CleftGeneDB-Search

Gene: MMP16

Basic information

Tag	Content
Uniprot ID	P51512; B2RAN7; Q14824; Q52H48;
Entrez ID	4325
Genbank protein ID	AAH69500.1; BAG36934.1; AAH75004.1; BAA22226.1; BAA12023.1; AAH75005.1; BAA12022.1; EAW91651.1; BAA23742.1; AAX84515.1;
Genbank nucleotide ID	NM_005941.4
Ensembl protein ID	ENSP00000286614
Ensembl nucleotide ID	ENSG00000156103
Gene name	Matrix metalloproteinase-16
Gene symbol	MMP16
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Endopeptidase that degrades various components of the extracellular matrix, such as collagen type III and fibronectin. Activates progelatinase A. Involved in the matrix remodeling of blood vessels. Isoform short cleaves fibronectin and also collagen type III, but at lower rate. It has no effect on type I, II, IV and V collagen. However, upon interaction with CSPG4, it may be involved in degradation and invasion of type I collagen by melanoma cells.
Sequence	MILLTFSTGR RLDFVHHSGV FFLQTLLWIL CATVCGTEQY FNVEVWLQKY GYLPPTDPRM 60 SVLRSAETMQ SALAAMQQFY GINMTGKVDR NTIDWMKKPR CGVPDQTRGS SKFHIRRKRY 120 ALTGQKWQHK HITYSIKNVT PKVGDPETRK AIRRAFDVWQ NVTPLTFEEV PYSELENGKR 180 DVDITIIFAS GFHGDSSPFD GEGGFLAHAY FPGPGIGGDT HFDSDEPWTL GNPNHDGNDL 240 FLVAVHELGH ALGLEHSNDP TAIMAPFYQY METDNFKLPN DDLQGIQKIY GPPDKIPPPT 300 RPLPTVPPHR SIPPADPRKN DRPKPPRPPT GRPSYPGAKP NICDGNFNTL AILRREMFVF 360 KDQWFWRVRN NRVMDGYPMQ ITYFWRGLPP SIDAVYENSD GNFVFFKGNK YWVFKDTTLQ 420 PGYPHDLITL GSGIPPHGID SAIWWEDVGK TYFFKGDRYW RYSEEMKTMD PGYPKPITVW 480 KGIPESPQGA FVHKENGFTY FYKGKEYWKF NNQILKVEPG YPRSILKDFM GCDGPTDRVK 540 EGHSPPDDVD IVIKLDNTAS TVKAIAIVIP CILALCLLVL VYTVFQFKRK GTPRHILYCK 600 RSMQEWV 607

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1RM8

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	MMP16	282886	F1N797		Bos taurus	Prediction	More>>
1:1 ortholog	MMP16	487036	F1PLV8		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	MMP16		A0A452EG47		Capra hircus	Prediction	More>>
1:1 ortholog	MMP16	4325	P51512		Homo sapiens	Prediction	More>>
1:1 ortholog	Mmp16	17389	Q9WTR0	CPO	Mus musculus	Publication	More>>
1:1 ortholog	MMP16		A0A2I3SEA5		Pan troglodytes	Prediction	More>>
1:1 ortholog	MMP16	100153257	A0A287AKC1		Sus scrofa	Prediction	More>>
1:1 ortholog	MMP16	100101605	G1T0W4		Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Mmp16		F1M7F5		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs780907693	p.Ile2Thr	missense variant	-	NC_000008.11:g.88327202A>G	ExAC,gnomAD
rs780907693	p.Ile2Asn	missense variant	-	NC_000008.11:g.88327202A>T	ExAC,gnomAD
rs1475032153	p.Leu4Phe	missense variant	-	NC_000008.11:g.88327197G>A	gnomAD
NCI-TCGA novel	p.Thr8Ser	missense variant	-	NC_000008.11:g.88327184G>C	NCI-TCGA
rs746562635	p.Thr8Ala	missense variant	-	NC_000008.11:g.88327185T>C	ExAC,TOPMed,gnomAD
rs199761222	p.Thr8Ile	missense variant	-	NC_000008.11:g.88327184G>A	1000Genomes,ExAC,gnomAD
rs1216621802	p.Gly9Arg	missense variant	-	NC_000008.11:g.88327182C>T	gnomAD
COSM4928728	p.Arg11Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88327176G>C	NCI-TCGA Cosmic
rs1353335466	p.Asp13Tyr	missense variant	-	NC_000008.11:g.88327170C>A	TOPMed
rs1217677523	p.His17Asn	missense variant	-	NC_000008.11:g.88327158G>T	gnomAD
NCI-TCGA novel	p.Ser18Leu	missense variant	-	NC_000008.11:g.88327154G>A	NCI-TCGA
rs764876063	p.Gly19Arg	missense variant	-	NC_000008.11:g.88327152C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Val20CysPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88327149C>-	NCI-TCGA
NCI-TCGA novel	p.Leu23Ser	missense variant	-	NC_000008.11:g.88327139A>G	NCI-TCGA
rs1272332781	p.Leu23Phe	missense variant	-	NC_000008.11:g.88327138C>G	TOPMed,gnomAD
COSM3901938	p.Leu23Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88327140A>C	NCI-TCGA Cosmic
rs757088495	p.Thr25Ala	missense variant	-	NC_000008.11:g.88327134T>C	ExAC,gnomAD
rs912293325	p.Leu26Trp	missense variant	-	NC_000008.11:g.88327130A>C	gnomAD
rs1256898559	p.Leu26Phe	missense variant	-	NC_000008.11:g.88327129C>G	TOPMed
rs1170557742	p.Leu27Phe	missense variant	-	NC_000008.11:g.88327128G>A	gnomAD
NCI-TCGA novel	p.Leu30Ter	stop gained	-	NC_000008.11:g.88327118A>C	NCI-TCGA
rs764331119	p.Leu30Phe	missense variant	-	NC_000008.11:g.88327117T>G	ExAC,TOPMed,gnomAD
rs559124187	p.Leu30Val	missense variant	-	NC_000008.11:g.88327119A>C	1000Genomes,ExAC,gnomAD
rs949006928	p.Cys31Arg	missense variant	-	NC_000008.11:g.88327116A>G	TOPMed
rs760714827	p.Cys31Tyr	missense variant	-	NC_000008.11:g.88327115C>T	ExAC,TOPMed,gnomAD
rs775594263	p.Thr33Ala	missense variant	-	NC_000008.11:g.88327110T>C	ExAC,gnomAD
NCI-TCGA novel	p.Val34Leu	missense variant	-	NC_000008.11:g.88327107C>G	NCI-TCGA
rs145799922	p.Val34Phe	missense variant	-	NC_000008.11:g.88327107C>A	ESP,ExAC,TOPMed,gnomAD
rs1293332514	p.Cys35Arg	missense variant	-	NC_000008.11:g.88327104A>G	gnomAD
rs201235027	p.Gly36Arg	missense variant	-	NC_000008.11:g.88327101C>T	TOPMed
NCI-TCGA novel	p.Thr37Met	missense variant	-	NC_000008.11:g.88327097G>A	NCI-TCGA
NCI-TCGA novel	p.Glu38Asp	missense variant	-	NC_000008.11:g.88327093C>A	NCI-TCGA
rs1173842074	p.Glu38Lys	missense variant	-	NC_000008.11:g.88327095C>T	TOPMed
NCI-TCGA novel	p.Tyr40Cys	missense variant	-	NC_000008.11:g.88327088T>C	NCI-TCGA
rs771138953	p.Asn42Ser	missense variant	-	NC_000008.11:g.88327082T>C	ExAC,gnomAD
NCI-TCGA novel	p.Gly51Ser	missense variant	-	NC_000008.11:g.88197288C>T	NCI-TCGA
COSM3651625	p.Gly51Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197287C>T	NCI-TCGA Cosmic
COSM751493	p.Gly51Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197288C>A	NCI-TCGA Cosmic
rs1403348162	p.TyrLeuPro52Ter	stop gained	-	NC_000008.11:g.88197278_88197283del	ESP
rs756484176	p.Tyr52Ter	stop gained	-	NC_000008.11:g.88197284dup	ExAC
rs200374626	p.Tyr52Ter	stop gained	-	NC_000008.11:g.88197283G>T	ExAC,gnomAD
rs781495752	p.Leu53Pro	missense variant	-	NC_000008.11:g.88197281A>G	ExAC
rs754968955	p.Pro54Ser	missense variant	-	NC_000008.11:g.88197279G>A	ExAC
rs751713792	p.Pro54Gln	missense variant	-	NC_000008.11:g.88197278G>T	ExAC
rs371768034	p.Pro55Ala	missense variant	-	NC_000008.11:g.88197276G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs371768034	p.Pro55Ser	missense variant	-	NC_000008.11:g.88197276G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs765641487	p.Pro55Arg	missense variant	-	NC_000008.11:g.88197275G>C	ExAC,TOPMed,gnomAD
rs765641487	p.Pro55Leu	missense variant	-	NC_000008.11:g.88197275G>A	ExAC,TOPMed,gnomAD
rs1476934120	p.Asp57Glu	missense variant	-	NC_000008.11:g.88197268G>C	TOPMed,gnomAD
NCI-TCGA novel	p.Pro58Ser	missense variant	-	NC_000008.11:g.88197267G>A	NCI-TCGA
COSM131391	p.Pro58Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197266G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser61Leu	missense variant	-	NC_000008.11:g.88197257G>A	NCI-TCGA
COSM3901937	p.Leu63Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197252G>T	NCI-TCGA Cosmic
rs373603451	p.Arg64His	missense variant	-	NC_000008.11:g.88197248C>T	ESP,ExAC,TOPMed,gnomAD
rs758946094	p.Arg64Cys	missense variant	-	NC_000008.11:g.88197249G>A	ExAC,TOPMed,gnomAD
COSM3432600	p.Glu67Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197238C>A	NCI-TCGA Cosmic
rs1213795620	p.Thr68Ile	missense variant	-	NC_000008.11:g.88197236G>A	gnomAD
COSM1569516	p.Gln70Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197230T>C	NCI-TCGA Cosmic
rs1014944012	p.Leu73Pro	missense variant	-	NC_000008.11:g.88197221A>G	TOPMed
rs747965900	p.Leu73Val	missense variant	-	NC_000008.11:g.88197222G>C	ExAC,TOPMed,gnomAD
rs747965900	p.Leu73Ile	missense variant	-	NC_000008.11:g.88197222G>T	ExAC,TOPMed,gnomAD
COSM297696	p.Met76Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197212A>G	NCI-TCGA Cosmic
rs781251258	p.Gln77His	missense variant	-	NC_000008.11:g.88197208C>G	ExAC,TOPMed,gnomAD
rs751591448	p.Tyr80Cys	missense variant	-	NC_000008.11:g.88197200T>C	ExAC,TOPMed,gnomAD
COSM3726296	p.Asn83Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197191T>G	NCI-TCGA Cosmic
rs1169511853	p.Met84Val	missense variant	-	NC_000008.11:g.88197189T>C	TOPMed
COSM1458539	p.Met84Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197188A>T	NCI-TCGA Cosmic
COSM1700328	p.Gly86Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197182C>T	NCI-TCGA Cosmic
COSM120101	p.Asp89Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88197173T>C	NCI-TCGA Cosmic
rs780118679	p.Asn91Ser	missense variant	-	NC_000008.11:g.88197167T>C	ExAC,TOPMed,gnomAD
rs758566345	p.Ile93Val	missense variant	-	NC_000008.11:g.88197162T>C	ExAC,gnomAD
rs375880255	p.Ile93Thr	missense variant	-	NC_000008.11:g.88197161A>G	ESP,TOPMed
NCI-TCGA novel	p.Lys97Asn	missense variant	-	NC_000008.11:g.88186589C>A	NCI-TCGA
NCI-TCGA novel	p.Lys97Glu	missense variant	-	NC_000008.11:g.88186591T>C	NCI-TCGA
rs1402438624	p.Lys98Asn	missense variant	-	NC_000008.11:g.88186586C>A	TOPMed,gnomAD
rs773090533	p.Pro99Leu	missense variant	-	NC_000008.11:g.88186584G>A	ExAC,TOPMed,gnomAD
rs145712283	p.Arg100Gln	missense variant	-	NC_000008.11:g.88186581C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs145712283	p.Arg100Leu	missense variant	-	NC_000008.11:g.88186581C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs747928115	p.Arg100Ter	stop gained	-	NC_000008.11:g.88186582G>A	ExAC,gnomAD
rs780162250	p.Gly102Ser	missense variant	-	NC_000008.11:g.88186576C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp105Asn	missense variant	-	NC_000008.11:g.88186567C>T	NCI-TCGA
NCI-TCGA novel	p.Gln106Phe	insertion	-	NC_000008.11:g.88186561_88186562insAAA	NCI-TCGA
NCI-TCGA novel	p.Gln106LeuGluTer	stop gained	-	NC_000008.11:g.88186563_88186564insATTCCA	NCI-TCGA
rs758515051	p.Arg108Lys	missense variant	-	NC_000008.11:g.88186557C>T	ExAC,gnomAD
rs1181413511	p.Arg108Gly	missense variant	-	NC_000008.11:g.88186558T>C	gnomAD
rs1233880609	p.Gly109Ser	missense variant	-	NC_000008.11:g.88186555C>T	TOPMed
rs745987268	p.Lys112Gln	missense variant	-	NC_000008.11:g.88186546T>G	ExAC,TOPMed,gnomAD
rs779538464	p.His114Arg	missense variant	-	NC_000008.11:g.88186539T>C	ExAC,gnomAD
COSM422043	p.His114Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88186540G>A	NCI-TCGA Cosmic
COSM1102290	p.His114Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88186540G>T	NCI-TCGA Cosmic
rs1373463653	p.Ile115Thr	missense variant	-	NC_000008.11:g.88186536A>G	TOPMed,gnomAD
COSM1624251	p.Arg116His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88186533C>T	NCI-TCGA Cosmic
COSM1102289	p.Arg116Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88186534G>A	NCI-TCGA Cosmic
rs757895279	p.Arg117Gln	missense variant	-	NC_000008.11:g.88186530C>T	ExAC,TOPMed,gnomAD
COSM1102288	p.Arg117Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88186531G>A	NCI-TCGA Cosmic
rs754148277	p.Arg119Gly	missense variant	-	NC_000008.11:g.88186525G>C	ExAC,gnomAD
COSM4544426	p.Arg119Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88186524C>T	NCI-TCGA Cosmic
COSM751494	p.Arg119Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88186525G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala121Thr	missense variant	-	NC_000008.11:g.88186519C>T	NCI-TCGA
rs1311546563	p.Ala121Ser	missense variant	-	NC_000008.11:g.88186519C>A	gnomAD
NCI-TCGA novel	p.Gln128His	missense variant	-	NC_000008.11:g.88186496C>A	NCI-TCGA
COSM6181821	p.Gln128Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88186498G>T	NCI-TCGA Cosmic
rs1352791560	p.His129Tyr	missense variant	-	NC_000008.11:g.88186495G>A	gnomAD
rs1331980989	p.Lys130Arg	missense variant	-	NC_000008.11:g.88186491T>C	gnomAD
rs1172667092	p.Lys130Glu	missense variant	-	NC_000008.11:g.88186492T>C	TOPMed,gnomAD
rs756445504	p.Thr133Ser	missense variant	-	NC_000008.11:g.88186483T>A	ExAC,gnomAD
COSM6181822	p.Tyr134Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88186478G>T	NCI-TCGA Cosmic
rs1382078614	p.Ile136Leu	missense variant	-	NC_000008.11:g.88167972T>A	TOPMed
rs1201596629	p.Lys137Asn	missense variant	-	NC_000008.11:g.88167967C>A	gnomAD
NCI-TCGA novel	p.Val139Ala	missense variant	-	NC_000008.11:g.88167962A>G	NCI-TCGA
rs147772248	p.Val139Ile	missense variant	-	NC_000008.11:g.88167963C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1219802631	p.Thr140Ser	missense variant	-	NC_000008.11:g.88167960T>A	gnomAD
COSM751495	p.Pro141Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167956G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Val143Leu	missense variant	-	NC_000008.11:g.88167951C>A	NCI-TCGA
rs377728837	p.Asp145Glu	missense variant	-	NC_000008.11:g.88167943G>T	ESP,ExAC,TOPMed,gnomAD
rs1479466584	p.Asp145Gly	missense variant	-	NC_000008.11:g.88167944T>C	TOPMed,gnomAD
rs1215318434	p.Pro146Leu	missense variant	-	NC_000008.11:g.88167941G>A	gnomAD
COSM6114145	p.Pro146His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167941G>T	NCI-TCGA Cosmic
COSM4913282	p.Glu147Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88167939C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg149Cys	missense variant	-	NC_000008.11:g.88167933G>A	NCI-TCGA
rs753769443	p.Arg149His	missense variant	-	NC_000008.11:g.88167932C>T	ExAC,gnomAD
COSM389664	p.Arg149Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167932C>A	NCI-TCGA Cosmic
COSM1102287	p.Ala151Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167927C>A	NCI-TCGA Cosmic
rs1450164048	p.Ile152Val	missense variant	-	NC_000008.11:g.88167924T>C	TOPMed
rs754978084	p.Arg153His	missense variant	-	NC_000008.11:g.88167920C>T	ExAC,gnomAD
COSM4839407	p.Arg153Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167921G>A	NCI-TCGA Cosmic
rs760497058	p.Arg154His	missense variant	-	NC_000008.11:g.88167917C>T	ExAC,TOPMed,gnomAD
rs1233813645	p.Arg154Cys	missense variant	-	NC_000008.11:g.88167918G>A	gnomAD
NCI-TCGA novel	p.Asp157Tyr	missense variant	-	NC_000008.11:g.88167909C>A	NCI-TCGA
rs1336244945	p.Asp157Gly	missense variant	-	NC_000008.11:g.88167908T>C	TOPMed
COSM4852748	p.Asp157His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167909C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Val158Gly	missense variant	-	NC_000008.11:g.88167905A>C	NCI-TCGA
rs775481555	p.Val158Ala	missense variant	-	NC_000008.11:g.88167905A>G	ExAC,gnomAD
COSM751496	p.Trp159Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167902C>G	NCI-TCGA Cosmic
rs940310916	p.Gln160Arg	missense variant	-	NC_000008.11:g.88167899T>C	gnomAD
rs1260245087	p.Val162Ile	missense variant	-	NC_000008.11:g.88167894C>T	TOPMed
rs909356477	p.Thr166Ile	missense variant	-	NC_000008.11:g.88167881G>A	TOPMed
rs1174838677	p.Pro171Leu	missense variant	-	NC_000008.11:g.88167866G>A	gnomAD
rs774726745	p.Ser173Asn	missense variant	-	NC_000008.11:g.88167860C>T	ExAC,gnomAD
rs148641870	p.Ser173Gly	missense variant	-	NC_000008.11:g.88167861T>C	ESP,TOPMed
rs1461193311	p.Glu174Val	missense variant	-	NC_000008.11:g.88167857T>A	TOPMed
NCI-TCGA novel	p.Asn177His	missense variant	-	NC_000008.11:g.88167849T>G	NCI-TCGA
rs1197786920	p.Gly178Ser	missense variant	-	NC_000008.11:g.88167846C>T	TOPMed,gnomAD
rs1478992446	p.Gly178Val	missense variant	-	NC_000008.11:g.88167845C>A	TOPMed,gnomAD
rs1478992446	p.Gly178Asp	missense variant	-	NC_000008.11:g.88167845C>T	TOPMed,gnomAD
rs1197786920	p.Gly178Arg	missense variant	-	NC_000008.11:g.88167846C>G	TOPMed,gnomAD
rs749353622	p.Lys179Arg	missense variant	-	NC_000008.11:g.88167842T>C	ExAC,gnomAD
rs770249742	p.Arg180His	missense variant	-	NC_000008.11:g.88167839C>T	ExAC,TOPMed,gnomAD
rs778310030	p.Arg180Cys	missense variant	-	NC_000008.11:g.88167840G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp181Asn	missense variant	-	NC_000008.11:g.88167837C>T	NCI-TCGA
rs748544150	p.Asp181Gly	missense variant	-	NC_000008.11:g.88167836T>C	ExAC,TOPMed,gnomAD
rs1404891577	p.Ile187Thr	missense variant	-	NC_000008.11:g.88167818A>G	TOPMed
COSM3651622	p.Ile187Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167818A>C	NCI-TCGA Cosmic
COSM3651623	p.Ile187Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167819T>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala189Glu	missense variant	-	NC_000008.11:g.88167812G>T	NCI-TCGA
COSM1314252	p.Ser190Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167810A>T	NCI-TCGA Cosmic
COSM4937432	p.Gly191Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167807C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.His193LeuPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88167764_88167800AATCCTCCCTCTCCATCAAAGGGAGAGCTGTCCCCAT>-	NCI-TCGA
NCI-TCGA novel	p.His193Leu	missense variant	-	NC_000008.11:g.88167800T>A	NCI-TCGA
COSM6114146	p.His193Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167801G>T	NCI-TCGA Cosmic
COSM5244101	p.Gly194Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167798C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser196Ile	missense variant	-	NC_000008.11:g.88167791C>A	NCI-TCGA
rs1340855815	p.Pro198Arg	missense variant	-	NC_000008.11:g.88167785G>C	gnomAD
COSM751497	p.Pro198His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167785G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe199Leu	missense variant	-	NC_000008.11:g.88167781A>T	NCI-TCGA
NCI-TCGA novel	p.Gly201Ter	stop gained	-	NC_000008.11:g.88167777C>A	NCI-TCGA
COSM3784174	p.Gly201Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167776C>T	NCI-TCGA Cosmic
COSM422044	p.Phe211Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167747A>G	NCI-TCGA Cosmic
COSM751498	p.Pro212Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167744G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly215Arg	missense variant	-	NC_000008.11:g.88167735C>T	NCI-TCGA
COSM5289854	p.Gly217Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167729C>T	NCI-TCGA Cosmic
COSM5900127	p.Gly218Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88167725C>T	NCI-TCGA Cosmic
rs778568795	p.Ser224Ala	missense variant	-	NC_000008.11:g.88167708A>C	ExAC,gnomAD
COSM751499	p.Ser224Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88167707G>T	NCI-TCGA Cosmic
rs756760859	p.Asn234Asp	missense variant	-	NC_000008.11:g.88167678T>C	ExAC,TOPMed,gnomAD
rs753339844	p.Asn234Ser	missense variant	-	NC_000008.11:g.88167677T>C	ExAC,gnomAD
NCI-TCGA novel	p.Gly237Val	missense variant	-	NC_000008.11:g.88118861C>A	NCI-TCGA
COSM4780564	p.Asp239Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88118856C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe241Cys	missense variant	-	NC_000008.11:g.88118849A>C	NCI-TCGA
COSM3901935	p.Val245Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88118837A>C	NCI-TCGA Cosmic
COSM6114148	p.His246Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88118834T>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala251Asp	missense variant	-	NC_000008.11:g.88118819G>T	NCI-TCGA
NCI-TCGA novel	p.Gly253Arg	missense variant	-	NC_000008.11:g.88118814C>T	NCI-TCGA
COSM6181825	p.Gly253Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88118814C>A	NCI-TCGA Cosmic
COSM1102285	p.Leu254Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88118811A>C	NCI-TCGA Cosmic
rs752632247	p.Asn258Ser	missense variant	-	NC_000008.11:g.88118798T>C	ExAC,gnomAD
NCI-TCGA novel	p.Pro260His	missense variant	-	NC_000008.11:g.88118792G>T	NCI-TCGA
rs368855347	p.Pro260Leu	missense variant	-	NC_000008.11:g.88118792G>A	ESP,TOPMed
rs1202242072	p.Thr261Ile	missense variant	-	NC_000008.11:g.88118789G>A	gnomAD
NCI-TCGA novel	p.Tyr268His	missense variant	-	NC_000008.11:g.88118769A>G	NCI-TCGA
COSM751500	p.Tyr268Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88118767G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gln269Leu	missense variant	-	NC_000008.11:g.88118765T>A	NCI-TCGA
rs1313095939	p.Gln269Ter	stop gained	-	NC_000008.11:g.88118766G>A	gnomAD
rs751446440	p.Tyr270His	missense variant	-	NC_000008.11:g.88118763A>G	ExAC,gnomAD
rs763022004	p.Asn275Lys	missense variant	-	NC_000008.11:g.88118746G>T	ExAC,gnomAD
rs533581617	p.Lys277Arg	missense variant	-	NC_000008.11:g.88118741T>C	1000Genomes,ExAC,gnomAD
rs1323825291	p.Asn280Asp	missense variant	-	NC_000008.11:g.88118733T>C	gnomAD
NCI-TCGA novel	p.Gln284Arg	missense variant	-	NC_000008.11:g.88118720T>C	NCI-TCGA
COSM1314251	p.Gln284His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88118719C>A	NCI-TCGA Cosmic
COSM282831	p.Gln287Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88118711T>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile289TyrPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88118707C>-	NCI-TCGA
rs1423536830	p.Ile289Thr	missense variant	-	NC_000008.11:g.88118705A>G	gnomAD
rs1198485742	p.Gly291Asp	missense variant	-	NC_000008.11:g.88116718C>T	gnomAD
rs1479316318	p.Pro292Ala	missense variant	-	NC_000008.11:g.88116716G>C	gnomAD
NCI-TCGA novel	p.Pro293His	missense variant	-	NC_000008.11:g.88116712G>T	NCI-TCGA
rs1356801641	p.Pro293Ser	missense variant	-	NC_000008.11:g.88116713G>A	TOPMed
rs1272441346	p.Lys295Asn	missense variant	-	NC_000008.11:g.88116705C>G	TOPMed
rs374569912	p.Ile296Ser	missense variant	-	NC_000008.11:g.88116703A>C	ESP,ExAC,TOPMed,gnomAD
rs1238848286	p.Ile296Val	missense variant	-	NC_000008.11:g.88116704T>C	gnomAD
rs1260152786	p.Pro298Leu	missense variant	-	NC_000008.11:g.88116697G>A	gnomAD
COSM6114149	p.Pro298Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116697G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr300Lys	missense variant	-	NC_000008.11:g.88116691G>T	NCI-TCGA
rs1213733085	p.Thr300Ala	missense variant	-	NC_000008.11:g.88116692T>C	gnomAD
rs953954213	p.Pro302Thr	missense variant	-	NC_000008.11:g.88116686G>T	TOPMed
rs772275333	p.Pro304Arg	missense variant	-	NC_000008.11:g.88116679G>C	ExAC,TOPMed,gnomAD
rs772275333	p.Pro304Leu	missense variant	-	NC_000008.11:g.88116679G>A	ExAC,TOPMed,gnomAD
rs1321801587	p.Val306Leu	missense variant	-	NC_000008.11:g.88116674C>A	gnomAD
rs1360663314	p.Pro307Leu	missense variant	-	NC_000008.11:g.88116670G>A	gnomAD
rs769615331	p.Pro307Thr	missense variant	-	NC_000008.11:g.88116671G>T	ExAC,gnomAD
rs1476208193	p.Pro308Ser	missense variant	-	NC_000008.11:g.88116668G>A	TOPMed
rs912451959	p.Pro308Leu	missense variant	-	NC_000008.11:g.88116667G>A	gnomAD
rs139170994	p.Arg310His	missense variant	-	NC_000008.11:g.88116661C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs202054317	p.Arg310Cys	missense variant	-	NC_000008.11:g.88116662G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1425435073	p.Ser311Cys	missense variant	-	NC_000008.11:g.88116658G>C	gnomAD
rs754551431	p.Ser311Ala	missense variant	-	NC_000008.11:g.88116659A>C	ExAC,gnomAD
rs780076056	p.Ile312Phe	missense variant	-	NC_000008.11:g.88116656T>A	ExAC,TOPMed,gnomAD
rs780076056	p.Ile312Val	missense variant	-	NC_000008.11:g.88116656T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro313His	missense variant	-	NC_000008.11:g.88116652G>T	NCI-TCGA
rs1429410357	p.Pro313Ser	missense variant	-	NC_000008.11:g.88116653G>A	gnomAD
rs758102140	p.Pro314Ser	missense variant	-	NC_000008.11:g.88116650G>A	ExAC,gnomAD
rs956723755	p.Ala315Ser	missense variant	-	NC_000008.11:g.88116647C>A	gnomAD
COSM6114150	p.Asp316Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116644C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro317Gln	missense variant	-	NC_000008.11:g.88116640G>T	NCI-TCGA
NCI-TCGA novel	p.Pro317Ser	missense variant	-	NC_000008.11:g.88116641G>A	NCI-TCGA
rs778990548	p.Arg318Gly	missense variant	-	NC_000008.11:g.88116638T>C	ExAC,gnomAD
rs757543386	p.Arg318Lys	missense variant	-	NC_000008.11:g.88116637C>T	ExAC,gnomAD
rs373778123	p.Lys319Glu	missense variant	-	NC_000008.11:g.88116635T>C	ESP,ExAC,TOPMed,gnomAD
rs1021800917	p.Lys319Arg	missense variant	-	NC_000008.11:g.88116634T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Asn320LysPheSerTerUnk	frameshift	-	NC_000008.11:g.88116630_88116631insT	NCI-TCGA
COSM3432599	p.Asn320Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116630A>C	NCI-TCGA Cosmic
rs753104583	p.Pro323Ala	missense variant	-	NC_000008.11:g.88116623G>C	ExAC,gnomAD
NCI-TCGA novel	p.Pro326Arg	missense variant	-	NC_000008.11:g.88116613G>C	NCI-TCGA
NCI-TCGA novel	p.Pro326Thr	missense variant	-	NC_000008.11:g.88116614G>T	NCI-TCGA
rs768109261	p.Arg327Trp	missense variant	-	NC_000008.11:g.88116611G>A	ExAC,gnomAD
rs146269135	p.Arg327Gln	missense variant	-	NC_000008.11:g.88116610C>T	ESP,ExAC,TOPMed,gnomAD
rs1415053023	p.Pro328Leu	missense variant	-	NC_000008.11:g.88116607G>A	TOPMed
COSM3901934	p.Pro329Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116604G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr330Asn	missense variant	-	NC_000008.11:g.88116601G>T	NCI-TCGA
COSM751504	p.Thr330Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116602T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly331AlaPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88116598C>-	NCI-TCGA
rs774833875	p.Gly331Ser	missense variant	-	NC_000008.11:g.88116599C>T	ExAC,TOPMed,gnomAD
rs575319329	p.Arg332Lys	missense variant	-	NC_000008.11:g.88116595C>T	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Pro333Thr	missense variant	-	NC_000008.11:g.88116593G>T	NCI-TCGA
rs1372758090	p.Tyr335Cys	missense variant	-	NC_000008.11:g.88116586T>C	gnomAD
COSM1102284	p.Pro336Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116584G>C	NCI-TCGA Cosmic
rs141858403	p.Gly337Arg	missense variant	-	NC_000008.11:g.88116581C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys339Asn	missense variant	-	NC_000008.11:g.88116573T>G	NCI-TCGA
rs1385879938	p.Lys339Arg	missense variant	-	NC_000008.11:g.88116574T>C	TOPMed,gnomAD
rs768243822	p.Ile342Val	missense variant	-	NC_000008.11:g.88116566T>C	ExAC,gnomAD
rs1240555571	p.Asn346Tyr	missense variant	-	NC_000008.11:g.88116554T>A	gnomAD
rs746573501	p.Asn346Lys	missense variant	-	NC_000008.11:g.88116552G>C	ExAC,gnomAD
NCI-TCGA novel	p.Asn348Lys	missense variant	-	NC_000008.11:g.88116546G>C	NCI-TCGA
rs1249283490	p.Asn348Ser	missense variant	-	NC_000008.11:g.88116547T>C	gnomAD
NCI-TCGA novel	p.Thr349Asn	missense variant	-	NC_000008.11:g.88116544G>T	NCI-TCGA
NCI-TCGA novel	p.Leu350Pro	missense variant	-	NC_000008.11:g.88116541A>G	NCI-TCGA
rs1223241665	p.Ala351Gly	missense variant	-	NC_000008.11:g.88116538G>C	gnomAD
NCI-TCGA novel	p.Leu353Ile	missense variant	-	NC_000008.11:g.88116533G>T	NCI-TCGA
COSM1257828	p.Leu353Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116532A>C	NCI-TCGA Cosmic
rs138174209	p.Arg354His	missense variant	-	NC_000008.11:g.88116529C>T	ESP,ExAC,TOPMed,gnomAD
COSM3901932	p.Arg354Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116530G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg355Cys	missense variant	-	NC_000008.11:g.88116527G>A	NCI-TCGA
rs1013166264	p.Arg355His	missense variant	-	NC_000008.11:g.88116526C>T	TOPMed,gnomAD
rs772106112	p.Glu356Asp	missense variant	-	NC_000008.11:g.88116522C>A	ExAC,gnomAD
rs1379083642	p.Met357Val	missense variant	-	NC_000008.11:g.88116521T>C	gnomAD
COSM751506	p.Met357Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88116520A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Val359Leu	missense variant	-	NC_000008.11:g.88116515C>G	NCI-TCGA
rs770672148	p.Asp362Asn	missense variant	-	NC_000008.11:g.88074743C>T	ExAC,gnomAD
NCI-TCGA novel	p.Gln363Ter	stop gained	-	NC_000008.11:g.88074740G>A	NCI-TCGA
COSM751507	p.Gln363His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074738C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe365Ile	missense variant	-	NC_000008.11:g.88074734A>T	NCI-TCGA
COSM1458529	p.Arg367Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88074728G>A	NCI-TCGA Cosmic
COSM3651619	p.Arg367Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074727C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg369Lys	missense variant	-	NC_000008.11:g.88074721C>T	NCI-TCGA
rs1488990440	p.Arg369Gly	missense variant	-	NC_000008.11:g.88074722T>C	gnomAD
COSM98229	p.Arg369Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074721C>G	NCI-TCGA Cosmic
rs777949111	p.Asn370Ser	missense variant	-	NC_000008.11:g.88074718T>C	ExAC,gnomAD
rs756412512	p.Asn370Lys	missense variant	-	NC_000008.11:g.88074717G>T	ExAC,gnomAD
COSM1215267	p.Asn370Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074718T>A	NCI-TCGA Cosmic
COSM3901931	p.Asn370Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074719T>C	NCI-TCGA Cosmic
rs1257667053	p.Asn371Ser	missense variant	-	NC_000008.11:g.88074715T>C	gnomAD
rs781263778	p.Arg372Gly	missense variant	-	NC_000008.11:g.88074713T>C	ExAC,gnomAD
NCI-TCGA novel	p.Val373Leu	missense variant	-	NC_000008.11:g.88074710C>A	NCI-TCGA
NCI-TCGA novel	p.Met374Ile	missense variant	-	NC_000008.11:g.88074705C>A	NCI-TCGA
NCI-TCGA novel	p.Asp375Asn	missense variant	-	NC_000008.11:g.88074704C>T	NCI-TCGA
COSM5769206	p.Asp375Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074704C>A	NCI-TCGA Cosmic
rs1240326844	p.Asp375Gly	missense variant	-	NC_000008.11:g.88074703T>C	TOPMed
NCI-TCGA novel	p.Gly376Val	missense variant	-	NC_000008.11:g.88074700C>A	NCI-TCGA
rs1403264969	p.Gly376Ter	stop gained	-	NC_000008.11:g.88074701C>A	gnomAD
COSM6181828	p.Gly376Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074701C>G	NCI-TCGA Cosmic
rs1260538571	p.Tyr377His	missense variant	-	NC_000008.11:g.88074698A>G	TOPMed
COSM606548	p.Pro378Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074695G>A	NCI-TCGA Cosmic
rs142006673	p.Met379Leu	missense variant	-	NC_000008.11:g.88074692T>A	ESP,ExAC,TOPMed,gnomAD
rs142006673	p.Met379Val	missense variant	-	NC_000008.11:g.88074692T>C	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe384SerPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88074678G>-	NCI-TCGA
rs750879897	p.Phe384Leu	missense variant	-	NC_000008.11:g.88074677A>G	ExAC,gnomAD
COSM6181829	p.Trp385Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074672C>A	NCI-TCGA Cosmic
rs760308984	p.Arg386Gly	missense variant	-	NC_000008.11:g.88074671G>C	ExAC,TOPMed,gnomAD
rs368200792	p.Arg386Gln	missense variant	-	NC_000008.11:g.88074670C>T	ESP,ExAC,TOPMed,gnomAD
rs760308984	p.Arg386Trp	missense variant	-	NC_000008.11:g.88074671G>A	ExAC,TOPMed,gnomAD
rs767006842	p.Gly387Ala	missense variant	-	NC_000008.11:g.88074667C>G	ExAC
rs1419628498	p.Gly387Ser	missense variant	-	NC_000008.11:g.88074668C>T	TOPMed
rs758996990	p.Pro389Ala	missense variant	-	NC_000008.11:g.88074662G>C	ExAC,gnomAD
rs774237231	p.Pro390Ser	missense variant	-	NC_000008.11:g.88074659G>A	ExAC,gnomAD
NCI-TCGA novel	p.Ser391Gly	missense variant	-	NC_000008.11:g.88074656T>C	NCI-TCGA
rs1057492560	p.Ser391Asn	missense variant	-	NC_000008.11:g.88074655C>T	gnomAD
NCI-TCGA novel	p.Asp393Tyr	missense variant	-	NC_000008.11:g.88074650C>A	NCI-TCGA
COSM4522943	p.Glu397Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074638C>T	NCI-TCGA Cosmic
rs769479277	p.Ser399Asn	missense variant	-	NC_000008.11:g.88074631C>T	ExAC
rs61753768	p.Ser399Gly	missense variant	-	NC_000008.11:g.88074632T>C	ESP,ExAC,TOPMed,gnomAD
COSM245727	p.Ser399Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074630G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp400Glu	missense variant	-	NC_000008.11:g.88074627G>T	NCI-TCGA
rs866043551	p.Asp400Asn	missense variant	-	NC_000008.11:g.88074629C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Gly401Trp	missense variant	-	NC_000008.11:g.88074626C>A	NCI-TCGA
rs1341796628	p.Gly401Glu	missense variant	-	NC_000008.11:g.88074625C>T	gnomAD
rs755055835	p.Gly401Arg	missense variant	-	NC_000008.11:g.88074626C>T	ExAC,gnomAD
NCI-TCGA novel	p.Phe405Leu	missense variant	-	NC_000008.11:g.88074612G>T	NCI-TCGA
NCI-TCGA novel	p.Phe406Cys	missense variant	-	NC_000008.11:g.88074610A>C	NCI-TCGA
COSM6181830	p.Phe406Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074611A>G	NCI-TCGA Cosmic
COSM6181831	p.Lys407Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074608T>G	NCI-TCGA Cosmic
COSM6114154	p.Gly408Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88074605C>G	NCI-TCGA Cosmic
rs182225592	p.Asn409Ser	missense variant	-	NC_000008.11:g.88056275T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1264212325	p.Asn409Lys	missense variant	-	NC_000008.11:g.88056274G>C	gnomAD
COSM4932885	p.Trp412Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88056267A>G	NCI-TCGA Cosmic
rs771047374	p.Val413Leu	missense variant	-	NC_000008.11:g.88056264C>G	ExAC,TOPMed,gnomAD
rs771047374	p.Val413Met	missense variant	-	NC_000008.11:g.88056264C>T	ExAC,TOPMed,gnomAD
rs749698962	p.Val413Ala	missense variant	-	NC_000008.11:g.88056263A>G	ExAC,gnomAD
rs968265107	p.Lys415Thr	missense variant	-	NC_000008.11:g.88056257T>G	TOPMed
NCI-TCGA novel	p.Thr417Lys	missense variant	-	NC_000008.11:g.88056251G>T	NCI-TCGA
NCI-TCGA novel	p.Thr418Ile	missense variant	-	NC_000008.11:g.88056248G>A	NCI-TCGA
rs770102092	p.Thr418Ala	missense variant	-	NC_000008.11:g.88056249T>C	ExAC,gnomAD
rs748562931	p.Leu419Pro	missense variant	-	NC_000008.11:g.88056245A>G	ExAC,gnomAD
NCI-TCGA novel	p.Gln420Ter	stop gained	-	NC_000008.11:g.88056243G>A	NCI-TCGA
COSM3925687	p.Gln420Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88056242T>G	NCI-TCGA Cosmic
rs1468010039	p.Tyr423Cys	missense variant	-	NC_000008.11:g.88056233T>C	gnomAD
rs1172747089	p.Pro424Leu	missense variant	-	NC_000008.11:g.88056230G>A	NCI-TCGA Cosmic
rs1172747089	p.Pro424Leu	missense variant	-	NC_000008.11:g.88056230G>A	gnomAD
NCI-TCGA novel	p.Ile428Lys	missense variant	-	NC_000008.11:g.88056218A>T	NCI-TCGA
rs1418804853	p.Ile428Leu	missense variant	-	NC_000008.11:g.88056219T>A	TOPMed,gnomAD
NCI-TCGA novel	p.Thr429Ser	missense variant	-	NC_000008.11:g.88056215G>C	NCI-TCGA
rs1186747588	p.Leu430Val	missense variant	-	NC_000008.11:g.88056213G>C	gnomAD
NCI-TCGA novel	p.Gly431Arg	missense variant	-	NC_000008.11:g.88056210C>G	NCI-TCGA
rs1459050274	p.Ser432Gly	missense variant	-	NC_000008.11:g.88056207T>C	TOPMed
rs1459050274	p.Ser432Gly	missense variant	-	NC_000008.11:g.88056207T>C	NCI-TCGA Cosmic
rs371382592	p.Gly433Arg	missense variant	-	NC_000008.11:g.88056204C>T	ESP,ExAC,TOPMed,gnomAD
rs149191104	p.Ile434Thr	missense variant	-	NC_000008.11:g.88056200A>G	ESP,TOPMed,gnomAD
rs1389984090	p.Ile434Val	missense variant	-	NC_000008.11:g.88056201T>C	TOPMed
COSM3651617	p.Pro435Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88056198G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro436LeuPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88056194G>-	NCI-TCGA
rs1482457377	p.Pro436Leu	missense variant	-	NC_000008.11:g.88056194G>A	gnomAD
COSM751508	p.Gly438Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88056189C>A	NCI-TCGA Cosmic
COSM461398	p.Trp445Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.88056167C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp447Tyr	missense variant	-	NC_000008.11:g.88056162C>A	NCI-TCGA
rs1306557973	p.Val448Ile	missense variant	-	NC_000008.11:g.88056159C>T	NCI-TCGA Cosmic
rs1306557973	p.Val448Ile	missense variant	-	NC_000008.11:g.88056159C>T	gnomAD
COSM6181832	p.Val448Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88056159C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly449Val	missense variant	-	NC_000008.11:g.88056155C>A	NCI-TCGA
rs1247506929	p.Gly449Arg	missense variant	-	NC_000008.11:g.88056156C>T	gnomAD
NCI-TCGA novel	p.Thr451ProPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.88056154C>-	NCI-TCGA
NCI-TCGA novel	p.Phe453Leu	missense variant	-	NC_000008.11:g.88056142G>T	NCI-TCGA
NCI-TCGA novel	p.Arg458Gly	missense variant	-	NC_000008.11:g.88056129T>C	NCI-TCGA
rs1314246709	p.Arg458Ile	missense variant	-	NC_000008.11:g.88056128C>A	NCI-TCGA
rs1314246709	p.Arg458Ile	missense variant	-	NC_000008.11:g.88056128C>A	gnomAD
NCI-TCGA novel	p.Glu465Asp	missense variant	-	NC_000008.11:g.88046763T>G	NCI-TCGA
rs1323199288	p.Met466Ile	missense variant	-	NC_000008.11:g.88046760C>A	TOPMed
COSM3651616	p.Met466Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88046760C>T	NCI-TCGA Cosmic
rs997950104	p.Met469Val	missense variant	-	NC_000008.11:g.88046753T>C	gnomAD
rs1345397592	p.Met469Ile	missense variant	-	NC_000008.11:g.88046751C>T	gnomAD
rs1276415745	p.Pro471Leu	missense variant	-	NC_000008.11:g.88046746G>A	TOPMed,gnomAD
rs1276415745	p.Pro471Arg	missense variant	-	NC_000008.11:g.88046746G>C	TOPMed,gnomAD
NCI-TCGA novel	p.Thr478Pro	missense variant	-	NC_000008.11:g.88046726T>G	NCI-TCGA
NCI-TCGA novel	p.Trp480Cys	missense variant	-	NC_000008.11:g.88046718C>A	NCI-TCGA
COSM1472210	p.Gly482Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88046713C>T	NCI-TCGA Cosmic
rs1272034361	p.Ile483Val	missense variant	-	NC_000008.11:g.88046711T>C	TOPMed
NCI-TCGA novel	p.Glu485Gly	missense variant	-	NC_000008.11:g.88046704T>C	NCI-TCGA
NCI-TCGA novel	p.His493Arg	missense variant	-	NC_000008.11:g.88046680T>C	NCI-TCGA
rs1323032130	p.His493Tyr	missense variant	-	NC_000008.11:g.88046681G>A	TOPMed,gnomAD
COSM3901928	p.His493Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88046680T>G	NCI-TCGA Cosmic
COSM3901927	p.Lys494Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88046676T>A	NCI-TCGA Cosmic
rs762250691	p.Asn496Ser	missense variant	-	NC_000008.11:g.88046671T>C	ExAC,gnomAD
COSM3651614	p.Gly497Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88046669C>T	NCI-TCGA Cosmic
rs760938151	p.Thr499Met	missense variant	-	NC_000008.11:g.88041789G>A	NCI-TCGA,NCI-TCGA Cosmic
rs760938151	p.Thr499Met	missense variant	-	NC_000008.11:g.88041789G>A	ExAC,gnomAD
NCI-TCGA novel	p.Tyr502Ser	missense variant	-	NC_000008.11:g.88041780T>G	NCI-TCGA
NCI-TCGA novel	p.Gly504Arg	missense variant	-	NC_000008.11:g.88041775C>T	NCI-TCGA
COSM3651613	p.Gly504Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041774C>G	NCI-TCGA Cosmic
COSM3901926	p.Asn512His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041751T>G	NCI-TCGA Cosmic
rs1244860626	p.Gln513Arg	missense variant	-	NC_000008.11:g.88041747T>C	gnomAD
NCI-TCGA novel	p.Ile514Lys	missense variant	-	NC_000008.11:g.88041744A>T	NCI-TCGA
rs762633102	p.Ile514Val	missense variant	-	NC_000008.11:g.88041745T>C	ExAC,gnomAD
NCI-TCGA novel	p.Lys516Asn	missense variant	-	NC_000008.11:g.88041737C>G	NCI-TCGA
rs921880030	p.Val517Ala	missense variant	-	NC_000008.11:g.88041735A>G	TOPMed,gnomAD
rs1441585389	p.Val517Ile	missense variant	-	NC_000008.11:g.88041736C>T	gnomAD
NCI-TCGA novel	p.Glu518Gly	missense variant	-	NC_000008.11:g.88041732T>C	NCI-TCGA
NCI-TCGA novel	p.Glu518Ter	stop gained	-	NC_000008.11:g.88041733C>A	NCI-TCGA
NCI-TCGA novel	p.Pro519Thr	missense variant	-	NC_000008.11:g.88041730G>T	NCI-TCGA
rs1490374655	p.Pro519Leu	missense variant	-	NC_000008.11:g.88041729G>A	TOPMed
rs1198881072	p.Pro519Ser	missense variant	-	NC_000008.11:g.88041730G>A	gnomAD
NCI-TCGA novel	p.Ser524Pro	missense variant	-	NC_000008.11:g.88041715A>G	NCI-TCGA
rs1252028530	p.Ile525Val	missense variant	-	NC_000008.11:g.88041712T>C	gnomAD
NCI-TCGA novel	p.Leu526Ile	missense variant	-	NC_000008.11:g.88041709G>T	NCI-TCGA
COSM751509	p.Phe529Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041698A>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Met530Ile	missense variant	-	NC_000008.11:g.88041695C>A	NCI-TCGA
COSM2790060	p.Met530Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041695C>T	NCI-TCGA Cosmic
COSM6114155	p.Gly531Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041694C>A	NCI-TCGA Cosmic
COSM3651612	p.Asp533Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041686A>C	NCI-TCGA Cosmic
rs747698919	p.Gly534Glu	missense variant	-	NC_000008.11:g.88041684C>T	ExAC,gnomAD
rs747698919	p.Gly534Glu	missense variant	-	NC_000008.11:g.88041684C>T	NCI-TCGA
rs542654507	p.Thr536Ile	missense variant	-	NC_000008.11:g.88041678G>A	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp537Tyr	missense variant	-	NC_000008.11:g.88041676C>A	NCI-TCGA
rs1453861930	p.Arg538Gly	missense variant	-	NC_000008.11:g.88041673T>C	gnomAD
NCI-TCGA novel	p.Lys540ThrPheSerTerUnk	frameshift	-	NC_000008.11:g.88041666_88041667insG	NCI-TCGA
rs1331794828	p.Lys540Arg	missense variant	-	NC_000008.11:g.88041666T>C	gnomAD
rs1411371571	p.His543Tyr	missense variant	-	NC_000008.11:g.88041658G>A	gnomAD
NCI-TCGA novel	p.Pro546Arg	missense variant	-	NC_000008.11:g.88041648G>C	NCI-TCGA
COSM4391636	p.Asp547Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041646C>T	NCI-TCGA Cosmic
COSM1102279	p.Asp547Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041646C>A	NCI-TCGA Cosmic
rs1167461551	p.Asp548Asn	missense variant	-	NC_000008.11:g.88041643C>T	gnomAD
rs1387038010	p.Lys554Asn	missense variant	-	NC_000008.11:g.88041623T>G	gnomAD
NCI-TCGA novel	p.Ala559Thr	missense variant	-	NC_000008.11:g.88041610C>T	NCI-TCGA
COSM6114157	p.Ala559Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041609G>T	NCI-TCGA Cosmic
rs758151246	p.Ser560Asn	missense variant	-	NC_000008.11:g.88041606C>T	ExAC,gnomAD
rs750607147	p.Thr561Pro	missense variant	-	NC_000008.11:g.88041604T>G	ExAC,gnomAD
rs200606225	p.Val562Leu	missense variant	-	NC_000008.11:g.88041601C>A	1000Genomes,ExAC,gnomAD
rs200606225	p.Val562Leu	missense variant	-	NC_000008.11:g.88041601C>A	NCI-TCGA,NCI-TCGA Cosmic
rs1204560152	p.Ala564Asp	missense variant	-	NC_000008.11:g.88041594G>T	gnomAD
rs911606002	p.Ile567Met	missense variant	-	NC_000008.11:g.88041584A>C	TOPMed
COSM71661	p.Ile567Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041586T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Val568Ile	missense variant	-	NC_000008.11:g.88041583C>T	NCI-TCGA
rs1340076048	p.Val568Phe	missense variant	-	NC_000008.11:g.88041583C>A	gnomAD
NCI-TCGA novel	p.Ile569Leu	missense variant	-	NC_000008.11:g.88041580T>G	NCI-TCGA
rs553868301	p.Pro570Leu	missense variant	-	NC_000008.11:g.88041576G>A	1000Genomes,ExAC,gnomAD
COSM1569519	p.Cys571Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041573C>T	NCI-TCGA Cosmic
rs764500669	p.Ile572Val	missense variant	-	NC_000008.11:g.88041571T>C	ExAC
NCI-TCGA novel	p.Leu573Phe	missense variant	-	NC_000008.11:g.88041566C>A	NCI-TCGA
NCI-TCGA novel	p.Ala574Asp	missense variant	-	NC_000008.11:g.88041564G>T	NCI-TCGA
rs761175224	p.Ala574Val	missense variant	-	NC_000008.11:g.88041564G>A	ExAC,TOPMed,gnomAD
rs1282852938	p.Leu575Phe	missense variant	-	NC_000008.11:g.88041560T>A	gnomAD
COSM751510	p.Cys576Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041559A>G	NCI-TCGA Cosmic
rs1367664047	p.Leu578Phe	missense variant	-	NC_000008.11:g.88041553G>A	TOPMed
NCI-TCGA novel	p.Tyr582Asn	missense variant	-	NC_000008.11:g.88041541A>T	NCI-TCGA
rs772968248	p.Phe587Ile	missense variant	-	NC_000008.11:g.88041526A>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg589Lys	missense variant	-	NC_000008.11:g.88041519C>T	NCI-TCGA
rs1306973545	p.Arg589Gly	missense variant	-	NC_000008.11:g.88041520T>C	TOPMed,gnomAD
rs765029042	p.Arg589Thr	missense variant	-	NC_000008.11:g.88041519C>G	ExAC,gnomAD
COSM4790769	p.Arg589Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041519C>A	NCI-TCGA Cosmic
rs141880029	p.Lys590Arg	missense variant	-	NC_000008.11:g.88041516T>C	ESP,ExAC,TOPMed,gnomAD
rs577048107	p.Gly591Glu	missense variant	-	NC_000008.11:g.88041513C>T	1000Genomes,ExAC,gnomAD
rs577048107	p.Gly591Ala	missense variant	-	NC_000008.11:g.88041513C>G	1000Genomes,ExAC,gnomAD
COSM6114158	p.Gly591Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.88041513C>A	NCI-TCGA Cosmic
rs775321586	p.Thr592Pro	missense variant	-	NC_000008.11:g.88041511T>G	ExAC,gnomAD
rs745716157	p.Pro593Ala	missense variant	-	NC_000008.11:g.88041508G>C	ExAC,gnomAD
NCI-TCGA novel	p.Arg594His	missense variant	-	NC_000008.11:g.88041504C>T	NCI-TCGA
rs749473846	p.Arg594Ser	missense variant	-	NC_000008.11:g.88041505G>T	ExAC,gnomAD
rs749473846	p.Arg594Cys	missense variant	-	NC_000008.11:g.88041505G>A	ExAC,gnomAD
rs749473846	p.Arg594Cys	missense variant	-	NC_000008.11:g.88041505G>A	NCI-TCGA
NCI-TCGA novel	p.His595Gln	missense variant	-	NC_000008.11:g.88041500G>T	NCI-TCGA
rs777849325	p.Ile596Leu	missense variant	-	NC_000008.11:g.88041499T>A	ExAC
rs756165796	p.Arg601His	missense variant	-	NC_000008.11:g.88041483C>T	ExAC,TOPMed,gnomAD
rs1271222004	p.Arg601Cys	missense variant	-	NC_000008.11:g.88041484G>A	NCI-TCGA Cosmic
rs1271222004	p.Arg601Cys	missense variant	-	NC_000008.11:g.88041484G>A	TOPMed,gnomAD
rs753205155	p.Met603Val	missense variant	-	NC_000008.11:g.88041478T>C	ExAC,gnomAD
NCI-TCGA novel	p.Glu605Val	missense variant	-	NC_000008.11:g.88041471T>A	NCI-TCGA
rs755370022	p.Glu605Asp	missense variant	-	NC_000008.11:g.88041470C>G	ExAC,gnomAD
rs767948410	p.Glu605Ala	missense variant	-	NC_000008.11:g.88041471T>G	ExAC,gnomAD
NCI-TCGA novel	p.Ter608TrpGluUnkThrTerUnkUnk	stop lost	-	NC_000008.11:g.88041461T>C	NCI-TCGA

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0004114	Astrocytoma	disease	BEFREE
C0006287	Bronchopulmonary Dysplasia	disease	BEFREE;LHGDN
C0007134	Renal Cell Carcinoma	disease	BEFREE
C0017636	Glioblastoma	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0029463	Osteosarcoma	disease	BEFREE
C0036341	Schizophrenia	disease	GWASCAT;GWASDB
C0036690	Septicemia	disease	BEFREE
C0149931	Migraine Disorders	group	BEFREE
C0154723	Migraine with Aura	disease	BEFREE
C0178874	Tumor Progression	phenotype	BEFREE
C0206681	Adenocarcinoma, Clear Cell	disease	BEFREE
C0243026	Sepsis	disease	BEFREE
C0302592	Cervix carcinoma	disease	BEFREE
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0585442	Osteosarcoma of bone	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0686619	Secondary malignant neoplasm of lymph node	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0851887	Adenoviral infections	group	BEFREE
C1510586	Autism Spectrum Disorders	disease	GWASCAT
C1853195	Prostate Cancer, Hereditary, 7	disease	BEFREE
C2239176	Liver carcinoma	disease	BEFREE;LHGDN

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0004222	metalloendopeptidase activity	IBA
GO:0004222	metalloendopeptidase activity	IDA
GO:0008047	enzyme activator activity	TAS
GO:0008270	zinc ion binding	IDA
GO:0070006	metalloaminopeptidase activity	TAS
GO:0070006	metalloaminopeptidase activity	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001501	skeletal system development	IBA
GO:0001958	endochondral ossification	IEA
GO:0006508	proteolysis	TAS
GO:0006508	proteolysis	IDA
GO:0016485	protein processing	IDA
GO:0019538	protein metabolic process	TAS
GO:0022617	extracellular matrix disassembly	TAS
GO:0030198	extracellular matrix organization	IBA
GO:0030574	collagen catabolic process	IBA
GO:0035988	chondrocyte proliferation	IEA
GO:0043085	positive regulation of catalytic activity	IEA
GO:0048701	embryonic cranial skeleton morphogenesis	IEA
GO:0097094	craniofacial suture morphogenesis	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005615	extracellular space	IBA
GO:0005796	Golgi lumen	TAS
GO:0005886	plasma membrane	TAS
GO:0005887	integral component of plasma membrane	IBA
GO:0005887	integral component of plasma membrane	IDA
GO:0009986	cell surface	IEA
GO:0031012	extracellular matrix	IEA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1474228	Degradation of the extracellular matrix	TAS
R-HSA-1474244	Extracellular matrix organization	TAS
R-HSA-1592389	Activation of Matrix Metalloproteinases	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015056	1-Methyl-3-isobutylxanthine	[Dexamethasone co-treated with Rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of MMP16 mRNA	16054899
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in decreased expression of MMP16 mRNA	24810058
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MMP16 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MMP16 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MMP16 mRNA	27188386
D015124	8-Bromo Cyclic Adenosine Monophosphate	8-Bromo Cyclic Adenosine Monophosphate results in increased expression of MMP16 mRNA	20147733
C507011	A-83-01	[IGF1 protein co-treated with MM-589 co-treated with A-83-01 co-treated with PTC-209] results in decreased expression of MMP16 mRNA	31023824
D000082	Acetaminophen	Acetaminophen results in increased expression of MMP16 mRNA	29067470
C016601	afimoxifene	afimoxifene inhibits the reaction [Estrogens results in decreased expression of MMP16 mRNA]	21233418
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of MMP16 gene	27153756
D000639	Amitriptyline	Amitriptyline results in increased expression of MMP16 mRNA	22341215
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of MMP16 mRNA	16483693
D018501	Antirheumatic Agents	Antirheumatic Agents results in increased expression of MMP16 mRNA	24449571
D001151	Arsenic	Arsenic affects the methylation of MMP16 gene	25304211
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of MMP16 mRNA	25258189
C006780	bisphenol A	bisphenol A results in decreased expression of MMP16 mRNA	25181051
D002117	Calcitriol	Calcitriol results in decreased expression of MMP16 mRNA	21592394
D002117	Calcitriol	[Testosterone co-treated with Calcitriol] results in decreased expression of MMP16 mRNA	21592394
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of MMP16 mRNA	31150632
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased expression of MMP16 mRNA	15650781
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased expression of MMP16 protein	15650781
D002509	Cephaloridine	Cephaloridine results in increased expression of MMP16 mRNA	18500788
C097658	CGS 27023A	CGS 27023A affects the activity of MMP16 protein	22017477
C074702	chromium hexavalent ion	chromium hexavalent ion results in decreased expression of MMP16 mRNA	30690063
D002945	Cisplatin	Cisplatin results in increased expression of MMP16 mRNA	12066199
C018021	cobaltous chloride	cobaltous chloride results in decreased expression of MMP16 mRNA	19320972
D005576	Colforsin	Colforsin results in increased expression of MMP16 mRNA	16751804
D003375	Coumestrol	[Coumestrol co-treated with Resveratrol] results in decreased expression of MMP16 mRNA	19167446
D000077209	Decitabine	Decitabine results in decreased expression of MMP16 mRNA	27915011
D003907	Dexamethasone	[Dexamethasone co-treated with Rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of MMP16 mRNA	16054899
D004008	Diclofenac	Diclofenac results in increased expression of MMP16 mRNA	26934552
D004051	Diethylhexyl Phthalate	Diethylhexyl Phthalate results in decreased expression of MMP16 mRNA	31163220
D004237	Diuron	Diuron results in increased expression of MMP16 mRNA	21551480; 25152437;
C516138	dorsomorphin	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MMP16 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MMP16 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MMP16 mRNA	27188386
C118739	entinostat	entinostat results in decreased expression of MMP16 mRNA	26272509; 27188386;
C118739	entinostat	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MMP16 mRNA	27188386
D004958	Estradiol	Estradiol results in decreased expression of MMP16 mRNA	21185374
D004958	Estradiol	[Progesterone co-treated with Estradiol] results in decreased expression of MMP16 mRNA	20226447
D004967	Estrogens	afimoxifene inhibits the reaction [Estrogens results in decreased expression of MMP16 mRNA]	21233418
D004967	Estrogens	Estrogens results in decreased expression of MMP16 mRNA	21233418
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of MMP16 mRNA	29097150
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of MMP16 mRNA	23129252
C001277	geldanamycin	geldanamycin results in increased expression of MMP16 mRNA	26705709
D019833	Genistein	Genistein results in decreased expression of MMP16 mRNA	15754008
C071834	glycidamide	glycidamide results in decreased expression of MMP16 mRNA	17822822
D018021	Lithium Chloride	Lithium Chloride results in increased expression of MMP16 mRNA	16609697
C042720	mercuric bromide	mercuric bromide results in decreased expression of MMP16 mRNA	26272509
D008727	Methotrexate	Methotrexate results in increased expression of MMP16 mRNA	24449571
C004925	methylmercuric chloride	methylmercuric chloride results in decreased expression of MMP16 mRNA	28001369
D015741	Metribolone	Metribolone results in decreased expression of MMP16 mRNA	16751804
D015735	Mifepristone	Mifepristone results in increased expression of MMP16 mRNA	17584828
C000621807	MM-589	[IGF1 protein co-treated with MM-589 co-treated with A-83-01 co-treated with PTC-209] results in decreased expression of MMP16 mRNA	31023824
C029938	nickel sulfate	nickel sulfate results in decreased expression of MMP16 mRNA	22714537
D017239	Paclitaxel	Paclitaxel results in decreased expression of MMP16 mRNA	18058816
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MMP16 mRNA	27188386
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in decreased expression of MMP16 mRNA	26272509
C006253	pirinixic acid	pirinixic acid results in decreased expression of MMP16 mRNA	19162173
D010936	Plant Extracts	Plant Extracts results in decreased expression of MMP16 mRNA	23557933
C027373	potassium chromate(VI)	potassium chromate(VI) results in decreased expression of MMP16 mRNA	22714537
D011374	Progesterone	[Progesterone co-treated with Estradiol] results in decreased expression of MMP16 mRNA	20226447
D011374	Progesterone	Progesterone results in decreased expression of MMP16 mRNA	20226447
D011441	Propylthiouracil	Propylthiouracil results in increased expression of MMP16 mRNA	24780913
C586999	PTC-209	[IGF1 protein co-treated with MM-589 co-treated with A-83-01 co-treated with PTC-209] results in decreased expression of MMP16 mRNA	31023824
D000077185	Resveratrol	[Coumestrol co-treated with Resveratrol] results in decreased expression of MMP16 mRNA	19167446
D000077154	Rosiglitazone	[Dexamethasone co-treated with Rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of MMP16 mRNA	16054899
D012643	Selenium	Selenium results in decreased expression of MMP16 mRNA	17390030
D012834	Silver	Silver results in decreased expression of MMP16 mRNA	27131904
D012969	Sodium Fluoride	Sodium Fluoride results in decreased expression of MMP16 mRNA	27862939
D013739	Testosterone	[Testosterone co-treated with Calcitriol] results in decreased expression of MMP16 mRNA	21592394
D013739	Testosterone	Testosterone results in decreased expression of MMP16 mRNA	21592394
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of MMP16 mRNA	24680724
D013849	Thimerosal	Thimerosal affects the expression of MMP16 mRNA	27188386
C009495	titanium dioxide	titanium dioxide results in decreased expression of MMP16 mRNA	29264374
D014118	Toxins, Biological	Toxins, Biological affects the expression of MMP16 mRNA	19682533
D014212	Tretinoin	Tretinoin results in decreased expression of MMP16 mRNA	16609697
C012589	trichostatin A	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MMP16 mRNA	27188386
C012589	trichostatin A	trichostatin A results in increased expression of MMP16 mRNA	24935251; 26272509;
D014635	Valproic Acid	Valproic Acid results in decreased expression of MMP16 mRNA	23179753; 27188386;
D014635	Valproic Acid	Valproic Acid affects the splicing of MMP16 mRNA	29427782
D014635	Valproic Acid	Valproic Acid results in decreased expression of MMP16 mRNA	29427782
D014638	Vanadates	Vanadates results in increased expression of MMP16 mRNA	22714537
D001335	Vehicle Emissions	Vehicle Emissions results in increased methylation of MMP16 gene	25560391
C025643	vinclozolin	vinclozolin results in increased expression of MMP16 mRNA	23034163
D000077337	Vorinostat	Vorinostat results in decreased expression of MMP16 mRNA	27188386
D000077337	Vorinostat	Vorinostat results in increased expression of MMP16 mRNA	26272509

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0025	Alternative splicing
KW-0106	Calcium
KW-1003	Cell membrane
KW-0165	Cleavage on pair of basic residues
KW-0177	Collagen degradation
KW-1015	Disulfide bond
KW-0272	Extracellular matrix
KW-0325	Glycoprotein
KW-0378	Hydrolase
KW-0472	Membrane
KW-0479	Metal-binding
KW-0482	Metalloprotease
KW-0645	Protease
KW-1185	Reference proteome
KW-0677	Repeat
KW-0964	Secreted
KW-0732	Signal
KW-0812	Transmembrane
KW-1133	Transmembrane helix
KW-0862	Zinc
KW-0865	Zymogen

Interpro

InterPro ID	InterPro Term
IPR000585	Hemopexin-like_dom
IPR036375	Hemopexin-like_dom_sf
IPR018487	Hemopexin-like_repeat
IPR018486	Hemopexin_CS
IPR033739	M10A_MMP
IPR024079	MetalloPept_cat_dom_sf
IPR028697	MMP16
IPR001818	Pept_M10_metallopeptidase
IPR021190	Pept_M10A
IPR021805	Pept_M10A_metallopeptidase_C
IPR021158	Pept_M10A_Zn_BS
IPR006026	Peptidase_Metallo
IPR002477	Peptidoglycan-bd-like
IPR036365	PGBD-like_sf

PROSITE

PROSITE ID	PROSITE Term
PS00546	CYSTEINE_SWITCH
PS00024	HEMOPEXIN
PS51642	HEMOPEXIN_2
PS00142	ZINC_PROTEASE

Pfam

Pfam ID	Pfam Term
PF11857	DUF3377
PF00045	Hemopexin
PF00413	Peptidase_M10
PF01471	PG_binding_1

Gene: MMP16

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction