CleftGeneDB-Search

Gene: GTF2I

Basic information

Tag	Content
Uniprot ID	P78347; O14743; O15359; O43546; O43588; O43589; Q75M85; Q75M86; Q75M87; Q75M88; Q86U51; Q9BSZ4;
Entrez ID	2969
Genbank protein ID	EAW69598.1; AAS07461.1; AAB70791.1; AAC08312.1; AAS07464.1; AAB48826.1; AAH04472.1; AAS07460.1; AAC08314.1; AAC08315.1; CAA75163.1; AAC08313.1; AAP36118.1; AAS07463.1; AAH70484.1; AAS07462.1; AAL93085.1;
Genbank nucleotide ID	NM_033000.3; NM_001518.4; NM_001280800.1; NM_032999.3; NM_033001.3; NM_001163636.2;
Ensembl protein ID	ENSP00000482476; ENSP00000460070; ENSP00000404240; ENSP00000477837; ENSP00000484526;
Ensembl nucleotide ID	ENSG00000263001
Gene name	General transcription factor II-I
Gene symbol	GTF2I
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Interacts with the basal transcription machinery by coordinating the formation of a multiprotein complex at the C-FOS promoter, and linking specific signal responsive activator complexes. Promotes the formation of stable high-order complexes of SRF and PHOX1 and interacts cooperatively with PHOX1 to promote serum-inducible transcription of a reporter gene deriven by the C-FOS serum response element (SRE). Acts as a coregulator for USF1 by binding independently two promoter elements, a pyrimidine-rich initiator (Inr) and an upstream E-box. Required for the formation of functional ARID3A DNA-binding complexes and for activation of immunoglobulin heavy-chain transcription upon B-lymphocyte activation.
Sequence	MAQVAMSTLP VEDEESSESR MVVTFLMSAL ESMCKELAKS KAEVACIAVY ETDVFVVGTE 60 RGRAFVNTRK DFQKDFVKYC VEEEEKAAEM HKMKSTTQAN RMSVDAVEIE TLRKTVEDYF 120 CFCYGKALGK STVVPVPYEK MLRDQSAVVV QGLPEGVAFK HPENYDLATL KWILENKAGI 180 SFIIKRPFLE PKKHVGGRVM VTDADRSILS PGGSCGPIKV KTEPTEDSGI SLEMAAVTVK 240 EESEDPDYYQ YNIQAGPSET DDVDEKQPLS KPLQGSHHSS EGNEGTEMEV PAEDSTQHVP 300 SETSEDPEVE VTIEDDDYSP PSKRPKANEL PQPPVPEPAN AGKRKVREFN FEKWNARITD 360 LRKQVEELFE RKYAQAIKAK GPVTIPYPLF QSHVEDLYVE GLPEGIPFRR PSTYGIPRLE 420 RILLAKERIR FVIKKHELLN STREDLQLDK PASGVKEEWY ARITKLRKMV DQLFCKKFAE 480 ALGSTEAKAV PYQKFEAHPN DLYVEGLPEN IPFRSPSWYG IPRLEKIIQV GNRIKFVIKR 540 PELLTHSTTE VTQPRTNTPV KEDWNVRITK LRKQVEEIFN LKFAQALGLT EAVKVPYPVF 600 ESNPEFLYVE GLPEGIPFRS PTWFGIPRLE RIVRGSNKIK FVVKKPELVI SYLPPGMASK 660 INTKALQSPK RPRSPGSNSK VPEIEVTVEG PNNNNPQTSA VRTPTQTNGS NVPFKPRGRE 720 FSFEAWNAKI TDLKQKVENL FNEKCGEALG LKQAVKVPFA LFESFPEDFY VEGLPEGVPF 780 RRPSTFGIPR LEKILRNKAK IKFIIKKPEM FETAIKESTS SKSPPRKINS SPNVNTTASG 840 VEDLNIIQVT IPDDDNERLS KVEKARQLRE QVNDLFSRKF GEAIGMGFPV KVPYRKITIN 900 PGCVVVDGMP PGVSFKAPSY LEISSMRRIL DSAEFIKFTV IRPFPGLVIN NQLVDQSESE 960 GPVIQESAEP SQLEVPATEE IKETDGSSQI KQEPDPTW 998

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
2D9B
2DN4
2ED2
2EJE
2D9B
2DN4
2ED2

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	GTF2I	534669	A7MB80		Bos taurus	Prediction	More>>
1:1 ortholog	GTF2I	479714	F6Y258		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	GTF2I	102190656	A0A452DXC3		Capra hircus	Prediction	More>>
1:1 ortholog	GTF2I	2969	P78347		Homo sapiens	Prediction	More>>
1:1 ortholog	Gtf2i	14886	Q9ESZ8	CPO	Mus musculus	Publication	More>>
1:1 ortholog	GTF2I	100513345	F1RJL2		Sus scrofa	Prediction	More>>
1:1 ortholog	Gtf2i	353256	A0A0G2K4T7		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
NCI-TCGA novel	p.Ala2Thr	missense variant	-	NC_000007.14:g.74689132G>A	NCI-TCGA
rs1554396182	p.Val4Ala	missense variant	-	NC_000007.14:g.74689139T>C	gnomAD
rs1437851275	p.Ala5Gly	missense variant	-	NC_000007.14:g.74689142C>G	TOPMed
rs781807761	p.Met6Thr	missense variant	-	NC_000007.14:g.74689145T>C	ExAC,gnomAD
rs1554396201	p.Thr8Ala	missense variant	-	NC_000007.14:g.74689150A>G	gnomAD
rs1554396209	p.Leu9Ile	missense variant	-	NC_000007.14:g.74689153C>A	gnomAD
rs782767960	p.Pro10Ser	missense variant	-	NC_000007.14:g.74689156C>T	ExAC,gnomAD
rs782542929	p.Val11Ile	missense variant	-	NC_000007.14:g.74689159G>A	ExAC,TOPMed,gnomAD
rs1178011726	p.Glu14Asp	missense variant	-	NC_000007.14:g.74689170G>C	TOPMed,gnomAD
rs782177453	p.Ser17Leu	missense variant	-	NC_000007.14:g.74689178C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu18Lys	missense variant	-	NC_000007.14:g.74689180G>A	NCI-TCGA
NCI-TCGA novel	p.Arg20Ser	missense variant	-	NC_000007.14:g.74689188G>C	NCI-TCGA
rs1451194266	p.Met21Ile	missense variant	-	NC_000007.14:g.74689191G>T	TOPMed
rs782238246	p.Met21Val	missense variant	-	NC_000007.14:g.74689189A>G	ExAC
rs782199279	p.Met27Thr	missense variant	-	NC_000007.14:g.74689208T>C	ExAC,gnomAD
rs1554396246	p.Met27Leu	missense variant	-	NC_000007.14:g.74689207A>C	gnomAD
NCI-TCGA novel	p.Ser28Leu	missense variant	-	NC_000007.14:g.74689211C>T	NCI-TCGA
NCI-TCGA novel	p.Ala29Asp	missense variant	-	NC_000007.14:g.74689214C>A	NCI-TCGA
NCI-TCGA novel	p.Leu30Val	missense variant	-	NC_000007.14:g.74689216C>G	NCI-TCGA
rs1554396253	p.Met33Thr	missense variant	-	NC_000007.14:g.74689226T>C	-
NCI-TCGA novel	p.Ser40Phe	missense variant	-	NC_000007.14:g.74690992C>T	NCI-TCGA
rs782225301	p.Lys41Thr	missense variant	-	NC_000007.14:g.74690995A>C	ExAC,gnomAD
rs587739841	p.Lys41Glu	missense variant	-	NC_000007.14:g.74690994A>G	1000Genomes
rs201580003	p.Ala42Gly	missense variant	-	NC_000007.14:g.74690998C>G	1000Genomes
NCI-TCGA novel	p.Glu43Lys	missense variant	-	NC_000007.14:g.74691000G>A	NCI-TCGA
rs1554396888	p.Ile47Val	missense variant	-	NC_000007.14:g.74691012A>G	gnomAD
rs782022638	p.Asp53Gly	missense variant	-	NC_000007.14:g.74691031A>G	ExAC,gnomAD
rs368759932	p.Val54Met	missense variant	-	NC_000007.14:g.74691033G>A	ESP,TOPMed
NCI-TCGA novel	p.Val54Ala	missense variant	-	NC_000007.14:g.74691034T>C	NCI-TCGA
rs979904437	p.Phe55Leu	missense variant	-	NC_000007.14:g.74691038T>A	gnomAD
rs1261533732	p.Val56Leu	missense variant	-	NC_000007.14:g.74691039G>C	TOPMed
rs1283124989	p.Val57Ala	missense variant	-	NC_000007.14:g.74691043T>C	TOPMed
rs1486175636	p.Val57Ile	missense variant	-	NC_000007.14:g.74691042G>A	TOPMed
rs781967568	p.Arg63His	missense variant	-	NC_000007.14:g.74691061G>A	ExAC,gnomAD
rs924091625	p.Arg63Cys	missense variant	-	NC_000007.14:g.74691060C>T	gnomAD
rs1309950856	p.Val66Leu	missense variant	-	NC_000007.14:g.74691069G>C	TOPMed
NCI-TCGA novel	p.Val66Ile	missense variant	-	NC_000007.14:g.74691069G>A	NCI-TCGA
rs782088030	p.Asn67Asp	missense variant	-	NC_000007.14:g.74691072A>G	ExAC,gnomAD
NCI-TCGA novel	p.Lys70Asn	missense variant	-	NC_000007.14:g.74691083G>T	NCI-TCGA
NCI-TCGA novel	p.Asp71Tyr	missense variant	-	NC_000007.14:g.74691084G>T	NCI-TCGA
NCI-TCGA novel	p.Asp75Tyr	missense variant	-	NC_000007.14:g.74691096G>T	NCI-TCGA
rs782142169	p.Lys78Glu	missense variant	-	NC_000007.14:g.74691105A>G	ExAC,TOPMed,gnomAD
rs1554396930	p.Lys78Thr	missense variant	-	NC_000007.14:g.74691106A>C	gnomAD
rs200063075	p.Val81Leu	missense variant	-	NC_000007.14:g.74698963G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1245840914	p.Glu83Val	missense variant	-	NC_000007.14:g.74698970A>T	TOPMed,gnomAD
NCI-TCGA novel	p.Glu85Ter	stop gained	-	NC_000007.14:g.74698975G>T	NCI-TCGA
rs1323681403	p.Met90Thr	missense variant	-	NC_000007.14:g.74698991T>C	TOPMed
rs1554399155	p.Met93Val	missense variant	-	NC_000007.14:g.74698999A>G	gnomAD
NCI-TCGA novel	p.Lys94Thr	missense variant	-	NC_000007.14:g.74699003A>C	NCI-TCGA
rs1554399160	p.Ser95Cys	missense variant	-	NC_000007.14:g.74699006C>G	gnomAD
NCI-TCGA novel	p.Ser95Tyr	missense variant	-	NC_000007.14:g.74699006C>A	NCI-TCGA
rs782230656	p.Thr96Ala	missense variant	-	NC_000007.14:g.74699008A>G	ExAC,TOPMed,gnomAD
rs1554399163	p.Thr97Ala	missense variant	-	NC_000007.14:g.74699011A>G	gnomAD
rs1554399167	p.Asn100His	missense variant	-	NC_000007.14:g.74699020A>C	gnomAD
rs782120808	p.Arg101Gln	missense variant	-	NC_000007.14:g.74699024G>A	ExAC,TOPMed,gnomAD
rs782003787	p.Arg101Trp	missense variant	-	NC_000007.14:g.74699023C>T	ExAC,TOPMed,gnomAD
rs782003787	p.Arg101Gly	missense variant	-	NC_000007.14:g.74699023C>G	ExAC,TOPMed,gnomAD
rs1445142239	p.Ser103Asn	missense variant	-	NC_000007.14:g.74699030G>A	TOPMed
rs906057032	p.Val104Ile	missense variant	-	NC_000007.14:g.74699032G>A	TOPMed,gnomAD
rs782413639	p.Asp105His	missense variant	-	NC_000007.14:g.74699035G>C	ExAC,gnomAD
rs1458112170	p.Ala106Thr	missense variant	-	NC_000007.14:g.74699038G>A	TOPMed
NCI-TCGA novel	p.Val107Leu	missense variant	-	NC_000007.14:g.74699041G>C	NCI-TCGA
rs1369813298	p.Ile109Leu	missense variant	-	NC_000007.14:g.74699047A>C	TOPMed
rs150259949	p.Tyr119Cys	missense variant	-	NC_000007.14:g.74699078A>G	ESP,TOPMed,gnomAD
rs782737598	p.Tyr119His	missense variant	-	NC_000007.14:g.74699077T>C	ExAC,gnomAD
RCV000489869	p.Tyr119Cys	missense variant	-	NC_000007.14:g.74699078A>G	ClinVar
rs1554399211	p.Phe122Tyr	missense variant	-	NC_000007.14:g.74699087T>A	gnomAD
NCI-TCGA novel	p.Cys123Trp	missense variant	-	NC_000007.14:g.74699091C>G	NCI-TCGA
rs782799288	p.Leu128Phe	missense variant	-	NC_000007.14:g.74700257A>C	ExAC,gnomAD
NCI-TCGA novel	p.Thr132TyrPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.74700266_74700278CACAGTGGTACCT>-	NCI-TCGA
rs782057203	p.Val133Met	missense variant	-	NC_000007.14:g.74700270G>A	ExAC,gnomAD
rs1378271459	p.Val134Leu	missense variant	-	NC_000007.14:g.74700273G>T	TOPMed
NCI-TCGA novel	p.Pro135Thr	missense variant	-	NC_000007.14:g.74700276C>A	NCI-TCGA
NCI-TCGA novel	p.Lys140Glu	missense variant	-	NC_000007.14:g.74700291A>G	NCI-TCGA
rs145729076	p.Arg143Gln	missense variant	-	NC_000007.14:g.74700301G>A	ESP,ExAC,TOPMed,gnomAD
rs1064765	p.Arg143Gly	missense variant	-	NC_000007.14:g.74700300C>G	ExAC,gnomAD
rs1064765	p.Arg143Ter	stop gained	-	NC_000007.14:g.74700300C>T	ExAC,gnomAD
rs782450205	p.Gln145His	missense variant	-	NC_000007.14:g.74700308G>T	ExAC,gnomAD
rs782450205	p.Gln145His	missense variant	-	NC_000007.14:g.74700308G>C	ExAC,gnomAD
rs782481420	p.Ser146Leu	missense variant	-	NC_000007.14:g.74700310C>T	ExAC,TOPMed,gnomAD
rs782228824	p.Ser146Pro	missense variant	-	NC_000007.14:g.74700309T>C	ExAC,TOPMed,gnomAD
rs782411031	p.Val148Met	missense variant	-	NC_000007.14:g.74700315G>A	ExAC,gnomAD
rs782411031	p.Val148Leu	missense variant	-	NC_000007.14:g.74700315G>C	ExAC,gnomAD
rs782015737	p.Gln151Arg	missense variant	-	NC_000007.14:g.74700325A>G	ExAC,TOPMed,gnomAD
rs782204993	p.Pro154Arg	missense variant	-	NC_000007.14:g.74700334C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro154Leu	missense variant	-	NC_000007.14:g.74700334C>T	NCI-TCGA
NCI-TCGA novel	p.Pro154Ser	missense variant	-	NC_000007.14:g.74700333C>T	NCI-TCGA
rs782793898	p.Ala158Val	missense variant	-	NC_000007.14:g.74700346C>T	ExAC
rs781788087	p.Glu163Asp	missense variant	-	NC_000007.14:g.74700362G>C	ExAC,gnomAD
rs587656081	p.Glu163Lys	missense variant	-	NC_000007.14:g.74700360G>A	1000Genomes,ExAC,gnomAD
rs1554399541	p.Asn164Tyr	missense variant	-	NC_000007.14:g.74700363A>T	gnomAD
rs1417416844	p.Leu167Val	missense variant	-	NC_000007.14:g.74700372C>G	TOPMed,gnomAD
rs1554399550	p.Leu167His	missense variant	-	NC_000007.14:g.74700373T>A	gnomAD
NCI-TCGA novel	p.Trp172Cys	missense variant	-	NC_000007.14:g.74700389G>T	NCI-TCGA
rs1057896	p.Leu174Val	missense variant	-	NC_000007.14:g.74700393T>G	UniProt,dbSNP
VAR_051026	p.Leu174Val	missense variant	-	NC_000007.14:g.74700393T>G	UniProt
rs1057896	p.Leu174Val	missense variant	-	NC_000007.14:g.74700393T>G	-
NCI-TCGA novel	p.Glu175Asp	missense variant	-	NC_000007.14:g.74700398G>C	NCI-TCGA
rs1249824042	p.Phe182Leu	missense variant	-	NC_000007.14:g.74700419C>A	TOPMed,gnomAD
NCI-TCGA novel	p.Phe182HisPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.74700416_74700417insCACTCGGCTAATTTTTTTTT	NCI-TCGA
NCI-TCGA novel	p.Phe182IlePheSerTerUnk	frameshift	-	NC_000007.14:g.74700415_74700416insT	NCI-TCGA
rs1489561711	p.Lys185Glu	missense variant	-	NC_000007.14:g.74700426A>G	TOPMed
rs1259679158	p.Pro187Ser	missense variant	-	NC_000007.14:g.74700607C>T	TOPMed
NCI-TCGA novel	p.Leu189Ter	frameshift	-	NC_000007.14:g.74700609T>-	NCI-TCGA
rs782702015	p.His194Asn	missense variant	-	NC_000007.14:g.74700628C>A	ExAC,gnomAD
rs782702015	p.His194Asp	missense variant	-	NC_000007.14:g.74700628C>G	ExAC,gnomAD
rs1554399641	p.His194Leu	missense variant	-	NC_000007.14:g.74700629A>T	gnomAD
rs147069558	p.His194Gln	missense variant	-	NC_000007.14:g.74700630T>A	ESP,ExAC,TOPMed,gnomAD
rs782431867	p.Val195Ala	missense variant	-	NC_000007.14:g.74700632T>C	TOPMed,gnomAD
rs781936472	p.Gly196Val	missense variant	-	NC_000007.14:g.74705164G>T	ExAC,gnomAD
rs373330111	p.Gly197Cys	missense variant	-	NC_000007.14:g.74705166G>T	ESP,ExAC,TOPMed,gnomAD
rs202085514	p.Arg198His	missense variant	-	NC_000007.14:g.74705170G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1163463075	p.Arg198Cys	missense variant	-	NC_000007.14:g.74705169C>T	TOPMed
NCI-TCGA novel	p.Val199Leu	missense variant	-	NC_000007.14:g.74705172G>C	NCI-TCGA
rs782134662	p.Thr202Ile	missense variant	-	NC_000007.14:g.74705182C>T	ExAC,gnomAD
rs781911148	p.Ala204Ser	missense variant	-	NC_000007.14:g.74705187G>T	ExAC,TOPMed,gnomAD
rs781911148	p.Ala204Thr	missense variant	-	NC_000007.14:g.74705187G>A	ExAC,TOPMed,gnomAD
rs782580708	p.Arg206Gly	missense variant	-	NC_000007.14:g.74705193A>G	ExAC,gnomAD
rs781834137	p.Arg206Lys	missense variant	-	NC_000007.14:g.74705194G>A	ExAC,gnomAD
rs368674948	p.Ser207Leu	missense variant	-	NC_000007.14:g.74705197C>T	ESP,ExAC,gnomAD
rs587751698	p.Ser207Thr	missense variant	-	NC_000007.14:g.74705196T>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1554401029	p.Ser210Tyr	missense variant	-	NC_000007.14:g.74705206C>A	gnomAD
rs1554401032	p.Pro211Thr	missense variant	-	NC_000007.14:g.74705208C>A	gnomAD
NCI-TCGA novel	p.Pro211Ala	missense variant	-	NC_000007.14:g.74705208C>G	NCI-TCGA
rs886875869	p.Gly212Ser	missense variant	-	NC_000007.14:g.74705211G>A	TOPMed
rs1554401036	p.Gly213Ala	missense variant	-	NC_000007.14:g.74705215G>C	gnomAD
rs1049146200	p.Pro217Ser	missense variant	-	NC_000007.14:g.74706397C>T	gnomAD
rs1554401414	p.Ile218Met	missense variant	-	NC_000007.14:g.74706402C>G	gnomAD
rs1554401416	p.Lys219Ile	missense variant	-	NC_000007.14:g.74706404A>T	gnomAD
NCI-TCGA novel	p.Val220Leu	missense variant	-	NC_000007.14:g.74706406G>T	NCI-TCGA
NCI-TCGA novel	p.Glu223Lys	missense variant	-	NC_000007.14:g.74706415G>A	NCI-TCGA
rs1554401421	p.Thr225Ile	missense variant	-	NC_000007.14:g.74706422C>T	gnomAD
rs782450272	p.Asp227Gly	missense variant	-	NC_000007.14:g.74706428A>G	ExAC,gnomAD
rs782564844	p.Ser228Ala	missense variant	-	NC_000007.14:g.74706430T>G	ExAC,gnomAD
rs1554401426	p.Ser228Cys	missense variant	-	NC_000007.14:g.74706431C>G	gnomAD
rs143885919	p.Ile230Ser	missense variant	-	NC_000007.14:g.74711035T>G	1000Genomes,ExAC,gnomAD
rs1554402418	p.Ser231Phe	missense variant	-	NC_000007.14:g.74711038C>T	gnomAD
rs781878557	p.Leu232Pro	missense variant	-	NC_000007.14:g.74711041T>C	ExAC,TOPMed,gnomAD
rs1554402432	p.Ala235Pro	missense variant	-	NC_000007.14:g.74711049G>C	gnomAD
rs1554402435	p.Ala236Thr	missense variant	-	NC_000007.14:g.74711052G>A	gnomAD
rs782675626	p.Thr238Ser	missense variant	-	NC_000007.14:g.74711058A>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln250Glu	missense variant	-	NC_000007.14:g.74711094C>G	NCI-TCGA
rs1554402445	p.Tyr251Cys	missense variant	-	NC_000007.14:g.74711098A>G	gnomAD
NCI-TCGA novel	p.Pro257Arg	missense variant	-	NC_000007.14:g.74714863C>G	NCI-TCGA
rs782392915	p.Asp261Glu	missense variant	-	NC_000007.14:g.74714876T>G	ExAC,gnomAD
rs782167572	p.Val263Ala	missense variant	-	NC_000007.14:g.74714881T>C	ExAC,TOPMed,gnomAD
rs781987759	p.Val263Ile	missense variant	-	NC_000007.14:g.74714880G>A	ExAC,gnomAD
rs782406901	p.Asp264Glu	missense variant	-	NC_000007.14:g.74714885T>G	ExAC,TOPMed,gnomAD
rs782057494	p.Lys266Asn	missense variant	-	NC_000007.14:g.74714891A>C	ExAC,gnomAD
rs781866719	p.Ser270Leu	missense variant	-	NC_000007.14:g.74714902C>T	ExAC,gnomAD
rs781866719	p.Ser270Trp	missense variant	-	NC_000007.14:g.74714902C>G	ExAC,gnomAD
rs374288797	p.Lys271Glu	missense variant	-	NC_000007.14:g.74714904A>G	ExAC,gnomAD
rs374288797	p.Lys271Gln	missense variant	-	NC_000007.14:g.74714904A>C	ExAC,gnomAD
rs1284748851	p.Gly275Arg	missense variant	-	NC_000007.14:g.74714916G>C	TOPMed
NCI-TCGA novel	p.Gly275Glu	missense variant	-	NC_000007.14:g.74716894G>A	NCI-TCGA
rs1554403740	p.His277Asn	missense variant	-	NC_000007.14:g.74716899C>A	gnomAD
rs1554403745	p.His278Gln	missense variant	-	NC_000007.14:g.74716904T>G	gnomAD
rs1554403742	p.His278Tyr	missense variant	-	NC_000007.14:g.74716902C>T	gnomAD
rs781919341	p.Gly282Val	missense variant	-	NC_000007.14:g.74716915G>T	ExAC,TOPMed,gnomAD
rs782819986	p.Val290Ala	missense variant	-	NC_000007.14:g.74716939T>C	ExAC,gnomAD
NCI-TCGA novel	p.Asp294Asn	missense variant	-	NC_000007.14:g.74716950G>A	NCI-TCGA
rs1554404076	p.Ser295Phe	missense variant	-	NC_000007.14:g.74718882C>T	gnomAD
rs1554404078	p.Thr296Asn	missense variant	-	NC_000007.14:g.74718885C>A	gnomAD
rs1554404077	p.Thr296Ser	missense variant	-	NC_000007.14:g.74718884A>T	gnomAD
rs1554404079	p.Gln297His	missense variant	-	NC_000007.14:g.74718889A>T	gnomAD
rs202059251	p.Val299Ile	missense variant	-	NC_000007.14:g.74718893G>A	ESP,ExAC,TOPMed,gnomAD
rs951680847	p.Val299Ala	missense variant	-	NC_000007.14:g.74718894T>C	TOPMed
rs781952004	p.Pro300His	missense variant	-	NC_000007.14:g.74718897C>A	ExAC,gnomAD
rs201733311	p.Thr303Ala	missense variant	-	NC_000007.14:g.74718905A>G	1000Genomes
rs1554404092	p.Glu308Lys	missense variant	-	NC_000007.14:g.74718920G>A	gnomAD
NCI-TCGA novel	p.Glu310Lys	missense variant	-	NC_000007.14:g.74718926G>A	NCI-TCGA
rs1554404093	p.Val311Glu	missense variant	-	NC_000007.14:g.74718930T>A	gnomAD
rs782779434	p.Ile313Ser	missense variant	-	NC_000007.14:g.74718936T>G	ExAC,gnomAD
rs782130738	p.Ile313Val	missense variant	-	NC_000007.14:g.74718935A>G	ExAC,TOPMed,gnomAD
rs1554406188	p.Asp316Gly	missense variant	-	NC_000007.14:g.74728789A>G	gnomAD
rs1554406191	p.Tyr318Asp	missense variant	-	NC_000007.14:g.74728794T>G	gnomAD
rs1554406192	p.Pro321Leu	missense variant	-	NC_000007.14:g.74728804C>T	gnomAD
rs1554406198	p.Pro331Leu	missense variant	-	NC_000007.14:g.74728834C>T	gnomAD
rs1195145913	p.Pro336Leu	missense variant	-	NC_000007.14:g.74728849C>T	TOPMed,gnomAD
rs1251817960	p.Asn340Ser	missense variant	-	NC_000007.14:g.74728861A>G	TOPMed,gnomAD
rs1466700180	p.Asn340His	missense variant	-	NC_000007.14:g.74728860A>C	TOPMed
rs1337735458	p.Gln364Lys	missense variant	-	NC_000007.14:g.74730264C>A	TOPMed
NCI-TCGA novel	p.Ala374Val	missense variant	-	NC_000007.14:g.74732479C>T	NCI-TCGA
rs782443780	p.Gln375Lys	missense variant	-	NC_000007.14:g.74732481C>A	ExAC,gnomAD
rs782608384	p.Lys378Arg	missense variant	-	NC_000007.14:g.74732491A>G	ExAC,TOPMed,gnomAD
rs782215532	p.Pro382Leu	missense variant	-	NC_000007.14:g.74732503C>T	ExAC,gnomAD
rs782631790	p.Thr384Met	missense variant	-	NC_000007.14:g.74732509C>T	ExAC,TOPMed,gnomAD
rs782048314	p.Pro388Ala	missense variant	-	NC_000007.14:g.74732520C>G	ExAC,gnomAD
NCI-TCGA novel	p.Pro388Thr	missense variant	-	NC_000007.14:g.74732520C>A	NCI-TCGA
NCI-TCGA novel	p.Leu389Val	missense variant	-	NC_000007.14:g.74732523C>G	NCI-TCGA
rs1614448	p.Gln391Ter	stop gained	-	NC_000007.14:g.74732529C>T	gnomAD
NCI-TCGA novel	p.Gly401Arg	missense variant	-	NC_000007.14:g.74732559G>C	NCI-TCGA
NCI-TCGA novel	p.Leu402HisPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.74732554_74732581TAGAAGGACTTCCTGAAGGAATTCCTTT>-	NCI-TCGA
rs782139658	p.Ser412Cys	missense variant	-	NC_000007.14:g.74732593C>G	ExAC,gnomAD
rs1404561582	p.Tyr414Ter	stop gained	-	NC_000007.14:g.74732599dup	TOPMed
NCI-TCGA novel	p.Tyr414Ter	stop gained	-	NC_000007.14:g.74732598_74732599insA	NCI-TCGA
rs1417975794	p.Glu420Gly	missense variant	-	NC_000007.14:g.74732617A>G	TOPMed
NCI-TCGA novel	p.Leu424His	missense variant	-	NC_000007.14:g.74732629T>A	NCI-TCGA
NCI-TCGA novel	p.Glu427Ter	stop gained	-	NC_000007.14:g.74732637G>T	NCI-TCGA
NCI-TCGA novel	p.Arg428Thr	missense variant	-	NC_000007.14:g.74732641G>C	NCI-TCGA
rs782059244	p.Arg430Cys	missense variant	-	NC_000007.14:g.74732646C>T	ExAC,gnomAD
rs782683917	p.Arg430His	missense variant	-	NC_000007.14:g.74732647G>A	ExAC,TOPMed,gnomAD
rs782319002	p.Glu437Ala	missense variant	-	NC_000007.14:g.74733928A>C	ExAC,gnomAD
NCI-TCGA novel	p.Glu437Gln	missense variant	-	NC_000007.14:g.74733927G>C	NCI-TCGA
rs1135649	p.Asn440Ser	missense variant	-	NC_000007.14:g.74733937A>G	ExAC,gnomAD
rs782742467	p.Ser441Ala	missense variant	-	NC_000007.14:g.74733939T>G	ExAC,TOPMed,gnomAD
rs782742467	p.Ser441Pro	missense variant	-	NC_000007.14:g.74733939T>C	ExAC,TOPMed,gnomAD
rs1554407205	p.Thr442Ala	missense variant	-	NC_000007.14:g.74733942A>G	gnomAD
rs587719538	p.Arg443Cys	missense variant	-	NC_000007.14:g.74733945C>T	1000Genomes,ExAC,gnomAD
rs782113008	p.Arg443His	missense variant	-	NC_000007.14:g.74733946G>A	ExAC,gnomAD
NCI-TCGA novel	p.Leu446Val	missense variant	-	NC_000007.14:g.74733954T>G	NCI-TCGA
NCI-TCGA novel	p.Leu448Phe	missense variant	-	NC_000007.14:g.74733960C>T	NCI-TCGA
NCI-TCGA novel	p.Asp449His	missense variant	-	NC_000007.14:g.74733963G>C	NCI-TCGA
rs1554407207	p.Lys450Asn	missense variant	-	NC_000007.14:g.74733968G>C	gnomAD
NCI-TCGA novel	p.Pro451Ser	missense variant	-	NC_000007.14:g.74733969C>T	NCI-TCGA
NCI-TCGA novel	p.Ser453Leu	missense variant	-	NC_000007.14:g.74733976C>T	NCI-TCGA
rs1554407395	p.Thr464Ser	missense variant	-	NC_000007.14:g.74735488C>G	gnomAD
rs1554407468	p.Ile528Val	missense variant	-	NC_000007.14:g.74736646A>G	TOPMed
rs1472417767	p.Asn532Ser	missense variant	-	NC_000007.14:g.74736659A>G	TOPMed,gnomAD
rs781923720	p.Leu544Arg	missense variant	-	NC_000007.14:g.74738056T>G	ExAC,gnomAD
rs782735877	p.His546Arg	missense variant	-	NC_000007.14:g.74738062A>G	ExAC,gnomAD
rs782103148	p.His546Asp	missense variant	-	NC_000007.14:g.74738061C>G	ExAC,TOPMed,gnomAD
rs1554407674	p.Thr549Ala	missense variant	-	NC_000007.14:g.74738070A>G	gnomAD
rs782521291	p.Thr549Ile	missense variant	-	NC_000007.14:g.74738071C>T	ExAC,gnomAD
rs1554407677	p.Thr552Ala	missense variant	-	NC_000007.14:g.74738079A>G	gnomAD
rs141809495	p.Gln553Glu	missense variant	-	NC_000007.14:g.74738082C>G	ESP,ExAC,TOPMed,gnomAD
rs781797507	p.Gln553His	missense variant	-	NC_000007.14:g.74738084G>C	ExAC,TOPMed,gnomAD
rs781797507	p.Gln553His	missense variant	-	NC_000007.14:g.74738084G>T	ExAC,TOPMed,gnomAD
rs782615736	p.Thr556Met	missense variant	-	NC_000007.14:g.74738092C>T	ExAC,gnomAD
rs782516515	p.Thr558Ala	missense variant	-	NC_000007.14:g.74738097A>G	ExAC,gnomAD
rs782637508	p.Pro559Ala	missense variant	-	NC_000007.14:g.74738100C>G	ExAC,gnomAD
rs1439328322	p.Lys561Arg	missense variant	-	NC_000007.14:g.74743452A>G	TOPMed
rs1270640072	p.Asn565Ser	missense variant	-	NC_000007.14:g.74743464A>G	TOPMed
rs1554408523	p.Thr569Ser	missense variant	-	NC_000007.14:g.74743476C>G	gnomAD
rs782552411	p.Arg572Gln	missense variant	-	NC_000007.14:g.74743485G>A	ExAC,TOPMed,gnomAD
rs1554408524	p.Arg572Trp	missense variant	-	NC_000007.14:g.74743484C>T	gnomAD
NCI-TCGA novel	p.Leu581Phe	missense variant	-	NC_000007.14:g.74743513G>C	NCI-TCGA
rs1354973364	p.Phe583Cys	missense variant	-	NC_000007.14:g.74743518T>G	TOPMed,gnomAD
rs200729390	p.Leu587Phe	missense variant	-	NC_000007.14:g.74744766C>T	1000Genomes,ExAC,gnomAD
rs1554408829	p.Pro596Arg	missense variant	-	NC_000007.14:g.74744794C>G	gnomAD
rs1554408829	p.Pro596Leu	missense variant	-	NC_000007.14:g.74744794C>T	gnomAD
rs1554408832	p.Tyr597His	missense variant	-	NC_000007.14:g.74744796T>C	gnomAD
rs1554408833	p.Pro598Ala	missense variant	-	NC_000007.14:g.74744799C>G	gnomAD
rs1554408835	p.Pro604Ser	missense variant	-	NC_000007.14:g.74744817C>T	gnomAD
rs1554408837	p.Pro604Arg	missense variant	-	NC_000007.14:g.74744818C>G	TOPMed,gnomAD
rs1554408837	p.Pro604Leu	missense variant	-	NC_000007.14:g.74744818C>T	TOPMed,gnomAD
rs201985028	p.Leu607Phe	missense variant	-	NC_000007.14:g.74744828G>C	ExAC,TOPMed,gnomAD
rs1554408844	p.Glu614Gln	missense variant	-	NC_000007.14:g.74744847G>C	gnomAD
rs782219254	p.Pro617Ala	missense variant	-	NC_000007.14:g.74744856C>G	ExAC,gnomAD
rs782219254	p.Pro617Ser	missense variant	-	NC_000007.14:g.74744856C>T	ExAC,gnomAD
rs1554408856	p.Arg619Ter	stop gained	-	NC_000007.14:g.74744862C>T	gnomAD
rs782305536	p.Arg619Gln	missense variant	-	NC_000007.14:g.74744863G>A	ExAC,gnomAD
rs1554408858	p.Ser620Arg	missense variant	-	NC_000007.14:g.74744867C>G	gnomAD
rs782412315	p.Thr622Ser	missense variant	-	NC_000007.14:g.74744872C>G	ExAC,gnomAD
rs1554408861	p.Pro627Leu	missense variant	-	NC_000007.14:g.74744887C>T	gnomAD
rs1554408866	p.Arg628Ter	stop gained	-	NC_000007.14:g.74744889C>T	gnomAD
rs1554408868	p.Arg628Gln	missense variant	-	NC_000007.14:g.74744890G>A	gnomAD
rs782334160	p.Ile632Asn	missense variant	-	NC_000007.14:g.74744902T>A	ExAC,gnomAD
rs139477988	p.Val633Ile	missense variant	-	NC_000007.14:g.74744904G>A	1000Genomes,ESP,ExAC,gnomAD
rs587647930	p.Arg634Cys	missense variant	-	NC_000007.14:g.74744907C>T	1000Genomes,ExAC,gnomAD
rs1554408877	p.Arg634His	missense variant	-	NC_000007.14:g.74744908G>A	gnomAD
rs782067111	p.Gly635Arg	missense variant	-	NC_000007.14:g.74744910G>A	ExAC,TOPMed,gnomAD
rs782708791	p.Ser636Cys	missense variant	-	NC_000007.14:g.74744913A>T	ExAC,gnomAD
rs1554408879	p.Val642Ile	missense variant	-	NC_000007.14:g.74744931G>A	gnomAD
rs782253272	p.Glu647Gly	missense variant	-	NC_000007.14:g.74745888A>G	ExAC,gnomAD
rs1554409026	p.Ile650Val	missense variant	-	NC_000007.14:g.74745896A>G	gnomAD
NCI-TCGA novel	p.Ile650Phe	missense variant	-	NC_000007.14:g.74745896A>T	NCI-TCGA
rs1554409030	p.Tyr652Asp	missense variant	-	NC_000007.14:g.74745902T>G	gnomAD
rs1554409033	p.Tyr652Cys	missense variant	-	NC_000007.14:g.74745903A>G	gnomAD
rs587597791	p.Pro655His	missense variant	-	NC_000007.14:g.74745912C>A	1000Genomes
rs782031290	p.Gly656Glu	missense variant	-	NC_000007.14:g.74745915G>A	ExAC,gnomAD
rs1554409041	p.Ala658Ser	missense variant	-	NC_000007.14:g.74745920G>T	gnomAD
rs1330426057	p.Thr663Ile	missense variant	-	NC_000007.14:g.74745936C>T	TOPMed
rs1554409043	p.Lys664Glu	missense variant	-	NC_000007.14:g.74745938A>G	gnomAD
rs782325579	p.Lys664Arg	missense variant	-	NC_000007.14:g.74745939A>G	ExAC,TOPMed,gnomAD
rs1554409118	p.Arg673Gln	missense variant	-	NC_000007.14:g.74746361G>A	gnomAD
rs1250627760	p.Val688Met	missense variant	-	NC_000007.14:g.74746405G>A	TOPMed,gnomAD
rs782621842	p.Asn693Ser	missense variant	-	NC_000007.14:g.74748024A>G	ExAC,TOPMed,gnomAD
rs1221518361	p.Arg702Gln	missense variant	-	NC_000007.14:g.74748051G>A	TOPMed,gnomAD
rs1488726890	p.Thr703Ala	missense variant	-	NC_000007.14:g.74748053A>G	TOPMed,gnomAD
rs1554409427	p.Thr703Ile	missense variant	-	NC_000007.14:g.74748054C>T	gnomAD
rs1554409431	p.Pro704Leu	missense variant	-	NC_000007.14:g.74748057C>T	gnomAD
rs200224470	p.Thr707Ile	missense variant	-	NC_000007.14:g.74748066C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1554409438	p.Gly709Ser	missense variant	-	NC_000007.14:g.74748071G>A	gnomAD
rs1344216605	p.Val712Leu	missense variant	-	NC_000007.14:g.74748080G>C	TOPMed,gnomAD
rs1344216605	p.Val712Ile	missense variant	-	NC_000007.14:g.74748080G>A	TOPMed,gnomAD
rs1401055646	p.Arg717Ter	stop gained	-	NC_000007.14:g.74748095C>T	TOPMed,gnomAD
rs1411232624	p.Ala725Ser	missense variant	-	NC_000007.14:g.74749027G>T	TOPMed
rs1199881888	p.Ile730Val	missense variant	-	NC_000007.14:g.74749042A>G	TOPMed
rs1322085555	p.Ala760Thr	missense variant	-	NC_000007.14:g.74749309G>A	TOPMed,gnomAD
rs1228687461	p.Tyr770Phe	missense variant	-	NC_000007.14:g.74749340A>T	TOPMed,gnomAD
rs1307717022	p.Ser784Leu	missense variant	-	NC_000007.14:g.74749382C>T	TOPMed
rs1554409610	p.Pro789Leu	missense variant	-	NC_000007.14:g.74749397C>T	gnomAD
rs1363861905	p.Ile805Val	missense variant	-	NC_000007.14:g.74749444A>G	TOPMed
rs1554409943	p.Glu812Gly	missense variant	-	NC_000007.14:g.74751375A>G	gnomAD
rs1554409946	p.Thr813Met	missense variant	-	NC_000007.14:g.74751378C>T	gnomAD
rs1554409948	p.Ala814Val	missense variant	-	NC_000007.14:g.74751381C>T	gnomAD
rs1554409953	p.Ser818Asn	missense variant	-	NC_000007.14:g.74751393G>A	gnomAD
rs1232358974	p.Ile828Val	missense variant	-	NC_000007.14:g.74752095A>G	TOPMed
rs1554410010	p.Pro832His	missense variant	-	NC_000007.14:g.74752108C>A	gnomAD
rs1323958246	p.Asn833Asp	missense variant	-	NC_000007.14:g.74752110A>G	TOPMed,gnomAD
rs1323958246	p.Asn833His	missense variant	-	NC_000007.14:g.74752110A>C	TOPMed,gnomAD
rs781951551	p.Asn833Ser	missense variant	-	NC_000007.14:g.74752111A>G	ExAC,TOPMed,gnomAD
rs782261089	p.Ser839Leu	missense variant	-	NC_000007.14:g.74752129C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser839Ter	stop gained	-	NC_000007.14:g.74752129C>G	NCI-TCGA
rs782382396	p.Gly840Arg	missense variant	-	NC_000007.14:g.74752131G>C	ExAC,TOPMed,gnomAD
rs782036223	p.Asp843Glu	missense variant	-	NC_000007.14:g.74752142C>G	ExAC,TOPMed,gnomAD
rs782149583	p.Thr850Ala	missense variant	-	NC_000007.14:g.74752161A>G	ExAC,gnomAD
rs1554410018	p.Asp853Tyr	missense variant	-	NC_000007.14:g.74752170G>T	gnomAD
NCI-TCGA novel	p.Asp853Gly	missense variant	-	NC_000007.14:g.74753094A>G	NCI-TCGA
NCI-TCGA novel	p.Asp854Asn	missense variant	-	NC_000007.14:g.74753096G>A	NCI-TCGA
rs782601028	p.Asp855Tyr	missense variant	-	NC_000007.14:g.74753099G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu857Ter	stop gained	-	NC_000007.14:g.74753105G>T	NCI-TCGA
NCI-TCGA novel	p.Leu859Ile	missense variant	-	NC_000007.14:g.74753111C>A	NCI-TCGA
NCI-TCGA novel	p.Ser860Leu	missense variant	-	NC_000007.14:g.74753115C>T	NCI-TCGA
rs782184501	p.Ser860Trp	missense variant	-	NC_000007.14:g.74753115C>G	ExAC,gnomAD
rs1554410253	p.Val862Ala	missense variant	-	NC_000007.14:g.74753121T>C	gnomAD
NCI-TCGA novel	p.Val862Asp	missense variant	-	NC_000007.14:g.74753121T>A	NCI-TCGA
NCI-TCGA novel	p.Lys864Asn	missense variant	-	NC_000007.14:g.74753128A>T	NCI-TCGA
NCI-TCGA novel	p.Ala865SerPheSerTerUnk	frameshift	-	NC_000007.14:g.74753123_74753124insA	NCI-TCGA
rs1554410257	p.Gln867Ter	stop gained	-	NC_000007.14:g.74753135C>T	gnomAD
rs1443752038	p.Gln871Ter	stop gained	-	NC_000007.14:g.74753147C>T	TOPMed
rs781998365	p.Val872Ala	missense variant	-	NC_000007.14:g.74753151T>C	ExAC,gnomAD
NCI-TCGA novel	p.Asn873Thr	missense variant	-	NC_000007.14:g.74753154A>C	NCI-TCGA
rs1554410265	p.Phe876Ile	missense variant	-	NC_000007.14:g.74753162T>A	gnomAD
rs782012327	p.Arg878Gln	missense variant	-	NC_000007.14:g.74753169G>A	ExAC,TOPMed,gnomAD
rs782419989	p.Arg878Trp	missense variant	-	NC_000007.14:g.74753168C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys879Glu	missense variant	-	NC_000007.14:g.74753171A>G	NCI-TCGA
rs782688212	p.Phe880Ser	missense variant	-	NC_000007.14:g.74753175T>C	ExAC,gnomAD
rs1353189544	p.Ile899Val	missense variant	-	NC_000007.14:g.74753899A>G	TOPMed
NCI-TCGA novel	p.Pro911ArgPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.74753932C>-	NCI-TCGA
NCI-TCGA novel	p.Glu922Gly	missense variant	-	NC_000007.14:g.74753969A>G	NCI-TCGA
NCI-TCGA novel	p.Ser932Cys	missense variant	-	NC_000007.14:g.74753999C>G	NCI-TCGA
rs1377780079	p.Leu953Pro	missense variant	-	NC_000007.14:g.74756823T>C	TOPMed
rs1554410763	p.Val954Ile	missense variant	-	NC_000007.14:g.74756825G>A	gnomAD
rs1279686438	p.Asp955His	missense variant	-	NC_000007.14:g.74756828G>C	TOPMed
rs1554410765	p.Ser957Asn	missense variant	-	NC_000007.14:g.74756835G>A	gnomAD
rs1554410769	p.Ser959Thr	missense variant	-	NC_000007.14:g.74756840T>A	gnomAD
rs373687583	p.Ser959Leu	missense variant	-	NC_000007.14:g.74756841C>T	ESP,ExAC,gnomAD
rs1554410770	p.Gly961Val	missense variant	-	NC_000007.14:g.74756847G>T	gnomAD
rs782277108	p.Val963Met	missense variant	-	NC_000007.14:g.74756852G>A	ExAC,TOPMed,gnomAD
rs1554410915	p.Pro970Gln	missense variant	-	NC_000007.14:g.74757971C>A	gnomAD
rs1554410921	p.Pro976Leu	missense variant	-	NC_000007.14:g.74757989C>T	gnomAD
rs1554410923	p.Ala977Asp	missense variant	-	NC_000007.14:g.74757992C>A	gnomAD
rs782593847	p.Glu980Lys	missense variant	-	NC_000007.14:g.74758000G>A	ExAC,gnomAD
rs1253960859	p.Glu980Gly	missense variant	-	NC_000007.14:g.74758780A>G	TOPMed,gnomAD
rs1554411118	p.Ile981Met	missense variant	-	NC_000007.14:g.74758784A>G	gnomAD
NCI-TCGA novel	p.Ile981Val	missense variant	-	NC_000007.14:g.74758782A>G	NCI-TCGA
rs1209186099	p.Thr984Pro	missense variant	-	NC_000007.14:g.74758791A>C	TOPMed
rs1554411119	p.Asp985Asn	missense variant	-	NC_000007.14:g.74758794G>A	gnomAD
rs1554411125	p.Ser987Gly	missense variant	-	NC_000007.14:g.74758800A>G	gnomAD
NCI-TCGA novel	p.Gln989Glu	missense variant	-	NC_000007.14:g.74758806C>G	NCI-TCGA
rs1554411127	p.Ile990Val	missense variant	-	NC_000007.14:g.74758809A>G	gnomAD
rs1260199641	p.Pro996His	missense variant	-	NC_000007.14:g.74758828C>A	TOPMed
rs1554411135	p.Pro996Thr	missense variant	-	NC_000007.14:g.74758827C>A	gnomAD
rs1339916973	p.Thr997Met	missense variant	-	NC_000007.14:g.74758831C>T	TOPMed

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0000737	Abdominal Pain	phenotype	HPO
C0000768	Congenital Abnormality	group	BEFREE
C0003467	Anxiety	disease	BEFREE;HPO
C0003469	Anxiety Disorders	group	BEFREE
C0003477	Separation Anxiety Disorder	disease	BEFREE
C0003499	Supravalvular aortic stenosis	disease	HPO
C0003862	Arthralgia	phenotype	HPO
C0004352	Autistic Disorder	group	BEFREE;HPO
C0004903	Beckwith-Wiedemann Syndrome	disease	BEFREE
C0005744	Blepharophimosis	disease	HPO
C0006386	Bunion	phenotype	HPO
C0006826	Malignant Neoplasms	group	BEFREE
C0007786	Brain Ischemia	disease	HPO
C0009241	Cognition Disorders	group	BEFREE
C0009806	Constipation	phenotype	HPO
C0011581	Depressive disorder	disease	HPO
C0012811	Colon diverticulum anatomic structure	phenotype	HPO
C0012819	Diverticular disease of colon	disease	HPO
C0015371	Extrapyramidal Disorders	group	HPO
C0016202	Flatfoot	phenotype	HPO
C0018536	Hallux Valgus	phenotype	HPO
C0018784	Sensorineural Hearing Loss (disorder)	disease	HPO
C0019294	Hernia, Inguinal	phenotype	HPO
C0019825	Hoarseness	phenotype	HPO
C0020437	Hypercalcemia	disease	HPO
C0020438	Hypercalciuria	phenotype	HPO
C0020545	Hypertension, Renovascular	disease	HPO
C0020608	Hypodontia	disease	HPO
C0022821	Kyphosis deformity of spine	phenotype	HPO
C0023467	Leukemia, Myelocytic, Acute	disease	CTD_human
C0024003	Lordosis	phenotype	HPO
C0024141	Lupus Erythematosus, Systemic	disease	BEFREE
C0024421	Macroglossia	disease	HPO
C0024433	Macrostomia	disease	HPO
C0024636	Malocclusion	phenotype	HPO
C0025362	Mental Retardation	disease	BEFREE;HPO
C0025990	Micrognathism	disease	HPO
C0026266	Mitral Valve Insufficiency	phenotype	HPO
C0026267	Mitral Valve Prolapse Syndrome	disease	HPO
C0026827	Muscle hypotonia	phenotype	HPO
C0026838	Muscle Spasticity	phenotype	HPO
C0026998	Acute Myeloid Leukemia, M1	disease	CTD_human
C0027498	Nausea and vomiting	phenotype	HPO
C0028754	Obesity	disease	HPO
C0028768	Obsessive-Compulsive Disorder	disease	HPO
C0029925	Ovarian Carcinoma	disease	BEFREE
C0033687	Proteinuria	phenotype	HPO
C0034880	Hyperacusis	phenotype	HPO
C0035078	Kidney Failure	disease	HPO
C0038379	Strabismus	disease	HPO
C0038454	Cerebrovascular accident	group	HPO
C0040034	Thrombocytopenia	phenotype	BEFREE
C0040100	Thymoma	disease	BEFREE
C0040822	Tremor	phenotype	HPO
C0042798	Low Vision	disease	HPO
C0085159	Seasonal Affective Disorder	disease	BEFREE
C0086981	Sicca Syndrome	disease	CTD_human
C0149754	Cellulitis of periorbital region	disease	HPO
C0151205	Periorbital edema	phenotype	HPO
C0151449	Primary Sj?gren's syndrome	disease	BEFREE
C0151576	Elevated creatine kinase	phenotype	HPO
C0151889	Hyperreflexia	phenotype	HPO
C0152421	Macrotia	disease	HPO
C0162298	Joint stiffness	phenotype	HPO
C0175702	Williams Syndrome	disease	BEFREE;CTD_human;MGD;ORPHANET
C0221209	Pelvic kidney	disease	HPO
C0232487	Abdominal discomfort	phenotype	HPO
C0234133	Extrapyramidal sign	phenotype	HPO
C0234144	Dysgraphia	phenotype	HPO
C0234162	Cerebellar Dysmetria	phenotype	HPO
C0237326	Dyschezia	phenotype	HPO
C0239676	High forehead	phenotype	HPO
C0240340	Microdontia (disorder)	disease	HPO
C0241005	Creatine phosphokinase serum increased	phenotype	HPO
C0264133	Acquired flat foot	phenotype	HPO
C0266061	Open Bite	phenotype	HPO
C0266453	Exencephaly	disease	BEFREE
C0266623	Congenital anomaly of neck	group	HPO
C0271441	Chronic otitis media	disease	HPO
C0279000	Liver and Intrahepatic Biliary Tract Carcinoma	disease	BEFREE
C0280781	Adult Pilocytic Astrocytoma	disease	BEFREE
C0332606	Elfin facies	phenotype	HPO
C0334583	Pilocytic Astrocytoma	disease	BEFREE
C0338656	Impaired cognition	disease	BEFREE
C0345030	Peripheral pulmonary artery stenosis	disease	HPO
C0345904	Malignant neoplasm of liver	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0423903	Low intelligence	phenotype	HPO
C0424688	Small head	phenotype	HPO
C0424810	Periorbital swelling	phenotype	HPO
C0426414	Small nose	phenotype	HPO
C0426848	Sacral dimples	phenotype	HPO
C0554972	Large auricle	phenotype	HPO
C0575167	Deformity of neck	phenotype	HPO
C0576093	Knee joint valgus deformity	phenotype	HPO
C0581342	Redundant skin	phenotype	HPO
C0600104	Obsessive compulsive behavior	disease	HPO
C0600139	Prostate carcinoma	disease	BEFREE
C0678230	Congenital Epicanthus	disease	HPO
C0687713	Gastrointestinal pain	phenotype	HPO
C0700613	Anxiety state	disease	BEFREE
C0743359	Chronic ear infection	disease	HPO
C0751466	Phonophobia	disease	HPO
C0917798	Cerebral Ischemia	disease	HPO
C0917801	Sleeplessness	phenotype	HPO
C0917816	Mental deficiency	disease	HPO
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1263846	Attention deficit hyperactivity disorder	disease	HPO
C1266101	Thymic epithelial tumor	disease	CTD_human
C1279420	Anxiety neurosis (finding)	disease	BEFREE
C1305420	Prominent ear	phenotype	HPO
C1306459	Primary malignant neoplasm	group	BEFREE
C1314691	Age at menarche	phenotype	GWASCAT
C1368683	Epithelioma	disease	BEFREE
C1510586	Autism Spectrum Disorders	disease	BEFREE;CTD_human
C1527281	Separation anxiety disorder of childhood	disease	BEFREE
C1527336	Sjogren's Syndrome	disease	CTD_human;GWASCAT
C1565489	Renal Insufficiency	disease	HPO
C1836150	Gait imbalance	phenotype	HPO
C1837279	Hypoplastic toenails	phenotype	HPO
C1837463	Narrow face	phenotype	HPO
C1839604	Renal failure in adulthood	phenotype	HPO
C1839739	Thick lower lip vermilion	phenotype	HPO
C1839764	Broad flat nasal bridge	phenotype	HPO
C1843367	Poor school performance	phenotype	HPO
C1844505	Pointed chin	phenotype	HPO
C1845112	Hyperkyphosis	phenotype	HPO
C1845847	Coarse facial features	phenotype	HPO
C1849089	Broad forehead	phenotype	HPO
C1849121	Thin face	phenotype	HPO
C1849367	Nasal bridge wide	phenotype	HPO
C1850049	Clinodactyly of the 5th finger	disease	HPO
C1850189	Large pinnae	phenotype	HPO
C1853246	Everted lower lip vermilion	phenotype	HPO
C1854114	Short nose	phenotype	HPO
C1855285	Protruding ear	phenotype	HPO
C1856872	Down-sloping shoulders	phenotype	HPO
C1857130	Hypoplastic mandible condyle	phenotype	HPO
C1857486	Low-set, posteriorly rotated ears	phenotype	HPO
C1865014	Long philtrum	phenotype	HPO
C1866234	Protruding lower lip	phenotype	HPO
C1867873	Failure to thrive in infancy	phenotype	HPO
C1879321	Acute Myeloid Leukemia (AML-M2)	disease	CTD_human
C1956257	Pulmonary Stenosis	disease	HPO
C2053437	Full lower lip	phenotype	HPO
C3551535	Mitral regurgitation, mild	phenotype	HPO
C3665347	Visual Impairment	phenotype	HPO
C3714756	Intellectual Disability	group	BEFREE;HPO;LHGDN
C4020847	Abnormality of pelvic girdle bone morphology	phenotype	HPO
C4020876	Dull intelligence	phenotype	HPO
C4020884	Anxiety disease	disease	HPO
C4021242	Hypoplasia of the zygomatic bone	phenotype	HPO
C4021782	Abnormality of the fingernails	phenotype	HPO
C4021800	Abnormality of dental enamel	phenotype	HPO
C4022386	Overfriendliness	phenotype	HPO
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4024665	High-grade hypermetropia	phenotype	HPO
C4025788	Nystagmus-induced head nodding	disease	HPO
C4072825	Thickened facial skin with coarse facial features	phenotype	HPO
C4072879	Small cheekbone	phenotype	HPO
C4280262	Dystrophic tooth enamel	phenotype	HPO
C4280368	Hypotrophic cheekbone	phenotype	HPO
C4280369	Flattening of the zygomatic bone	phenotype	HPO
C4280370	Depressed cheekbone	phenotype	HPO
C4280538	Curvature of little finger	phenotype	HPO
C4280611	Decreased size of teeth	phenotype	HPO
C4280612	Decreased width of tooth	phenotype	HPO
C4280613	Angle class 3 malocclusion	phenotype	HPO
C4280614	Angle class 2 malocclusion	disease	HPO
C4280615	Defective tooth enamel	phenotype	HPO
C4280628	Malformation of the neck	phenotype	HPO
C4476523	Decreased projection of lower jaw	phenotype	HPO
C4476524	Decreased projection of mandible	phenotype	HPO
C4476525	Retrusion of lower jaw	phenotype	HPO
C4477058	Fragmented sleep	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0003677	DNA binding	IEA
GO:0003700	DNA-binding transcription factor activity	IEA
GO:0005515	protein binding	IPI

GO:Biological Process

GO ID	GO Term	Evidence
GO:0006355	regulation of transcription, DNA-templated	IEA
GO:0006366	transcription by RNA polymerase II	TAS
GO:0006367	transcription initiation from RNA polymerase II promoter	TAS
GO:0007165	signal transduction	TAS
GO:0016525	negative regulation of angiogenesis	IDA
GO:0051481	negative regulation of cytosolic calcium ion concentration	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005623	cell	IEA
GO:0005634	nucleus	IDA
GO:0005654	nucleoplasm	IDA
GO:0005737	cytoplasm	IEA
GO:0016020	membrane	HDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence

Drugs and compounds information

ID	Drug Name	Action	PubMed
C517943	1-(4-(6-bromobenzo(1,3)dioxol-5-yl)-3a,4,5,9b-tetrahydro-3H-cyclopenta(c)quinolin-8-yl)ethanone	1-(4-(6-bromobenzo(1,3)dioxol-5-yl)-3a,4,5,9b-tetrahydro-3H-cyclopenta(c)quinolin-8-yl)ethanone results in decreased phosphorylation of GTF2I protein	27026707
D015632	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine results in decreased expression of GTF2I mRNA	15329391
C078765	2,3,5-(triglutathion-S-yl)hydroquinone	2,3,5-(triglutathion-S-yl)hydroquinone affects the localization of and results in decreased phosphorylation of GTF2I protein	31165168
C078765	2,3,5-(triglutathion-S-yl)hydroquinone	[2,3,5-(triglutathion-S-yl)hydroquinone results in increased abundance of Reactive Oxygen Species] which affects the activity of GTF2I protein	31165168
C078765	2,3,5-(triglutathion-S-yl)hydroquinone	2,3,5-(triglutathion-S-yl)hydroquinone results in increased ADP-ribosylation of GTF2I protein	31165168
C014211	2,3,7,8-tetrachlorodibenzofuran	2,3,7,8-tetrachlorodibenzofuran affects the expression of GTF2I mRNA	18343893
C009505	4,4'-diaminodiphenylmethane	4,4'-diaminodiphenylmethane results in increased expression of GTF2I mRNA	18648102
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of GTF2I mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of GTF2I mRNA	27188386
C496492	abrine	abrine results in decreased expression of GTF2I mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in decreased expression of GTF2I mRNA	21420995; 29067470;
D000082	Acetaminophen	Acetaminophen affects the expression of GTF2I mRNA	17562736
D000082	Acetaminophen	[Clofibrate co-treated with Acetaminophen] affects the expression of GTF2I mRNA	17585979
D000082	Acetaminophen	PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of GTF2I mRNA]	17585979
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of GTF2I mRNA	16483693
D000661	Amphetamine	Amphetamine results in decreased expression of GTF2I mRNA	30779732
D001241	Aspirin	Aspirin results in decreased expression of GTF2I mRNA	11906190
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of GTF2I mRNA	26238291
C044887	beta-methylcholine	beta-methylcholine affects the expression of GTF2I mRNA	21179406
C006780	bisphenol A	bisphenol A affects the methylation of GTF2I promoter	27334623
C006780	bisphenol A	bisphenol A results in decreased expression of GTF2I mRNA	29161229
C006780	bisphenol A	bisphenol A affects the expression of GTF2I mRNA	25181051
C006780	bisphenol A	[bisphenol A co-treated with Estradiol] results in decreased expression of GTF2I mRNA	26496021
C018475	butyraldehyde	butyraldehyde results in decreased expression of GTF2I mRNA	26079696
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of GTF2I mRNA	26472689
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of GTF2I mRNA	31150632
C026690	cerous chloride	cerous chloride results in decreased expression of GTF2I mRNA	28954213
D002994	Clofibrate	[Clofibrate co-treated with Acetaminophen] affects the expression of GTF2I mRNA	17585979
D002994	Clofibrate	Clofibrate results in decreased expression of GTF2I mRNA	17585979
D002994	Clofibrate	PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of GTF2I mRNA]	17585979
C018021	cobaltous chloride	cobaltous chloride results in decreased expression of GTF2I mRNA	19320972
D003300	Copper	Copper results in increased expression of GTF2I mRNA	30556269
D019327	Copper Sulfate	Copper Sulfate results in decreased expression of GTF2I mRNA	19549813
D004054	Diethylstilbestrol	Diethylstilbestrol results in decreased expression of GTF2I mRNA	15171707
D013196	Dihydrotestosterone	Dihydrotestosterone results in increased expression of GTF2I mRNA	17023530
C516138	dorsomorphin	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of GTF2I mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of GTF2I mRNA	27188386
D013759	Dronabinol	Dronabinol affects the methylation of GTF2I gene	26044905
D004726	Endosulfan	Endosulfan results in decreased expression of GTF2I mRNA	29391264
D004791	Enzyme Inhibitors	[Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of GTF2I protein	23301498
D004958	Estradiol	Estradiol results in decreased phosphorylation of GTF2I protein	27026707
D004958	Estradiol	[bisphenol A co-treated with Estradiol] results in decreased expression of GTF2I mRNA	26496021
D000431	Ethanol	Ethanol affects the splicing of GTF2I mRNA	30319688
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of GTF2I mRNA	17555576
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of GTF2I mRNA	17942748
D004997	Ethinyl Estradiol	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of GTF2I mRNA	17942748
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of GTF2I mRNA	17351261; 17557909;
D005485	Flutamide	Flutamide results in decreased expression of GTF2I mRNA	24793618
C039281	furan	furan results in increased methylation of GTF2I gene	22079235
D005897	Glafenine	Glafenine results in decreased expression of GTF2I mRNA	24136188
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of GTF2I mRNA	25613284
D007657	Ketone Bodies	Ketone Bodies results in increased expression of GTF2I mRNA	16807920
D019344	Lactic Acid	Lactic Acid results in decreased expression of GTF2I mRNA	30851411
D008694	Methamphetamine	Methamphetamine affects the expression of GTF2I mRNA	29802913
D008701	Methapyrilene	Methapyrilene results in decreased expression of GTF2I mRNA	30467583
C000622638	MLN7243	MLN7243 results in decreased sumoylation of GTF2I protein	31285264
C517284	monomethyl phthalate	monomethyl phthalate affects the expression of GTF2I mRNA	26924002
D009151	Mustard Gas	Mustard Gas results in decreased expression of GTF2I mRNA	15674843
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in decreased expression of GTF2I mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in decreased expression of GTF2I mRNA	25554681
C014707	nitrosobenzylmethylamine	nitrosobenzylmethylamine results in decreased expression of GTF2I mRNA	17616710
D018817	N-Methyl-3,4-methylenedioxyamphetamine	N-Methyl-3,4-methylenedioxyamphetamine results in increased expression of GTF2I mRNA	20188158
D017239	Paclitaxel	Paclitaxel results in decreased expression of GTF2I mRNA	15000894
D019308	Palmitic Acid	Palmitic Acid results in decreased phosphorylation of GTF2I protein	28073184
C023036	perfluorooctanoic acid	perfluorooctanoic acid results in decreased expression of GTF2I protein	26879310
D010705	Phosgene	Phosgene affects the expression of GTF2I mRNA	16300373
C006253	pirinixic acid	pirinixic acid results in decreased expression of GTF2I mRNA	18445702
C045950	propiconazole	propiconazole results in decreased expression of GTF2I mRNA	21278054
D017382	Reactive Oxygen Species	[2,3,5-(triglutathion-S-yl)hydroquinone results in increased abundance of Reactive Oxygen Species] which affects the activity of GTF2I protein	31165168
C513635	S-2-pentyl-4-pentynoic hydroxamic acid	S-2-pentyl-4-pentynoic hydroxamic acid results in decreased expression of GTF2I mRNA	21427059
D012822	Silicon Dioxide	Silicon Dioxide analog results in decreased expression of GTF2I mRNA	25895662
C009277	sodium arsenate	sodium arsenate results in increased expression of GTF2I mRNA	30953684
C017947	sodium arsenite	sodium arsenite results in increased expression of GTF2I mRNA	28229933
D013629	Tamoxifen	Tamoxifen affects the expression of GTF2I mRNA	17555576
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in decreased expression of GTF2I mRNA	15336504
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of GTF2I mRNA	18343893; 21570461;
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin binds to AHR protein] which results in increased expression of GTF2I mRNA	16214954
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of GTF2I mRNA	17942748
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of GTF2I mRNA	15328365; 18796159;
D013749	Tetrachlorodibenzodioxin	[TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in increased expression of GTF2I mRNA	25975270
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of GTF2I mRNA	25613284
C009495	titanium dioxide	titanium dioxide results in increased expression of GTF2I mRNA	29264374
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased expression of GTF2I mRNA	28065790
D019772	Topotecan	GTF2I protein affects the susceptibility to Topotecan	16217747
C012589	trichostatin A	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of GTF2I mRNA	27188386
C012589	trichostatin A	trichostatin A affects the expression of GTF2I mRNA	28542535
C012589	trichostatin A	trichostatin A results in decreased expression of GTF2I mRNA	24935251
C016805	tris(1,3-dichloro-2-propyl)phosphate	tris(1,3-dichloro-2-propyl)phosphate results in decreased expression of GTF2I mRNA	26179874
D014414	Tungsten	Tungsten results in decreased expression of GTF2I mRNA	30912803
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of GTF2I mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of GTF2I mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in decreased expression of GTF2I mRNA	23179753; 26272509; 28001369;
D014635	Valproic Acid	Valproic Acid results in decreased expression of GTF2I mRNA	19136453; 20546886; 21427059;
D014747	Vinblastine	GTF2I protein affects the susceptibility to Vinblastine	16217747
C025643	vinclozolin	vinclozolin affects the expression of GTF2I mRNA	19015723
D024483	Vitamin K 3	Vitamin K 3 affects the expression of GTF2I mRNA	20044591
D000077337	Vorinostat	Vorinostat results in decreased expression of GTF2I mRNA	27188386
D000077211	Zoledronic Acid	Zoledronic Acid results in increased expression of GTF2I mRNA	20977926

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0007	Acetylation
KW-0025	Alternative splicing
KW-0963	Cytoplasm
KW-0903	Direct protein sequencing
KW-0238	DNA-binding
KW-1017	Isopeptide bond
KW-0539	Nucleus
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0677	Repeat
KW-0804	Transcription
KW-0805	Transcription regulation
KW-0832	Ubl conjugation
KW-0856	Williams-Beuren syndrome

Interpro

InterPro ID	InterPro Term
IPR004212	GTF2I
IPR036647	GTF2I-like_rpt_sf
IPR016659	TF_II-I

PROSITE

PROSITE ID	PROSITE Term
PS51139	GTF2I

Pfam

Pfam ID	Pfam Term
PF02946	GTF2I

Gene: GTF2I

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction