	sesamin	sesamin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	22524206
C025583	sesamol	sesamol results in increased activity of CASP3 protein	27270451
C025583	sesamol	sesamol inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	30261164
C025583	sesamol	zinc protoporphyrin inhibits the reaction [sesamol inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	30261164
D012717	Sesquiterpenes	Sesquiterpenes results in increased activity of CASP3 protein	18070620
C042431	S-ethyl glutathione	S-ethyl glutathione inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D000077149	Sevoflurane	APP protein modified form promotes the reaction [Sevoflurane results in increased cleavage of CASP3 protein]	19433662
D000077149	Sevoflurane	benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Sevoflurane results in increased cleavage of CASP3 protein]	19433662
D000077149	Sevoflurane	L 685458 inhibits the reaction [Sevoflurane results in increased cleavage of CASP3 protein]	19433662
D000077149	Sevoflurane	Sevoflurane results in increased activity of CASP3 protein	16678324
D000077149	Sevoflurane	Sevoflurane results in increased cleavage of and results in increased activity of CASP3 protein	15915027
D000077149	Sevoflurane	Sevoflurane results in increased cleavage of CASP3 protein	18349187; 19433662;
D000077149	Sevoflurane	Sevoflurane results in increased expression of CASP3 mRNA	19572936
D000077149	Sevoflurane	Sevoflurane promotes the reaction [CASP3 protein results in increased cleavage of APP protein]	19433662
D000077149	Sevoflurane	Sevoflurane results in increased cleavage of and results in increased activity of CASP3 protein	19212262; 19433662;
D000077149	Sevoflurane	Sevoflurane results in increased cleavage of CASP3 protein	18852026
C516024	SH-6 compound	SH-6 compound promotes the reaction [Resveratrol results in increased activity of CASP3 protein]	19827268
C516024	SH-6 compound	SH-6 compound results in increased activity of CASP3 protein	14990993
C516024	SH-6 compound	SH-6 compound promotes the reaction [Dopamine results in increased activity of CASP3 protein]	18194434
C516024	SH-6 compound	SH-6 compound promotes the reaction [tanespimycin promotes the reaction [Dopamine results in increased activity of CASP3 protein]]	18194434
D022641	Shiga Toxin 2	Shiga Toxin 2 results in increased activity of CASP3 protein	12826277
D022641	Shiga Toxin 2	Terbutaline inhibits the reaction [Shiga Toxin 2 results in increased activity of CASP3 protein]	12826277
D022641	Shiga Toxin 2	[Terbutaline results in increased activity of ADRB2 protein] inhibits the reaction [Shiga Toxin 2 results in increased activity of CASP3 protein]	12826277
C016101	shikonin	shikonin results in increased cleavage of CASP3 protein	25591861
C040115	shogaol	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[shogaol co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein]	25619640
C040115	shogaol	[shogaol co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein	25619640
C040115	shogaol	shogaol results in increased cleavage of and results in increased activity of CASP3 protein	18384088
C058254	sibutramine	sibutramine results in increased activity of CASP3 protein	27838152
D000068677	Sildenafil Citrate	CASP3 protein promotes the reaction [Sildenafil Citrate results in increased susceptibility to Doxorubicin]	20155316
D000068677	Sildenafil Citrate	Sildenafil Citrate promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	20884855
D000068677	Sildenafil Citrate	5-hydroxydecanoic acid inhibits the reaction [Sildenafil Citrate inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	15811867
D000068677	Sildenafil Citrate	Sildenafil Citrate inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	15811867
D000068677	Sildenafil Citrate	Sildenafil Citrate inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	19152827
D012822	Silicon Dioxide	Ascorbic Acid inhibits the reaction [Silicon Dioxide results in decreased expression of CASP3 mRNA]	22245848
D012822	Silicon Dioxide	Ascorbic Acid inhibits the reaction [Silicon Dioxide results in increased activity of CASP3 protein]	22245848
D012822	Silicon Dioxide	fisetin inhibits the reaction [Silicon Dioxide results in increased expression of CASP3 mRNA]	22931364
D012822	Silicon Dioxide	pifithrin inhibits the reaction [Silicon Dioxide results in increased expression of CASP3 protein modified form]	31082419
D012822	Silicon Dioxide	Silicon Dioxide results in increased activity of CASP3 protein	22245848
D012822	Silicon Dioxide	Silicon Dioxide results in increased expression of CASP3 mRNA	22245848; 22931364;
D012822	Silicon Dioxide	Silicon Dioxide results in increased expression of CASP3 protein	21723938
D012822	Silicon Dioxide	Silicon Dioxide results in increased expression of CASP3 protein modified form	31082419
D012822	Silicon Dioxide	SIRT1 protein inhibits the reaction [Silicon Dioxide results in increased expression of CASP3 protein modified form]	31082419
D012822	Silicon Dioxide	HMGB1 protein promotes the reaction [Silicon Dioxide results in increased cleavage of CASP3 protein]	27616297
D012822	Silicon Dioxide	neo-gambogic acid inhibits the reaction [Silicon Dioxide results in increased cleavage of CASP3 protein]	27616297
D012822	Silicon Dioxide	Silicon Dioxide analog results in increased expression of CASP3 mRNA	26263183
D012822	Silicon Dioxide	Silicon Dioxide analog results in increased expression of CASP3 protein	26263183
D012822	Silicon Dioxide	Silicon Dioxide results in increased activity of CASP3 protein	19022359
D012822	Silicon Dioxide	Silicon Dioxide results in increased cleavage of CASP3 protein	27616297; 30698894;
D012822	Silicon Dioxide	Vitamin D inhibits the reaction [Silicon Dioxide results in increased cleavage of CASP3 protein]	30698894
D012834	Silver	Dexamethasone promotes the reaction [Silver results in increased activity of CASP3 protein]	19760634
D012834	Silver	Etoposide promotes the reaction [Silver results in increased activity of CASP3 protein]	19760634
D012834	Silver	Silver analog affects the expression of CASP3 mRNA	24849675
D012834	Silver	Silver analog affects the expression of CASP3 protein	24849675
D012834	Silver	[Silver analog co-treated with Polyethylene Glycols] results in increased expression of CASP3 mRNA	27021274
D012834	Silver	[Silver analog co-treated with poly(N-vinylpyrrolidine)] results in increased cleavage of CASP3 protein	26028148
D012834	Silver	[Silver co-treated with Povidone] affects the expression of CASP3 protein	27387714
D012834	Silver	[Silver co-treated with Povidone] results in decreased expression of CASP3 mRNA	27387714
D012834	Silver	Silver results in decreased expression of CASP3 protein	25462594
D012834	Silver	Silver results in increased activity of CASP3 protein	19760634; 23804405;
D012834	Silver	Silver analog results in increased activity of CASP3 protein	19269301
D018030	Silver Compounds	4-phenylbutyric acid inhibits the reaction [Silver Compounds results in increased expression of CASP3 protein modified form]	29306025
D018030	Silver Compounds	Silver Compounds results in increased activity of CASP3 protein	21182908
D018030	Silver Compounds	Silver Compounds results in increased expression of CASP3 protein modified form	29306025
D000077385	Silybin	Arsenic Trioxide promotes the reaction [Silybin results in increased activity of CASP3 protein]	21969006
D000077385	Silybin	benzoylcarbonyl-valyl-aspartyl-valyl-alanyl-aspartyl-fluoromethyl ketone inhibits the reaction [Silybin results in increased cleavage of and results in increased activity of CASP3 protein]	16777994
D000077385	Silybin	Caffeine inhibits the reaction [Silybin results in increased cleavage of and results in increased activity of CASP3 protein]	16777994
D000077385	Silybin	pifithrin inhibits the reaction [Silybin results in increased cleavage of and results in increased activity of CASP3 protein]	16777994
D000077385	Silybin	Silybin promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 mRNA]	21969006
D000077385	Silybin	Silybin results in increased activity of CASP3 protein	21969006
D000077385	Silybin	Silybin results in increased cleavage of and results in increased activity of CASP3 protein	16777994
D000077385	Silybin	Silybin results in increased expression of CASP3 mRNA	21969006
D012838	Silymarin	[essential 303 forte co-treated with Silymarin co-treated with Melatonin analog] affects the activity of CASP3 protein	25903262
D012838	Silymarin	Silymarin inhibits the reaction [[Lipopolysaccharides co-treated with Galactosamine] results in increased expression of CASP3 protein modified form]	20850421
D012838	Silymarin	Silymarin inhibits the reaction [Mercuric Chloride results in increased activity of CASP3 protein]	15050407
D012838	Silymarin	Silymarin inhibits the reaction [Paraquat results in increased expression of CASP3 protein modified form]	29054699
D012838	Silymarin	Silymarin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	27616468
D012838	Silymarin	Silymarin inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D012838	Silymarin	Silymarin inhibits the reaction [Indomethacin results in increased expression of CASP3 protein]	28648817
D012838	Silymarin	Silymarin inhibits the reaction [nimesulide results in increased cleavage of CASP3 protein]	22509279
D012838	Silymarin	Silymarin inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19772912
D012838	Silymarin	Silymarin inhibits the reaction [Testosterone results in decreased activity of CASP3 protein]	23500659
D019821	Simvastatin	geranylgeranyl pyrophosphate inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	16470222
D019821	Simvastatin	Mevalonic Acid inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	16470222; 17428261; 20427495;
D019821	Simvastatin	Mevalonic Acid inhibits the reaction [Simvastatin results in increased expression of CASP3 protein]	15949312
D019821	Simvastatin	Simvastatin inhibits the reaction [APP protein alternative form results in decreased expression of CASP3 protein]	17241114
D019821	Simvastatin	Simvastatin inhibits the reaction [APP protein alternative form results in increased activity of CASP3 protein]	17241114
D019821	Simvastatin	Simvastatin inhibits the reaction [Coal Ash results in increased expression of CASP3 protein modified form]	26773838
D019821	Simvastatin	Simvastatin inhibits the reaction [Homocysteine results in increased activity of CASP3 protein]	19343037
D019821	Simvastatin	Simvastatin results in increased activity of CASP3 protein	16470222; 17428261; 18521906; 20427495;
D019821	Simvastatin	Simvastatin results in increased cleavage of and results in increased activity of CASP3 protein	15200425; 19253821; 20045437;
D019821	Simvastatin	Simvastatin results in increased cleavage of CASP3 protein	12962723; 20464445;
D019821	Simvastatin	Simvastatin results in increased expression of CASP3 mRNA	21729534
D019821	Simvastatin	Simvastatin results in increased expression of CASP3 protein	15949312; 18031796; 21729534;
D019821	Simvastatin	Acetylcysteine inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	20883752
D019821	Simvastatin	[Glucose deficiency co-treated with Simvastatin] results in increased cleavage of CASP3 protein	17928392
D019821	Simvastatin	IGF1 protein inhibits the reaction [Simvastatin results in increased cleavage of CASP3 protein]	27734117
D019821	Simvastatin	[Lipopolysaccharides co-treated with Simvastatin] results in increased activity of CASP3 protein	16325779
D019821	Simvastatin	Simvastatin results in increased activity of CASP3 protein	20883752
D019821	Simvastatin	Simvastatin results in increased cleavage of CASP3 protein	27734117
D019821	Simvastatin	zinc protoporphyrin inhibits the reaction [[Glucose deficiency co-treated with Simvastatin] results in increased cleavage of CASP3 protein]	17928392
D019821	Simvastatin	carvacrol inhibits the reaction [Simvastatin promotes the reaction [Poloxamer results in increased expression of CASP3 protein]]	29071762
D019821	Simvastatin	farnesyl pyrophosphate inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	15200425
D019821	Simvastatin	geranylgeranyl pyrophosphate inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	15200425
D019821	Simvastatin	Mevalonic Acid inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	16698853
D019821	Simvastatin	PD 150606 inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	14527821
D019821	Simvastatin	Simvastatin inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	18004065
D019821	Simvastatin	Simvastatin inhibits the reaction [Monocrotaline results in increased expression of CASP3 mRNA]	22022327
D019821	Simvastatin	Simvastatin promotes the reaction [Poloxamer results in increased expression of CASP3 protein]	29071762
D019821	Simvastatin	Simvastatin results in decreased activity of CASP3 protein	18826357; 20403180; 21968084;
D019821	Simvastatin	Simvastatin results in decreased expression of and results in decreased activity of CASP3 protein	16054375
D019821	Simvastatin	Simvastatin results in increased activity of CASP3 protein	11868908; 12557325; 14527821; 15200425; 16698853; 25300705;
D019821	Simvastatin	Simvastatin results in increased cleavage of and results in increased activity of CASP3 protein	21651924
D019821	Simvastatin	Verapamil inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	14527821
C574383	sinularin	Acetylcysteine promotes the reaction [sinularin results in increased cleavage of CASP3 protein]	28548367
C574383	sinularin	sinularin results in increased cleavage of CASP3 protein	28548367
D020123	Sirolimus	[7-hydroxystaurosporine co-treated with Sirolimus] results in increased cleavage of CASP3 protein	15767555
D020123	Sirolimus	Boc-D-FMK inhibits the reaction [[Sirolimus co-treated with 7-hydroxystaurosporine] results in increased cleavage of CASP3 protein]	15767555
D020123	Sirolimus	[Curcumin co-treated with Sirolimus] results in increased activity of CASP3 protein	19373661
D020123	Sirolimus	Fluorouracil promotes the reaction [Sirolimus results in increased expression of CASP3 mRNA]	19764996
D020123	Sirolimus	pyrazolanthrone inhibits the reaction [[Sirolimus co-treated with 7-hydroxystaurosporine] results in increased cleavage of CASP3 protein]	15767555
D020123	Sirolimus	[S 1 (combination) co-treated with Sirolimus] results in increased expression of CASP3 protein	19764996
D020123	Sirolimus	[Sirolimus co-treated with Paclitaxel] results in increased cleavage of CASP3 protein	15753396
D020123	Sirolimus	Sirolimus inhibits the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	30236763
D020123	Sirolimus	Sirolimus inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	21410490
D020123	Sirolimus	Sirolimus inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]	19682553
D020123	Sirolimus	Sirolimus promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]	18058806
D020123	Sirolimus	Sirolimus promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15571967
D020123	Sirolimus	Sirolimus promotes the reaction [Fluorouracil results in increased expression of CASP3 mRNA]	19764996
D020123	Sirolimus	Sirolimus results in increased activity of CASP3 protein	15782132
D020123	Sirolimus	Sirolimus results in increased cleavage of CASP3 protein	15878982
D020123	Sirolimus	Sirolimus results in increased expression of CASP3 mRNA	19764996
D020123	Sirolimus	Sirolimus inhibits the reaction [Cadmium Chloride results in increased activity of CASP3 protein]	24299490; 30030080;
D020123	Sirolimus	Sirolimus inhibits the reaction [TGFB1 protein inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]]	28342888
D020123	Sirolimus	Sirolimus promotes the reaction [Cadmium results in increased cleavage of CASP3 protein]	29111403
D020123	Sirolimus	Sirolimus results in decreased activity of CASP3 protein	18097008
D020123	Sirolimus	Sirolimus results in increased activity of CASP3 protein	14502240
D020123	Sirolimus	Sirolimus results in increased expression of CASP3 mRNA	21681844
D020123	Sirolimus	Sirolimus results in increased expression of CASP3 protein	20358864
D020123	Sirolimus	[Sirolimus co-treated with Resveratrol] results in increased cleavage of CASP3 protein	24304514
D020123	Sirolimus	Sirolimus inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
D020123	Sirolimus	Sirolimus inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	16497721
D020123	Sirolimus	Sirolimus inhibits the reaction [T-2 Toxin results in increased expression of CASP3 protein modified form]	30629952
D020123	Sirolimus	Sirolimus promotes the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
D020123	Sirolimus	Sirolimus results in decreased activity of CASP3 protein	20031680
D020123	Sirolimus	Sirolimus results in decreased cleavage of and results in decreased activity of CASP3 protein	21357504
D020123	Sirolimus	Sirolimus results in increased expression of CASP3 protein modified form	26825372
C439060	sirtinol	sirtinol inhibits the reaction [Resveratrol results in increased activity of CASP3 protein]	20697895
C439060	sirtinol	sirtinol inhibits the reaction [rhodioloside inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]]	28851138
C439060	sirtinol	sirtinol promotes the reaction [cudraflavone B results in increased activity of CASP3 protein]	23881456
C439060	sirtinol	sirtinol inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	25665036; 26450947;
C439060	sirtinol	sirtinol results in increased cleavage of and results in increased activity of CASP3 protein	26251326
C439060	sirtinol	sirtinol inhibits the reaction [Resveratrol inhibits the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]]	24889822
C439060	sirtinol	sirtinol promotes the reaction [Hydrogen Peroxide results in increased expression of CASP3 protein modified form]	24889822
C497103	SK-7041	SK-7041 results in increased cleavage of and results in increased activity of CASP3 protein	16009488
C533467	SM 164	SM 164 results in increased cleavage of CASP3 protein	22241084
C000619853	SM-1 compound	SM-1 compound affects the localization of CASP3 protein	27488460
C000619853	SM-1 compound	[SM-1 compound co-treated with Fluorouracil] results in increased cleavage of CASP3 protein	28599477
C000619853	SM-1 compound	SM-1 compound inhibits the reaction [Zinc results in decreased activity of CASP3 protein]	27488460
C000619853	SM-1 compound	SM-1 compound results in increased activity of and results in increased cleavage of CASP3 protein	27488460
C017514	S-methyl glutathione	S-methyl glutathione inhibits the reaction [chelerythrine results in increased cleavage of CASP3 protein]	26124276
C027744	S-methylisothiopseudouronium	S-methylisothiopseudouronium inhibits the reaction [IL1B protein results in increased activity of CASP3 protein]	12384474
D012906	Smoke	Smoke analog results in increased activity of CASP3 protein	23665932
D012906	Smoke	Smoke analog results in increased cleavage of and results in increased activity of CASP3 protein	19394402
C118258	SN50 peptide	SN50 peptide inhibits the reaction [Diquat results in increased expression of CASP3 protein modified form]	29484840
C110881	S-nitro-N-acetylpenicillamine	Mercuric Chloride inhibits the reaction [S-nitro-N-acetylpenicillamine inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]]	15623433
C110881	S-nitro-N-acetylpenicillamine	S-nitro-N-acetylpenicillamine inhibits the reaction [Doxorubicin results in increased activity of and results in increased cleavage of CASP3 protein]	15623433
C110881	S-nitro-N-acetylpenicillamine	S-nitro-N-acetylpenicillamine results in increased nitrosation of CASP3 protein	15623433
C021315	S-nitrosocysteine	S-nitrosocysteine inhibits the reaction [SIRT1 protein results in decreased cleavage of CASP3 protein]	24451382
D026422	S-Nitrosoglutathione	[S-Nitrosoglutathione results in increased abundance of Nitric Oxide] which results in decreased activity of CASP3 protein	10828028
D026422	S-Nitrosoglutathione	[S-Nitrosoglutathione results in increased abundance of Nitric Oxide] which results in increased metabolism of CASP3 protein	10828028
D026422	S-Nitrosoglutathione	S-Nitrosoglutathione results in increased activity of CASP3 protein	20153346
D026422	S-Nitrosoglutathione	[tempol co-treated with UCF 101 co-treated with acetovanillone] inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	20153346
D026422	S-Nitrosoglutathione	Cyclosporine inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	10205001
D026422	S-Nitrosoglutathione	S-Nitrosoglutathione results in increased activity of CASP3 protein	10205001
D026422	S-Nitrosoglutathione	Tacrolimus inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	10205001
D026423	S-Nitroso-N-Acetylpenicillamine	S-Nitroso-N-Acetylpenicillamine results in decreased cleavage of CASP3 protein	29059224
D026423	S-Nitroso-N-Acetylpenicillamine	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [N-caproylsphingosine promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	10811113
D026423	S-Nitroso-N-Acetylpenicillamine	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [N-caproylsphingosine results in increased activity of CASP3 protein]	10811113
D026423	S-Nitroso-N-Acetylpenicillamine	Melatonin inhibits the reaction [S-Nitroso-N-Acetylpenicillamine results in increased activity of CASP3 protein]	12220328
D026423	S-Nitroso-N-Acetylpenicillamine	S-Nitroso-N-Acetylpenicillamine results in increased activity of CASP3 protein	12220328
D026423	S-Nitroso-N-Acetylpenicillamine	[S-Nitroso-N-Acetylpenicillamine results in increased abundance of Nitric Oxide] inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	9755104
D026423	S-Nitroso-N-Acetylpenicillamine	S-Nitroso-N-Acetylpenicillamine results in decreased activity of CASP3 protein	12006578
C534922	SNX 2112	SNX 2112 results in increased expression of CASP3 protein modified form	23777986
C009277	sodium arsenate	Ellagic Acid inhibits the reaction [sodium arsenate results in increased activity of CASP3 protein]	29854611
C009277	sodium arsenate	sodium arsenate results in increased activity of CASP3 protein	29854611
C009277	sodium arsenate	sodium arsenate results in increased cleavage of CASP3 protein	29710533
C009277	sodium arsenate	sodium arsenate results in increased expression of CASP3 mRNA	29710533
C009277	sodium arsenate	thymoquinone inhibits the reaction [sodium arsenate results in increased cleavage of CASP3 protein]	29710533
C009277	sodium arsenate	thymoquinone inhibits the reaction [sodium arsenate results in increased expression of CASP3 mRNA]	29710533
C017947	sodium arsenite	2,3-dimercaptosuccinic acid monocyclohexyl ester inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	18163546; 23376091;
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	18163546; 23376091;
C017947	sodium arsenite	sodium arsenite results in increased activity of CASP3 protein	18163546; 23376091;
C017947	sodium arsenite	[Succimer co-treated with Succimer analog] inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	18163546
C017947	sodium arsenite	Succimer promotes the reaction [2,3-dimercaptosuccinic acid monocyclohexyl ester inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	18163546; 23376091;
C017947	sodium arsenite	Succimer promotes the reaction [monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	18163546; 23376091;
C017947	sodium arsenite	2-tert-butylhydroquinone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	26878773
C017947	sodium arsenite	Acetylcysteine inhibits the reaction [[sodium arsenite co-treated with Vitamin K 3] results in increased activity of CASP3 protein]	19082730
C017947	sodium arsenite	Acetylcysteine inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	19536524
C017947	sodium arsenite	CASP3 protein affects the susceptibility to sodium arsenite	23219847
C017947	sodium arsenite	Curcumin inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	23710286
C017947	sodium arsenite	[delphinidin results in increased susceptibility to sodium arsenite] which results in increased cleavage of CASP3 protein	30125548
C017947	sodium arsenite	EIF4E protein modified form inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	25923732
C017947	sodium arsenite	Lithium inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	17849503
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	23681673
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	19615344
C017947	sodium arsenite	Roscovitine inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	18501396
C017947	sodium arsenite	SB 216763 inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	17849503
C017947	sodium arsenite	sodium arsenite affects the activity of CASP3 protein	23994116
C017947	sodium arsenite	[sodium arsenite co-treated with FASLG protein] results in increased cleavage of CASP3 protein	18977016
C017947	sodium arsenite	[sodium arsenite co-treated with Hydrogen Peroxide] results in increased cleavage of CASP3 protein	18977016
C017947	sodium arsenite	[sodium arsenite co-treated with monomethylarsonic acid co-treated with Cacodylic Acid] affects the expression of CASP3 mRNA	23192986
C017947	sodium arsenite	[sodium arsenite co-treated with Vitamin K 3] results in increased activity of CASP3 protein	19082730
C017947	sodium arsenite	[sodium arsenite results in decreased expression of BIRC5] which results in increased activity of CASP3 protein	16497974
C017947	sodium arsenite	sodium arsenite results in decreased expression of CASP3 protein modified form	22706169
C017947	sodium arsenite	sodium arsenite results in increased activity of CASP3 protein	16614167; 17202112; 17849503; 23681673; 25923732; 26878773;
C017947	sodium arsenite	sodium arsenite results in increased cleavage of CASP3 protein	16614167; 18328521; 18501396; 19536524; 23710286; 24100277; 29039521;
C017947	sodium arsenite	sodium arsenite results in increased expression of and results in increased activity of CASP3 protein	28512695
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 mRNA	19615344; 20339138;
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 protein modified form	22706169
C017947	sodium arsenite	TP53 protein inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	16614167
C017947	sodium arsenite	CDKN1B protein affects the reaction [sodium arsenite results in increased activity of CASP3 protein]	20566634
C017947	sodium arsenite	[Dietary Fats co-treated with sodium arsenite] results in increased expression of CASP3 mRNA	30302732
C017947	sodium arsenite	Drugs, Chinese Herbal inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]	28757890
C017947	sodium arsenite	epigallocatechin gallate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	28365685
C017947	sodium arsenite	GADD45A protein promotes the reaction [sodium arsenite results in increased activity of CASP3 protein]	16973625
C017947	sodium arsenite	[GCLM co-treated with GCLC] inhibits the reaction [sodium arsenite results in increased activity of and results in increased cleavage of CASP3 protein]	20006689
C017947	sodium arsenite	MAPK8 protein promotes the reaction [sodium arsenite results in increased activity of CASP3 protein]	16973625
C017947	sodium arsenite	MAPK9 protein promotes the reaction [sodium arsenite results in increased activity of CASP3 protein]	16973625
C017947	sodium arsenite	Melatonin inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	29763682
C017947	sodium arsenite	NFE2L1 protein alternative form inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	28549828
C017947	sodium arsenite	Plant Extracts inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]	27723467
C017947	sodium arsenite	salvin inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	29854073
C017947	sodium arsenite	sodium arsenite promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	23143138
C017947	sodium arsenite	sodium arsenite results in decreased activity of CASP3 protein	30195209
C017947	sodium arsenite	sodium arsenite results in increased activity of and results in increased cleavage of CASP3 protein	20006689
C017947	sodium arsenite	sodium arsenite results in increased activity of CASP3 protein	16447264; 16973625; 20566634; 21134390; 28365685; 30278210;
C017947	sodium arsenite	sodium arsenite results in increased cleavage of CASP3 protein	28549828; 29854073;
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 mRNA	30302732
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 protein	22750630; 29763682;
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 protein modified form	27723467; 28757890; 29944914;
C017947	sodium arsenite	[Sulfur Dioxide co-treated with sodium arsenite] results in increased activity of CASP3 protein	30195209
C017947	sodium arsenite	Telmisartan inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	22750630
C017947	sodium arsenite	TRP53 gene mutant form promotes the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]	29944914
C017947	sodium arsenite	TRP53 protein promotes the reaction [Plant Extracts inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein modified form]]	27723467
C017947	sodium arsenite	3-methyladenine inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	25639566
C017947	sodium arsenite	Acetylcarnitine inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	29278859
C017947	sodium arsenite	[Acetylcysteine co-treated with Atorvastatin] inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	20946910
C017947	sodium arsenite	Calcium affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
C017947	sodium arsenite	[Calcium co-treated with Zinc] affects the reaction [monoisoamyl-2,3-dimercaptosuccinate affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	24184500
C017947	sodium arsenite	[Calcium co-treated with Zinc] affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
C017947	sodium arsenite	Curcumin inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	27966075
C017947	sodium arsenite	Curcumin inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	24952339
C017947	sodium arsenite	ebselen inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	30558456
C017947	sodium arsenite	lead acetate promotes the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	23906897
C017947	sodium arsenite	Melatonin inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	17645694; 18715270;
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [lead acetate promotes the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	23906897
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite promotes the reaction [lead acetate results in increased expression of CASP3 mRNA]]	23906897
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	21513725
C017947	sodium arsenite	monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	23906897
C017947	sodium arsenite	Polysaccharides inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	31163222
C017947	sodium arsenite	PS1145 inhibits the reaction [sodium arsenite results in increased cleavage of and results in increased activity of CASP3 protein]	19616567
C017947	sodium arsenite	pyrazolanthrone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	20830294
C017947	sodium arsenite	[SERPINF1 protein co-treated with sodium arsenite] results in increased activity of CASP3 protein	30408888
C017947	sodium arsenite	[sodium arsenite co-treated with lead acetate co-treated with Cadmium Chloride] results in increased expression of CASP3 protein modified form	23680456
C017947	sodium arsenite	sodium arsenite inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	12472888
C017947	sodium arsenite	sodium arsenite promotes the reaction [lead acetate results in increased expression of CASP3 mRNA]	23906897
C017947	sodium arsenite	sodium arsenite results in decreased activity of CASP3 protein	16433889
C017947	sodium arsenite	sodium arsenite results in increased activity of and results in increased cleavage of CASP3 protein	20682336
C017947	sodium arsenite	sodium arsenite results in increased activity of and results in increased expression of CASP3 protein	20830294
C017947	sodium arsenite	sodium arsenite results in increased activity of CASP3 protein	17645694; 18715270; 20946910; 21513725; 25639566; 29278859; 30408888;
C017947	sodium arsenite	sodium arsenite results in increased cleavage of and results in increased activity of CASP3 protein	19616567
C017947	sodium arsenite	sodium arsenite results in increased cleavage of CASP3 protein	19429265; 27966075;
C017947	sodium arsenite	sodium arsenite results in increased expression of and results in increased cleavage of CASP3 protein	24517892
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3	26439596
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 mRNA	23906897; 24184500; 24497207; 29214690;
C017947	sodium arsenite	sodium arsenite results in increased expression of CASP3 protein	17681577; 19429265; 24952339; 25179238; 26767369; 27425645; 29497947; 30558456; 31163222;
C017947	sodium arsenite	Succimer inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	31163222
C017947	sodium arsenite	Taurine inhibits the reaction [sodium arsenite results in increased activity of and results in increased expression of CASP3 protein]	20830294
C017947	sodium arsenite	Taurine inhibits the reaction [sodium arsenite results in increased cleavage of and results in increased activity of CASP3 protein]	19616567
C017947	sodium arsenite	Taurine inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	19429265
C017947	sodium arsenite	Taurine inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	19429265
C017947	sodium arsenite	Taurine promotes the reaction [pyrazolanthrone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	20830294
C017947	sodium arsenite	Telmisartan inhibits the reaction [sodium arsenite results in increased expression of CASP3]	26439596
C017947	sodium arsenite	Thioctic Acid inhibits the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	29214690
C017947	sodium arsenite	thymoquinone inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	30558456
C017947	sodium arsenite	Zinc affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
D019810	Sodium Azide	Minocycline inhibits the reaction [Sodium Azide results in increased activity of CASP3 protein]	15004018
D019810	Sodium Azide	Sodium Azide results in increased activity of CASP3 protein	15004018
D020160	Sodium Benzoate	Sodium Benzoate inhibits the reaction [Asbestos, Amosite results in increased activity of CASP3 protein]	11329530
C016104	sodium bichromate	FBP1 protein promotes the reaction [sodium bichromate results in increased expression of CASP3 protein modified form]	28624442
C016104	sodium bichromate	sodium bichromate results in increased expression of CASP3 protein modified form	28624442
C016104	sodium bichromate	CAT protein inhibits the reaction [sodium bichromate results in increased activity of CASP3 protein]	20298709
C016104	sodium bichromate	MAPK8 protein affects the reaction [sodium bichromate results in increased expression of CASP3 protein modified form]	21047991
C016104	sodium bichromate	MAPK9 protein affects the reaction [sodium bichromate results in increased expression of CASP3 protein modified form]	21047991
C016104	sodium bichromate	sodium bichromate results in increased activity of CASP3 protein	20298709
C016104	sodium bichromate	sodium bichromate results in increased expression of CASP3 protein modified form	21047991
C016104	sodium bichromate	TRP53 mutant form inhibits the reaction [sodium bichromate results in increased activity of CASP3 protein]	20298709
C016104	sodium bichromate	sodium bichromate affects the expression of CASP3 mRNA	11960910
C025451	sodium bisulfide	sodium bisulfide results in increased cleavage of and results in increased activity of CASP3 protein	23479079
C025451	sodium bisulfide	sodium bisulfide inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C025451	sodium bisulfide	sodium bisulfide inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30980911
C025451	sodium bisulfide	sodium bisulfide inhibits the reaction [[Oxygen deficiency co-treated with Blood Glucose deficiency] results in increased expression of CASP3 protein modified form]	24058562
C025451	sodium bisulfide	sodium bisulfide inhibits the reaction [uranyl acetate results in increased expression of CASP3 protein]	26991019
C009279	sodium bisulfite	6-isopropoxy-9-oxoxanthene-2-carboxylic acid inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	Ascorbic Acid inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	Dizocilpine Maleate inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	KT 5720 inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	PTGS2 protein affects the susceptibility to [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C009279	sodium bisulfite	[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein	21873648
C009279	sodium bisulfite	Vitamin E inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C503854	sodium boranocarbonate	sodium boranocarbonate inhibits the reaction [lead acetate results in increased expression of CASP3 protein]	30980911
C503854	sodium boranocarbonate	sodium boranocarbonate inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]	16371440
D012965	Sodium Chloride	Sodium Chloride results in increased activity of CASP3 protein	15975986
D012965	Sodium Chloride	[Methylnitronitrosoguanidine co-treated with Sodium Chloride] results in decreased expression of CASP3 protein	16030430
D012965	Sodium Chloride	[S-allylcysteine co-treated with Lycopene] inhibits the reaction [[Methylnitronitrosoguanidine co-treated with Sodium Chloride] results in decreased expression of CASP3 protein]	16030430
D017673	Sodium Chloride, Dietary	[IGF2R protein alternative form results in increased susceptibility to Sodium Chloride, Dietary] which results in increased expression of CASP3 protein	30450786
D017673	Sodium Chloride, Dietary	[IGF2R protein alternative form results in increased susceptibility to Sodium Chloride, Dietary] which results in increased expression of CASP3 protein modified form	30450786
D020358	Sodium Cholate	[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased cleavage of CASP3 protein	27394961
D020358	Sodium Cholate	MET gene mutant form promotes the reaction [[Cholesterol, Dietary co-treated with Sodium Cholate] results in increased cleavage of CASP3 protein]	27394961
C028982	sodium chromate(VI)	sodium chromate(VI) results in increased activity of CASP3 protein	19839025
C028982	sodium chromate(VI)	sodium chromate(VI) results in increased expression of CASP3 mRNA	16283527
C009281	sodium cyanate	[sodium cyanate co-treated with Hydrogen Peroxide] results in increased activity of CASP3 protein	28400100
D012969	Sodium Fluoride	Sodium Fluoride results in increased activity of CASP3 protein	19852076
D012969	Sodium Fluoride	Sodium Fluoride results in increased cleavage of and results in increased activity of CASP3 protein	21708216
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of CASP3 mRNA	19852076
D012969	Sodium Fluoride	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Sodium Fluoride results in increased activity of CASP3 protein]	23578390
D012969	Sodium Fluoride	Lycopene inhibits the reaction [Sodium Fluoride results in increased activity of CASP3 protein]	27871895
D012969	Sodium Fluoride	Lycopene inhibits the reaction [Sodium Fluoride results in increased expression of CASP3 mRNA]	27871895
D012969	Sodium Fluoride	pyrazolanthrone inhibits the reaction [Sodium Fluoride results in increased activity of CASP3 protein]	23578390
D012969	Sodium Fluoride	Resveratrol inhibits the reaction [Sodium Fluoride results in increased cleavage of CASP3 protein]	24296261
D012969	Sodium Fluoride	Sodium Fluoride results in increased activity of CASP3 protein	21340527; 23578390; 27871895;
D012969	Sodium Fluoride	Sodium Fluoride results in increased cleavage of CASP3 protein	24296261; 30130527;
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of CASP3 mRNA	27871895; 30225638;
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of CASP3 protein	30225638; 30738887;
D012969	Sodium Fluoride	SRT1720 inhibits the reaction [Sodium Fluoride results in increased expression of CASP3 protein]	30738887
D012969	Sodium Fluoride	Calcium affects the reaction [Sodium Fluoride results in increased expression of CASP3 protein]	29642045
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of CASP3 protein	29642045
D012969	Sodium Fluoride	Acetylcysteine inhibits the reaction [Sodium Fluoride results in increased cleavage of CASP3 protein]	30633982
D012969	Sodium Fluoride	Diethylnitrosamine promotes the reaction [[Sodium Fluoride results in increased abundance of Fluorides] which results in increased activity of CASP3 protein]	30920066
D012969	Sodium Fluoride	protocatechuic acid methyl ester inhibits the reaction [Sodium Fluoride results in increased expression of CASP3 protein modified form]	29758312
D012969	Sodium Fluoride	Sodium Fluoride inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	26779593
D012969	Sodium Fluoride	[Sodium Fluoride results in increased abundance of Fluorides] promotes the reaction [Diethylnitrosamine results in increased activity of CASP3 protein]	30920066
D012969	Sodium Fluoride	[Sodium Fluoride results in increased abundance of Fluorides] which results in increased activity of CASP3 protein	30920066
D012969	Sodium Fluoride	Sodium Fluoride results in increased activity of CASP3 protein	18696052; 27871895;
D012969	Sodium Fluoride	Sodium Fluoride results in increased cleavage of CASP3 protein	30633982
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of CASP3 mRNA	19009284; 27871895;
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of CASP3 protein modified form	29758312
D012974	Sodium Iodide	Sodium Iodide promotes the reaction [perchlorate results in increased activity of CASP3 protein]	11834455
D012977	Sodium Nitrite	Sodium Nitrite results in increased expression of CASP3 mRNA	23474501
D012977	Sodium Nitrite	Carnosine inhibits the reaction [Sodium Nitrite results in increased activity of CASP3 protein]	28833918
D012977	Sodium Nitrite	Sodium Nitrite results in increased activity of CASP3 protein	28833918
D012980	Sodium Salicylate	Sodium Salicylate promotes the reaction [[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA]	29117515
D012980	Sodium Salicylate	Sodium Salicylate promotes the reaction [Metformin results in increased expression of CASP3 mRNA]	29117515
D012980	Sodium Salicylate	Sodium Salicylate results in increased activity of CASP3 protein	10090950
D012980	Sodium Salicylate	Sodium Salicylate results in increased expression of CASP3 mRNA	29117515
D012980	Sodium Salicylate	Sodium Salicylate inhibits the reaction [Paraquat results in increased activity of CASP3 protein]	17561093
D012980	Sodium Salicylate	Sodium Salicylate results in increased activity of CASP3 protein	17561093
D018038	Sodium Selenite	Sodium Selenite inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	25261862
D018038	Sodium Selenite	[Sodium Selenite co-treated with (1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane] results in increased cleavage of CASP3 protein	28757135
D018038	Sodium Selenite	Sodium Selenite results in decreased expression of CASP3 mRNA	16705456
D018038	Sodium Selenite	Sodium Selenite results in increased activity of CASP3 protein	21215776
D018038	Sodium Selenite	Sodium Selenite results in increased cleavage of CASP3 protein	28161410
D018038	Sodium Selenite	Sodium Selenite promotes the reaction [Buthionine Sulfoximine results in increased expression of CASP3 mRNA]	17989939
D018038	Sodium Selenite	Sodium Selenite results in increased expression of CASP3 mRNA	17989939; 19363675;
D018038	Sodium Selenite	Sodium Selenite inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23023949
D018038	Sodium Selenite	Acetylcarnitine inhibits the reaction [Sodium Selenite results in increased expression of CASP3 mRNA]	20067779
D018038	Sodium Selenite	Sodium Selenite results in decreased activity of CASP3 protein	18209489
D018038	Sodium Selenite	Sodium Selenite results in increased expression of CASP3 mRNA	20067779
D018038	Sodium Selenite	Sodium Selenite inhibits the reaction [[Cadmium Chloride co-treated with MIR125A mRNA mutant form] results in increased expression of CASP3 protein]	26607349
D018038	Sodium Selenite	Sodium Selenite inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	26607349
D018038	Sodium Selenite	Sodium Selenite inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	15191356
D018038	Sodium Selenite	Sodium Selenite inhibits the reaction [MIR125A mRNA mutant form results in increased expression of CASP3 protein]	26607349
D018038	Sodium Selenite	Sodium Selenite results in decreased expression of CASP3 protein	17342738
C025026	sodium sulfite	6-isopropoxy-9-oxoxanthene-2-carboxylic acid inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	Ascorbic Acid inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	Dizocilpine Maleate inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	KT 5720 inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	PTGS2 protein affects the susceptibility to [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C025026	sodium sulfite	[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein	21873648
C025026	sodium sulfite	Vitamin E inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
C017719	solanesol	2-phenylacetylenesulfonamide inhibits the reaction [solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
C017719	solanesol	solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	25645596
C017719	solanesol	solanesol promotes the reaction [2-tert-butylhydroquinone inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
C017719	solanesol	tin protoporphyrin IX inhibits the reaction [solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
D012999	Soman	Soman results in increased expression of CASP3 mRNA	19281266
C000621168	so-ochim-tang-gamibang	so-ochim-tang-gamibang results in decreased expression of CASP3 protein	27988398
C000621168	so-ochim-tang-gamibang	so-ochim-tang-gamibang inhibits the reaction [Corticosterone results in increased expression of CASP3 mRNA]	27988398
D053260	Soot	Soot affects the expression of CASP3 mRNA	29496469
D053260	Soot	Acetylcysteine inhibits the reaction [Soot analog results in increased expression of CASP3 protein]	30240709
D053260	Soot	bafilomycin A1 inhibits the reaction [Soot analog results in increased expression of CASP3 protein]	30240709
D053260	Soot	MK 2206 inhibits the reaction [Soot analog results in increased expression of CASP3 protein]	30240709
D053260	Soot	Soot analog results in increased expression of CASP3 protein	30240709
D053260	Soot	Soot results in increased expression of CASP3 mRNA	26551751
D000077157	Sorafenib	AKT1 protein inhibits the reaction [[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein]	16985072
D000077157	Sorafenib	Arsenic Trioxide promotes the reaction [Sorafenib results in decreased expression of CASP3 protein]	25416439
D000077157	Sorafenib	Arsenic Trioxide promotes the reaction [Sorafenib results in increased activity of CASP3 protein]	25416439
D000077157	Sorafenib	BCL2L1 protein inhibits the reaction [Sorafenib results in increased cleavage of and results in increased activity of CASP3 protein]	19366808
D000077157	Sorafenib	Boc-D-FMK inhibits the reaction [[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein]	16985072
D000077157	Sorafenib	Boc-D-FMK inhibits the reaction [Sorafenib results in increased cleavage of and results in increased activity of CASP3 protein]	16007148
D000077157	Sorafenib	[Bortezomib co-treated with Sorafenib] results in increased cleavage of CASP3 protein	16985072
D000077157	Sorafenib	Resveratrol promotes the reaction [Sorafenib results in increased cleavage of CASP3 protein]	26911335
D000077157	Sorafenib	Sorafenib affects the cleavage of CASP3 protein	20473320
D000077157	Sorafenib	[Sorafenib co-treated with 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine] results in increased cleavage of CASP3 protein	23036488
D000077157	Sorafenib	[Sorafenib co-treated with 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide] results in increased cleavage of CASP3 protein	20117835
D000077157	Sorafenib	[Sorafenib co-treated with PRKN protein] results in decreased expression of CASP3 protein	28673964
D000077157	Sorafenib	[Sorafenib co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	17909059
D000077157	Sorafenib	[Sorafenib co-treated with TNFSF10 protein] results in increased cleavage of CASP3 protein	20071162
D000077157	Sorafenib	[Sorafenib co-treated with Vitamin K 1] results in increased cleavage of CASP3 protein	20301194
D000077157	Sorafenib	[Sorafenib co-treated with Vorinostat] results in increased cleavage of CASP3 protein	18787411
D000077157	Sorafenib	Sorafenib inhibits the reaction [TGFB1 protein results in increased activity of CASP3 mRNA]	21360571
D000077157	Sorafenib	Sorafenib promotes the reaction [Arsenic Trioxide results in decreased expression of CASP3 protein]	25416439
D000077157	Sorafenib	Sorafenib promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25416439
D000077157	Sorafenib	Sorafenib results in decreased expression of CASP3 protein	25416439
D000077157	Sorafenib	Sorafenib results in increased activity of CASP3 protein	19770576; 21293487; 25416439; 26409325;
D000077157	Sorafenib	Sorafenib results in increased cleavage of and results in increased activity of CASP3 protein	16007148; 16109713; 19366808;
D000077157	Sorafenib	Sorafenib results in increased cleavage of CASP3 protein	18200035; 20071162; 26911335;
D000077157	Sorafenib	Sorafenib results in decreased expression of CASP3 mRNA	21360571
D013012	Sorbitol	Sorbitol results in increased activity of CASP3 protein	20609311
D013012	Sorbitol	Spironolactone inhibits the reaction [Testosterone inhibits the reaction [Sorbitol results in increased activity of CASP3 protein]]	20609311
D013012	Sorbitol	Testosterone inhibits the reaction [Sorbitol results in increased activity of CASP3 protein]	20609311
C000594309	SP2509	SP2509 results in increased activity of CASP3 protein	29581250
C000591235	spautin-1	[spautin-1 results in decreased susceptibility to Tunicamycin] which results in decreased expression of CASP3 protein modified form	29793971
D013095	Spermidine	Acetylcysteine inhibits the reaction [[Naphthalimides co-treated with Spermidine] results in increased activity of CASP3 protein]	21349322
D013095	Spermidine	[Naphthalimides co-treated with Spermidine] results in increased activity of CASP3 protein	21349322
D013096	Spermine	Spermine inhibits the reaction [Dexamethasone results in increased activity of CASP3 protein]	11399061
D013096	Spermine	Spermine results in decreased expression of CASP3 protein	17606387
C091861	spermine nitric oxide complex	spermine nitric oxide complex inhibits the reaction [Cadmium results in increased expression of CASP3 mRNA]	25490952
C091861	spermine nitric oxide complex	spermine nitric oxide complex results in decreased activity of CASP3 protein	12006578
D013141	Spiro Compounds	Spiro Compounds analog results in decreased activity of CASP3 protein	25320076
D013141	Spiro Compounds	Spiro Compounds analog results in increased cleavage of CASP3 protein	25320076
D013148	Spironolactone	Spironolactone results in decreased expression of CASP3 protein	20082611
D013148	Spironolactone	Palmitic Acid promotes the reaction [Spironolactone results in increased activity of CASP3 protein]	22700542
D013148	Spironolactone	Spironolactone results in increased activity of CASP3 protein	22700542
D013148	Spironolactone	Spironolactone inhibits the reaction [Testosterone inhibits the reaction [Sorbitol results in increased activity of CASP3 protein]]	20609311
D013148	Spironolactone	Spironolactone results in decreased activity of CASP3 protein	19114643
C088106	spiroquinazoline	spiroquinazoline analog results in increased expression of and results in increased cleavage of CASP3 protein	25743751
C485419	spiruchostatin A	spiruchostatin A results in increased activity of CASP3 protein	25078973
C529984	spiruchostatin B	spiruchostatin B results in increased activity of CASP3 protein	25078973
C444426	splitomicin	splitomicin promotes the reaction [Antimycin A results in increased cleavage of CASP3 protein]	24040102
C110630	SR 144528	SR 144528 inhibits the reaction [Dronabinol results in increased activity of CASP3 protein]	16818634; 16818650;
C525422	SRT1720	SRT1720 results in increased activity of CASP3 protein	26055805
C525422	SRT1720	SRT1720 inhibits the reaction [Sodium Fluoride results in increased expression of CASP3 protein]	30738887
C525422	SRT1720	SRT1720 results in decreased cleavage of CASP3 protein	20335659
C525423	SRT2183	SRT2183 inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]	20335659
D019311	Staurosporine	Staurosporine results in increased activity of CASP3 protein	29088535
D019311	Staurosporine	Staurosporine results in increased activity of CASP3 protein	20886113
D019311	Staurosporine	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	7-nitroindazole inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	Allopurinol inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	arachidonyltrifluoromethane inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	idebenone inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	[Rotenone co-treated with Oligomycins] inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	S-ethyl glutathione inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	14642398
D019311	Staurosporine	Staurosporine results in increased cleavage of and results in increased activity of CASP3 protein	14642398
D019311	Staurosporine	Acetaminophen promotes the reaction [Staurosporine results in increased activity of CASP3 protein]	17245372
D019311	Staurosporine	DOCK1 protein inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	25586182
D019311	Staurosporine	ELMO1 protein inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	25586182
D019311	Staurosporine	EOMES protein inhibits the reaction [Staurosporine results in increased expression of CASP3 protein modified form]	27539959
D019311	Staurosporine	ginkgolide B inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	26775663
D019311	Staurosporine	Lithium Chloride inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	19101580
D019311	Staurosporine	Memantine inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	17996985
D019311	Staurosporine	pifithrin inhibits the reaction [PSEN2 protein mutant form promotes the reaction [Staurosporine results in increased activity of CASP3 protein]]	12556443
D019311	Staurosporine	PSEN2 protein mutant form promotes the reaction [Staurosporine results in increased activity of CASP3 protein]	12556443
D019311	Staurosporine	quinoline-val-asp(OMe)-CH2-OPH inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	26124276
D019311	Staurosporine	Rifampin inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	26775663
D019311	Staurosporine	Staurosporine results in increased activity of CASP3 protein	10663630; 12871656; 16225760; 16402917; 17051331; 17245372; 17996985; 18218830; 18832097; 19101580; 19352495; 21864672; 24912781; 25586182; 27392949; 29410032; 29458164;
D019311	Staurosporine	Staurosporine results in increased cleavage of and results in increased activity of CASP3 protein	16007152
D019311	Staurosporine	Staurosporine results in increased cleavage of CASP3 protein	18178165; 26124276; 26775663; 28450277; 28975372; 29140133;
D019311	Staurosporine	Staurosporine results in increased expression of CASP3 protein modified form	27539959
D019311	Staurosporine	Staurosporine results in increased secretion of CASP3 protein	26963176
D019311	Staurosporine	Thiopental inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	18218830
D019311	Staurosporine	Valproic Acid inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	19101580
D019311	Staurosporine	HR protein affects the reaction [Staurosporine results in increased activity of CASP3 protein]	20886113
D019311	Staurosporine	Staurosporine promotes the reaction [CASP3 protein results in increased cleavage of SPTAN1 protein]	18182247
D019311	Staurosporine	Staurosporine results in increased activity of CASP3 protein	20886113; 21534955; 24260418;
D019311	Staurosporine	Staurosporine results in increased cleavage of CASP3 protein	18178165; 28975372;
D019311	Staurosporine	TRP53 protein affects the reaction [HR protein affects the reaction [Staurosporine results in increased activity of CASP3 protein]]	20886113
D019311	Staurosporine	VASP mutant form promotes the reaction [Staurosporine promotes the reaction [CASP3 protein results in increased cleavage of SPTAN1 protein]]	18182247
D019311	Staurosporine	3-methyladenine promotes the reaction [Staurosporine results in increased cleavage of CASP3 protein]	16497721
D019311	Staurosporine	EGF protein inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	19406941
D019311	Staurosporine	HR protein inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	20886113
D019311	Staurosporine	Ibuprofen inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	11296547
D019311	Staurosporine	IGF1 protein inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	19406941
D019311	Staurosporine	nimesulide inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	11296547
D019311	Staurosporine	Sirolimus inhibits the reaction [Staurosporine results in increased cleavage of CASP3 protein]	16497721
D019311	Staurosporine	Staurosporine results in increased activity of CASP3 protein	11296547; 15909127; 17045724; 19406941; 20302886;
D019311	Staurosporine	Staurosporine results in increased cleavage of CASP3 protein	28747609
C049985	staurosporine aglycone	staurosporine aglycone inhibits the reaction [alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid inhibits the reaction [Phencyclidine results in increased activity of CASP3 protein]]	24995437
C049985	staurosporine aglycone	staurosporine aglycone inhibits the reaction [NOG protein inhibits the reaction [Arsenic results in increased cleavage of CASP3 protein]]	28903487
C049985	staurosporine aglycone	staurosporine aglycone results in increased activity of CASP3 protein	25545984
C049985	staurosporine aglycone	staurosporine aglycone inhibits the reaction [echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	23189969
C031183	stearic acid	SCD1 protein inhibits the reaction [stearic acid results in increased activity of CASP3 protein]	22413010
C031183	stearic acid	stearic acid results in increased cleavage of and results in increased activity of CASP3 protein	22413010
D013267	Stilbenes	Stilbenes inhibits the reaction [Hydrogen Peroxide results in increased expression of and results in increased activity of CASP3 protein]	22358095
D013267	Stilbenes	Stilbenes results in increased activity of CASP3 protein	23059970
D013267	Stilbenes	[Stilbenes results in increased activity of CASP9 protein] which results in increased cleavage of CASP3 protein	22293408
D013311	Streptozocin	fatostatin promotes the reaction [Streptozocin results in increased cleavage of CASP3 protein]	29420703
D013311	Streptozocin	montelukast inhibits the reaction [Streptozocin results in increased expression of CASP3 protein modified form]	27702591
D013311	Streptozocin	NTN1 protein inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	29059224
D013311	Streptozocin	Quercetin inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	26887929
D013311	Streptozocin	Resveratrol inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	20424226
D013311	Streptozocin	Streptozocin analog results in increased activity of CASP3 protein	18721751
D013311	Streptozocin	[Streptozocin co-treated with bisphenol A] results in increased expression of CASP3 mRNA	29935216
D013311	Streptozocin	[Streptozocin co-treated with NQO1 protein mutant form] results in increased expression of CASP3 protein modified form	23458895
D013311	Streptozocin	[Streptozocin co-treated with octylphenol] results in increased expression of CASP3 mRNA	29935216
D013311	Streptozocin	Streptozocin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	25665769
D013311	Streptozocin	Streptozocin inhibits the reaction [Ethinyl Estradiol results in decreased expression of CASP3 mRNA]	29935216
D013311	Streptozocin	Streptozocin results in increased activity of CASP3 protein	18721751; 20424226;
D013311	Streptozocin	Streptozocin results in increased cleavage of CASP3 protein	24967692; 26887929; 29059224; 29420703;
D013311	Streptozocin	Streptozocin results in increased expression of CASP3 mRNA	29935216
D013311	Streptozocin	Streptozocin results in increased expression of CASP3 protein modified form	27702591
D013311	Streptozocin	sulforafan inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	24967692
D013311	Streptozocin	3,3',4,5'-tetrahydroxystilbene inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	31323227
D013311	Streptozocin	4-phenylbutyric acid inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	30980806
D013311	Streptozocin	Acetylcysteine inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	19840221
D013311	Streptozocin	Anthocyanins inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	28856781
D013311	Streptozocin	arjunolic acid inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	19133311; 19682444; 20053369;
D013311	Streptozocin	Ascorbic Acid inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	18758938
D013311	Streptozocin	Curcumin inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	25541178
D013311	Streptozocin	Curcumin inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	23267840
D013311	Streptozocin	diallyl trisulfide inhibits the reaction [Streptozocin results in decreased cleavage of CASP3 protein]	23453443
D013311	Streptozocin	ferulic acid analog inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	31029786
D013311	Streptozocin	Ibuprofen inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	24333387
D013311	Streptozocin	Ibuprofen inhibits the reaction [Streptozocin results in increased expression of CASP3 mRNA]	24333387
D013311	Streptozocin	INS1 protein inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	23267840
D013311	Streptozocin	Memantine inhibits the reaction [Streptozocin results in increased activity of CASP3 protein]	24333387
D013311	Streptozocin	Memantine inhibits the reaction [Streptozocin results in increased expression of CASP3 mRNA]	24333387
D013311	Streptozocin	Propofol inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	24810525
D013311	Streptozocin	Resveratrol inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	26499206
D013311	Streptozocin	Rosiglitazone inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	21599458
D013311	Streptozocin	Streptozocin results in decreased cleavage of CASP3 protein	23453443
D013311	Streptozocin	Streptozocin results in increased activity of CASP3 protein	18758938; 19133311; 19682444; 19840221; 20053369; 20224876; 24333387; 31029786;
D013311	Streptozocin	Streptozocin results in increased cleavage of CASP3 protein	19931367; 21599458; 24810525; 25541178; 28856781; 30980806;
D013311	Streptozocin	Streptozocin results in increased expression of and results in increased cleavage of CASP3 protein	26499206
D013311	Streptozocin	Streptozocin results in increased expression of CASP3 mRNA	20654064; 24333387;
D013311	Streptozocin	Streptozocin results in increased expression of CASP3 protein	12502508; 15976052; 19951573; 20654064; 23267840; 31323227;
D013311	Streptozocin	Thioctic Acid inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	19951573
D013331	Strychnine	Strychnine results in increased expression of CASP3 mRNA	19815060
C013690	styrene oxide	styrene oxide results in increased activity of CASP3 protein	11929631
C013690	styrene oxide	styrene oxide results in increased activity of CASP3 protein	17662326; 19666080;
C013690	styrene oxide	styrene oxide results in increased activity of CASP3 protein	11929631; 12663515;
D004113	Succimer	[Succimer co-treated with Succimer analog] inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]	18163546
D004113	Succimer	Succimer promotes the reaction [2,3-dimercaptosuccinic acid monocyclohexyl ester inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	18163546; 23376091;
D004113	Succimer	Succimer promotes the reaction [monoisoamyl-2,3-dimercaptosuccinate inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	18163546; 23376091;
D004113	Succimer	Succimer inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	31163222
D013395	Sucrose	EIF2AK2 protein affects the reaction [Sucrose results in increased activity of and results in increased cleavage of CASP3 protein]	27920257
D013395	Sucrose	EIF2AK2 protein affects the reaction [Sucrose results in increased cleavage of CASP3 protein]	27920257
D013395	Sucrose	GW 506033X inhibits the reaction [Sucrose results in increased activity of CASP3 protein]	27920257
D013395	Sucrose	Sucrose results in increased activity of and results in increased cleavage of CASP3 protein	27920257
D013395	Sucrose	Sucrose results in increased activity of CASP3 protein	15975986
C061636	suillin	suillin results in increased cleavage of and results in increased activity of CASP3 protein	19616521
D012460	Sulfasalazine	Sulfasalazine inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]	16322111
D012460	Sulfasalazine	Sulfasalazine results in increased activity of CASP3 protein	12381674; 17051331; 19473188;
D012460	Sulfasalazine	Sulfasalazine results in increased cleavage of and results in increased activity of CASP3 protein	19859796
D012460	Sulfasalazine	Sulfasalazine inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein]	26165751
D013449	Sulfonamides	Sulfonamides analog results in increased activity of CASP3 protein	15826604
C016766	sulforafan	Acetylcysteine inhibits the reaction [[sulforafan co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein]	22922937
C016766	sulforafan	Acetylcysteine inhibits the reaction [sulforafan promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]]	22922937
C016766	sulforafan	NGF protein inhibits the reaction [sulforafan results in increased activity of CASP3 protein]	29407470
C016766	sulforafan	[sulforafan co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	22922937
C016766	sulforafan	[sulforafan co-treated with TNFSF10 protein] results in decreased expression of CASP3 protein	29792947
C016766	sulforafan	sulforafan inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	19780897
C016766	sulforafan	sulforafan inhibits the reaction [Pyruvaldehyde results in increased activity of CASP3 protein]	25933243
C016766	sulforafan	sulforafan promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	22922937
C016766	sulforafan	sulforafan results in increased activity of CASP3 protein	26833863; 29407470;
C016766	sulforafan	sulforafan inhibits the reaction [cyanoginosin LR results in increased activity of CASP3 protein]	21684301
C016766	sulforafan	sulforafan inhibits the reaction [Ethanol results in increased expression of CASP3 protein modified form]	29069573
C016766	sulforafan	sulforafan inhibits the reaction [Oxidopamine results in increased activity of CASP3 protein]	23518299
C016766	sulforafan	sulforafan inhibits the reaction [Streptozocin results in increased cleavage of CASP3 protein]	24967692
C016766	sulforafan	NFE2L2 protein affects the reaction [[sulforafan co-treated with Diatrizoate Meglumine] results in increased activity of CASP3 protein]	31173751
C016766	sulforafan	[sulforafan co-treated with Diatrizoate Meglumine] results in increased activity of CASP3 protein	31173751
D013458	Sulfur Dioxide	CNR1 protein affects the reaction [JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]]	26209559
D013458	Sulfur Dioxide	JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]	26209559
D013458	Sulfur Dioxide	Rimonabant inhibits the reaction [JZL 184 inhibits the reaction [Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein]]	26209559
D013458	Sulfur Dioxide	[Sulfur Dioxide co-treated with sodium arsenite] results in increased activity of CASP3 protein	30195209
D013458	Sulfur Dioxide	Sulfur Dioxide results in decreased activity of CASP3 protein	30195209
D013458	Sulfur Dioxide	Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein	26209559
D013458	Sulfur Dioxide	Sulfur Dioxide inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein modified form]	30503585
D013458	Sulfur Dioxide	Sulfur Dioxide results in increased cleavage of and results in increased activity of CASP3 protein	21873648
D013458	Sulfur Dioxide	Sulfur Dioxide results in increased expression of and results in increased activity of CASP3 protein	19621461
D013458	Sulfur Dioxide	Sulfur Dioxide results in increased expression of CASP3 mRNA	19621461
C009354	sulglicotide	sulglicotide inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17657623
D013467	Sulindac	Acetylcysteine inhibits the reaction [[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	18281123
D013467	Sulindac	pyrazolanthrone inhibits the reaction [[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein]	18281123
D013467	Sulindac	[Sulindac co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	18281123
D013467	Sulindac	Sulindac results in increased activity of CASP3 protein	12017300; 15713900; 15946692;
D013467	Sulindac	[Sulindac results in increased expression of IL24 protein] which results in increased expression of CASP3 protein	15713900
D013467	Sulindac	epigallocatechin gallate promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]]	29999212
D013467	Sulindac	kaempferol promotes the reaction [Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]]	29999212
D013467	Sulindac	Sulindac inhibits the reaction [1,2-Dimethylhydrazine results in decreased expression of CASP3 protein]	29999212
C025462	sulindac sulfide	BAX protein affects the reaction [TNFSF10 protein promotes the reaction [sulindac sulfide results in increased cleavage of and results in increased activity of CASP3 protein]]	12203115
C025462	sulindac sulfide	MAP2K1 protein inhibits the reaction [sulindac sulfide results in increased cleavage of and results in increased activity of CASP3 protein]	15548677
C025462	sulindac sulfide	PTGS2 protein inhibits the reaction [sulindac sulfide results in increased activity of CASP3 protein]	12414664
C025462	sulindac sulfide	[sulindac sulfide co-treated with TNF protein] results in increased activity of CASP3 protein	20371263
C025462	sulindac sulfide	sulindac sulfide results in increased activity of CASP3 protein	11051267; 12414664;
C025462	sulindac sulfide	sulindac sulfide results in increased cleavage of and results in increased activity of CASP3 protein	12203115; 14555707; 15548677;
C025462	sulindac sulfide	tempol inhibits the reaction [[sulindac sulfide co-treated with TNF protein] results in increased activity of CASP3 protein]	20371263
C025462	sulindac sulfide	TNFSF10 protein promotes the reaction [sulindac sulfide results in increased cleavage of and results in increased activity of CASP3 protein]	12203115
C025462	sulindac sulfide	sulindac sulfide results in increased activity of CASP3 protein	16886631
C025462	sulindac sulfide	sulindac sulfide results in increased expression of CASP3 mRNA	16886631
C025463	sulindac sulfone	MAP2K1 protein inhibits the reaction [sulindac sulfone results in increased cleavage of and results in increased activity of CASP3 protein]	15548677
C025463	sulindac sulfone	sulindac sulfone results in increased activity of CASP3 protein	11051267
C025463	sulindac sulfone	sulindac sulfone results in increased cleavage of and results in increased activity of CASP3 protein	14555707; 15548677;
C473643	sulphoraphene	sulphoraphene results in increased cleavage of CASP3 protein	29247643
D013469	Sulpiride	Sulpiride inhibits the reaction [1-(2-thienyl)-2-(methylamino)propane results in increased cleavage of CASP3 protein]	30922767
D018170	Sumatriptan	Sumatriptan inhibits the reaction [Vincristine results in increased expression of CASP3 mRNA]	29958920
D018170	Sumatriptan	Sumatriptan inhibits the reaction [Vincristine results in increased expression of CASP3 protein]	29958920
D000077210	Sunitinib	AICA ribonucleotide inhibits the reaction [Sunitinib results in increased cleavage of CASP3 protein]	21906609
D000077210	Sunitinib	Metformin inhibits the reaction [Sunitinib results in increased cleavage of CASP3 protein]	21906609
D000077210	Sunitinib	Sunitinib results in increased cleavage of CASP3 protein	21906609
D000077210	Sunitinib	Chloroquine promotes the reaction [Sunitinib results in increased activity of CASP3 protein]	24751611
D000077210	Sunitinib	Sunitinib results in increased activity of CASP3 protein	24751611
D000077210	Sunitinib	Sunitinib results in increased cleavage of CASP3 protein	30031043; 31445075;
D000077210	Sunitinib	Sunitinib results in increased cleavage of CASP3 protein	31445075
D013498	Suramin	Suramin inhibits the reaction [Adenosine Triphosphate results in increased expression of CASP3]	19448140
D013498	Suramin	Suramin inhibits the reaction [Clodronic Acid results in increased expression of CASP3]	19448140
D013501	Surface-Active Agents	[Surface-Active Agents co-treated with glyphosate] results in increased activity of CASP3 protein	23099315
C009365	surfactin peptide	surfactin peptide results in increased cleavage of and results in increased activity of CASP3 protein	19954742
D013605	T-2 Toxin	Bentonite inhibits the reaction [[HT-2 toxin co-treated with T-2 Toxin] results in increased expression of CASP3 mRNA]	25296281
D013605	T-2 Toxin	[HT-2 toxin co-treated with T-2 Toxin] results in increased expression of CASP3 mRNA	25296281
D013605	T-2 Toxin	T-2 Toxin results in increased activity of CASP3 protein	19428930; 19524637; 19541794; 21295106;
D013605	T-2 Toxin	Acetylcysteine inhibits the reaction [T-2 Toxin results in increased activity of CASP3 protein]	29432840
D013605	T-2 Toxin	brusatol promotes the reaction [T-2 Toxin results in increased activity of CASP3 protein]	29432840
D013605	T-2 Toxin	T-2 Toxin results in increased activity of CASP3 protein	29432840
D013605	T-2 Toxin	T-2 Toxin results in increased expression of CASP3 mRNA	26138683
D013605	T-2 Toxin	zinc protoporphyrin promotes the reaction [T-2 Toxin results in increased activity of CASP3 protein]	29432840
D013605	T-2 Toxin	3-methyladenine promotes the reaction [T-2 Toxin results in increased expression of CASP3 protein modified form]	30629952
D013605	T-2 Toxin	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [T-2 Toxin results in increased activity of CASP3 protein]	21296132
D013605	T-2 Toxin	Selenium deficiency promotes the reaction [T-2 Toxin results in increased expression of CASP3 protein modified form]	30629952
D013605	T-2 Toxin	Sirolimus inhibits the reaction [T-2 Toxin results in increased expression of CASP3 protein modified form]	30629952
D013605	T-2 Toxin	T-2 Toxin affects the expression of CASP3 protein	29413859
D013605	T-2 Toxin	T-2 Toxin results in increased cleavage of and results in increased activity of CASP3 protein	21296132
D013605	T-2 Toxin	T-2 Toxin results in increased expression of CASP3 mRNA	29567467; 29870751;
D013605	T-2 Toxin	T-2 Toxin results in increased expression of CASP3 protein	29567467
D013605	T-2 Toxin	T-2 Toxin results in increased expression of CASP3 protein modified form	30629952
C112689	TAC 101	TAC 101 results in increased activity of CASP3 protein	17436592
D016559	Tacrolimus	Tacrolimus inhibits the reaction [FAS protein results in increased activity of CASP3 protein]	15548389
D016559	Tacrolimus	Tacrolimus inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	12871656
D016559	Tacrolimus	Tacrolimus inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased activity of CASP3 protein]	10205001
D016559	Tacrolimus	Tacrolimus inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	10205001
D016559	Tacrolimus	Tacrolimus results in increased activity of CASP3 protein	15207740
D016559	Tacrolimus	MK0626 inhibits the reaction [Tacrolimus results in increased activity of CASP3 protein]	24959755
D016559	Tacrolimus	NGF protein inhibits the reaction [Tacrolimus results in increased activity of CASP3 protein]	17385075
D016559	Tacrolimus	Tacrolimus inhibits the reaction [3-nitropropionic acid results in increased activity of CASP3 protein]	15571979
D016559	Tacrolimus	Tacrolimus inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	12642403
D016559	Tacrolimus	Tacrolimus inhibits the reaction [[Lithium co-treated with Pilocarpine] results in increased activity of CASP3 protein]	20149694
D016559	Tacrolimus	Tacrolimus inhibits the reaction [Oxygen deficiency results in increased activity of CASP3 protein]	12892836
D016559	Tacrolimus	Tacrolimus results in increased activity of CASP3 protein	17166486; 17385075; 24959755;
D016559	Tacrolimus	Tacrolimus results in increased activity of CASP3 protein	14675044
C467766	taiwanin C	taiwanin C results in increased cleavage of CASP3 protein	30884126
D013627	Talc	Talc results in increased activity of CASP3 protein	22331707
C508967	tamarixetin	tamarixetin results in increased activity of CASP3 protein	12826665
D013629	Tamoxifen	AKT1 protein inhibits the reaction [Tamoxifen analog results in increased activity of CASP3 protein]	14990993
D013629	Tamoxifen	AKT1 protein inhibits the reaction [Tamoxifen results in increased activity of CASP3 protein]	14990993
D013629	Tamoxifen	Tamoxifen analog results in increased activity of CASP3 protein	14990993
D013629	Tamoxifen	Tamoxifen results in increased activity of CASP3 protein	12810152; 14990993; 16924424;
D013629	Tamoxifen	Tamoxifen results in increased expression of CASP3 protein	19812351
D013629	Tamoxifen	Tamoxifen affects the expression of CASP3 mRNA	20937368
D013629	Tamoxifen	Tamoxifen inhibits the reaction [Estradiol results in increased activity of CASP3 protein]	15545282
D013629	Tamoxifen	Tamoxifen results in decreased activity of CASP3 protein	17901229
C112765	tanespimycin	Scorpion Venoms results in increased susceptibility to [tanespimycin results in increased activity of CASP3 protein]	19913524
C112765	tanespimycin	[tanespimycin co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	15993848
C112765	tanespimycin	tanespimycin results in increased activity of CASP3 protein	19913524; 24189122;
C112765	tanespimycin	tanespimycin results in increased cleavage of and results in increased activity of CASP3 protein	17157164
C112765	tanespimycin	SH-6 compound promotes the reaction [tanespimycin promotes the reaction [Dopamine results in increased activity of CASP3 protein]]	18194434
C112765	tanespimycin	tanespimycin promotes the reaction [Dopamine results in increased activity of CASP3 protein]	18194434
C112765	tanespimycin	tanespimycin results in increased activity of CASP3 protein	18194434
C059006	tangeretin	tangeretin inhibits the reaction [Cisplatin results in increased expression of CASP3 protein]	27616468
C021751	tanshinone	tanshinone results in increased activity of CASP3 protein	21699893
C021751	tanshinone	tanshinone results in increased expression of CASP3 protein	15849732
D000077432	Tapentadol	Tapentadol results in increased activity of CASP3 protein	27317026
D013654	Taurine	[Taurine binds to Zinc] inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D013654	Taurine	[Taurine co-treated with Zinc Acetate] inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D013654	Taurine	Taurine inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 mRNA]	30101532
D013654	Taurine	Taurine inhibits the reaction [9,10-Dimethyl-1,2-benzanthracene results in decreased expression of CASP3 protein]	30101532
D013654	Taurine	Taurine inhibits the reaction [Alloxan results in increased expression of CASP3 protein modified form]	22138235; 23092809;
D013654	Taurine	Taurine inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D013654	Taurine	Taurine inhibits the reaction [Nandrolone Decanoate results in increased expression of CASP3 protein]	25542992
D013654	Taurine	Taurine inhibits the reaction [sodium arsenite results in increased activity of and results in increased expression of CASP3 protein]	20830294
D013654	Taurine	Taurine inhibits the reaction [sodium arsenite results in increased cleavage of and results in increased activity of CASP3 protein]	19616567
D013654	Taurine	Taurine inhibits the reaction [sodium arsenite results in increased cleavage of CASP3 protein]	19429265
D013654	Taurine	Taurine inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	19429265
D013654	Taurine	Taurine promotes the reaction [pyrazolanthrone inhibits the reaction [sodium arsenite results in increased activity of CASP3 protein]]	20830294
C030141	taurine-ursodeoxycholate conjugate	taurine-ursodeoxycholate conjugate inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	14514686
D013656	Taurocholic Acid	Taurocholic Acid inhibits the reaction [Carbon Tetrachloride results in increased activity of CASP3 protein]	12388182
D013657	Taurodeoxycholic Acid	Taurodeoxycholic Acid results in increased activity of CASP3 protein	12773247
D013657	Taurodeoxycholic Acid	tauroursodeoxycholic acid inhibits the reaction [Taurodeoxycholic Acid results in increased activity of CASP3 protein]	12773247
C066776	taurolithocholic acid 3-sulfate	AGT protein inhibits the reaction [taurolithocholic acid 3-sulfate results in increased activity of CASP3 protein]	23300732
C066776	taurolithocholic acid 3-sulfate	taurolithocholic acid 3-sulfate results in increased activity of CASP3 protein	23300732
C518135	tauropyrone	tauropyrone inhibits the reaction [Zidovudine results in increased expression of CASP3 protein]	18801031
C518135	tauropyrone	tauropyrone results in increased expression of CASP3 protein	18801031
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [Quercetin promotes the reaction [Cisplatin results in increased cleavage of CASP3 protein]]	25611565
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [SERPINA1 protein mutant form results in increased cleavage of and results in increased activity of CASP3 protein]	17559149
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [Taurodeoxycholic Acid results in increased activity of CASP3 protein]	12773247
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	12198651
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [Gentamicins results in increased expression of CASP3 mRNA]	29751043
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [Gentamicins results in increased expression of CASP3 protein]	29751043
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]	18368144
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [[APP protein modified form results in increased activity of CASP3 protein] which results in increased cleavage of MAPT protein]	18368144
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [Neurotoxins results in increased activity of CASP3 protein]	15190125
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	15222754
C031655	tauroursodeoxycholic acid	tauroursodeoxycholic acid results in decreased activity of CASP3 protein	17436368
C053079	tautomycin	tautomycin inhibits the reaction [Docosahexaenoic Acids results in increased cleavage of and results in increased activity of CASP3 protein]	11341974
C003377	taxifolin	taxifolin results in decreased activity of CASP3 protein	24269735
C086827	tazarotene	tazarotene results in increased activity of CASP3 protein	16196285
C041348	tcdA protein, Clostridium difficile	tcdA protein, Clostridium difficile results in increased activity of CASP3 protein	16368960
C508490	TDP 521252	TDP 521252 results in increased activity of CASP3 protein	16432175
D013662	Tea	[Tea co-treated with Bleomycin] results in increased expression of CASP3 mRNA	26800624
D013662	Tea	Tea inhibits the reaction [Oxygen deficiency results in increased expression of and results in increased cleavage of CASP3 protein]	29139225
D013662	Tea	Tea results in decreased cleavage of CASP3 protein	29708300
D013691	Tellurium	Tellurium results in decreased activity of CASP3 protein	18571097
D000077333	Telmisartan	Telmisartan inhibits the reaction [Pyruvaldehyde results in increased cleavage of CASP3 protein]	18565324
D000077333	Telmisartan	Telmisartan inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	21620867
D000077333	Telmisartan	Telmisartan inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	22750630
D000077333	Telmisartan	Telmisartan inhibits the reaction [Cadmium Chloride results in increased expression of CASP3 protein]	21819444
D000077333	Telmisartan	Telmisartan inhibits the reaction [Diatrizoate results in increased activity of CASP3 protein]	19452295
D000077333	Telmisartan	Telmisartan inhibits the reaction [Iohexol results in increased activity of CASP3 protein]	19452295
D000077333	Telmisartan	Telmisartan inhibits the reaction [sodium arsenite results in increased expression of CASP3]	26439596
D000077333	Telmisartan	Telmisartan inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of and results in increased activity of CASP3 protein]	24831514
D000077333	Telmisartan	Telmisartan inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 mRNA]	24831514
D000077204	Temozolomide	[Pyrimethamine co-treated with Temozolomide] results in increased cleavage of CASP3 protein	19435820
D000077204	Temozolomide	[Quercetin co-treated with Temozolomide] results in increased activity of CASP3 protein	20654599
D000077204	Temozolomide	Temozolomide analog results in increased activity of CASP3 protein	19363609
D000077204	Temozolomide	[Temozolomide co-treated with Quercetin] results in increased activity of CASP3 protein	24126416
D000077204	Temozolomide	Temozolomide results in increased activity of CASP3 protein	26911376
D000077204	Temozolomide	Temozolomide results in increased cleavage of CASP3 protein	26418950
D000077204	Temozolomide	Temozolomide results in increased expression of CASP3	22231932
C003959	TEMPO	pyrazolanthrone inhibits the reaction [TEMPO results in increased activity of CASP3 protein]	25882087
C003959	TEMPO	TEMPO results in increased activity of CASP3 protein	25882087
C003959	TEMPO	TEMPO inhibits the reaction [Hexachlorocyclohexane results in increased activity of CASP3 protein]	22001173
C003959	TEMPO	TEMPO inhibits the reaction [nickel sulfate results in increased expression of CASP3 protein]	28296042
C001803	tempol	[tempol co-treated with UCF 101 co-treated with acetovanillone] inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	20153346
C001803	tempol	tempol inhibits the reaction [[sulindac sulfide co-treated with TNF protein] results in increased activity of CASP3 protein]	20371263
C001803	tempol	tempol results in decreased expression of CASP3 protein	18714161
C505333	TEMPOL-H	TEMPOL-H inhibits the reaction [Dichlorvos results in increased cleavage of CASP3 protein]	24369695
C401859	temsirolimus	Fluorouracil promotes the reaction [temsirolimus results in increased expression of CASP3 mRNA]	19764996
C401859	temsirolimus	[S 1 (combination) co-treated with temsirolimus] results in increased expression of CASP3 protein	19764996
C401859	temsirolimus	temsirolimus promotes the reaction [Fluorouracil results in increased expression of CASP3 mRNA]	19764996
C401859	temsirolimus	temsirolimus results in increased expression of CASP3 mRNA	19764996
C401859	temsirolimus	temsirolimus results in increased activity of CASP3 protein	15861431
D013726	Terbutaline	Terbutaline inhibits the reaction [Shiga Toxin 2 results in increased activity of CASP3 protein]	12826277
D013726	Terbutaline	[Terbutaline results in increased activity of ADRB2 protein] inhibits the reaction [Shiga Toxin 2 results in increased activity of CASP3 protein]	12826277
D016593	Terfenadine	Terfenadine results in increased activity of CASP3 protein	20570632
D016593	Terfenadine	Dasatinib promotes the reaction [Terfenadine results in increased activity of CASP3 protein]	20570632
D016593	Terfenadine	midostaurin promotes the reaction [Terfenadine results in increased activity of CASP3 protein]	20570632
D016593	Terfenadine	Terfenadine analog results in increased activity of CASP3 protein	19289568
D016593	Terfenadine	Terfenadine results in increased activity of CASP3 protein	16569656; 20570632;
D016593	Terfenadine	Terfenadine results in increased cleavage of CASP3 protein	20570632
D016593	Terfenadine	Terfenadine results in increased activity of CASP3 protein	15288570
C028786	teroxirone	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [teroxirone results in increased cleavage of CASP3 protein]	23954467
C028786	teroxirone	teroxirone results in increased cleavage of CASP3 protein	23954467; 29908167;
C028786	teroxirone	[TP53 protein results in increased susceptibility to teroxirone] which results in increased cleavage of CASP3 protein	23954467
D020122	tert-Butylhydroperoxide	1-(3,4-dihydroxyphenyl)-3-(2-methoxyphenyl)prop-2-en-1-one inhibits the reaction [tert-Butylhydroperoxide results in increased expression of CASP3 protein modified form]	28063877
D020122	tert-Butylhydroperoxide	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
D020122	tert-Butylhydroperoxide	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	17419000
D020122	tert-Butylhydroperoxide	Drugs, Chinese Herbal inhibits the reaction [tert-Butylhydroperoxide results in decreased expression of CASP3 protein]	28733231
D020122	tert-Butylhydroperoxide	GPX4 protein inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	15496407
D020122	tert-Butylhydroperoxide	KN 93 inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
D020122	tert-Butylhydroperoxide	LY96 protein promotes the reaction [tert-Butylhydroperoxide results in increased expression of CASP3 protein modified form]	28063877
D020122	tert-Butylhydroperoxide	MCL1 protein inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	15611089
D020122	tert-Butylhydroperoxide	N-(3-methoxyphenyl)-4-chlorocinnamanilide inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
D020122	tert-Butylhydroperoxide	nectandrin-B inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	27511913
D020122	tert-Butylhydroperoxide	PAFAH2 protein inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	12406338
D020122	tert-Butylhydroperoxide	puag-haad inhibits the reaction [tert-Butylhydroperoxide results in decreased expression of CASP3 protein]	26102008
D020122	tert-Butylhydroperoxide	rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	28025122
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in decreased expression of CASP3 protein	26102008; 28733231;
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased activity of CASP3 protein	12406338; 15611089; 17419000; 28025122;
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased cleavage of CASP3 protein	27511913
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased expression of CASP3 protein	20847119
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased expression of CASP3 protein modified form	28063877
D020122	tert-Butylhydroperoxide	zinc protoporphyrin inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
D020122	tert-Butylhydroperoxide	caffeoylquinic acid analog inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19647727
D020122	tert-Butylhydroperoxide	Catechin inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	16753784
D020122	tert-Butylhydroperoxide	Drugs, Chinese Herbal inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19647727
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased activity of CASP3 protein	15496407; 19647727;
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased cleavage of CASP3 protein	16753784
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased expression of and results in increased cleavage of CASP3 protein	20510348
D020122	tert-Butylhydroperoxide	AICA ribonucleotide inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	26989860
D020122	tert-Butylhydroperoxide	Curcumin inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	15569404
D020122	tert-Butylhydroperoxide	Fenofibrate inhibits the reaction [tert-Butylhydroperoxide results in increased cleavage of CASP3 protein]	26989860
D020122	tert-Butylhydroperoxide	Plant Extracts inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19772912
D020122	tert-Butylhydroperoxide	Silymarin inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]	19772912
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased cleavage of CASP3 protein	15569404; 15877105; 26989860;
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased expression of CASP3 protein	15877105
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in increased cleavage of CASP3 protein	16005169
D013739	Testosterone	gingerol inhibits the reaction [Testosterone results in decreased expression of CASP3 protein]	18030663
D013739	Testosterone	Testosterone results in decreased expression of CASP3 protein	18030663
D013739	Testosterone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
D013739	Testosterone	Carbonyl Cyanide m-Chlorophenyl Hydrazone inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
D013739	Testosterone	chrysin inhibits the reaction [Testosterone results in decreased cleavage of CASP3 protein]	29247772
D013739	Testosterone	dapoxetine inhibits the reaction [Testosterone results in decreased expression of CASP3 protein modified form]	27687055
D013739	Testosterone	Estradiol promotes the reaction [Testosterone inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]]	29625166
D013739	Testosterone	Finasteride inhibits the reaction [Testosterone results in decreased expression of CASP3 protein modified form]	27687055
D013739	Testosterone	Finasteride inhibits the reaction [Testosterone results in increased expression of CASP3 protein]	25714330
D013739	Testosterone	Flutamide inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
D013739	Testosterone	Resveratrol inhibits the reaction [Testosterone results in increased expression of CASP3 protein]	25714330
D013739	Testosterone	Silymarin inhibits the reaction [Testosterone results in decreased activity of CASP3 protein]	23500659
D013739	Testosterone	Spironolactone inhibits the reaction [Testosterone inhibits the reaction [Sorbitol results in increased activity of CASP3 protein]]	20609311
D013739	Testosterone	Testosterone affects the expression of CASP3 protein	17237611
D013739	Testosterone	Testosterone inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]	29625166
D013739	Testosterone	Testosterone inhibits the reaction [Sorbitol results in increased activity of CASP3 protein]	20609311
D013739	Testosterone	Testosterone promotes the reaction [Estradiol inhibits the reaction [Corticosterone results in increased cleavage of CASP3 protein]]	29625166
D013739	Testosterone	Testosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D013739	Testosterone	Testosterone results in decreased activity of CASP3 protein	23500659
D013739	Testosterone	Testosterone results in decreased cleavage of and results in decreased activity of CASP3 protein	12724284
D013739	Testosterone	Testosterone results in decreased cleavage of CASP3 protein	29247772
D013739	Testosterone	Testosterone results in decreased expression of CASP3 mRNA	12724284
D013739	Testosterone	Testosterone results in decreased expression of CASP3 protein	12724284
D013739	Testosterone	Testosterone results in decreased expression of CASP3 protein modified form	27687055
D013739	Testosterone	Testosterone results in increased cleavage of CASP3 protein	24658017
D013739	Testosterone	Testosterone results in increased expression of CASP3 protein	25714330
D013739	Testosterone	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
D013739	Testosterone	Testosterone results in increased expression of CASP3 mRNA	16845445
D013739	Testosterone	Testosterone results in increased expression of CASP3 protein	16845445
C045037	testosterone-3-carboxymethyloxime-bovine serum albumin conjugate	EPO inhibits the reaction [testosterone-3-carboxymethyloxime-bovine serum albumin conjugate results in increased activity of CASP3]	20189893
C045037	testosterone-3-carboxymethyloxime-bovine serum albumin conjugate	testosterone-3-carboxymethyloxime-bovine serum albumin conjugate results in increased activity of CASP3	20189893
C534735	tetraarsenic tetrasulfide	Arsenic Trioxide promotes the reaction [tetraarsenic tetrasulfide results in decreased expression of CASP3 mRNA]	26110921
C534735	tetraarsenic tetrasulfide	Arsenic Trioxide promotes the reaction [tetraarsenic tetrasulfide results in increased cleavage of CASP3 protein]	26110921
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide promotes the reaction [Arsenic Trioxide results in decreased expression of CASP3 mRNA]	26110921
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide promotes the reaction [Arsenic Trioxide results in increased cleavage of CASP3 protein]	26110921
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide results in decreased expression of CASP3 mRNA	26110921
C534735	tetraarsenic tetrasulfide	tetraarsenic tetrasulfide results in increased cleavage of CASP3 protein	26110921
C020806	tetrabromobisphenol A	tetrabromobisphenol A results in increased activity of CASP3 protein	22485137; 22547355;
C020806	tetrabromobisphenol A	tetrabromobisphenol A results in increased activity of CASP3 protein	27592553
D013748	Tetracaine	Tetracaine results in increased activity of CASP3 protein	11981161
C000591600	tetrachlorobenzoquinone	RAD51 protein inhibits the reaction [tetrachlorobenzoquinone results in increased expression of CASP3 protein modified form]	27989139
C000591600	tetrachlorobenzoquinone	tetrachlorobenzoquinone results in increased expression of CASP3 protein modified form	27989139
C000591600	tetrachlorobenzoquinone	TP53 protein promotes the reaction [tetrachlorobenzoquinone results in increased expression of CASP3 protein modified form]	27989139
C000591600	tetrachlorobenzoquinone	tetrachlorobenzoquinone results in increased cleavage of CASP3 protein	27484784
C000591600	tetrachlorobenzoquinone	Acetylcysteine inhibits the reaction [tetrachlorobenzoquinone results in increased cleavage of CASP3 protein]	27484784
C000591600	tetrachlorobenzoquinone	TNFRSF10B protein promotes the reaction [tetrachlorobenzoquinone results in increased cleavage of CASP3 protein]	27484784
D013749	Tetrachlorodibenzodioxin	Resveratrol inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of CASP3 mRNA]	15536054
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of CASP3 mRNA	15536054
D013749	Tetrachlorodibenzodioxin	fostriecin inhibits the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D013749	Tetrachlorodibenzodioxin	Okadaic Acid inhibits the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]]	24954032
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of CASP3 mRNA	22574217
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the reaction [dibenzo(a,l)pyrene results in increased cleavage of CASP3 protein]	24954032
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin inhibits the reaction [Benzo(a)pyrene results in increased cleavage of CASP3 protein]	24954032
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin inhibits the reaction [Etoposide results in increased activity of CASP3 protein]	20299546
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of CASP3 mRNA	23152189
D013749	Tetrachlorodibenzodioxin	AHR protein inhibits the reaction [Tetrachlorodibenzodioxin results in decreased expression of CASP3 mRNA]	15034205
D013749	Tetrachlorodibenzodioxin	IGFBP6 protein promotes the reaction [Tetrachlorodibenzodioxin results in increased activity of CASP3 protein]	12962974
D013749	Tetrachlorodibenzodioxin	NFE2L2 gene mutant form promotes the reaction [Tetrachlorodibenzodioxin results in increased activity of CASP3 protein]	21846477
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of CASP3 mRNA	21570461
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin co-treated with AHR protein] results in increased activity of CASP3 protein	21534955
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	12878042
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of CASP3 mRNA	15034205
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased activity of CASP3 protein	12962974; 16080534; 21846477;
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased cleavage of and affects the activity of CASP3 protein	15664267
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased cleavage of and results in increased activity of CASP3 protein	14718643
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of CASP3 mRNA	12167310
D013749	Tetrachlorodibenzodioxin	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [[Tetrachlorodibenzodioxin results in increased activity of CASP3 protein] which results in increased activity of PRKCD protein]	20846705
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin results in increased activity of CASP3 protein] which results in increased activity of PRKCD protein	20846705
D013749	Tetrachlorodibenzodioxin	AHR protein alternative form affects the reaction [Tetrachlorodibenzodioxin results in decreased expression of CASP3 mRNA]	21215274
D013749	Tetrachlorodibenzodioxin	EIF2S1 mutant form promotes the reaction [Tetrachlorodibenzodioxin results in increased cleavage of CASP3 protein]	24932542
D013749	Tetrachlorodibenzodioxin	salubrinal inhibits the reaction [Tetrachlorodibenzodioxin results in increased cleavage of CASP3 protein]	24932542
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin promotes the reaction [Camptothecin results in increased cleavage of CASP3 protein]	25843524
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of CASP3 mRNA	18796159; 21215274;
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased activity of CASP3 protein	20302886
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased cleavage of CASP3 protein	24932542
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of CASP3 mRNA	19520675
D013750	Tetrachloroethylene	Tetrachloroethylene results in increased activity of CASP3 protein	23559643
C434652	tetrachloroguaiacol	tetrachloroguaiacol results in increased activity of CASP3 protein	19766705
D013752	Tetracycline	Tetracycline results in decreased expression of CASP3 mRNA	24489787
C117155	tetracycline CMT-3	Celecoxib promotes the reaction [tetracycline CMT-3 results in increased activity of and results in increased expression of CASP3 protein]	15688368
C117155	tetracycline CMT-3	tetracycline CMT-3 promotes the reaction [Celecoxib results in increased activity of and results in increased expression of CASP3 protein]	15688368
C117155	tetracycline CMT-3	tetracycline CMT-3 results in increased activity of and results in increased expression of CASP3 protein	15688368
C117155	tetracycline CMT-3	tetracycline CMT-3 results in increased activity of CASP3 protein	16039551
C117155	tetracycline CMT-3	tetracycline CMT-3 results in decreased activity of CASP3 protein	16003065
D013755	Tetradecanoylphorbol Acetate	[Glucose deficiency co-treated with Tetradecanoylphorbol Acetate] results in increased activity of CASP3 protein	17309078
D013755	Tetradecanoylphorbol Acetate	[Graphite analog co-treated with Tetradecanoylphorbol Acetate] results in increased cleavage of CASP3 protein	25446327
D013755	Tetradecanoylphorbol Acetate	[Ionomycin co-treated with Tetradecanoylphorbol Acetate] results in increased activity of CASP3 protein	12165276
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	14610070
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate inhibits the reaction [Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein]	19631781
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	14610070
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate results in decreased expression of CASP3 protein	24073338
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate results in increased cleavage of and results in increased activity of CASP3 protein	11139146
D013755	Tetradecanoylphorbol Acetate	Tetradecanoylphorbol Acetate promotes the reaction [Quercetin results in increased activity of CASP3 protein]	15538571
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] affects the expression of CASP3 mRNA	25613284
C040733	tetraethoxysilane	tetraethoxysilane analog results in increased expression of CASP3 protein	27362941
D044005	Tetrahydroisoquinolines	Tetrahydroisoquinolines results in increased cleavage of CASP3 protein	30342220
C014215	tetrahydropalmatine	tetrahydropalmatine results in increased cleavage of CASP3 protein	20109541
C474019	tetrakis(4-benzoic acid)porphyriniron(III)	tetrakis(4-benzoic acid)porphyriniron(III) inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	12523938
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex affects the activity of CASP3 protein	16002045
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	19286953
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Doxorubicin results in increased expression of CASP3 mRNA]	19286953
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Ethanol results in increased cleavage of and results in increased activity of CASP3 protein]	22497828
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	28962519
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex results in decreased cleavage of CASP3 protein	22934841
C050950	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex	tetrakis(N-methyl-4-pyridiniumyl)porphine manganese(III) complex inhibits the reaction [Testosterone results in increased cleavage of CASP3 protein]	24658017
C017953	tetramethylpyrazine	tetramethylpyrazine inhibits the reaction [Gentamicins results in increased activity of CASP3 protein]	17132701
C009438	tetrandrine	3-methyladenine inhibits the reaction [tetrandrine results in increased cleavage of CASP3 protein]	25266202
C009438	tetrandrine	3-methyladenine promotes the reaction [tetrandrine results in increased cleavage of CASP3 protein]	26822499
C009438	tetrandrine	bafilomycin A1 inhibits the reaction [tetrandrine results in increased cleavage of CASP3 protein]	25266202
C009438	tetrandrine	CYP3A5 protein promotes the reaction [tetrandrine results in increased expression of CASP3 protein]	26302866
C009438	tetrandrine	tetrandrine results in increased cleavage of and results in increased activity of CASP3 protein	26822499
C009438	tetrandrine	tetrandrine results in increased cleavage of CASP3 protein	25266202
C009438	tetrandrine	tetrandrine results in increased expression of CASP3 protein	26302866; 31255635;
C020809	tetrathiomolybdate	[Copper deficiency co-treated with tetrathiomolybdate] results in increased cleavage of CASP3 protein	22276220
C020809	tetrathiomolybdate	[Copper deficiency co-treated with tetrathiomolybdate] results in increased expression of CASP3 protein	22276220
C531352	tetrazolium violet	tetrazolium violet results in increased activity of CASP3 protein	18547555
D013792	Thalidomide	Thalidomide results in decreased activity of CASP3 protein	15067094
D013792	Thalidomide	Thalidomide results in increased activity of CASP3 protein	14682394
D013792	Thalidomide	Thalidomide results in increased expression of CASP3 mRNA	18291259
C042172	thallium nitrate	EGF protein inhibits the reaction [thallium nitrate analog results in increased activity of CASP3 protein]	27412756
C042172	thallium nitrate	EGF protein inhibits the reaction [thallium nitrate results in increased activity of CASP3 protein]	27412756
C042172	thallium nitrate	acetyl-aspartyl-glutamyl-valyl-aspartic acid p-nitroanilide inhibits the reaction [thallium nitrate analog results in increased activity of CASP3 protein]	19371624
C042172	thallium nitrate	acetyl-aspartyl-glutamyl-valyl-aspartic acid p-nitroanilide inhibits the reaction [thallium nitrate results in increased activity of CASP3 protein]	19371624
C042172	thallium nitrate	pepstatin affects the reaction [thallium nitrate results in increased activity of CASP3 protein]	22669516
C042172	thallium nitrate	pepstatin inhibits the reaction [thallium nitrate analog results in increased activity of CASP3 protein]	22669516
C042172	thallium nitrate	thallium nitrate analog results in increased activity of CASP3 protein	19371624; 22669516; 27412756;
C042172	thallium nitrate	thallium nitrate results in increased activity of CASP3 protein	19371624; 22669516; 27412756;
D019284	Thapsigargin	1-(1-methanesulfonylpiperidin-4-yl)-3-(4-trifluoromethoxyphenyl)urea inhibits the reaction [Thapsigargin results in increased expression of CASP3 protein]	23576437
D019284	Thapsigargin	Bortezomib promotes the reaction [Thapsigargin results in increased activity of CASP3 protein]	16357177
D019284	Thapsigargin	Cyclosporine inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	12871656
D019284	Thapsigargin	Diclofenac inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	16388830
D019284	Thapsigargin	Melatonin inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	20130848
D019284	Thapsigargin	Tacrolimus inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	12871656
D019284	Thapsigargin	tauroursodeoxycholic acid inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	12198651
D019284	Thapsigargin	Thapsigargin promotes the reaction [pterostilbene results in increased activity of CASP3 protein]	25341683
D019284	Thapsigargin	Thapsigargin results in increased activity of CASP3 protein	12198651; 12871656; 16357177; 16388830; 17559149; 20022965; 20130848;
D019284	Thapsigargin	Thapsigargin results in increased cleavage of CASP3 protein	18178165; 22800509;
D019284	Thapsigargin	Thapsigargin results in increased expression of CASP3 protein	23576437
D019284	Thapsigargin	Thapsigargin results in increased expression of CASP3 protein alternative form	16382148
D019284	Thapsigargin	Thapsigargin results in increased metabolism of CASP3 protein	16382148
D019284	Thapsigargin	Apigenin inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	20493918
D019284	Thapsigargin	HR protein affects the reaction [Thapsigargin results in increased activity of CASP3 protein]	20886113
D019284	Thapsigargin	Thapsigargin promotes the reaction [Arsenic Trioxide results in increased expression of CASP3 protein modified form]	27638049
D019284	Thapsigargin	Thapsigargin results in increased activity of CASP3 protein	20493918; 20886113;
D019284	Thapsigargin	Thapsigargin results in increased cleavage of CASP3 protein	18178165
D019284	Thapsigargin	1-Deoxynojirimycin inhibits the reaction [Thapsigargin results in increased activity of CASP3 protein]	19028522
D019284	Thapsigargin	Thapsigargin results in increased activity of CASP3 protein	19028522
D019284	Thapsigargin	Thapsigargin results in increased cleavage of CASP3 protein	16338971
D019284	Thapsigargin	NGF protein inhibits the reaction [Thapsigargin results in increased cleavage of CASP3 protein]	16338971
D019284	Thapsigargin	Thapsigargin results in increased activity of CASP3 protein	10899114
D013806	Theophylline	Theophylline results in increased activity of CASP3 protein	14634331
C001996	thermozymocidin	thermozymocidin inhibits the reaction [Dronabinol results in increased activity of CASP3 protein]	16818650
C001996	thermozymocidin	thermozymocidin inhibits the reaction [gamma-Tocopherol results in increased activity of CASP3 protein]	15596715
D013827	Thiabendazole	Thiabendazole results in increased activity of CASP3 protein	26748015
D013844	Thiazoles	Acetylcysteine inhibits the reaction [[Heterocyclic Compounds binds to Thiazoles] which results in increased activity of CASP3 protein]	19014919
D013844	Thiazoles	[Heterocyclic Compounds binds to Thiazoles] which results in increased activity of CASP3 protein	19014919
C022616	thiazolyl blue	thiazolyl blue results in increased activity of CASP3 protein	22401948
D013849	Thimerosal	Acetylcysteine inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein]	17888894
D013849	Thimerosal	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein]	17888894
D013849	Thimerosal	Glutathione inhibits the reaction [Thimerosal results in increased activity of CASP3 protein]	12140745
D013849	Thimerosal	Resveratrol inhibits the reaction [[SOD1 protein results in increased susceptibility to Thimerosal] which results in increased cleavage of CASP3 protein]	30503815
D013849	Thimerosal	SB 203580 inhibits the reaction [Thimerosal results in increased activity of CASP3 protein]	17698513
D013849	Thimerosal	[SOD1 protein results in increased susceptibility to Thimerosal] which results in increased cleavage of CASP3 protein	30503815
D013849	Thimerosal	[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	17888894
D013849	Thimerosal	[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein	17888894
D013849	Thimerosal	Thimerosal results in increased activity of CASP3 protein	12140745; 15869795; 16649253; 17698513;
D013849	Thimerosal	Thimerosal results in increased cleavage of CASP3 protein	15869795
D013849	Thimerosal	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	BIRC5 mutant form promotes the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	BIRC5 protein inhibits the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	IGF1 protein inhibits the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	Thimerosal promotes the reaction [BIRC5 mutant form results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	Thimerosal promotes the reaction [Wortmannin results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	Thimerosal results in increased cleavage of CASP3 protein	23145070
D013849	Thimerosal	Wortmannin promotes the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D013849	Thimerosal	MC1568 inhibits the reaction [Thimerosal results in increased cleavage of and results in increased activity of CASP3 protein]	27660204
D013849	Thimerosal	Thimerosal results in increased cleavage of and results in increased activity of CASP3 protein	27660204
D013849	Thimerosal	Thimerosal results in increased activity of CASP3 protein	16273274
D013853	Thioacetamide	Thioacetamide results in increased expression of CASP3 mRNA	16456712
D013853	Thioacetamide	[TGFBR1 protein results in increased susceptibility to Thioacetamide] which results in increased cleavage of CASP3 protein	28560358
D013853	Thioacetamide	Thioacetamide results in increased activity of CASP3 protein	20713078
D013853	Thioacetamide	TXNIP gene mutant form inhibits the reaction [Thioacetamide results in increased activity of CASP3 protein]	20713078
D013853	Thioacetamide	[Berberine co-treated with Thioacetamide] results in increased expression of CASP3 mRNA	30138605
D013853	Thioacetamide	chloroquine diphosphate inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]	29133031
D013853	Thioacetamide	chloroquine diphosphate promotes the reaction [Doxorubicin inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]]	29133031
D013853	Thioacetamide	chrysin inhibits the reaction [Thioacetamide results in increased expression of CASP3 protein]	30500344
D013853	Thioacetamide	Doxorubicin inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]	29133031
D013853	Thioacetamide	Doxorubicin promotes the reaction [chloroquine diphosphate inhibits the reaction [Thioacetamide results in decreased expression of CASP3 mRNA]]	29133031
D013853	Thioacetamide	Mesalamine inhibits the reaction [Thioacetamide affects the expression of CASP3 protein]	29738702
D013853	Thioacetamide	Thioacetamide affects the expression of CASP3 mRNA	19483382
D013853	Thioacetamide	Thioacetamide affects the expression of CASP3 protein	29738702
D013853	Thioacetamide	Thioacetamide results in decreased expression of CASP3 mRNA	29133031
D013853	Thioacetamide	Thioacetamide results in increased activity of CASP3 protein	16937528
D013853	Thioacetamide	Thioacetamide results in increased cleavage of CASP3 protein	26011634; 26558467;
D013853	Thioacetamide	Thioacetamide results in increased expression of CASP3 mRNA	16337175; 17292413;
D013853	Thioacetamide	Thioacetamide results in increased expression of CASP3 protein	30500344
D013859	Thiocarbamates	Thiocarbamates analog inhibits the reaction [Dimethylformamide results in increased expression of CASP3 protein modified form]	29984871
D013859	Thiocarbamates	Thiocarbamates results in increased activity of CASP3 protein	20209498
C014856	thiocholchicine	[pifithrin co-treated with thiocholchicine] results in increased cleavage of and results in increased activity of CASP3 protein	18516295
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [Zinc Oxide analog results in increased activity of CASP3 protein]	27544635
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	23892647
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	21763304
D008063	Thioctic Acid	[Ryanodine co-treated with Thioctic Acid] results in decreased activity of CASP3 protein	17079870
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [cadmium acetate results in increased expression of CASP3 protein modified form]	30605698
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	17079870
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	21062633
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	29214690
D008063	Thioctic Acid	Thioctic Acid inhibits the reaction [Streptozocin results in increased expression of CASP3 protein]	19951573
D008063	Thioctic Acid	Thioctic Acid results in increased activity of CASP3 protein	15909127
D008063	Thioctic Acid	Thioctic Acid results in increased expression of CASP3 protein modified form	30605698
D013874	Thiopental	Thiopental inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	18218830
D013874	Thiopental	Thiopental results in increased activity of CASP3 protein	16129983
D013881	Thioridazine	Thioridazine results in increased activity of CASP3 protein	21035837
C441201	thiosalicylic acid	[Diethylnitrosamine co-treated with thiosalicylic acid] results in increased activity of CASP3 protein	19427195
D013882	Thiosemicarbazones	Thiosemicarbazones analog affects the activity of CASP3 protein	24946146
D013882	Thiosemicarbazones	[Thiosemicarbazones binds to Copper] which results in decreased activity of CASP3 protein	20931265
C100040	thiosulfinic acids	thiosulfinic acids results in increased activity of CASP3 protein	19446247
D013852	Thiotepa	Thiotepa results in increased activity of CASP3 protein	10822281
D013852	Thiotepa	Niacinamide inhibits the reaction [Thiotepa results in increased activity of CASP3 protein]	22164206
D013852	Thiotepa	Thiotepa results in increased activity of CASP3 protein	22164206
D013890	Thiourea	Thiourea inhibits the reaction [[cupric chloride co-treated with di(2-picolyl)amine-3(bromoacetyl)coumarin] results in increased activity of CASP3 protein]	29803612
D013890	Thiourea	Thiourea analog inhibits the reaction [Diclofenac results in increased activity of CASP3 protein]	14599462
C000628091	THJ-2201	THJ-2201 results in increased activity of CASP3 protein	30796436
D013936	Thymidine	Thymidine inhibits the reaction [Adenosine results in increased activity of CASP3 protein]	11570579
D013936	Thymidine	Thymidine results in increased activity of CASP3 protein	16419169
C557007	thymiplatin	thymiplatin results in increased activity of CASP3 protein	20981665
D013943	Thymol	Thymol results in increased activity of CASP3 protein	21640085
C003466	thymoquinone	4-phenylbutyric acid inhibits the reaction [thymoquinone results in increased cleavage of CASP3 protein]	29981725
C003466	thymoquinone	Acetylcysteine inhibits the reaction [thymoquinone results in increased expression of CASP3 protein modified form]	31433961
C003466	thymoquinone	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [thymoquinone results in increased activity of CASP3 protein]	29981725
C003466	thymoquinone	DDIT3 protein affects the reaction [thymoquinone results in increased activity of and results in increased cleavage of CASP3 protein]	29981725
C003466	thymoquinone	thymoquinone results in increased activity of and results in increased cleavage of CASP3 protein	29981725
C003466	thymoquinone	thymoquinone results in increased expression of CASP3 protein modified form	31433961
C003466	thymoquinone	thymoquinone inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]	29085585
C003466	thymoquinone	thymoquinone inhibits the reaction [sodium arsenate results in increased cleavage of CASP3 protein]	29710533
C003466	thymoquinone	thymoquinone inhibits the reaction [sodium arsenate results in increased expression of CASP3 mRNA]	29710533
C003466	thymoquinone	thymoquinone inhibits the reaction [sodium arsenite results in increased expression of CASP3 protein]	30558456
D013974	Thyroxine	Thyroxine results in decreased expression of CASP3 mRNA	17403546
C000596184	THZ1 compound	[THZ1 compound co-treated with (+)-JQ1 compound] results in increased cleavage of CASP3 protein	30127528
C000596184	THZ1 compound	THZ1 compound results in increased cleavage of CASP3 protein	30127528
C027385	tibolone	tibolone results in decreased expression of CASP3 protein	16021059
D013988	Ticlopidine	Palmitic Acid promotes the reaction [Ticlopidine results in increased activity of CASP3 protein]	22700542
D013988	Ticlopidine	Ticlopidine results in increased activity of CASP3 protein	22700542
D000078304	Tigecycline	Tigecycline inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]	23200736
C032628	tin protoporphyrin IX	tin protoporphyrin IX inhibits the reaction [FASLG protein results in increased activity of CASP3 protein]	16051694
C032628	tin protoporphyrin IX	tin protoporphyrin IX inhibits the reaction [FASLG protein results in increased cleavage of CASP3 protein]	16051694
C032628	tin protoporphyrin IX	tin protoporphyrin IX inhibits the reaction [solanesol inhibits the reaction [Ethanol results in increased cleavage of CASP3 protein]]	25645596
C032628	tin protoporphyrin IX	tin protoporphyrin IX results in decreased activity of CASP3 protein	16051694
C032628	tin protoporphyrin IX	[Methamphetamine co-treated with tin protoporphyrin IX] results in increased cleavage of CASP3 protein	23933405
C032628	tin protoporphyrin IX	tin protoporphyrin IX inhibits the reaction [ADIPOQ protein inhibits the reaction [Iron-Dextran Complex results in increased activity of CASP3 protein]]	20709802
C032628	tin protoporphyrin IX	tin protoporphyrin IX results in decreased activity of CASP3 protein	14512878
C032628	tin protoporphyrin IX	tin protoporphyrin IX inhibits the reaction [Hemin inhibits the reaction [Carbon Monoxide results in increased cleavage of and results in increased activity of CASP3 protein]]	19520142
C032628	tin protoporphyrin IX	tin protoporphyrin IX inhibits the reaction [[cobaltiprotoporphyrin results in increased expression of HMOX1 protein] inhibits the reaction [Excitatory Amino Acid Agents results in increased activity of CASP3 protein]]	16371440
C032628	tin protoporphyrin IX	tin protoporphyrin IX results in increased activity of CASP3 protein	16371440
C078041	tin sulfide	tin sulfide results in increased expression of CASP3 protein	29069489
C016151	tinuvin	tinuvin analog results in decreased expression of CASP3 mRNA	30315675
C402769	tipifarnib	[tipifarnib co-treated with Paclitaxel] results in increased activity of CASP3 protein	15728126
C009495	titanium dioxide	Acetylcysteine inhibits the reaction [titanium dioxide results in increased cleavage of CASP3 protein]	20362650
C009495	titanium dioxide	benzyloxycarbonyl-leucyl-glutamyl-histidyl-aspartic acid fluoromethyl ketone inhibits the reaction [titanium dioxide results in increased cleavage of CASP3 protein]	20362650
C009495	titanium dioxide	[Ferrosoferric Oxide binds to titanium dioxide] which results in increased cleavage of CASP3 protein	30098274
C009495	titanium dioxide	titanium dioxide inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in increased activity of CASP3 protein]	30738203
C009495	titanium dioxide	titanium dioxide inhibits the reaction [[lead nitrate results in increased abundance of Lead] which results in increased expression of CASP3 mRNA]	30738203
C009495	titanium dioxide	titanium dioxide results in increased activity of CASP3 protein	19783790; 20541599; 23044362;
C009495	titanium dioxide	titanium dioxide results in increased cleavage of CASP3 protein	20362650; 23111874; 26028148; 30098274; 30126039;
C009495	titanium dioxide	titanium dioxide results in increased expression of CASP3 mRNA	20362650
C009495	titanium dioxide	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of CASP3 mRNA	29950665
C009495	titanium dioxide	titanium dioxide results in increased activity of CASP3 protein	20381595; 30626778;
C009495	titanium dioxide	Vitamin E inhibits the reaction [titanium dioxide results in increased activity of CASP3 protein]	30626778
C009495	titanium dioxide	morin inhibits the reaction [titanium dioxide results in increased expression of CASP3 mRNA]	28844848
C009495	titanium dioxide	titanium dioxide results in increased activity of CASP3 protein	23044362
C009495	titanium dioxide	titanium dioxide results in increased expression of CASP3 mRNA	28844848
C423915	TO-901317	GPAM protein affects the reaction [TO-901317 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]]	21209018
C423915	TO-901317	SREBF1 protein affects the reaction [TO-901317 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]]	21209018
C423915	TO-901317	[TO-901317 co-treated with Alitretinoin] promotes the reaction [Palmitic Acid results in increased activity of CASP3 protein]	17194744
C423915	TO-901317	TO-901317 inhibits the reaction [Palmitates results in increased cleavage of CASP3 protein]	21209018
C423915	TO-901317	TO-901317 promotes the reaction [Palmitic Acid results in increased activity of CASP3 protein]	17194744
D014028	Tobacco Smoke Pollution	Acetylcysteine inhibits the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
D014028	Tobacco Smoke Pollution	DDIT3 mutant form promotes the reaction [Tobacco Smoke Pollution analog results in increased activity of CASP3 protein]	25568320
D014028	Tobacco Smoke Pollution	MIR145 mRNA inhibits the reaction [Tobacco Smoke Pollution results in increased expression of CASP3 protein modified form]	30639269
D014028	Tobacco Smoke Pollution	NFE2L2 protein inhibits the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
D014028	Tobacco Smoke Pollution	Resveratrol promotes the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]	20060927
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of CASP3 mRNA	29505817
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein	25568320
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution inhibits the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]	20118622
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased activity of CASP3 protein	20060927; 20118622; 22960471;
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased cleavage of CASP3 protein	30579903
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased expression of CASP3 protein modified form	30053496; 30639269;
D014028	Tobacco Smoke Pollution	trimethyloxamine inhibits the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
D014028	Tobacco Smoke Pollution	[XBP1 mutant form co-treated with benzyloxycarbonylleucyl-leucyl-leucine aldehyde] promotes the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the activity of CASP3 protein	26746805
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of CASP3 mRNA	20133372
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased expression of CASP3 protein	27237783
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased expression of CASP3 protein modified form	27589885
D014028	Tobacco Smoke Pollution	Resveratrol inhibits the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]	18424637
D014028	Tobacco Smoke Pollution	SIRT1 protein promotes the reaction [Resveratrol inhibits the reaction [Tobacco Smoke Pollution results in increased activity of CASP3 protein]]	18424637
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in increased activity of CASP3 protein	18424637
D014050	Toluene	Toluene results in increased activity of CASP3 protein	20804784
D014050	Toluene	aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Toluene results in increased activity of CASP3 protein]	14705839
D014050	Toluene	CASP3 protein affects the susceptibility to Toluene	14705839
D014050	Toluene	Toluene results in increased activity of CASP3 protein	14705839
C036454	toosendanin	toosendanin results in increased expression of CASP3 protein modified form	23111283
D000077236	Topiramate	Topiramate affects the expression of CASP3 mRNA	19148780
D000077236	Topiramate	Topiramate affects the expression of CASP3 protein	19148780
D000077236	Topiramate	Topiramate inhibits the reaction [3-nitropropionic acid results in increased activity of CASP3 protein]	29753867
D019772	Topotecan	[Amlodipine co-treated with Topotecan] results in increased activity of CASP3 protein	16516327
D019772	Topotecan	chrysin inhibits the reaction [Topotecan results in increased activity of CASP3 protein]	20457140
D019772	Topotecan	Topotecan results in increased activity of CASP3 protein	19812371; 20457140;
D019772	Topotecan	TP53 inhibits the reaction [Topotecan results in increased activity of CASP3 protein]	19812371
D019772	Topotecan	APAF1 promotes the reaction [Topotecan results in increased cleavage of CASP3 protein]	19812371
D019772	Topotecan	pifithrin promotes the reaction [Topotecan results in increased activity of CASP3 protein]	19812371
D019772	Topotecan	Topotecan results in increased activity of CASP3 protein	19812371
D019772	Topotecan	Topotecan results in increased cleavage of CASP3 protein	19812371
D019772	Topotecan	TRP53 inhibits the reaction [Topotecan results in increased activity of CASP3 protein]	19812371
D014108	Tosylphenylalanyl Chloromethyl Ketone	Tosylphenylalanyl Chloromethyl Ketone results in increased activity of CASP3 protein	19679660
D014108	Tosylphenylalanyl Chloromethyl Ketone	Tosylphenylalanyl Chloromethyl Ketone results in increased cleavage of and results in increased activity of CASP3 protein	12821135
D014108	Tosylphenylalanyl Chloromethyl Ketone	TP53 protein promotes the reaction [Tosylphenylalanyl Chloromethyl Ketone results in increased activity of CASP3 protein]	12821135
D014147	Tramadol	Tramadol affects the activity of CASP3 protein	27317026
D014147	Tramadol	Tramadol results in decreased activity of CASP3 protein	28499616
C560077	trametinib	[GNAQ gene mutant form results in increased susceptibility to [trametinib co-treated with 2,4-difluoro-N-(2-(methyloxy)-5-(4-(4-pyridazinyl)-6-quinolinyl)-3-pyridinyl)benzenesulfonamide]] which results in increased cleavage of CASP3 protein	22733540
D014148	Tranexamic Acid	Tranexamic Acid inhibits the reaction [Rotenone results in increased cleavage of and results in increased activity of CASP3 protein]	19539006
C496197	trans-10,cis-12-conjugated linoleic acid	trans-10,cis-12-conjugated linoleic acid results in increased expression of CASP3 mRNA	15888570
C496197	trans-10,cis-12-conjugated linoleic acid	trans-10,cis-12-conjugated linoleic acid results in increased activity of CASP3 protein	16005259
D014191	Tranylcypromine	Tranylcypromine inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased activity of CASP3 protein]	19135049
C095106	traxoprodil mesylate	traxoprodil mesylate inhibits the reaction [Dextromethorphan results in increased cleavage of CASP3 protein]	28916251
D014204	Trenbolone Acetate	Dihydrotestosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D014204	Trenbolone Acetate	Flutamide promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D014204	Trenbolone Acetate	Fulvestrant affects the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D014204	Trenbolone Acetate	Testosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]	25461682
D014204	Trenbolone Acetate	Trenbolone Acetate analog results in increased activity of CASP3 protein	25461682
D014204	Trenbolone Acetate	trilostane inhibits the reaction [Dihydrotestosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]]	25461682
D014212	Tretinoin	Tretinoin results in increased activity of CASP3 protein	16953078
D014212	Tretinoin	Tretinoin results in increased activity of CASP3 protein	16829022
D014212	Tretinoin	[alpha-Tocopherol co-treated with Tretinoin] results in increased activity of CASP3 protein	17874176
D014212	Tretinoin	CYP26A1 protein inhibits the reaction [Tretinoin results in increased cleavage of CASP3 protein]	15703382
D014212	Tretinoin	[IDH1 protein affects the susceptibility to Tretinoin] which affects the cleavage of CASP3 protein	26951332
D014212	Tretinoin	[IFNB1 protein co-treated with Tretinoin] results in increased cleavage of and results in increased activity of CASP3 protein	16826196
D014212	Tretinoin	LTF protein inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16168621
D014212	Tretinoin	MGAT5 protein inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16411021
D014212	Tretinoin	RARA gene mutant form inhibits the reaction [Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	25003661
D014212	Tretinoin	TGFB1 protein inhibits the reaction [Tretinoin results in increased cleavage of and results in increased activity of CASP3 protein]	16242776
D014212	Tretinoin	[Tretinoin co-treated with ALK gene mutant form] results in increased cleavage of CASP3 protein	20576349
D014212	Tretinoin	[Tretinoin co-treated with IFNG protein] results in increased activity of CASP3 protein	16947022; 17960384;
D014212	Tretinoin	[Tretinoin co-treated with Paclitaxel] results in increased activity of CASP3 protein	17701358
D014212	Tretinoin	[Tretinoin co-treated with Zoledronic Acid] results in increased activity of CASP3 protein	20349282
D014212	Tretinoin	Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25003661
D014212	Tretinoin	Tretinoin promotes the reaction [[GJB1 protein co-treated with GJB2 protein] promotes the reaction [Cisplatin results in increased activity of CASP3 protein]]	23747833
D014212	Tretinoin	Tretinoin promotes the reaction [Imatinib Mesylate results in increased activity of CASP3 protein]	17915318
D014212	Tretinoin	Tretinoin promotes the reaction [Rosiglitazone results in increased activity of CASP3 protein]	19467017; 19731824;
D014212	Tretinoin	Tretinoin results in increased activity of CASP3 protein	12431242; 14519626; 16168621; 16196285; 16411021; 16568081; 16765349; 17701358; 17915318; 21159206;
D014212	Tretinoin	Tretinoin results in increased cleavage of and results in increased activity of CASP3 protein	16242776
D014212	Tretinoin	Tretinoin results in increased cleavage of CASP3 protein	15703382; 16135400; 16935849;
D014212	Tretinoin	Tretinoin results in increased expression of and results in increased cleavage of CASP3 protein	23830798
D014212	Tretinoin	Tretinoin results in increased expression of CASP3	16909596
D014212	Tretinoin	Tretinoin results in increased expression of CASP3 protein	16109544; 16157052;
D014212	Tretinoin	4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16712891
D014212	Tretinoin	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16291826
D014212	Tretinoin	MAPT protein promotes the reaction [Tretinoin results in increased activity of CASP3 protein]	16417947
D014212	Tretinoin	pyrazolanthrone inhibits the reaction [Tretinoin results in increased activity of CASP3 protein]	16712891
D014212	Tretinoin	[Tretinoin co-treated with U 0126] results in increased cleavage of CASP3 protein	17026715
D014212	Tretinoin	Tretinoin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	15688020
D014212	Tretinoin	Tretinoin promotes the reaction [pevonedistat results in increased cleavage of and results in increased activity of CASP3 protein]	22110742
D014212	Tretinoin	Tretinoin promotes the reaction [Tretinoin results in increased activity of CASP3 protein]	16417947
D014212	Tretinoin	Tretinoin results in decreased expression of CASP3 mRNA	22498432
D014212	Tretinoin	Tretinoin results in increased activity of CASP3 protein	16291826; 16712891; 18668354;
D014212	Tretinoin	Tretinoin results in increased cleavage of CASP3 protein	21626648; 29767511;
D014212	Tretinoin	Tretinoin results in increased expression of CASP3 protein	11851873; 16764683;
D014212	Tretinoin	DDAH2 protein promotes the reaction [Tretinoin inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]]	19156866
D014212	Tretinoin	[Quercetin co-treated with Tretinoin] results in increased cleavage of CASP3 protein	25203460
D014212	Tretinoin	Tretinoin inhibits the reaction [cobaltous chloride results in increased activity of CASP3 protein]	19156866
D014212	Tretinoin	Tretinoin inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	26915917
D014215	Triacetin	[Biofuels co-treated with Triacetin] results in decreased expression of CASP3 mRNA	30738890
C034613	triacsin C	triacsin C results in increased activity of CASP3 protein	16704987
C032910	triadimefon	triadimefon results in increased expression of CASP3 mRNA	19363144
C011559	tributyltin	DFFB protein promotes the reaction [tributyltin results in decreased expression of CASP3 protein]	31401084
C011559	tributyltin	tributyltin results in decreased expression of CASP3 protein	31401084
C011559	tributyltin	tributyltin results in increased cleavage of CASP3 protein	21626652
C011559	tributyltin	PRKCD gene mutant form inhibits the reaction [tributyltin results in increased expression of CASP3 protein modified form]	25895139
C011559	tributyltin	tributyltin results in increased activity of CASP3 protein	22223438
C011559	tributyltin	Acetylcysteine inhibits the reaction [tributyltin results in increased expression of CASP3 protein modified form]	26079211
C011559	tributyltin	Phycocyanin inhibits the reaction [tributyltin results in increased activity of CASP3 protein]	21477642
C011559	tributyltin	Phycocyanin inhibits the reaction [tributyltin results in increased expression of CASP3 protein modified form]	26079211
C011559	tributyltin	SB 203580 inhibits the reaction [tributyltin results in increased expression of CASP3 protein]	23743147
C011559	tributyltin	tributyltin results in increased activity of CASP3 protein	21477642; 21683754; 24055800; 28161095;
C011559	tributyltin	tributyltin results in increased expression of and results in increased cleavage of CASP3 protein	28707438
C011559	tributyltin	tributyltin results in increased expression of CASP3 protein	23743147; 27521499;
C011559	tributyltin	tributyltin results in increased expression of CASP3 protein modified form	17341481; 26079211;
C447082	tricarbonyldichlororuthenium (II) dimer	tricarbonyldichlororuthenium (II) dimer inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	21443895
D014236	Trichlorfon	Tetradecanoylphorbol Acetate inhibits the reaction [Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein]	19631781
D014236	Trichlorfon	Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein	19631781
D014236	Trichlorfon	[Verapamil co-treated with Ruthenium Red co-treated with 2-aminoethoxydiphenyl borate] inhibits the reaction [Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein]	19631781
D014241	Trichloroethylene	SET protein affects the reaction [Trichloroethylene results in increased activity of CASP3 protein]	22245669
D014241	Trichloroethylene	Trichloroethylene results in increased activity of CASP3 protein	22245669; 23559643;
D014241	Trichloroethylene	[Benzene co-treated with methylmercury II co-treated with Trichloroethylene] results in increased expression of CASP3 mRNA	17905399
C012589	trichostatin A	[Bortezomib co-treated with trichostatin A] results in increased cleavage of and results in increased activity of CASP3 protein	16904634
C012589	trichostatin A	[Decitabine co-treated with trichostatin A] results in increased activity of CASP3 protein	17019711
C012589	trichostatin A	EP300 protein affects the reaction [Quercetin promotes the reaction [trichostatin A results in increased activity of CASP3 protein]]	30958996
C012589	trichostatin A	EP300 protein affects the reaction [trichostatin A results in increased activity of CASP3 protein]	30958996
C012589	trichostatin A	[Genistein co-treated with trichostatin A] results in increased activity of CASP3 protein	22626855
C012589	trichostatin A	Genistein promotes the reaction [trichostatin A results in increased activity of CASP3 protein]	26768552
C012589	trichostatin A	N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine inhibits the reaction [SLC39A6 mutant form inhibits the reaction [trichostatin A results in increased cleavage of CASP3 protein]]	19887557
C012589	trichostatin A	NR4A1 protein promotes the reaction [trichostatin A results in increased cleavage of CASP3 protein]	21319187
C012589	trichostatin A	[perifosine co-treated with trichostatin A] results in increased activity of CASP3 protein	15781658
C012589	trichostatin A	Quercetin promotes the reaction [trichostatin A results in increased activity of CASP3 protein]	30958996
C012589	trichostatin A	SLC39A6 mutant form inhibits the reaction [trichostatin A results in increased cleavage of CASP3 protein]	19887557
C012589	trichostatin A	[trichostatin A co-treated with Bortezomib] results in increased cleavage of CASP3 protein	21345073
C012589	trichostatin A	trichostatin A results in increased activity of CASP3 protein	26768552; 30958996;
C012589	trichostatin A	trichostatin A results in increased cleavage of and results in increased activity of CASP3 protein	16009488; 16010430;
C012589	trichostatin A	trichostatin A results in increased cleavage of CASP3 protein	19887557; 21319187;
C012589	trichostatin A	trichostatin A results in increased expression of CASP3 mRNA	16865256
C012589	trichostatin A	trichostatin A results in increased expression of CASP3 protein modified form	23770000
C012589	trichostatin A	Zinc inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine inhibits the reaction [SLC39A6 mutant form inhibits the reaction [trichostatin A results in increased cleavage of CASP3 protein]]]	19887557
C012589	trichostatin A	ATG7 gene mutant form inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]]	29476062
C012589	trichostatin A	ATG7 gene mutant form inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]]	29476062
C012589	trichostatin A	Chloroquine inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]]	29476062
C012589	trichostatin A	trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]	29476062
C012589	trichostatin A	trichostatin A inhibits the reaction [Cisplatin results in increased expression of CASP3 protein modified form]	29476062
C012589	trichostatin A	Chloroquine inhibits the reaction [trichostatin A inhibits the reaction [Cisplatin results in increased activity of CASP3 protein]]	29476062
C023764	triciribine	triciribine promotes the reaction [[epothilone A co-treated with Metformin] results in increased expression of CASP3 mRNA]	29117515
C023764	triciribine	triciribine results in increased expression of CASP3 mRNA	29117515
D014266	Trientine	Paraquat promotes the reaction [Trientine results in increased activity of CASP3 protein]	11369509
D014266	Trientine	Trientine inhibits the reaction [APP protein results in increased activity of CASP3 protein]	12963085
D014266	Trientine	Trientine results in increased activity of CASP3 protein	11369509; 14513838;
D014266	Trientine	Trientine results in increased activity of CASP3 protein	22362149
C020946	triethylene glycol dimethacrylate	triethylene glycol dimethacrylate results in increased activity of CASP3 protein	24307521
D014268	Trifluoperazine	Trifluoperazine inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21544200
D014268	Trifluoperazine	Trifluoperazine inhibits the reaction [Cadmium results in increased cleavage of CASP3 protein]	21544200
D014271	Trifluridine	CA 074 methyl ester inhibits the reaction [Trifluridine results in increased cleavage of CASP3 protein]	19816940
D014271	Trifluridine	Trifluridine results in increased cleavage of and results in increased activity of CASP3 protein	19816940
C009560	trigonelline	trigonelline results in increased activity of CASP3 protein	26593444
D014284	Triiodothyronine	Triiodothyronine results in decreased expression of CASP3 protein	16021636
C009954	trilostane	trilostane inhibits the reaction [Dihydrotestosterone promotes the reaction [Trenbolone Acetate analog results in increased activity of CASP3 protein]]	25461682
C015559	trimellitic anhydride	trimellitic anhydride results in increased expression of CASP3 mRNA	19042947
D014292	Trimetazidine	Trimetazidine inhibits the reaction [Oxygen deficiency results in increased expression of CASP3 mRNA]	25937560
C052920	trimethylarsine oxide	trimethylarsine oxide results in increased expression of CASP3 mRNA	17481689
C009475	trimethylenediamine	[Copper binds to Isatin binds to trimethylenediamine] which results in increased cleavage of CASP3 protein	17327230
C005855	trimethyloxamine	trimethyloxamine inhibits the reaction [Tobacco Smoke Pollution analog results in increased cleavage of CASP3 protein]	25568320
C046488	trimethyltin	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [rottlerin inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]]	25895139
C046488	trimethyltin	HR protein affects the reaction [trimethyltin results in increased activity of CASP3 protein]	20886113
C046488	trimethyltin	magnolol inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]	26756313
C046488	trimethyltin	rottlerin inhibits the reaction [trimethyltin results in increased expression of CASP3 protein modified form]	25895139
C046488	trimethyltin	trimethyltin results in increased activity of CASP3 protein	20886113; 22634143; 24002884;
C046488	trimethyltin	trimethyltin results in increased expression of CASP3 mRNA	21435392; 24002884;
C046488	trimethyltin	trimethyltin results in increased expression of CASP3 protein modified form	25895139; 26756313;
C040533	trimethyltin chloride	trimethyltin chloride results in increased activity of CASP3 protein	19655806
D014302	Trinitrobenzenesulfonic Acid	D-JNKI-1 inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased activity of CASP3 protein]	22427801
D014302	Trinitrobenzenesulfonic Acid	Trinitrobenzenesulfonic Acid results in increased cleavage of and results in increased activity of CASP3 protein	22427801
D014302	Trinitrobenzenesulfonic Acid	geraniol inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein]	26165751
D014302	Trinitrobenzenesulfonic Acid	Sulfasalazine inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein]	26165751
D014302	Trinitrobenzenesulfonic Acid	Sulfur Dioxide inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein modified form]	30503585
D014302	Trinitrobenzenesulfonic Acid	Telmisartan inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of and results in increased activity of CASP3 protein]	24831514
D014302	Trinitrobenzenesulfonic Acid	Telmisartan inhibits the reaction [Trinitrobenzenesulfonic Acid results in increased expression of CASP3 mRNA]	24831514
D014302	Trinitrobenzenesulfonic Acid	Trinitrobenzenesulfonic Acid results in increased expression of and results in increased activity of CASP3 protein	24831514
D014302	Trinitrobenzenesulfonic Acid	Trinitrobenzenesulfonic Acid results in increased expression of CASP3 mRNA	24831514
D014302	Trinitrobenzenesulfonic Acid	Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein	26165751
D014302	Trinitrobenzenesulfonic Acid	Trinitrobenzenesulfonic Acid results in increased expression of CASP3 protein modified form	30503585
C025541	tri-o-cresyl phosphate	Phenylmethylsulfonyl Fluoride inhibits the reaction [tri-o-cresyl phosphate results in increased activity of CASP3 protein]	11032765
C025541	tri-o-cresyl phosphate	tri-o-cresyl phosphate results in increased activity of CASP3 protein	11032765
C013318	triphenyl phosphite	Cyclosporine inhibits the reaction [triphenyl phosphite results in increased activity of CASP3 protein]	11032765
C013318	triphenyl phosphite	triphenyl phosphite results in increased activity of CASP3 protein	11032765
C050414	tripterine	[TNFSF10 protein co-treated with tripterine] results in increased cleavage of CASP3 protein	20605676
C050414	tripterine	tripterine results in increased cleavage of CASP3 protein	21466843; 27374097;
C050414	tripterine	tripterine results in increased expression of CASP3 mRNA	27374097
C050414	tripterine	Uridine inhibits the reaction [tripterine results in increased cleavage of CASP3 protein]	27374097
C050414	tripterine	JUN mutant form promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
C050414	tripterine	PTEN protein promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
C050414	tripterine	pyrazolanthrone promotes the reaction [tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]]	24111524
C050414	tripterine	tripterine inhibits the reaction [Cadmium Chloride results in increased cleavage of CASP3 protein]	24111524
C001899	triptolide	triptolide results in increased activity of and results in increased cleavage of CASP3 protein	19233258
C001899	triptolide	triptolide results in increased activity of CASP3 protein	15972136; 21640813;
C001899	triptolide	triptolide results in increased cleavage of CASP3 protein	12533674
C001899	triptolide	triptolide results in increased expression of CASP3 protein modified form	30394310
C001899	triptolide	10-(6'-ubiquinonyl)decyltriphenylphosphonium bromide inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30836114
C001899	triptolide	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane inhibits the reaction [[triptolide co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form]	30633930
C001899	triptolide	NOTCH1 protein modified form inhibits the reaction [triptolide results in increased expression of CASP3 protein modified form]	30394310
C001899	triptolide	[triptolide co-treated with Lipopolysaccharides] results in increased expression of CASP3 protein modified form	30633930
C001899	triptolide	triptolide results in increased cleavage of CASP3 protein	25169008; 30009776; 30836114;
C001899	triptolide	triptolide results in increased expression of and results in increased activity of CASP3 protein	26990902
C001899	triptolide	TRP53 gene mutant form inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30009776
C001899	triptolide	benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	25169008
C001899	triptolide	NFE2L2 protein inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	25169008
C001899	triptolide	pifithrin inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30009776
C001899	triptolide	Quercetin inhibits the reaction [triptolide results in increased activity of CASP3 protein]	26277538
C001899	triptolide	triptolide results in increased activity of CASP3 protein	23639586; 26277538;
C001899	triptolide	triptolide results in increased cleavage of CASP3 protein	25169008; 30009776;
C001899	triptolide	Val-Pro-Met-Leu-Lys inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30009776
C084079	triptonide	triptonide results in increased cleavage of CASP3 protein	28666825
C495433	tris(1,10-phenanthroline)chromium(III) chloride	AG 1879 inhibits the reaction [tris(1,10-phenanthroline)chromium(III) chloride results in increased activity of CASP3 protein]	15124906
C495433	tris(1,10-phenanthroline)chromium(III) chloride	tris(1,10-phenanthroline)chromium(III) chloride results in increased activity of CASP3 protein	15124906
C016805	tris(1,3-dichloro-2-propyl)phosphate	tris(1,3-dichloro-2-propyl)phosphate results in increased expression of CASP3 protein modified form	27816613
C544864	tris(dicarboxymethylene)fullerene-C3	tris(dicarboxymethylene)fullerene-C3 inhibits the reaction [Acrylamide results in increased activity of CASP3 protein]	19475399
D000077288	Troglitazone	GSK3B protein affects the susceptibility to [Troglitazone results in increased expression of CASP3 protein]	20540935
D000077288	Troglitazone	[N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea results in decreased activity of GSK3B protein] results in increased susceptibility to [Troglitazone results in increased expression of CASP3 protein]	20540935
D000077288	Troglitazone	Palmitic Acid promotes the reaction [Troglitazone results in increased activity of CASP3 protein]	22700542
D000077288	Troglitazone	[Troglitazone co-treated with Aspirin] results in increased cleavage of and results in increased activity of CASP3 protein	19908241
D000077288	Troglitazone	Troglitazone results in increased activity of CASP3 protein	18407589; 22700542;
D000077288	Troglitazone	Troglitazone results in increased cleavage of CASP3 protein	19632256
D000077288	Troglitazone	Troglitazone results in increased expression of CASP3	12680223
D000077288	Troglitazone	Troglitazone results in increased expression of CASP3 protein	20540935
D000077288	Troglitazone	Troglitazone results in increased expression of CASP3 protein modified form	16820965
D000077288	Troglitazone	Troglitazone results in increased activity of CASP3 protein	17363128
D000077288	Troglitazone	Troglitazone inhibits the reaction [Potassium deficiency results in increased activity of CASP3 protein]	11750908
D000077288	Troglitazone	Troglitazone results in increased activity of CASP3 protein	11218074
D000077288	Troglitazone	[Troglitazone co-treated with beta-glycerophosphoric acid co-treated with Ascorbic Acid co-treated with Dexamethasone] results in increased expression of CASP3 mRNA	30481989
C080163	trovafloxacin	[TNF protein co-treated with trovafloxacin] results in increased activity of CASP3 protein	25748550
C080163	trovafloxacin	[trovafloxacin co-treated with TNF protein] results in increased activity of CASP3 protein	24097668
C080163	trovafloxacin	U 0126 inhibits the reaction [[TNF protein co-treated with trovafloxacin] results in increased activity of CASP3 protein]	25748550
C080163	trovafloxacin	[TNF protein co-treated with trovafloxacin] results in increased cleavage of CASP3 protein	19638433
C005865	troxerutin	troxerutin results in increased expression of CASP3 protein	30389603
C005865	troxerutin	epoxomicin inhibits the reaction [troxerutin inhibits the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of and results in increased activity of CASP3 protein]]	25639565
C005865	troxerutin	troxerutin inhibits the reaction [2,2',4,4'-tetrabromodiphenyl ether results in increased cleavage of and results in increased activity of CASP3 protein]	25639565
C005865	troxerutin	troxerutin inhibits the reaction [[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 mRNA]	28916335
C005865	troxerutin	troxerutin inhibits the reaction [[Fructose co-treated with Dietary Fats] results in increased expression of CASP3 protein]	28916335
D014361	Trypsin Inhibitors	Trypsin Inhibitors results in increased activity of CASP3 protein	19481592
C030820	tryptamine	tryptamine analog inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	22157011
D014414	Tungsten	[Tungsten co-treated with Nickel co-treated with Cobalt] results in decreased activity of CASP3 protein	20934443
D014415	Tunicamycin	Tunicamycin results in increased activity of CASP3 protein	20886113
D014415	Tunicamycin	Bortezomib promotes the reaction [Tunicamycin results in increased activity of CASP3 protein]	16357177
D014415	Tunicamycin	Diclofenac inhibits the reaction [Tunicamycin results in increased activity of CASP3 protein]	16388830
D014415	Tunicamycin	MT2A protein inhibits the reaction [Tunicamycin results in increased cleavage of CASP3 protein]	24680926
D014415	Tunicamycin	Tunicamycin results in increased activity of CASP3 protein	12871656; 16357177; 16388830; 19735704;
D014415	Tunicamycin	Tunicamycin results in increased cleavage of CASP3 protein	17553788
D014415	Tunicamycin	[spautin-1 results in decreased susceptibility to Tunicamycin] which results in decreased expression of CASP3 protein modified form	29793971
D014415	Tunicamycin	TRP53 protein affects the reaction [HR protein affects the reaction [Tunicamycin results in increased activity of CASP3 protein]]	20886113
D014415	Tunicamycin	Tunicamycin results in increased cleavage of CASP3 protein	14747384
D014415	Tunicamycin	Tunicamycin results in increased expression of CASP3 protein modified form	31330229
D014415	Tunicamycin	1-Deoxynojirimycin inhibits the reaction [Tunicamycin results in increased activity of CASP3 protein]	19028522
D014415	Tunicamycin	HR protein inhibits the reaction [Tunicamycin results in increased activity of CASP3 protein]	20886113
D014415	Tunicamycin	Tunicamycin results in increased activity of CASP3 protein	19028522
D014415	Tunicamycin	Tunicamycin results in increased cleavage of CASP3 protein	24680926
C004218	tylophorine	tylophorine results in decreased cleavage of CASP3 protein	28438630
C118632	tyrosyl-valyl-alanyl-aspartal	[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] promotes the reaction [[tyrosyl-valyl-alanyl-aspartal results in decreased activity of CASP1 protein] which results in decreased susceptibility to Resveratrol]	9680369
C118632	tyrosyl-valyl-alanyl-aspartal	[tyrosyl-valyl-alanyl-aspartal results in decreased activity of CASP1 protein] promotes the reaction [[aspartyl-glutamyl-valyl-aspartal results in decreased activity of CASP3 protein] which results in decreased susceptibility to Resveratrol]	9680369
C113580	U 0126	U 0126 inhibits the reaction [Arsenic results in increased activity of CASP3 protein]	21798276
C113580	U 0126	U 0126 inhibits the reaction [Cisplatin results in increased cleavage of and results in increased activity of CASP3 protein]	16013042
C113580	U 0126	nimbolide promotes the reaction [U 0126 results in increased expression of CASP3 protein modified form]	28383207
C113580	U 0126	U 0126 inhibits the reaction [Acetaldehyde results in increased activity of CASP3 protein]	14722101
C113580	U 0126	U 0126 inhibits the reaction [Cadmium results in increased activity of and results in increased cleavage of CASP3 protein]	24824807
C113580	U 0126	U 0126 inhibits the reaction [ellipticine results in increased cleavage of and results in increased activity of CASP3 protein]	21843585
C113580	U 0126	U 0126 inhibits the reaction [Indomethacin results in increased activity of CASP3 protein]	17341418
C113580	U 0126	U 0126 inhibits the reaction [nimbolide results in increased expression of CASP3 protein modified form]	29962003
C113580	U 0126	U 0126 inhibits the reaction [norcantharidin results in increased expression of CASP3 protein modified form]	29193574
C113580	U 0126	U 0126 inhibits the reaction [ochratoxin A results in increased activity of CASP3 protein]	25002221
C113580	U 0126	U 0126 inhibits the reaction [Quercetin results in increased cleavage of CASP3 protein]	14688022
C113580	U 0126	U 0126 inhibits the reaction [[TNF protein co-treated with trovafloxacin] results in increased activity of CASP3 protein]	25748550
C113580	U 0126	U 0126 promotes the reaction [Biological Products results in increased expression of CASP3 mRNA]	22654482
C113580	U 0126	U 0126 promotes the reaction [dihydromyricetin results in increased cleavage of CASP3 protein]	27539140
C113580	U 0126	U 0126 promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	15557793
C113580	U 0126	U 0126 promotes the reaction [Emodin results in increased cleavage of CASP3 protein]	27032576
C113580	U 0126	U 0126 promotes the reaction [nimbolide results in increased expression of CASP3 protein modified form]	28383207
C113580	U 0126	U 0126 results in increased cleavage of CASP3 protein	15557793
C113580	U 0126	U 0126 results in increased expression of CASP3 protein modified form	28383207
C113580	U 0126	[Tretinoin co-treated with U 0126] results in increased cleavage of CASP3 protein	17026715
C113580	U 0126	U 0126 inhibits the reaction [[Nitroprusside results in increased abundance of Nitric Oxide] which results in increased activity of CASP3 protein]	22878015
C113580	U 0126	U 0126 inhibits the reaction [nonylphenol results in increased cleavage of CASP3 protein]	23677851
C113580	U 0126	U 0126 inhibits the reaction [[Oxygen deficiency co-treated with Glucose deficiency] results in increased cleavage of CASP3 protein]	24682241
C113580	U 0126	U 0126 inhibits the reaction [Copper results in increased activity of CASP3 protein]	16672322
C113580	U 0126	U 0126 inhibits the reaction [Calcimycin results in increased activity of CASP3 protein]	16000378
C113580	U 0126	U 0126 inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
C113580	U 0126	U 0126 inhibits the reaction [Atorvastatin results in increased activity of CASP3 protein]	18339080
C113580	U 0126	U 0126 inhibits the reaction [cadmium acetate results in increased cleavage of CASP3 protein]	24577723; 25043952;
C113580	U 0126	U 0126 inhibits the reaction [Cadmium Chloride results in increased cleavage of and results in increased activity of CASP3 protein]	18703135
C113580	U 0126	U 0126 inhibits the reaction [cobaltous chloride results in increased cleavage of and results in increased activity of CASP3 protein]	21998720
C113580	U 0126	U 0126 inhibits the reaction [decamethrin results in increased cleavage of CASP3 protein]	26588882
C113580	U 0126	U 0126 inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	18775851
C113580	U 0126	U 0126 inhibits the reaction [manganese chloride results in increased expression of CASP3 mRNA]	16787641
C113580	U 0126	U 0126 inhibits the reaction [manganese chloride results in increased expression of CASP3 protein]	16787641
C113580	U 0126	U 0126 inhibits the reaction [Manganese results in increased expression of CASP3 mRNA]	16787641
C113580	U 0126	U 0126 inhibits the reaction [Manganese results in increased expression of CASP3 protein]	16787641
C113580	U 0126	U 0126 promotes the reaction [Vitamin K 3 results in increased activity of CASP3 protein]	16310883
C113580	U 0126	U 0126 inhibits the reaction [aristolochic acid I results in increased cleavage of and results in increased activity of CASP3 protein]	21658425
C113580	U 0126	U 0126 inhibits the reaction [echinacoside inhibits the reaction [Rotenone results in increased cleavage of CASP3 protein]]	23189969
C074965	U 74389F	U 74389F inhibits the reaction [Paraquat results in increased cleavage of CASP3 protein]	25947082
D014451	Ubiquinone	Ubiquinone inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	12880480
D014451	Ubiquinone	Ubiquinone inhibits the reaction [linsidomine results in increased expression of CASP3 mRNA]	16291239
C501517	UCF 101	[tempol co-treated with UCF 101 co-treated with acetovanillone] inhibits the reaction [S-Nitrosoglutathione results in increased activity of CASP3 protein]	20153346
C000592878	UMI-77	UMI-77 results in increased cleavage of CASP3 protein	24019208
D014501	Uranium	GHRL protein inhibits the reaction [Uranium results in increased activity of CASP3 protein]	29477364
D014501	Uranium	Uranium results in increased activity of CASP3 protein	29477364
C005460	uranyl acetate	uranyl acetate results in increased expression of CASP3 mRNA	19460415
C005460	uranyl acetate	sodium bisulfide inhibits the reaction [uranyl acetate results in increased expression of CASP3 protein]	26991019
C005460	uranyl acetate	uranyl acetate results in increased activity of CASP3 protein	19096828
C005460	uranyl acetate	uranyl acetate results in increased expression of CASP3 protein	26991019
D014502	Uranyl Nitrate	GHRL protein inhibits the reaction [Uranyl Nitrate results in increased activity of CASP3 protein]	26529667
D014502	Uranyl Nitrate	[MT1 gene mutant form co-treated with MT2 gene mutant form] promotes the reaction [Uranyl Nitrate results in increased activity of CASP3 protein]	26148447
D014502	Uranyl Nitrate	SB 203580 inhibits the reaction [Uranyl Nitrate results in increased activity of CASP3 protein]	26529667
D014502	Uranyl Nitrate	Uranyl Nitrate results in increased activity of CASP3 protein	26148447; 26529667;
D014502	Uranyl Nitrate	Uranyl Nitrate results in increased activity of CASP3 protein	17522072
D014529	Uridine	Uridine inhibits the reaction [tripterine results in increased cleavage of CASP3 protein]	27374097
D014580	Ursodeoxycholic Acid	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
D014580	Ursodeoxycholic Acid	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of and results in increased activity of CASP3 protein]	21362627
D014580	Ursodeoxycholic Acid	FADD mutant form inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
D014580	Ursodeoxycholic Acid	methyl-beta-cyclodextrin inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
D014580	Ursodeoxycholic Acid	[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein	19728331
D014580	Ursodeoxycholic Acid	pifithrin inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
D014580	Ursodeoxycholic Acid	RIPK1 mutant form inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
D014580	Ursodeoxycholic Acid	rottlerin inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
D014580	Ursodeoxycholic Acid	TNFRSF10B mutant form inhibits the reaction [Ursodeoxycholic Acid results in increased cleavage of CASP3 protein]	21362627
D014580	Ursodeoxycholic Acid	TP53 mutant form inhibits the reaction [[Oxaliplatin co-treated with Ursodeoxycholic Acid] results in increased activity of CASP3 protein]	19728331
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid analog inhibits the reaction [TNF protein results in increased activity of CASP3 protein]	21146893
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid inhibits the reaction [Nitroprusside results in increased activity of CASP3 protein]	22178905
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid promotes the reaction [Irinotecan results in increased activity of CASP3 protein]	16432164
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid results in increased cleavage of and results in increased activity of CASP3 protein	21362627
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid analog inhibits the reaction [[Galactosamine co-treated with Lipopolysaccharides] results in increased activity of CASP3 protein]	21146893
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid inhibits the reaction [[Isoniazid co-treated with Rifampin] results in increased activity of CASP3 protein]	21419764
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid inhibits the reaction [Deoxycholic Acid results in increased activity of CASP3 protein]	20137712
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid inhibits the reaction [Rotenone results in increased expression of CASP3 protein]	25502462
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid inhibits the reaction [TGFB1 protein results in increased activity of CASP3 protein]	14514686; 15222754;
D014580	Ursodeoxycholic Acid	Ursodeoxycholic Acid results in decreased activity of CASP3 protein	15970352; 16310035;
C005466	ursolic acid	acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [ursolic acid results in increased cleavage of and results in increased activity of CASP3 protein]	16012738
C005466	ursolic acid	ursolic acid results in increased activity of CASP3 protein	20005942
C005466	ursolic acid	ursolic acid results in increased cleavage of and results in increased activity of CASP3 protein	16012738
C005466	ursolic acid	ursolic acid results in increased activity of CASP3 protein	19329757
C005466	ursolic acid	ursolic acid results in increased expression of CASP3 protein	24051192
C073339	usnic acid	3-methyladenine promotes the reaction [usnic acid results in increased activity of CASP3 protein]	25078063
C073339	usnic acid	4-phenylbutyric acid inhibits the reaction [usnic acid results in increased activity of CASP3 protein]	25870318
C073339	usnic acid	Chloroquine promotes the reaction [usnic acid results in increased activity of CASP3 protein]	25078063
C073339	usnic acid	pyrazolanthrone promotes the reaction [usnic acid results in increased activity of CASP3 protein]	25078063
C073339	usnic acid	usnic acid results in increased activity of CASP3 protein	22285236; 25078063; 25870318;
D014634	Valinomycin	Valinomycin results in increased activity of CASP3 protein	28157593
D014634	Valinomycin	Valinomycin results in increased cleavage of CASP3 protein	18926839
D014635	Valproic Acid	Hydroxyurea promotes the reaction [Valproic Acid results in increased cleavage of CASP3 protein]	17653085
D014635	Valproic Acid	Valproic Acid affects the expression of CASP3 mRNA	25979313
D014635	Valproic Acid	[Valproic Acid co-treated with Decitabine co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	21771726
D014635	Valproic Acid	Valproic Acid inhibits the reaction [Staurosporine results in increased activity of CASP3 protein]	19101580
D014635	Valproic Acid	Valproic Acid promotes the reaction [Cisplatin results in increased activity of CASP3 protein]	21507255
D014635	Valproic Acid	Valproic Acid promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	17088416
D014635	Valproic Acid	Valproic Acid results in decreased methylation of CASP3 gene	29154799
D014635	Valproic Acid	Valproic Acid results in increased cleavage of and results in increased activity of CASP3 protein	22814014
D014635	Valproic Acid	Valproic Acid results in increased cleavage of CASP3 protein	17653085
D014635	Valproic Acid	4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione promotes the reaction [Valproic Acid inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]]	25453207
D014635	Valproic Acid	Valproic Acid affects the expression of CASP3 mRNA	17292431; 17963808;
D014635	Valproic Acid	Valproic Acid inhibits the reaction [Kainic Acid results in increased cleavage of CASP3 protein]	25453207
D014635	Valproic Acid	Valproic Acid results in increased cleavage of and results in increased activity of CASP3 protein	26251326
D014635	Valproic Acid	Valproic Acid results in increased cleavage of CASP3 protein	19136453; 24913804; 27381264; 29845424;
D014635	Valproic Acid	Valproic Acid results in increased expression of CASP3 mRNA	19136453
D014635	Valproic Acid	Valproic Acid results in increased expression of CASP3 protein modified form	21708246
D014635	Valproic Acid	caffeic acid inhibits the reaction [Valproic Acid results in increased expression of CASP3 protein]	29968957
D014635	Valproic Acid	Valproic Acid results in increased expression of CASP3 protein	29968957
C509183	Val-Pro-Met-Leu-Lys	Val-Pro-Met-Leu-Lys inhibits the reaction [triptolide results in increased cleavage of CASP3 protein]	30009776
D000068756	Valsartan	Valsartan inhibits the reaction [AGT protein inhibits the reaction [Glycochenodeoxycholic Acid results in increased activity of CASP3 protein]]	23300732
D014638	Vanadates	Vanadates inhibits the reaction [Deferoxamine results in increased activity of CASP3 protein]	16374551
D017968	Vanadium Compounds	Vanadium Compounds results in increased activity of CASP3 protein	26391003
C066075	vanadium pentoxide	PRKCD mutant form inhibits the reaction [vanadium pentoxide results in increased activity of CASP3 protein]	19646462
C066075	vanadium pentoxide	vanadium pentoxide results in increased activity of CASP3 protein	19646462
D014640	Vancomycin	JBP 485 inhibits the reaction [Vancomycin results in increased cleavage of CASP3 protein]	29964132
D014640	Vancomycin	Vancomycin results in increased cleavage of CASP3 protein	29964132
D014641	Vanillic Acid	Vanillic Acid inhibits the reaction [Isoproterenol results in increased expression of CASP3 mRNA]	25794854
C459559	vaticanol C	vaticanol C results in increased activity of CASP3 protein	12844481
D001335	Vehicle Emissions	Biofuels inhibits the reaction [Vehicle Emissions results in decreased expression of CASP3 mRNA]	30738890
D001335	Vehicle Emissions	Vehicle Emissions results in decreased expression of CASP3 mRNA	30738890
D001335	Vehicle Emissions	Vehicle Emissions results in increased activity of CASP3 protein	17680010; 28189646;
D001335	Vehicle Emissions	Vehicle Emissions results in increased expression of CASP3 mRNA	26856867
D001335	Vehicle Emissions	pifithrin inhibits the reaction [Vehicle Emissions results in increased activity of CASP3 protein]	18940243
D001335	Vehicle Emissions	Vehicle Emissions results in increased activity of CASP3 protein	18940243
D001335	Vehicle Emissions	Vehicle Emissions results in increased cleavage of and results in increased activity of CASP3 protein	17240030
D001335	Vehicle Emissions	Vehicle Emissions results in increased expression of CASP3 mRNA	24216475
D000077484	Vemurafenib	AZD 6244 inhibits the reaction [[KRAS protein mutant form affects the susceptibility to Vemurafenib] promotes the reaction [TNFRSF10B protein results in increased cleavage of CASP3 protein]]	27222248
D000077484	Vemurafenib	[KRAS protein mutant form affects the susceptibility to Vemurafenib] promotes the reaction [TNFRSF10B protein results in increased cleavage of CASP3 protein]	27222248
D000077484	Vemurafenib	RAF1 protein affects the reaction [[KRAS protein mutant form affects the susceptibility to Vemurafenib] promotes the reaction [TNFRSF10B protein results in increased cleavage of CASP3 protein]]	27222248
D000069470	Venlafaxine Hydrochloride	Venlafaxine Hydrochloride inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	29852128
C550733	VER 155008	[VER 155008 co-treated with Arsenic Trioxide] results in increased activity of CASP3 protein	27592447
D014700	Verapamil	[Doxorubicin co-treated with Verapamil] results in increased activity of CASP3 protein	18358092
D014700	Verapamil	[Verapamil co-treated with gambogic acid] results in increased cleavage of and results in increased activity of CASP3 protein	24373880
D014700	Verapamil	[Verapamil co-treated with Ruthenium Red co-treated with 2-aminoethoxydiphenyl borate] inhibits the reaction [Trichlorfon results in increased cleavage of and results in increased activity of CASP3 protein]	19631781
D014700	Verapamil	Verapamil inhibits the reaction [Pilocarpine results in increased activity of CASP3 protein]	19927300
D014700	Verapamil	[Verapamil results in decreased expression of ABCB1] promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	15861398
D014700	Verapamil	Verapamil inhibits the reaction [Simvastatin results in increased activity of CASP3 protein]	14527821
D014700	Verapamil	Verapamil results in increased expression of CASP3 mRNA	19815060
C570018	vicanicin	vicanicin results in increased activity of CASP3 protein	22063921
D014747	Vinblastine	CD40LG protein inhibits the reaction [Vinblastine promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]]	16545138
D014747	Vinblastine	Vinblastine promotes the reaction [CASP3 protein results in increased cleavage of PARP1 protein]	16545138
D014747	Vinblastine	Vinblastine results in increased cleavage of CASP3 protein	20624997
D014750	Vincristine	Sumatriptan inhibits the reaction [Vincristine results in increased expression of CASP3 mRNA]	29958920
D014750	Vincristine	Sumatriptan inhibits the reaction [Vincristine results in increased expression of CASP3 protein]	29958920
D014750	Vincristine	Vincristine results in increased cleavage of CASP3 protein	20624997
D014750	Vincristine	Vincristine results in increased expression of CASP3 mRNA	29958920
D014750	Vincristine	Vincristine results in increased expression of CASP3 protein	29958920
D000077235	Vinorelbine	[pifithrin co-treated with Vinorelbine] results in increased cleavage of and results in increased activity of CASP3 protein	18516295
D000077235	Vinorelbine	[Cisplatin co-treated with Vinorelbine] results in increased activity of CASP3 protein	21544650
C017963	vinyl carbamate	vinyl carbamate results in increased expression of CASP3 mRNA	17163412; 17849452;
C063155	violacein	violacein results in increased activity of CASP3 protein	20416285
D014757	Viper Venoms	Viper Venoms results in increased cleavage of CASP3 protein	25417048
D014801	Vitamin A	alpha-Tocopherol inhibits the reaction [Vitamin A results in increased activity of CASP3 protein]	17618090
D014801	Vitamin A	Vitamin A results in decreased activity of CASP3 protein	16531423
D014801	Vitamin A	Vitamin A results in increased activity of CASP3 protein	17618090
D014801	Vitamin A	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Vitamin A results in increased activity of CASP3 protein]	17942326
D014801	Vitamin A	Vitamin A results in increased activity of CASP3 protein	17942326
D014807	Vitamin D	Vitamin D inhibits the reaction [Particulate Matter results in increased cleavage of CASP3 protein]	30698894
D014807	Vitamin D	Vitamin D inhibits the reaction [Silicon Dioxide results in increased cleavage of CASP3 protein]	30698894
D014810	Vitamin E	Vitamin E inhibits the reaction [cinnamic aldehyde results in increased activity of CASP3 protein]	15566391
D014810	Vitamin E	Vitamin E inhibits the reaction [Curcumin results in decreased expression of CASP3 protein]	30935902
D014810	Vitamin E	Vitamin E inhibits the reaction [osimertinib results in increased expression of CASP3 protein modified form]	28237877
D014810	Vitamin E	Vitamin E inhibits the reaction [phenethyl isothiocyanate results in increased activity of CASP3 protein]	16054126
D014810	Vitamin E	Vitamin E inhibits the reaction [titanium dioxide results in increased activity of CASP3 protein]	30626778
D014810	Vitamin E	[Vitamin E co-treated with Ascorbic Acid] inhibits the reaction [Dichlorvos results in increased activity of CASP3 protein]	16973328
D014810	Vitamin E	[Vitamin E co-treated with Selenium] inhibits the reaction [Malathion results in increased expression of CASP3 mRNA]	21628957
D014810	Vitamin E	Vitamin E inhibits the reaction [APP protein results in increased activity of CASP3]	12117551
D014810	Vitamin E	Vitamin E inhibits the reaction [Diazinon results in increased activity of CASP3 protein]	23523949
D014810	Vitamin E	Vitamin E inhibits the reaction [Diazinon results in increased cleavage of CASP3 protein]	27353299
D014810	Vitamin E	Vitamin E inhibits the reaction [Diazinon results in increased expression of CASP3 protein modified form]	23523949
D014810	Vitamin E	Vitamin E inhibits the reaction [Nanotubes, Carbon results in increased activity of CASP3 protein]	22020378
D014810	Vitamin E	Vitamin E inhibits the reaction [[sodium bisulfite co-treated with sodium sulfite] results in increased cleavage of CASP3 protein]	21873648
D010837	Vitamin K 1	[Sorafenib co-treated with Vitamin K 1] results in increased cleavage of CASP3 protein	20301194
D010837	Vitamin K 1	[Warfarin co-treated with Vitamin K 1] results in increased cleavage of CASP3 protein	23990204
D024482	Vitamin K 2	Acetylcysteine inhibits the reaction [[Vitamin K 2 co-treated with Arsenic Trioxide] results in increased expression of CASP3]	24273890
D024482	Vitamin K 2	[Vitamin K 2 co-treated with Arsenic Trioxide] results in increased expression of CASP3	24273890
D024482	Vitamin K 2	Vitamin K 2 results in increased cleavage of CASP3 protein	29432837
D024483	Vitamin K 3	Acetylcysteine inhibits the reaction [[sodium arsenite co-treated with Vitamin K 3] results in increased activity of CASP3 protein]	19082730
D024483	Vitamin K 3	[sodium arsenite co-treated with Vitamin K 3] results in increased activity of CASP3 protein	19082730
D024483	Vitamin K 3	Vitamin K 3 analog inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]	29141199
D024483	Vitamin K 3	Vitamin K 3 analog promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]	29141199
D024483	Vitamin K 3	Vitamin K 3 results in increased activity of CASP3 protein	12965111
D024483	Vitamin K 3	Vitamin K 3 results in increased expression of CASP3 protein modified form	20829426
D024483	Vitamin K 3	Buthionine Sulfoximine promotes the reaction [Vitamin K 3 results in increased activity of CASP3 protein]	16310883
D024483	Vitamin K 3	pyrazolanthrone inhibits the reaction [Vitamin K 3 results in increased cleavage of CASP3 protein]	16310883
D024483	Vitamin K 3	U 0126 promotes the reaction [Vitamin K 3 results in increased activity of CASP3 protein]	16310883
D024483	Vitamin K 3	Vitamin K 3 results in increased activity of CASP3 protein	16310883; 23300732;
D024483	Vitamin K 3	Vitamin K 3 results in increased cleavage of CASP3 protein	16310883
C032731	vitexin	vitexin inhibits the reaction [APP protein modified form results in increased activity of CASP3 protein]	29545167
D000077337	Vorinostat	BCL2 protein inhibits the reaction [Vorinostat results in increased activity of CASP3 protein]	21527555
D000077337	Vorinostat	[Bortezomib co-treated with Vorinostat] results in increased activity of CASP3 protein	18005386; 18641367;
D000077337	Vorinostat	[Bortezomib co-treated with Vorinostat] results in increased cleavage of and results in increased activity of CASP3 protein	12893773
D000077337	Vorinostat	Bortezomib promotes the reaction [Vorinostat results in increased activity of CASP3 protein]	15173093
D000077337	Vorinostat	[caffeic acid results in decreased activity of ALOX15 protein] inhibits the reaction [Vorinostat results in increased activity of CASP3 protein]	15574791
D000077337	Vorinostat	EP300 protein affects the reaction [Quercetin promotes the reaction [Vorinostat results in increased activity of CASP3 protein]]	30958996
D000077337	Vorinostat	EP300 protein affects the reaction [Vorinostat results in increased activity of CASP3 protein]	30958996
D000077337	Vorinostat	[(+)-JQ1 compound co-treated with Vorinostat] results in increased cleavage of CASP3 protein	26390243
D000077337	Vorinostat	[navitoclax co-treated with Vorinostat] results in increased activity of CASP3 protein	21652541
D000077337	Vorinostat	[perifosine co-treated with Vorinostat] results in increased activity of CASP3 protein	15781658
D000077337	Vorinostat	Quercetin promotes the reaction [Vorinostat results in increased activity of CASP3 protein]	30958996
D000077337	Vorinostat	[Resveratrol co-treated with Vorinostat] results in increased cleavage of CASP3 protein	22923501
D000077337	Vorinostat	[Sorafenib co-treated with Vorinostat] results in increased cleavage of CASP3 protein	18787411
D000077337	Vorinostat	TNFSF10 protein promotes the reaction [Vorinostat results in increased cleavage of and results in increased activity of CASP3 protein]	17410615
D000077337	Vorinostat	[Vorinostat co-treated with Bortezomib] results in increased activity of CASP3 protein	15514602; 21472287;
D000077337	Vorinostat	[Vorinostat co-treated with Bortezomib] results in increased cleavage of CASP3 protein	17351739
D000077337	Vorinostat	[Vorinostat co-treated with gemcitabine] results in increased activity of CASP3 protein	16153448
D000077337	Vorinostat	[Vorinostat co-treated with TNFSF10 protein] results in increased activity of CASP3 protein	19509267
D000077337	Vorinostat	[Vorinostat co-treated with TNFSF10 protein] results in increased cleavage of and results in increased activity of CASP3 protein	19643600
D000077337	Vorinostat	[Vorinostat co-treated with Zoledronic Acid] results in increased activity of CASP3 protein	18025282
D000077337	Vorinostat	Vorinostat inhibits the reaction [BCL2 protein inhibits the reaction [Resveratrol results in increased cleavage of and results in increased activity of CASP3 protein]]	19631782
D000077337	Vorinostat	Vorinostat promotes the reaction [Doxorubicin results in increased cleavage of CASP3 protein]	20957741
D000077337	Vorinostat	Vorinostat promotes the reaction [Zoledronic Acid results in increased activity of CASP3 protein]	18025282
D000077337	Vorinostat	Vorinostat results in increased activity of CASP3 protein	10597302; 15173093; 15574791; 17218635; 17881280; 18025281; 19509267; 20145270; 21527555; 21652541; 30958996;
D000077337	Vorinostat	[Vorinostat results in increased activity of CASP3 protein] which results in increased abundance of Reactive Oxygen Species	21652541
D000077337	Vorinostat	Vorinostat results in increased cleavage of and results in increased activity of CASP3 protein	11979447; 17410615; 19631782;
D000077337	Vorinostat	Vorinostat results in increased cleavage of CASP3 protein	15897598; 17351739; 27163855;
D000077337	Vorinostat	[Vorinostat co-treated with MYC protein] results in increased activity of CASP3 protein	17331788
C485113	vosaroxin	vosaroxin results in increased activity of CASP3 protein	29800573
C585120	VS-5584	Arsenic Trioxide promotes the reaction [VS-5584 results in increased cleavage of CASP3 protein]	29574283
C585120	VS-5584	VS-5584 results in increased cleavage of CASP3 protein	29574283
C017967	W 7	W 7 inhibits the reaction [bisphenol A results in increased cleavage of CASP3 protein]	24905940
C017967	W 7	W 7 inhibits the reaction [bisphenol A results in increased expression of and results in increased cleavage of CASP3 protein]	26096086
C017967	W 7	W 7 inhibits the reaction [Cadmium results in increased activity of CASP3 protein]	24144892
C017967	W 7	W 7 inhibits the reaction [Methamphetamine results in increased cleavage of CASP3 protein]	26923100
C568854	waixenicin A	waixenicin A inhibits the reaction [Glucose results in increased cleavage of CASP3 protein]	30076216
D014859	Warfarin	Warfarin results in increased expression of CASP3 protein modified form	26206560
D014859	Warfarin	[Warfarin co-treated with Vitamin K 1] results in increased cleavage of CASP3 protein	23990204
D014859	Warfarin	Warfarin results in decreased expression of CASP3 mRNA	20493250
D014859	Warfarin	Warfarin results in increased expression of CASP3 mRNA	19815060
D014867	Water	Gum Arabic inhibits the reaction [[Water deficiency co-treated with Diclofenac] results in increased expression of CASP3 protein]	31042592
D014867	Water	[Water deficiency co-treated with Diclofenac] results in increased expression of CASP3 protein	31042592
D014874	Water Pollutants, Chemical	Water Pollutants, Chemical results in increased activity of CASP3 protein	24394944
D014874	Water Pollutants, Chemical	Water Pollutants, Chemical results in increased activity of CASP3 protein	18172893
D014874	Water Pollutants, Chemical	Water Pollutants, Chemical results in increased expression of CASP3 mRNA	25198161
C051122	wedelolactone	wedelolactone inhibits the reaction [Methamphetamine results in increased cleavage of and results in increased activity of CASP3 protein]	25631491
C528002	Weichang'an	Weichang'an results in increased cleavage of CASP3 protein	17498489; 18161298; 18205257;
C070417	Win 55212-2	Win 55212-2 results in decreased cleavage of CASP3 protein	30776504
C085514	wogonin	[wogonin co-treated with Fluorouracil] results in increased activity of CASP3 protein	20570612
C085514	wogonin	wogonin results in increased activity of CASP3 protein	20570612
C085514	wogonin	wogonin inhibits the reaction [Bisphenol A-Glycidyl Methacrylate results in increased activity of CASP3 protein]	26756871
C085514	wogonin	wogonin inhibits the reaction [Cisplatin results in increased expression of and results in increased activity of CASP3 protein]	31103702
D000077191	Wortmannin	ABT-737 promotes the reaction [Wortmannin promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]]	20104024
D000077191	Wortmannin	Wortmannin inhibits the reaction [Hydrogen Peroxide inhibits the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]]	15142122
D000077191	Wortmannin	Wortmannin inhibits the reaction [Liraglutide inhibits the reaction [Hydrogen Peroxide results in increased cleavage of CASP3 protein]]	31173752
D000077191	Wortmannin	Wortmannin promotes the reaction [Celecoxib results in increased cleavage of CASP3 protein]	20104024
D000077191	Wortmannin	Wortmannin promotes the reaction [Doxorubicin results in increased cleavage of and results in increased activity of CASP3 protein]	17935137
D000077191	Wortmannin	Wortmannin promotes the reaction [Etoposide results in increased cleavage of and results in increased activity of CASP3 protein]	17935137
D000077191	Wortmannin	Wortmannin promotes the reaction [ochratoxin A results in increased activity of CASP3 protein]	25002221
D000077191	Wortmannin	[Rotenone co-treated with Wortmannin] results in increased cleavage of CASP3 protein	26847702
D000077191	Wortmannin	Thimerosal promotes the reaction [Wortmannin results in increased cleavage of CASP3 protein]	23145070
D000077191	Wortmannin	Wortmannin promotes the reaction [Resveratrol results in increased cleavage of CASP3 protein]	25603053
D000077191	Wortmannin	Wortmannin promotes the reaction [Thimerosal results in increased cleavage of CASP3 protein]	23145070
D000077191	Wortmannin	Wortmannin promotes the reaction [Wortmannin results in increased cleavage of CASP3 protein]	22137261
D000077191	Wortmannin	Wortmannin results in increased cleavage of CASP3 protein	15695173; 22137261; 25603053;
D000077191	Wortmannin	Wortmannin inhibits the reaction [4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	18164246
D000077191	Wortmannin	Wortmannin inhibits the reaction [2,4,5,2',4',5'-hexachlorobiphenyl results in decreased activity of CASP3 protein]	24726520
D000077191	Wortmannin	Wortmannin results in decreased activity of CASP3 protein	21256120
D000077191	Wortmannin	Wortmannin inhibits the reaction [IL1B protein results in increased cleavage of CASP3 protein]	22936809
C519885	WP1066	WP1066 results in increased activity of CASP3 protein	18245540
C519885	WP1066	WP1066 results in increased cleavage of and results in increased activity of CASP3 protein	18056455
C104426	WP 631	WP 631 results in increased activity of CASP3 protein	24287111
C451735	WP 744	WP 744 results in increased cleavage of CASP3 protein	15555623
C000626624	WY-135	WY-135 results in decreased expression of CASP3 protein	29458018
D019820	Xanthine	[Xanthine co-treated with XDH protein] results in increased activity of CASP3 protein	19268487
D019820	Xanthine	3,4-dihydroxyphenylethanol inhibits the reaction [[Xanthine co-treated with XDH protein] results in increased cleavage of CASP3 protein]	26374991
D019820	Xanthine	Epinephrine promotes the reaction [[Xanthine co-treated with XDH protein] results in increased activity of CASP3 protein]	19135123
D019820	Xanthine	Quercetin inhibits the reaction [[Xanthine co-treated with XDH protein] results in increased cleavage of CASP3 protein]	26374991
D019820	Xanthine	[Xanthine co-treated with XDH protein] results in increased activity of CASP3 protein	19135123
D019820	Xanthine	[Xanthine co-treated with XDH protein] results in increased cleavage of CASP3 protein	26374991
D019820	Xanthine	Nitric Oxide affects the reaction [[XDH protein co-treated with Xanthine] results in increased activity of and results in increased cleavage of CASP3 protein]	10073970
D019820	Xanthine	SOD1 protein affects the reaction [[XDH protein co-treated with Xanthine] results in increased activity of and results in increased cleavage of CASP3 protein]	10073970
D019820	Xanthine	[XDH protein co-treated with Xanthine] results in increased activity of and results in increased cleavage of CASP3 protein	10073970
C068244	xanthoangelol	xanthoangelol results in increased activity of CASP3 protein	27908776
C068244	xanthoangelol	xanthoangelol results in increased cleavage of and results in increased activity of CASP3 protein	16079483
C104536	xanthohumol	xanthohumol results in decreased activity of CASP3 protein	27317025
C104536	xanthohumol	xanthohumol results in increased activity of CASP3 protein	26297991; 30240731;
C104536	xanthohumol	xanthohumol results in increased cleavage of and results in increased activity of CASP3 protein	15995977
C488234	XCT790	manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [[XCT790 results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein]	19464277
C488234	XCT790	[XCT790 results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein	19464277
C585106	XLR-11	[Cannabinoid Receptor Antagonists results in decreased activity of CNR2 protein] inhibits the reaction [XLR-11 results in increased activity of CASP3 protein]	29410032
C585106	XLR-11	Rimonabant inhibits the reaction [XLR-11 results in increased activity of CASP3 protein]	29410032
C585106	XLR-11	XLR-11 results in increased activity of CASP3 protein	29410032
C108830	Y 27632	Y 27632 inhibits the reaction [TNF protein results in increased cleavage of CASP3 protein]	28743511
C108830	Y 27632	Y 27632 inhibits the reaction [1-Butanol results in increased activity of and results in increased cleavage of CASP3 protein]	22564901
C108830	Y 27632	Y 27632 inhibits the reaction [[Oxygen co-treated with [Oxygen deficiency co-treated with Glucose deficiency]] results in increased cleavage of CASP3 protein]	25305180
C487701	zAsp(Ome)-Arg-His-Asp(Ome)-fluoromethyl ketone	zAsp(Ome)-Arg-His-Asp(Ome)-fluoromethyl ketone inhibits the reaction [[Butylated Hydroxytoluene co-treated with Oxygen] results in increased cleavage of CASP3 protein]	16272459
C029659	zearalenol	Quercetin inhibits the reaction [zearalenol results in increased activity of CASP3 protein]	26584763
C029659	zearalenol	zearalenol results in increased activity of CASP3 protein	26584763
D015025	Zearalenone	benzyloxycarbonyl-valyl-alanyl-aspartyl-fluoromethane analog inhibits the reaction [Zearalenone results in increased expression of CASP3 protein]	28011299
D015025	Zearalenone	Zearalenone results in increased expression of CASP3 protein	28011299
D015025	Zearalenone	[Zearalenone co-treated with Aflatoxin B1] promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	30668976
D015025	Zearalenone	Zearalenone results in increased activity of CASP3 protein	19541794; 19705349;
D015025	Zearalenone	Zearalenone results in increased expression of CASP3 mRNA	30668976
D015025	Zearalenone	HERPUD1 protein promotes the reaction [Zearalenone results in increased expression of CASP3 protein modified form]	30394307
D015025	Zearalenone	Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	25445755
D015025	Zearalenone	Zearalenone results in increased expression of CASP3 protein modified form	28089945; 30394307;
D015025	Zearalenone	benzyloxycarbonyl-isoleucyl-glutamyl-threonyl-aspartic acid fluoromethyl ketone inhibits the reaction [Zearalenone results in increased cleavage of CASP3 protein]	30600648
D015025	Zearalenone	Zearalenone results in increased activity of CASP3 protein	24530352
D015025	Zearalenone	Zearalenone results in increased cleavage of CASP3 protein	30600648
D015025	Zearalenone	[Acetylcysteine co-treated with Zearalenone] results in decreased expression of CASP3 protein	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]]	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]]	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 protein]	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]]	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]]	29109043
D015025	Zearalenone	Acetylcysteine inhibits the reaction [Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]]	29109043
D015025	Zearalenone	deoxynivalenol promotes the reaction [[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA]	29109043
D015025	Zearalenone	deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]	29109043
D015025	Zearalenone	[fumonisin B1 co-treated with Zearalenone] promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
D015025	Zearalenone	[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 mRNA	29109043
D015025	Zearalenone	[fumonisin B1 co-treated with Zearalenone] results in increased expression of CASP3 protein	29109043
D015025	Zearalenone	fumonisin B1 promotes the reaction [deoxynivalenol promotes the reaction [Zearalenone results in increased expression of CASP3 mRNA]]	29109043
D015025	Zearalenone	fumonisin B1 promotes the reaction [Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]]	29109043
D015025	Zearalenone	Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 mRNA]	29109043
D015025	Zearalenone	Zearalenone promotes the reaction [deoxynivalenol results in increased expression of CASP3 protein]	29109043
D015025	Zearalenone	Zearalenone promotes the reaction [[fumonisin B1 co-treated with deoxynivalenol] results in increased expression of CASP3 mRNA]	29109043
D015025	Zearalenone	Zearalenone results in increased expression of CASP3 mRNA	29109043
C403304	zerumbone	zerumbone analog results in increased activity of and results in increased cleavage of CASP3 protein	28987329
D015215	Zidovudine	[Acrolein co-treated with Zidovudine] results in increased cleavage of CASP3 protein	27238871
D015215	Zidovudine	Drugs, Chinese Herbal promotes the reaction [Zidovudine results in increased expression of CASP3 mRNA]	17696246
D015215	Zidovudine	Zidovudine results in increased activity of CASP3 protein	16601281
D015215	Zidovudine	Zidovudine results in increased cleavage of CASP3 protein	27238871
D015215	Zidovudine	Zidovudine results in increased expression of CASP3 mRNA	17696246
D015215	Zidovudine	2,6-dimethyl-3,5-bis(2'-propoxyethoxycarbonyl)-4-(2''-difluoromethoxyphenyl)-1,4-dihydropyridine inhibits the reaction [Zidovudine results in increased expression of CASP3 protein]	18801031
D015215	Zidovudine	glutapyrone inhibits the reaction [Zidovudine results in increased expression of CASP3 protein]	18801031
D015215	Zidovudine	tauropyrone inhibits the reaction [Zidovudine results in increased expression of CASP3 protein]	18801031
D015215	Zidovudine	Zidovudine results in increased activity of CASP3 protein	17943461
D015215	Zidovudine	Zidovudine results in increased expression of CASP3 protein	18801031
C063449	zileuton	Palmitic Acid promotes the reaction [zileuton results in increased activity of CASP3 protein]	22700542
C063449	zileuton	zileuton results in increased activity of CASP3 protein	22700542
D015032	Zinc	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Zinc results in increased cleavage of CASP3 protein]	16799065
D015032	Zinc	[Dopamine co-treated with Zinc deficiency] results in increased activity of CASP3 protein	23377617
D015032	Zinc	Metipranolol inhibits the reaction [Zinc results in increased cleavage of CASP3 protein]	16799065
D015032	Zinc	SM-1 compound inhibits the reaction [Zinc results in decreased activity of CASP3 protein]	27488460
D015032	Zinc	Zinc affects the reaction [chromium hexavalent ion results in increased activity of CASP3 protein]	15966574
D015032	Zinc	Zinc inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine inhibits the reaction [SLC39A6 mutant form inhibits the reaction [trichostatin A results in increased cleavage of CASP3 protein]]]	19887557
D015032	Zinc	Zinc results in decreased activity of CASP3 protein	12107073; 27488460;
D015032	Zinc	Zinc results in increased cleavage of and results in increased activity of CASP3 protein	16472982
D015032	Zinc	Zinc results in increased cleavage of CASP3 protein	16799065
D015032	Zinc	[Rutin binds to Zinc] which results in increased expression of CASP3 mRNA	26091902
D015032	Zinc	Zinc deficiency results in increased expression of and results in increased cleavage of CASP3 protein	20101602
D015032	Zinc	Zinc inhibits the reaction [Ethanol results in increased expression of CASP3 mRNA]	27033740
D015032	Zinc	Zinc results in decreased expression of CASP3 mRNA	27033740
D015032	Zinc	Zinc inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine results in increased activity of CASP3 protein]	21239534
D015032	Zinc	[Calcium co-treated with Zinc] affects the reaction [monoisoamyl-2,3-dimercaptosuccinate affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]]	24184500
D015032	Zinc	[Calcium co-treated with Zinc] affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
D015032	Zinc	[Taurine binds to Zinc] inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D015032	Zinc	Zinc affects the reaction [sodium arsenite results in increased expression of CASP3 mRNA]	24184500
D015032	Zinc	Zinc results in decreased activity of CASP3 protein	22523284
D019345	Zinc Acetate	[Zinc Acetate co-treated with motexafin gadolinium] results in decreased expression of CASP3 mRNA	16357179
D019345	Zinc Acetate	Zinc Acetate results in decreased expression of CASP3 mRNA	16357179
D019345	Zinc Acetate	[Taurine co-treated with Zinc Acetate] inhibits the reaction [Doxorubicin results in increased expression of CASP3 protein]	26335259
D019345	Zinc Acetate	Zinc Acetate inhibits the reaction [Linoleic Acid results in increased activity of CASP3 protein]	10617950
D019345	Zinc Acetate	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid promotes the reaction [TNF protein results in increased activity of CASP3 protein]]]	10617950
D019345	Zinc Acetate	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]	10617950
D019345	Zinc Acetate	Zinc Acetate inhibits the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein results in increased activity of CASP3 protein]]	10617950
D019345	Zinc Acetate	Zinc Acetate promotes the reaction [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine promotes the reaction [TNF protein promotes the reaction [Linoleic Acid results in increased activity of CASP3 protein]]]	10617950
C016837	zinc chloride	[Citric Acid co-treated with zinc chloride] results in increased activity of CASP3 protein	16624386
C016837	zinc chloride	zinc chloride results in increased activity of CASP3 protein	16339863
C016837	zinc chloride	[zinc chloride co-treated with pyrithione] inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased activity of CASP3 protein]	21239534
D017967	Zinc Compounds	Zinc Compounds results in increased expression of CASP3 mRNA	24035972
D017967	Zinc Compounds	Zinc Compounds results in increased expression of CASP3 protein	24035972
D015034	Zinc Oxide	Zinc Oxide affects the expression of CASP3 protein	28648595
D015034	Zinc Oxide	benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Zinc Oxide analog results in increased activity of CASP3 protein]	27544635
D015034	Zinc Oxide	Cyclosporine inhibits the reaction [Zinc Oxide analog results in increased activity of CASP3 protein]	27544635
D015034	Zinc Oxide	Thioctic Acid inhibits the reaction [Zinc Oxide analog results in increased activity of CASP3 protein]	27544635
D015034	Zinc Oxide	Zinc Oxide analog results in increased activity of CASP3 protein	27544635
D015034	Zinc Oxide	Zinc Oxide results in increased activity of CASP3 protein	22112499
D015034	Zinc Oxide	Acetylcysteine inhibits the reaction [Zinc Oxide analog results in increased cleavage of CASP3 protein]	24614525
D015034	Zinc Oxide	MAP1LC3B mutant form inhibits the reaction [Zinc Oxide analog results in increased cleavage of CASP3 protein]	24614525
D015034	Zinc Oxide	Zinc Oxide affects the splicing of and results in increased expression of CASP3 mRNA	30500950
D015034	Zinc Oxide	Zinc Oxide analog results in increased activity of CASP3 protein	25680694
D015034	Zinc Oxide	Zinc Oxide analog results in increased cleavage of CASP3 protein	24614525
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [Cisplatin results in increased cleavage of CASP3 protein]	27815112
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [Curcumin inhibits the reaction [quinocetone results in increased activity of CASP3 protein]]	27375190
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [FASLG protein results in increased activity of CASP3 protein]	16051694
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [FASLG protein results in increased cleavage of CASP3 protein]	16051694
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [rutecarpine inhibits the reaction [tert-Butylhydroperoxide results in increased activity of CASP3 protein]]	28025122
C017803	zinc protoporphyrin	zinc protoporphyrin promotes the reaction [Arsenic Trioxide results in increased activity of CASP3 protein]	25003661
C017803	zinc protoporphyrin	zinc protoporphyrin promotes the reaction [quinocetone results in increased activity of CASP3 protein]	27375190
C017803	zinc protoporphyrin	zinc protoporphyrin results in decreased activity of CASP3 protein	16051694
C017803	zinc protoporphyrin	zinc protoporphyrin results in increased cleavage of CASP3 protein	27815112
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [[Glucose deficiency co-treated with Simvastatin] results in increased cleavage of CASP3 protein]	17928392
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [Resveratrol inhibits the reaction [Doxorubicin results in increased activity of CASP3 protein]]	22763982
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [sesamol inhibits the reaction [Lipopolysaccharides results in increased activity of CASP3 protein]]	30261164
C017803	zinc protoporphyrin	zinc protoporphyrin promotes the reaction [T-2 Toxin results in increased activity of CASP3 protein]	29432840
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [cobaltiprotoporphyrin results in decreased expression of CASP3 protein]	20357190
C017803	zinc protoporphyrin	zinc protoporphyrin inhibits the reaction [[IFNG protein co-treated with IL1B protein] results in increased cleavage of CASP3 protein]	21295052
C017803	zinc protoporphyrin	zinc protoporphyrin promotes the reaction [[[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] co-treated with Ethanol] results in increased cleavage of CASP3 protein]	26747958
C017803	zinc protoporphyrin	zinc protoporphyrin promotes the reaction [[[Oxygen deficiency co-treated with Blood Glucose deficiency] co-treated with [Oxygen co-treated with Blood Glucose]] results in increased cleavage of CASP3 protein]	26747958
D019287	Zinc Sulfate	6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Zinc Sulfate results in increased cleavage of CASP3 protein]	16799065
D019287	Zinc Sulfate	gluconic acid promotes the reaction [Zinc Sulfate inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]]	27017951
D019287	Zinc Sulfate	Metipranolol inhibits the reaction [Zinc Sulfate results in increased cleavage of CASP3 protein]	16799065
D019287	Zinc Sulfate	Zinc Sulfate inhibits the reaction [Aflatoxin B1 results in increased expression of CASP3 mRNA]	27017951
D019287	Zinc Sulfate	Zinc Sulfate inhibits the reaction [Hydrogen Peroxide results in increased activity of CASP3 protein]	20096349
D019287	Zinc Sulfate	Zinc Sulfate results in increased cleavage of CASP3 protein	16799065
D019287	Zinc Sulfate	Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]	18636177
D019287	Zinc Sulfate	[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]	18636177
D019287	Zinc Sulfate	[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]	18636177
D019287	Zinc Sulfate	Cycloheximide inhibits the reaction [Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Cycloheximide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Cycloheximide inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Cycloheximide inhibits the reaction [Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]]	17295206
D019287	Zinc Sulfate	Cycloheximide inhibits the reaction [Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	17295206
D019287	Zinc Sulfate	Cycloheximide inhibits the reaction [Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Dichlororibofuranosylbenzimidazole inhibits the reaction [Cryptoxanthins promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Dichlororibofuranosylbenzimidazole inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Cryptoxanthins] promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Dichlororibofuranosylbenzimidazole inhibits the reaction [[CSF1 protein co-treated with TNFSF11 protein co-treated with Zinc Sulfate] promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Dichlororibofuranosylbenzimidazole inhibits the reaction [Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]]	17295206
D019287	Zinc Sulfate	Dichlororibofuranosylbenzimidazole inhibits the reaction [Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]]	17295206
D019287	Zinc Sulfate	Dichlororibofuranosylbenzimidazole inhibits the reaction [Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]]	18636177
D019287	Zinc Sulfate	Genistein promotes the reaction [[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA]	17295206
D019287	Zinc Sulfate	Genistein promotes the reaction [Zinc Sulfate results in increased expression of CASP3 mRNA]	17295206
D019287	Zinc Sulfate	[Zinc Sulfate co-treated with CSF1 protein co-treated with TNFSF11 protein] results in increased expression of CASP3 mRNA	17295206
D019287	Zinc Sulfate	Zinc Sulfate promotes the reaction [Cryptoxanthins results in increased expression of CASP3 mRNA]	18636177
D019287	Zinc Sulfate	Zinc Sulfate promotes the reaction [Genistein results in increased expression of CASP3 mRNA]	17295206
D019287	Zinc Sulfate	Zinc Sulfate results in increased expression of CASP3 mRNA	17295206; 18636177;
D019287	Zinc Sulfate	Zinc Sulfate inhibits the reaction [Carmustine results in increased activity of CASP3 protein]	20046642
D019287	Zinc Sulfate	3-methyladenine inhibits the reaction [Zinc Sulfate results in increased cleavage of CASP3 protein]	28803810
D019287	Zinc Sulfate	Zinc Sulfate results in increased cleavage of CASP3 protein	28803810
D019287	Zinc Sulfate	Zinc Sulfate results in increased expression of CASP3 mRNA	28803810
D015038	Zineb	Zineb results in increased activity of CASP3 protein	17189834
C013738	zingerone	zingerone inhibits the reaction [Ethanol results in increased expression of CASP3 protein]	28442378
D015039	Ziram	Ziram results in increased activity of CASP3 protein	20842346; 22159898;
C484848	ziyuglycoside I	TP53 protein affects the reaction [ziyuglycoside I results in increased activity of CASP3 protein]	28960612
C484848	ziyuglycoside I	ziyuglycoside I results in increased activity of CASP3 protein	28960612
D000077211	Zoledronic Acid	[Tretinoin co-treated with Zoledronic Acid] results in increased activity of CASP3 protein	20349282
D000077211	Zoledronic Acid	[Vorinostat co-treated with Zoledronic Acid] results in increased activity of CASP3 protein	18025282
D000077211	Zoledronic Acid	Vorinostat promotes the reaction [Zoledronic Acid results in increased activity of CASP3 protein]	18025282
D000077211	Zoledronic Acid	[Zoledronic Acid co-treated with Arsenic Trioxide] results in increased cleavage of CASP3 protein	20977926
D000077211	Zoledronic Acid	[Zoledronic Acid co-treated with Docetaxel] results in decreased expression of CASP3 protein	17562444
D000077211	Zoledronic Acid	[Zoledronic Acid co-treated with Doxorubicin] results in increased expression of CASP3 protein	18695136
D000077211	Zoledronic Acid	[Zoledronic Acid co-treated with Gossypol] results in increased activity of CASP3 protein	19825521
D000077211	Zoledronic Acid	Zoledronic Acid results in decreased expression of CASP3 protein	17562444
D000077211	Zoledronic Acid	Zoledronic Acid results in increased activity of CASP3 protein	12796698; 17070308; 18025282; 19825521;
D000077211	Zoledronic Acid	Zoledronic Acid results in increased cleavage of and results in increased activity of CASP3 protein	11986784
D000077211	Zoledronic Acid	Zoledronic Acid results in increased cleavage of CASP3 protein	20977926
D000077211	Zoledronic Acid	Zoledronic Acid results in increased expression of and results in increased activity of CASP3 protein	19036117
D000077211	Zoledronic Acid	Zoledronic Acid results in increased expression of CASP3 mRNA	19915386; 24714768;
D000077211	Zoledronic Acid	[Zoledronic Acid co-treated with Doxorubicin] results in increased activity of CASP3 protein	19789217
C089750	zolmitriptan	zolmitriptan inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 mRNA]	31129132
C089750	zolmitriptan	zolmitriptan inhibits the reaction [Diethylnitrosamine results in decreased expression of CASP3 protein]	31129132
C424422	zoniporide	zoniporide results in decreased cleavage of CASP3 protein	20942815
D015054	Zymosan	SLC7A11 gene mutant form inhibits the reaction [Zymosan results in increased activity of CASP3 protein]	17200146
D015054	Zymosan	Zymosan results in increased activity of CASP3 protein	17200146

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0007	Acetylation
KW-0053	Apoptosis
KW-0963	Cytoplasm
KW-0903	Direct protein sequencing
KW-0378	Hydrolase
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-0645	Protease
KW-1185	Reference proteome
KW-0702	S-nitrosylation
KW-0788	Thiol protease
KW-0865	Zymogen

Interpro

InterPro ID	InterPro Term
IPR029030	Caspase-like_dom_sf
IPR033139	Caspase_cys_AS
IPR016129	Caspase_his_AS
IPR002398	Pept_C14
IPR002138	Pept_C14_p10
IPR001309	Pept_C14_p20
IPR015917	Pept_C14A

PROSITE

PROSITE ID	PROSITE Term
PS01122	CASPASE_CYS
PS01121	CASPASE_HIS
PS50207	CASPASE_P10
PS50208	CASPASE_P20

Pfam

Pfam ID	Pfam Term

Gene: CASP3

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction