CleftGeneDB-Search

Gene: SMAD4

Basic information

Tag	Content
Uniprot ID	Q13485; A8K405;
Entrez ID	4089
Genbank protein ID	BAF83459.1; EAW62985.1; AAH02379.1; AAC03051.1; AAA91041.1;
Genbank nucleotide ID	NM_005359.5
Ensembl protein ID	ENSP00000381452; ENSP00000341551;
Ensembl nucleotide ID	ENSG00000141646
Gene name	Mothers against decapentaplegic homolog 4
Gene symbol	SMAD4
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	In muscle physiology, plays a central role in the balance between atrophy and hypertrophy. When recruited by MSTN, promotes atrophy response via phosphorylated SMAD2/4. MSTN decrease causes SMAD4 release and subsequent recruitment by the BMP pathway to promote hypertrophy via phosphorylated SMAD1/5/8. Acts synergistically with SMAD1 and YY1 in bone morphogenetic protein (BMP)-mediated cardiac-specific gene expression. Binds to SMAD binding elements (SBEs) (5'-GTCT/AGAC-3') within BMP response element (BMPRE) of cardiac activating regions (By similarity). Common SMAD (co-SMAD) is the coactivator and mediator of signal transduction by TGF-beta (transforming growth factor). Component of the heterotrimeric SMAD2/SMAD3-SMAD4 complex that forms in the nucleus and is required for the TGF-mediated signaling (PubMed:25514493). Promotes binding of the SMAD2/SMAD4/FAST-1 complex to DNA and provides an activation function required for SMAD1 or SMAD2 to stimulate transcription. Component of the multimeric SMAD3/SMAD4/JUN/FOS complex which forms at the AP1 promoter site; required for synergistic transcriptional activity in response to TGF-beta. May act as a tumor suppressor. Positively regulates PDPK1 kinase activity by stimulating its dissociation from the 14-3-3 protein YWHAQ which acts as a negative regulator.
Sequence	MDNMSITNTP TSNDACLSIV HSLMCHRQGG ESETFAKRAI ESLVKKLKEK KDELDSLITA 60 ITTNGAHPSK CVTIQRTLDG RLQVAGRKGF PHVIYARLWR WPDLHKNELK HVKYCQYAFD 120 LKCDSVCVNP YHYERVVSPG IDLSGLTLQS NAPSSMMVKD EYVHDFEGQP SLSTEGHSIQ 180 TIQHPPSNRA STETYSTPAL LAPSESNATS TANFPNIPVA STSQPASILG GSHSEGLLQI 240 ASGPQPGQQQ NGFTGQPATY HHNSTTTWTG SRTAPYTPNL PHHQNGHLQH HPPMPPHPGH 300 YWPVHNELAF QPPISNHPAP EYWCSIAYFE MDVQVGETFK VPSSCPIVTV DGYVDPSGGD 360 RFCLGQLSNV HRTEAIERAR LHIGKGVQLE CKGEGDVWVR CLSDHAVFVQ SYYLDREAGR 420 APGDAVHKIY PSAYIKVFDL RQCHRQMQQQ AATAQAAAAA QAAAVAGNIP GPGSVGGIAP 480 AISLSAAAGI GVDDLRRLCI LRMSFVKGWG PDYPRQSIKE TPCWIEIHLH RALQLLDEVL 540 HTMPIADPQP LD 552

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
1DD1
1G88
1MR1
1U7F
1U7V
1YGS
5C4V
5MEY
5MEZ
5MF0
5UWU
1DD1
1U7F
1YGS
5MEY

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Developmental stage	Species	Evidence	Details
1:1 ortholog	SMAD4	540248	B0JYL0			Bos taurus	Prediction	More>>
1:1 ortholog	SMAD4		A0A5F4CED2			Canis lupus familiaris	Prediction	More>>
1:1 ortholog	SMAD4		A0A452F8L3			Capra hircus	Prediction	More>>
1:1 ortholog	SMAD4		A0A3Q2GWH9			Equus caballus	Prediction	More>>
1:1 ortholog	SMAD4	4089	Q13485			Homo sapiens	Prediction	More>>
1:1 ortholog	Smad4	17128	P97471	CPO	E12.5, E13.5, E14.5	Mus musculus	Publication	More>>
1:1 ortholog	SMAD4		A0A2I3S6S5			Pan troglodytes	Prediction	More>>
1:1 ortholog			A0A4X1UID5			Sus scrofa	Prediction	More>>
1:1 ortholog	SMAD4	100342294	G1SKR1			Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Smad4		A0A0G2K970			Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs774342820	p.Asn3Asp	missense variant	-	NC_000018.10:g.51047053A>G	ExAC,gnomAD
NCI-TCGA novel	p.Met4ValPheSerTerUnk	frameshift	-	NC_000018.10:g.51047054_51047055AT>-	NCI-TCGA
rs1376500870	p.Ile6Val	missense variant	-	NC_000018.10:g.51047062A>G	gnomAD
rs372316981	p.Thr7Met	missense variant	-	NC_000018.10:g.51047066C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Thr11Lys	missense variant	-	NC_000018.10:g.51047078C>A	NCI-TCGA
NCI-TCGA novel	p.Ser12Arg	missense variant	-	NC_000018.10:g.51047080A>C	NCI-TCGA
NCI-TCGA novel	p.Ser12Asn	missense variant	-	NC_000018.10:g.51047081G>A	NCI-TCGA
rs281875323	p.Asn13Ser	missense variant	-	NC_000018.10:g.51047084A>G	ExAC,gnomAD
rs281875323	p.Asn13Ser	missense variant	-	NC_000018.10:g.51047084A>G	UniProt,dbSNP
VAR_066870	p.Asn13Ser	missense variant	-	NC_000018.10:g.51047084A>G	UniProt
rs1280706054	p.His21Arg	missense variant	-	NC_000018.10:g.51047108A>G	gnomAD
rs876659391	p.Met24Val	missense variant	-	NC_000018.10:g.51047116A>G	gnomAD
COSM30786	p.Cys25Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51047120G>A	NCI-TCGA Cosmic
COSM294838	p.Ser32Ter	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51047135_51047136GA>-	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser32Thr	missense variant	-	NC_000018.10:g.51047141G>C	NCI-TCGA
rs758408642	p.Ala39Thr	missense variant	-	NC_000018.10:g.51047161G>A	ExAC,gnomAD
rs746732669	p.Val44Ile	missense variant	-	NC_000018.10:g.51047176G>A	ExAC,gnomAD
rs1392175055	p.Lys46Arg	missense variant	-	NC_000018.10:g.51047183A>G	gnomAD
rs770789755	p.Leu47Val	missense variant	-	NC_000018.10:g.51047185C>G	ExAC,gnomAD
COSM3422224	p.Leu47Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51047186T>A	NCI-TCGA Cosmic
rs780090544	p.Glu49Gly	missense variant	-	NC_000018.10:g.51047192A>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp52ArgPheSerTerUnk	frameshift	-	NC_000018.10:g.51047193_51047194insA	NCI-TCGA
NCI-TCGA novel	p.Ser56Tyr	missense variant	-	NC_000018.10:g.51047213C>A	NCI-TCGA
COSM169637	p.Leu57Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51047215T>G	NCI-TCGA Cosmic
COSM4072502	p.Ala60Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51047224G>C	NCI-TCGA Cosmic
rs1064794204	p.Ile61Val	missense variant	-	NC_000018.10:g.51047227A>G	gnomAD
rs1064794204	p.Ile61Leu	missense variant	-	NC_000018.10:g.51047227A>C	gnomAD
rs1316987372	p.Thr62Ile	missense variant	-	NC_000018.10:g.51047231C>T	TOPMed
NCI-TCGA novel	p.Gly65Glu	missense variant	-	NC_000018.10:g.51047240G>A	NCI-TCGA
COSM988903	p.Lys70Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51047255A>C	NCI-TCGA Cosmic
rs772506979	p.Ile74Val	missense variant	-	NC_000018.10:g.51047266A>G	ExAC,gnomAD
NCI-TCGA novel	p.Leu78Phe	missense variant	-	NC_000018.10:g.51047280G>T	NCI-TCGA
rs1382032973	p.Gly80Arg	missense variant	-	NC_000018.10:g.51047284G>A	TOPMed
NCI-TCGA novel	p.Gly86Cys	missense variant	-	NC_000018.10:g.51048692G>T	NCI-TCGA
rs1060500735	p.Arg87Pro	missense variant	-	NC_000018.10:g.51048696G>C	gnomAD
rs1060500735	p.Arg87Gln	missense variant	-	NC_000018.10:g.51048696G>A	gnomAD
COSM1389027	p.Gly89Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51048701G>T	NCI-TCGA Cosmic
COSM3526297	p.Pro91Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048707C>T	NCI-TCGA Cosmic
COSM4830946	p.His92Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048710C>T	NCI-TCGA Cosmic
rs1460631652	p.Tyr95Phe	missense variant	-	NC_000018.10:g.51048720A>T	gnomAD
COSM5256678	p.Tyr95Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048720A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala96Val	missense variant	-	NC_000018.10:g.51048723C>T	NCI-TCGA
NCI-TCGA novel	p.Ala96Asp	missense variant	-	NC_000018.10:g.51048723C>A	NCI-TCGA
rs1555685158	p.Arg97Cys	missense variant	-	NC_000018.10:g.51048725C>T	-
COSM291721	p.Arg97His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048726G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg97ValPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51048723C>-	NCI-TCGA
NCI-TCGA novel	p.Trp99Cys	missense variant	-	NC_000018.10:g.51048733G>C	NCI-TCGA
COSM6149421	p.Arg100Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048734A>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg100Ser	missense variant	-	NC_000018.10:g.51048736G>T	NCI-TCGA
COSM265463	p.Leu104Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048746C>T	NCI-TCGA Cosmic
COSM1480368	p.Leu109Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048762T>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu109Gln	missense variant	-	NC_000018.10:g.51048762T>A	NCI-TCGA
COSM5951342	p.Lys110AsnPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51048763A>-	NCI-TCGA Cosmic
rs1064794363	p.His111Pro	missense variant	-	NC_000018.10:g.51048768A>C	TOPMed,gnomAD
rs876659844	p.Cys115Tyr	missense variant	-	NC_000018.10:g.51048780G>A	-
rs1291259529	p.Gln116Arg	missense variant	-	NC_000018.10:g.51048783A>G	gnomAD
COSM84440	p.Gln116Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51048782C>T	NCI-TCGA Cosmic
COSM1389032	p.Tyr117His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048785T>C	NCI-TCGA Cosmic
COSM14215	p.Ala118Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048789C>T	NCI-TCGA Cosmic
rs1357104939	p.Cys123Tyr	missense variant	-	NC_000018.10:g.51048804G>A	TOPMed
rs750172880	p.Asp124Ala	missense variant	-	NC_000018.10:g.51048807A>C	ExAC,gnomAD
NCI-TCGA novel	p.Val128Ala	missense variant	-	NC_000018.10:g.51048819T>C	NCI-TCGA
rs1555685186	p.Pro130Ser	missense variant	-	NC_000018.10:g.51048824C>T	UniProt,dbSNP
VAR_036475	p.Pro130Ser	missense variant	-	NC_000018.10:g.51048824C>T	UniProt
rs1555685186	p.Pro130Ser	missense variant	-	NC_000018.10:g.51048824C>T	-
rs1060500743	p.His132Tyr	missense variant	-	NC_000018.10:g.51048830C>T	-
NCI-TCGA novel	p.His132Gln	missense variant	-	NC_000018.10:g.51048832C>A	NCI-TCGA
COSM1303772	p.Tyr133Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048833T>A	NCI-TCGA Cosmic
rs748395067	p.Glu134Gln	missense variant	-	NC_000018.10:g.51048836G>C	ExAC,gnomAD
COSM189730	p.Glu134Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51048836G>A	NCI-TCGA Cosmic
rs377767326	p.Arg135Ter	stop gained	-	NC_000018.10:g.51048839C>T	-
NCI-TCGA novel	p.Val136Ala	missense variant	-	NC_000018.10:g.51048843T>C	NCI-TCGA
NCI-TCGA novel	p.Val137Ala	missense variant	-	NC_000018.10:g.51048846T>C	NCI-TCGA
NCI-TCGA novel	p.Ser138IlePheSerTerUnk	frameshift	-	NC_000018.10:g.51048845_51048846insT	NCI-TCGA
rs1474668300	p.Pro139Thr	missense variant	-	NC_000018.10:g.51048851C>A	gnomAD
COSM13115	p.Ser144Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51049301C>G	NCI-TCGA Cosmic
rs750355699	p.Ser150Asn	missense variant	-	NC_000018.10:g.51049319G>A	ExAC,TOPMed,gnomAD
rs751763157	p.Pro153Ser	missense variant	-	NC_000018.10:g.51054783C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser154ThrProSer	insertion	-	NC_000018.10:g.51049324_51049325insCTCCATCAA	NCI-TCGA
rs199790852	p.Ser155Thr	missense variant	-	NC_000018.10:g.51054790G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1057519259	p.Ser155Gly	missense variant	-	NC_000018.10:g.51054789A>G	gnomAD
rs199790852	p.Ser155Asn	missense variant	-	NC_000018.10:g.51054790G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs534355764	p.Met156Leu	missense variant	-	NC_000018.10:g.51054792A>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1443471590	p.Met157Leu	missense variant	-	NC_000018.10:g.51054795A>T	TOPMed
rs756675590	p.Met157Thr	missense variant	-	NC_000018.10:g.51054796T>C	ExAC,gnomAD
rs780716382	p.Met157Ile	missense variant	-	NC_000018.10:g.51054797G>A	ExAC,gnomAD
rs1183671082	p.Glu161Lys	missense variant	-	NC_000018.10:g.51054807G>A	gnomAD
rs876660058	p.His164Arg	missense variant	-	NC_000018.10:g.51054817A>G	gnomAD
NCI-TCGA novel	p.Glu167Gln	missense variant	-	NC_000018.10:g.51054825G>C	NCI-TCGA
COSM14118	p.Gly168Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51054828G>T	NCI-TCGA Cosmic
rs1449334786	p.Gln169Glu	missense variant	-	NC_000018.10:g.51054831C>G	gnomAD
rs1333974956	p.Thr174Ala	missense variant	-	NC_000018.10:g.51054846A>G	gnomAD
rs138800446	p.Thr174Asn	missense variant	-	NC_000018.10:g.51054847C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs377767331	p.Ser178Ter	stop gained	-	NC_000018.10:g.51054859C>G	-
COSM1226725	p.Ser178Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51054859C>A	NCI-TCGA Cosmic
rs542392980	p.Ile179Val	missense variant	-	NC_000018.10:g.51054861A>G	1000Genomes,ExAC,gnomAD
rs542392980	p.Ile179Phe	missense variant	-	NC_000018.10:g.51054861A>T	1000Genomes,ExAC,gnomAD
rs377767332	p.Gln180Ter	stop gained	-	NC_000018.10:g.51054864C>T	-
NCI-TCGA novel	p.Ile182Met	missense variant	-	NC_000018.10:g.51054872C>G	NCI-TCGA
COSM308153	p.Gln183Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51054873C>T	NCI-TCGA Cosmic
rs760236686	p.His184Pro	missense variant	-	NC_000018.10:g.51054877A>C	ExAC,gnomAD
rs770798845	p.Pro185Leu	missense variant	-	NC_000018.10:g.51054880C>T	ExAC,TOPMed,gnomAD
rs770798845	p.Pro185Gln	missense variant	-	NC_000018.10:g.51054880C>A	ExAC,TOPMed,gnomAD
rs140743238	p.Arg189Ser	missense variant	-	NC_000018.10:g.51054891C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs140743238	p.Arg189Gly	missense variant	-	NC_000018.10:g.51054891C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs759288477	p.Arg189Leu	missense variant	-	NC_000018.10:g.51054892G>T	ExAC,TOPMed,gnomAD
rs759288477	p.Arg189His	missense variant	-	NC_000018.10:g.51054892G>A	ExAC,TOPMed,gnomAD
rs140743238	p.Arg189Cys	missense variant	-	NC_000018.10:g.51054891C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs752575871	p.Ser191Leu	missense variant	-	NC_000018.10:g.51054898C>T	ExAC,gnomAD
rs587780792	p.Thr192Ile	missense variant	-	NC_000018.10:g.51054901C>T	ExAC,gnomAD
rs1432058632	p.Thr194Ala	missense variant	-	NC_000018.10:g.51054906A>G	TOPMed
NCI-TCGA novel	p.Tyr195Ter	stop gained	-	NC_000018.10:g.51054911C>G	NCI-TCGA
rs1189715258	p.Pro198Leu	missense variant	-	NC_000018.10:g.51054919C>T	gnomAD
rs1189715258	p.Pro198Arg	missense variant	-	NC_000018.10:g.51054919C>G	gnomAD
NCI-TCGA novel	p.Ala199SerPheSerTerUnk	frameshift	-	NC_000018.10:g.51054915_51054916insC	NCI-TCGA
rs1477349147	p.Leu200Val	missense variant	-	NC_000018.10:g.51054924C>G	gnomAD
rs199809905	p.Pro203Thr	missense variant	-	NC_000018.10:g.51054933C>A	1000Genomes,ExAC,gnomAD
rs199809905	p.Pro203Ala	missense variant	-	NC_000018.10:g.51054933C>G	1000Genomes,ExAC,gnomAD
rs779119136	p.Pro203Leu	missense variant	-	NC_000018.10:g.51054934C>T	ExAC,gnomAD
rs199809905	p.Pro203Ser	missense variant	-	NC_000018.10:g.51054933C>T	1000Genomes,ExAC,gnomAD
COSM709388	p.Ser204Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51054937C>A	NCI-TCGA Cosmic
rs748615724	p.Glu205Ala	missense variant	-	NC_000018.10:g.51054940A>C	ExAC,gnomAD
rs1046411210	p.Ala208Thr	missense variant	-	NC_000018.10:g.51054948G>A	TOPMed
rs757977781	p.Asn213Ser	missense variant	-	NC_000018.10:g.51054964A>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn213ThrPheSerTerUnk	stop gained	-	NC_000018.10:g.51054963_51054964insCCACATAAGGGAACATTTTGACACAAGTTCTAAAACTTACAGT	NCI-TCGA
rs777495692	p.Pro215Arg	missense variant	-	NC_000018.10:g.51054970C>G	ExAC,gnomAD
rs1064793270	p.Pro215Ser	missense variant	-	NC_000018.10:g.51054969C>T	-
rs138386557	p.Asn216Ser	missense variant	-	NC_000018.10:g.51054973A>G	ESP,ExAC,TOPMed,gnomAD
rs1345146274	p.Pro218Thr	missense variant	-	NC_000018.10:g.51054978C>A	TOPMed,gnomAD
rs1368696589	p.Val219Met	missense variant	-	NC_000018.10:g.51054981G>A	gnomAD
rs770461626	p.Thr222Ala	missense variant	-	NC_000018.10:g.51054990A>G	ExAC,gnomAD
rs774334251	p.Ser223Ile	missense variant	-	NC_000018.10:g.51058125G>T	ExAC,gnomAD
rs774334251	p.Ser223Asn	missense variant	-	NC_000018.10:g.51058125G>A	ExAC,gnomAD
rs587780793	p.Gln224Leu	missense variant	-	NC_000018.10:g.51058128A>T	TOPMed,gnomAD
rs539739051	p.Ala226Val	missense variant	-	NC_000018.10:g.51058134C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1443767329	p.Ser227Gly	missense variant	-	NC_000018.10:g.51058136A>G	TOPMed
NCI-TCGA novel	p.Ser227ValPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51058134C>-	NCI-TCGA
rs1280682459	p.Ile228Val	missense variant	-	NC_000018.10:g.51058139A>G	TOPMed
rs75667697	p.Leu229Arg	missense variant	-	NC_000018.10:g.51058143T>G	ExAC,gnomAD
rs759679579	p.Gly231Ala	missense variant	-	NC_000018.10:g.51058149G>C	ExAC,gnomAD
COSM1389042	p.Gly231AlaPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058144G>-	NCI-TCGA Cosmic
COSM1389041	p.Ser232GlnPheSerTerUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058143_51058144insG	NCI-TCGA Cosmic
rs552880257	p.His233Asn	missense variant	-	NC_000018.10:g.51058154C>A	1000Genomes,ExAC,gnomAD
rs758642067	p.Ser234Gly	missense variant	-	NC_000018.10:g.51058157A>G	ExAC,gnomAD
rs758642067	p.Ser234Arg	missense variant	-	NC_000018.10:g.51058157A>C	ExAC,gnomAD
rs1163381283	p.Gln239Glu	missense variant	-	NC_000018.10:g.51058172C>G	gnomAD
COSM563754	p.Ser242Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058182C>G	NCI-TCGA Cosmic
rs764421512	p.Pro244His	missense variant	-	NC_000018.10:g.51058188C>A	ExAC,gnomAD
COSM14057	p.Gln245Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058190C>T	NCI-TCGA Cosmic
rs876659967	p.Pro246Thr	missense variant	-	NC_000018.10:g.51058193C>A	gnomAD
rs751985298	p.Gln248Leu	missense variant	-	NC_000018.10:g.51058200A>T	ExAC,TOPMed,gnomAD
COSM218558	p.Gln248Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058199C>T	NCI-TCGA Cosmic
rs1370953444	p.Gln249Glu	missense variant	-	NC_000018.10:g.51058202C>G	gnomAD
rs371536364	p.Gln249Arg	missense variant	-	NC_000018.10:g.51058203A>G	ESP,ExAC,TOPMed,gnomAD
rs1370953444	p.Gln249Lys	missense variant	-	NC_000018.10:g.51058202C>A	gnomAD
rs371536364	p.Gln249Pro	missense variant	-	NC_000018.10:g.51058203A>C	ESP,ExAC,TOPMed,gnomAD
rs372095620	p.Gln249His	missense variant	-	NC_000018.10:g.51058204G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1372278030	p.Gln250Glu	missense variant	-	NC_000018.10:g.51058205C>G	TOPMed
rs878854768	p.Gly252Val	missense variant	-	NC_000018.10:g.51058212G>T	gnomAD
NCI-TCGA novel	p.Phe253Ile	missense variant	-	NC_000018.10:g.51058214T>A	NCI-TCGA
rs1284924848	p.Thr254Ala	missense variant	-	NC_000018.10:g.51058217A>G	gnomAD
rs143082783	p.Gly270Glu	missense variant	-	NC_000018.10:g.51058361G>A	ESP
NCI-TCGA novel	p.Gly270GluPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51058360G>-	NCI-TCGA
rs1343555503	p.Ser271Asn	missense variant	-	NC_000018.10:g.51058364G>A	TOPMed,gnomAD
rs1282145977	p.Thr273Ser	missense variant	-	NC_000018.10:g.51058370C>G	TOPMed
rs751860447	p.Ala274Thr	missense variant	-	NC_000018.10:g.51058372G>A	ExAC,gnomAD
NCI-TCGA novel	p.Pro275Thr	missense variant	-	NC_000018.10:g.51058375C>A	NCI-TCGA
rs1229812463	p.Tyr276Phe	missense variant	-	NC_000018.10:g.51058379A>T	TOPMed
rs1257577085	p.Pro278Thr	missense variant	-	NC_000018.10:g.51058384C>A	gnomAD
COSM5079016	p.Asn285ThrPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058403A>-	NCI-TCGA Cosmic
rs750111831	p.Gly286Ser	missense variant	-	NC_000018.10:g.51058408G>A	ExAC,gnomAD
rs1451329701	p.Gln289Arg	missense variant	-	NC_000018.10:g.51058418A>G	gnomAD
COSM709387	p.Gln289Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51058417C>T	NCI-TCGA Cosmic
rs755770046	p.His290Pro	missense variant	-	NC_000018.10:g.51058421A>C	ExAC
rs863224733	p.His291Tyr	missense variant	-	NC_000018.10:g.51058423C>T	TOPMed
rs779583608	p.His291Pro	missense variant	-	NC_000018.10:g.51058424A>C	ExAC,gnomAD
rs786201404	p.Pro292Leu	missense variant	-	NC_000018.10:g.51058427C>T	TOPMed,gnomAD
rs7238500	p.Met294Val	missense variant	-	NC_000018.10:g.51058432A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs370176106	p.Pro295Gln	missense variant	-	NC_000018.10:g.51058436C>A	ESP,ExAC,TOPMed,gnomAD
rs370176106	p.Pro295Arg	missense variant	-	NC_000018.10:g.51058436C>G	ESP,ExAC,TOPMed,gnomAD
rs370176106	p.Pro295Leu	missense variant	-	NC_000018.10:g.51058436C>T	ESP,ExAC,TOPMed,gnomAD
rs1167543544	p.Pro295Ala	missense variant	-	NC_000018.10:g.51058435C>G	TOPMed
rs1417632301	p.Pro296Leu	missense variant	-	NC_000018.10:g.51058439C>T	TOPMed
NCI-TCGA novel	p.Pro298Ser	missense variant	-	NC_000018.10:g.51058444C>T	NCI-TCGA
rs1330888967	p.Gly299Arg	missense variant	-	NC_000018.10:g.51058447G>A	gnomAD
rs963931106	p.His300Asp	missense variant	-	NC_000018.10:g.51058450C>G	TOPMed
rs746084369	p.Tyr301Ter	stop gained	-	NC_000018.10:g.51058455C>G	ExAC,gnomAD
rs878854769	p.Trp302Ter	stop gained	-	NC_000018.10:g.51059867G>A	-
rs375185293	p.Val304Ile	missense variant	-	NC_000018.10:g.51059871G>A	ESP,ExAC,gnomAD
rs730881953	p.Asn306Ser	missense variant	-	NC_000018.10:g.51059878A>G	ExAC,TOPMed,gnomAD
rs1383128743	p.Leu308Ile	missense variant	-	NC_000018.10:g.51059883C>A	gnomAD
rs774463256	p.Ala309Ser	missense variant	-	NC_000018.10:g.51059886G>T	ExAC,gnomAD
rs774463256	p.Ala309Pro	missense variant	-	NC_000018.10:g.51059886G>C	ExAC,gnomAD
NCI-TCGA novel	p.Ala309SerPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51059886_51059892GCATTCC>-	NCI-TCGA
COSM1324558	p.Phe310Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51059889T>C	NCI-TCGA Cosmic
rs1381679797	p.Gln311Arg	missense variant	-	NC_000018.10:g.51059893A>G	gnomAD
rs748622028	p.Ile314Val	missense variant	-	NC_000018.10:g.51059901A>G	ExAC,TOPMed,gnomAD
rs377119288	p.Asn316Ser	missense variant	-	NC_000018.10:g.51059908A>G	ExAC,TOPMed,gnomAD
COSM438195	p.Asn316IlePheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51059905C>-	NCI-TCGA Cosmic
rs772575670	p.Trp323Cys	missense variant	-	NC_000018.10:g.51065436G>C	ExAC
NCI-TCGA novel	p.Ser325TyrPheSerTerUnk	frameshift	-	NC_000018.10:g.51065441_51065442CC>-	NCI-TCGA
rs1402203611	p.Ile326Val	missense variant	-	NC_000018.10:g.51065443A>G	TOPMed
NCI-TCGA novel	p.Ala327Val	missense variant	-	NC_000018.10:g.51065447C>T	NCI-TCGA
rs572960016	p.Phe329Leu	missense variant	-	NC_000018.10:g.51065454T>G	1000Genomes
rs281875324	p.Glu330Gly	missense variant	Juvenile polyposis syndrome (JPS)	NC_000018.10:g.51065456A>G	UniProt,dbSNP
VAR_022833	p.Glu330Gly	missense variant	Juvenile polyposis syndrome (JPS)	NC_000018.10:g.51065456A>G	UniProt
rs281875324	p.Glu330Gly	missense variant	-	NC_000018.10:g.51065456A>G	-
rs377767342	p.Glu330Lys	missense variant	-	NC_000018.10:g.51065455G>A	-
COSM14240	p.Glu330Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065455G>C	NCI-TCGA Cosmic
COSM14133	p.Asp332Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065462A>G	NCI-TCGA Cosmic
rs1274926456	p.Val333Ile	missense variant	-	NC_000018.10:g.51065464G>A	TOPMed,gnomAD
rs867764109	p.Gln334Ter	stop gained	-	NC_000018.10:g.51065467C>T	-
rs773598775	p.Gln334His	missense variant	-	NC_000018.10:g.51065469G>T	ExAC,gnomAD
COSM417827	p.Glu337Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065476G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Thr338Ile	missense variant	-	NC_000018.10:g.51065480C>T	NCI-TCGA
NCI-TCGA novel	p.Phe339Leu	missense variant	-	NC_000018.10:g.51065484T>A	NCI-TCGA
COSM14109	p.Lys340Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065485A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro342LeuPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51065491C>-	NCI-TCGA
COSM1389060	p.Ser343Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51065495C>A	NCI-TCGA Cosmic
rs747360831	p.Ile347Val	missense variant	-	NC_000018.10:g.51065506A>G	ExAC,TOPMed,gnomAD
rs747360831	p.Ile347Phe	missense variant	-	NC_000018.10:g.51065506A>T	ExAC,TOPMed,gnomAD
rs564408927	p.Thr349Ile	missense variant	-	NC_000018.10:g.51065513C>T	ExAC,TOPMed,gnomAD
rs1057519739	p.Asp351His	missense variant	-	NC_000018.10:g.51065518G>C	-
rs1057519739	p.Asp351Asn	missense variant	-	NC_000018.10:g.51065518G>A	-
COSM1151549	p.Asp351Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065518G>T	NCI-TCGA Cosmic
COSM373800	p.Asp351Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065519A>G	NCI-TCGA Cosmic
COSM5576133	p.Asp351Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065519A>C	NCI-TCGA Cosmic
rs121912581	p.Gly352Arg	missense variant	Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome (JP/HHT)	NC_000018.10:g.51065521G>A	UniProt,dbSNP
VAR_019571	p.Gly352Arg	missense variant	Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome (JP/HHT)	NC_000018.10:g.51065521G>A	UniProt
COSM1151246	p.Gly352Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065522G>T	NCI-TCGA Cosmic
COSM4072504	p.Gly352Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065522G>C	NCI-TCGA Cosmic
COSM5364543	p.Gly352Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51065521G>T	NCI-TCGA Cosmic
rs863224400	p.Tyr353Ter	stop gained	-	NC_000018.10:g.51065526C>G	gnomAD
COSM1471119	p.Tyr353Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065524T>A	NCI-TCGA Cosmic
COSM14220	p.Tyr353Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065525A>G	NCI-TCGA Cosmic
COSM14232	p.Asp355Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065531A>G	NCI-TCGA Cosmic
COSM3388466	p.Asp355Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065531A>T	NCI-TCGA Cosmic
COSM24274	p.Asp355Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065530G>A	NCI-TCGA Cosmic
COSM4754642	p.Asp355Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065530G>T	NCI-TCGA Cosmic
COSM1226726	p.Pro356Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065533C>T	NCI-TCGA Cosmic
COSM14049	p.Pro356Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065534C>T	NCI-TCGA Cosmic
rs121912576	p.Gly358Ter	stop gained	-	NC_000018.10:g.51065539G>T	-
rs80338963	p.Arg361Gly	missense variant	Juvenile polyposis syndrome (jps)	NC_000018.10:g.51065548C>G	gnomAD
rs80338963	p.Arg361Gly	missense variant	-	NC_000018.10:g.51065548C>G	gnomAD
rs80338963	p.Arg361Ser	missense variant	-	NC_000018.10:g.51065548C>A	gnomAD
rs80338963	p.Arg361Cys	missense variant	-	NC_000018.10:g.51065548C>T	gnomAD
rs80338963	p.Arg361Ser	missense variant	Juvenile polyposis syndrome (jps)	NC_000018.10:g.51065548C>A	gnomAD
rs80338963	p.Arg361Cys	missense variant	Juvenile polyposis syndrome (jps)	NC_000018.10:g.51065548C>T	gnomAD
rs377767347	p.Arg361Pro	missense variant	-	NC_000018.10:g.51065549G>C	-
rs80338963	p.Arg361Cys	missense variant	Juvenile polyposis syndrome (JPS)	NC_000018.10:g.51065548C>T	UniProt,dbSNP
VAR_019572	p.Arg361Cys	missense variant	Juvenile polyposis syndrome (JPS)	NC_000018.10:g.51065548C>T	UniProt
rs876660556	p.Cys363Ser	missense variant	-	NC_000018.10:g.51065555G>C	-
rs876660556	p.Cys363Tyr	missense variant	-	NC_000018.10:g.51065555G>A	-
NCI-TCGA novel	p.Cys363Trp	missense variant	-	NC_000018.10:g.51065556T>G	NCI-TCGA
COSM1389067	p.Gly365Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065561G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly365Arg	missense variant	-	NC_000018.10:g.51065560G>C	NCI-TCGA
NCI-TCGA novel	p.Gln366Lys	missense variant	-	NC_000018.10:g.51065563C>A	NCI-TCGA
COSM4072506	p.Ser368Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065570C>G	NCI-TCGA Cosmic
rs139569694	p.Asn369Ser	missense variant	-	NC_000018.10:g.51065573A>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Val370Gly	missense variant	-	NC_000018.10:g.51065576T>G	NCI-TCGA
rs761858248	p.Arg372Gly	missense variant	-	NC_000018.10:g.51065581A>G	ExAC
COSM4834240	p.Thr373Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51065585C>G	NCI-TCGA Cosmic
rs201092541	p.Glu374Lys	missense variant	-	NC_000018.10:g.51065587G>A	ExAC,gnomAD
NCI-TCGA novel	p.Glu374Ter	stop gained	-	NC_000018.10:g.51065587G>T	NCI-TCGA
NCI-TCGA novel	p.Glu377Val	missense variant	-	NC_000018.10:g.51065597A>T	NCI-TCGA
COSM3388468	p.His382Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067024A>T	NCI-TCGA Cosmic
COSM4072507	p.His382Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067023C>G	NCI-TCGA Cosmic
COSM4072508	p.Ile383Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067027T>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile383Thr	missense variant	-	NC_000018.10:g.51067027T>C	NCI-TCGA
NCI-TCGA novel	p.Gly384Asp	missense variant	-	NC_000018.10:g.51067030G>A	NCI-TCGA
rs923348055	p.Lys385Arg	missense variant	-	NC_000018.10:g.51067033A>G	TOPMed
rs1057519962	p.Gly386Ser	missense variant	-	NC_000018.10:g.51067035G>A	-
rs121912580	p.Gly386Asp	missense variant	Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome (JP/HHT)	NC_000018.10:g.51067036G>A	UniProt,dbSNP
VAR_019573	p.Gly386Asp	missense variant	Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome (JP/HHT)	NC_000018.10:g.51067036G>A	UniProt
rs80338964	p.Gln388Ter	stop gained	-	NC_000018.10:g.51067041C>T	-
NCI-TCGA novel	p.Gln388CysPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51067035_51067036insGT	NCI-TCGA
NCI-TCGA novel	p.Trp398CysPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51067069_51067100TTTGGGTCAGGTGCCTTAGTGACCACGCGGTC>-	NCI-TCGA
NCI-TCGA novel	p.Val399Asp	inframe deletion	-	NC_000018.10:g.51067075_51067092TCAGGTGCCTTAGTGACC>-	NCI-TCGA
rs1179609154	p.His405Tyr	missense variant	-	NC_000018.10:g.51067092C>T	TOPMed,gnomAD
rs1064796102	p.Ala406Val	missense variant	-	NC_000018.10:g.51067096C>T	-
rs794726995	p.Ala406Thr	missense variant	-	NC_000018.10:g.51067095G>A	-
rs147621330	p.Val407Leu	missense variant	-	NC_000018.10:g.51067098G>C	ESP,ExAC,TOPMed,gnomAD
COSM1564039	p.Phe408Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067103T>A	NCI-TCGA Cosmic
rs121912577	p.Tyr412Ter	stop gained	-	NC_000018.10:g.51067115C>G	TOPMed,gnomAD
NCI-TCGA novel	p.Tyr412LeuPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51067111_51067112insT	NCI-TCGA
NCI-TCGA novel	p.Tyr412Asp	missense variant	-	NC_000018.10:g.51067113T>G	NCI-TCGA
rs730881954	p.Tyr413Ter	stop gained	-	NC_000018.10:g.51067118C>A	TOPMed
COSM1266191	p.Asp415GluPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51067121_51067124AGAC>-	NCI-TCGA Cosmic
rs786202472	p.Arg416Ser	missense variant	-	NC_000018.10:g.51067127A>T	gnomAD
NCI-TCGA novel	p.Glu417SerPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51067125_51067126AG>-	NCI-TCGA
COSM1151291	p.Gly419Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067135G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly419Ala	missense variant	-	NC_000018.10:g.51067135G>C	NCI-TCGA
rs1367209662	p.Arg420Cys	missense variant	-	NC_000018.10:g.51067137C>T	gnomAD
NCI-TCGA novel	p.Asp424Asn	missense variant	-	NC_000018.10:g.51067149G>A	NCI-TCGA
rs1555686619	p.His427Arg	missense variant	-	NC_000018.10:g.51067159A>G	-
rs1555686620	p.Lys428Thr	missense variant	-	NC_000018.10:g.51067162A>C	-
COSM6149419	p.Lys428Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067163G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys428Met	missense variant	-	NC_000018.10:g.51067162A>T	NCI-TCGA
rs1469448199	p.Ile429Asn	missense variant	-	NC_000018.10:g.51067165T>A	TOPMed
rs1306423305	p.Pro431Leu	missense variant	-	NC_000018.10:g.51067171C>T	TOPMed,gnomAD
rs770301659	p.Ser432Asn	missense variant	-	NC_000018.10:g.51067174G>A	ExAC,gnomAD
rs770301659	p.Ser432Thr	missense variant	-	NC_000018.10:g.51067174G>C	ExAC,gnomAD
rs770301659	p.Ser432Ile	missense variant	-	NC_000018.10:g.51067174G>T	ExAC,gnomAD
rs780610518	p.Tyr434Phe	missense variant	-	NC_000018.10:g.51067180A>T	ExAC,gnomAD
COSM1389080	p.Lys436Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51067187G>T	NCI-TCGA Cosmic
COSM265853	p.Val437Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51076639T>A	NCI-TCGA Cosmic
COSM14237	p.Arg441Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51076650C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Cys443Ter	stop gained	-	NC_000018.10:g.51076658T>A	NCI-TCGA
COSM3422225	p.Arg445Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51076663G>A	NCI-TCGA Cosmic
rs377767360	p.Arg445Ter	stop gained	-	NC_000018.10:g.51076662C>T	ExAC,gnomAD
rs1197191570	p.Gln448Leu	missense variant	-	NC_000018.10:g.51076672A>T	gnomAD
NCI-TCGA novel	p.Gln450LeuPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51076669_51076696TGCAGCAGCAGGCGGCTACTGCACAAGC>-	NCI-TCGA
NCI-TCGA novel	p.Gln450Ter	stop gained	-	NC_000018.10:g.51076677C>T	NCI-TCGA
rs1275841831	p.Ala451Val	missense variant	-	NC_000018.10:g.51076681C>T	gnomAD
NCI-TCGA novel	p.Ala451Thr	missense variant	-	NC_000018.10:g.51076680G>A	NCI-TCGA
rs768086109	p.Thr453Ala	missense variant	-	NC_000018.10:g.51076686A>G	ExAC,gnomAD
NCI-TCGA novel	p.Gln461Ter	stop gained	-	NC_000018.10:g.51076710C>T	NCI-TCGA
rs786201798	p.Val465Leu	missense variant	-	NC_000018.10:g.51076722G>T	gnomAD
rs786201798	p.Val465Met	missense variant	-	NC_000018.10:g.51076722G>A	gnomAD
rs569981255	p.Asn468Ser	missense variant	-	NC_000018.10:g.51076732A>G	1000Genomes,ExAC,gnomAD
rs876658851	p.Ile469Leu	missense variant	-	NC_000018.10:g.51076734A>C	gnomAD
rs876658851	p.Ile469Val	missense variant	-	NC_000018.10:g.51076734A>G	gnomAD
COSM4072510	p.Pro470His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51076738C>A	NCI-TCGA Cosmic
rs1169893474	p.Pro472Ala	missense variant	-	NC_000018.10:g.51076743C>G	TOPMed,gnomAD
NCI-TCGA novel	p.Ser474Ter	stop gained	-	NC_000018.10:g.51076750C>A	NCI-TCGA
NCI-TCGA novel	p.Ala479Thr	missense variant	-	NC_000018.10:g.51076764G>A	NCI-TCGA
rs864622736	p.Ile482Val	missense variant	-	NC_000018.10:g.51076773A>G	gnomAD
rs745598003	p.Ser483Arg	missense variant	-	NC_000018.10:g.51078257T>G	ExAC,gnomAD
NCI-TCGA novel	p.Ser485Leu	missense variant	-	NC_000018.10:g.51078262C>T	NCI-TCGA
COSM14222	p.Val492Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078282G>T	NCI-TCGA Cosmic
rs121912578	p.Asp493His	missense variant	-	NC_000018.10:g.51078285G>C	-
rs121912578	p.Asp493His	missense variant	-	NC_000018.10:g.51078285G>C	UniProt,dbSNP
VAR_011380	p.Asp493His	missense variant	-	NC_000018.10:g.51078285G>C	UniProt
COSM14227	p.Asp493Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078285G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu495Arg	missense variant	-	NC_000018.10:g.51078292T>G	NCI-TCGA
rs397518413	p.Arg496Cys	missense variant	-	NC_000018.10:g.51078294C>T	ExAC,TOPMed,gnomAD
rs876660045	p.Arg496His	missense variant	-	NC_000018.10:g.51078295G>A	-
COSM14113	p.Arg497His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078298G>A	NCI-TCGA Cosmic
rs762118751	p.Arg497Cys	missense variant	-	NC_000018.10:g.51078297C>T	ExAC,gnomAD
COSM14221	p.Cys499Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078304G>A	NCI-TCGA Cosmic
rs281875322	p.Ile500Val	missense variant	Myhre syndrome (myhrs)	NC_000018.10:g.51078306A>G	gnomAD
rs281875320	p.Ile500Met	missense variant	Myhre syndrome (myhrs)	NC_000018.10:g.51078308A>G	-
rs281875322	p.Ile500Val	missense variant	Myhre syndrome (MYHRS)	NC_000018.10:g.51078306A>G	UniProt,dbSNP
VAR_067604	p.Ile500Val	missense variant	Myhre syndrome (MYHRS)	NC_000018.10:g.51078306A>G	UniProt
rs281875320	p.Ile500Met	missense variant	Myhre syndrome (MYHRS)	NC_000018.10:g.51078308A>G	UniProt,dbSNP
VAR_067602	p.Ile500Met	missense variant	Myhre syndrome (MYHRS)	NC_000018.10:g.51078308A>G	UniProt
rs281875321	p.Ile500Thr	missense variant	Myhre syndrome (myhrs)	NC_000018.10:g.51078307T>C	-
rs281875321	p.Ile500Thr	missense variant	Myhre syndrome (MYHRS)	NC_000018.10:g.51078307T>C	UniProt,dbSNP
VAR_067603	p.Ile500Thr	missense variant	Myhre syndrome (MYHRS)	NC_000018.10:g.51078307T>C	UniProt
rs1426800709	p.Met503Leu	missense variant	-	NC_000018.10:g.51078315A>C	TOPMed
COSM14148	p.Ser504Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078320T>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser504Arg	missense variant	-	NC_000018.10:g.51078320T>G	NCI-TCGA
rs1364877488	p.Phe505Leu	missense variant	-	NC_000018.10:g.51078323T>A	gnomAD
NCI-TCGA novel	p.Lys507ArgPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51078327_51078328AA>-	NCI-TCGA
NCI-TCGA novel	p.Lys507Asn	missense variant	-	NC_000018.10:g.51078329A>T	NCI-TCGA
rs377767370	p.Trp509Ter	stop gained	-	NC_000018.10:g.51078335G>A	-
COSM1389102	p.Trp509Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078333T>C	NCI-TCGA Cosmic
COSM6056828	p.Gly510Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078336G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly510Ter	stop gained	-	NC_000018.10:g.51078336G>T	NCI-TCGA
rs773367516	p.Pro511Leu	missense variant	-	NC_000018.10:g.51078340C>T	ExAC,gnomAD
NCI-TCGA novel	p.Tyr513Ter	stop gained	-	NC_000018.10:g.51078345_51078346insA	NCI-TCGA
rs1282106789	p.Pro514Leu	missense variant	-	NC_000018.10:g.51078349C>T	gnomAD
rs1221103079	p.Pro514Ser	missense variant	-	NC_000018.10:g.51078348C>T	gnomAD
COSM14143	p.Gln516Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51078354C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gln516Glu	missense variant	-	NC_000018.10:g.51078354C>G	NCI-TCGA
rs1015480027	p.Lys519Arg	missense variant	-	NC_000018.10:g.51078364A>G	TOPMed
COSM988906	p.Lys519Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078365A>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys519Ter	stop gained	-	NC_000018.10:g.51078363A>T	NCI-TCGA
NCI-TCGA novel	p.Glu520Ter	stop gained	-	NC_000018.10:g.51078366G>T	NCI-TCGA
rs876659840	p.Thr521Ile	missense variant	-	NC_000018.10:g.51078370C>T	gnomAD
rs377767374	p.Pro522LeuPheSerTerUnk	frameshift	-	NC_000018.10:g.51078372_51078373CC>-	NCI-TCGA
COSM14115	p.Cys523Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078377C>G	NCI-TCGA Cosmic
rs377767375	p.Trp524Leu	missense variant	-	NC_000018.10:g.51078379G>T	-
COSM3388472	p.Trp524Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078380G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Trp524Arg	missense variant	-	NC_000018.10:g.51078378T>A	NCI-TCGA
rs149755320	p.Ile525Val	missense variant	-	NC_000018.10:g.51078381A>G	ESP,ExAC,TOPMed,gnomAD
rs1304558237	p.Ile525Thr	missense variant	-	NC_000018.10:g.51078382T>C	gnomAD
COSM14134	p.Glu526Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51078384G>T	NCI-TCGA Cosmic
COSM14130	p.Leu529ThrPheSerTerUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51078391_51078394ACTT>-	NCI-TCGA Cosmic
NCI-TCGA novel	p.Leu529Ter	stop gained	-	NC_000018.10:g.51078394T>G	NCI-TCGA
rs754393017	p.His530Asn	missense variant	-	NC_000018.10:g.51078396C>A	ExAC,TOPMed,gnomAD
rs766833269	p.Arg531Trp	missense variant	-	NC_000018.10:g.51078399C>T	ExAC,gnomAD
COSM1389109	p.Ala532Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078403C>A	NCI-TCGA Cosmic
COSM1389108	p.Ala532ProPheSerTerUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000018.10:g.51078400G>-	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala532Ser	missense variant	-	NC_000018.10:g.51078402G>T	NCI-TCGA
NCI-TCGA novel	p.Gln534Pro	missense variant	-	NC_000018.10:g.51078409A>C	NCI-TCGA
NCI-TCGA novel	p.Leu535ProPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51078412_51078418TCCTAGA>-	NCI-TCGA
NCI-TCGA novel	p.Leu536Arg	missense variant	-	NC_000018.10:g.51078415T>G	NCI-TCGA
NCI-TCGA novel	p.Leu536Pro	missense variant	-	NC_000018.10:g.51078415T>C	NCI-TCGA
rs1555687605	p.Asp537Gly	missense variant	-	NC_000018.10:g.51078418A>G	-
rs1057519741	p.Asp537Tyr	missense variant	-	NC_000018.10:g.51078417G>T	-
COSM1389112	p.Asp537His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078417G>C	NCI-TCGA Cosmic
COSM3422226	p.Asp537Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078419C>G	NCI-TCGA Cosmic
COSM256174	p.Asp537Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078418A>T	NCI-TCGA Cosmic
COSM709386	p.Asp537Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078419C>A	NCI-TCGA Cosmic
COSM988907	p.Glu538Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000018.10:g.51078420G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Val539AspPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51078423_51078439GTACTTCATACCATGCC>-	NCI-TCGA
NCI-TCGA novel	p.Leu540ProPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51078424_51078430TACTTCA>-	NCI-TCGA
rs200595795	p.Ile545Met	missense variant	-	NC_000018.10:g.51078443T>G	1000Genomes
NCI-TCGA novel	p.Pro550Thr	missense variant	-	NC_000018.10:g.51078456C>A	NCI-TCGA
NCI-TCGA novel	p.Asp552ThrPheSerTerUnkUnk	frameshift	-	NC_000018.10:g.51078462G>-	NCI-TCGA
rs121912581	p.Gly352Arg	missense variant	-	NC_000018.10:g.51065521G>A	-
rs121912580	p.Gly386Val	missense variant	-	NC_000018.10:g.51067036G>T	-
rs121912580	p.Gly386Asp	missense variant	-	NC_000018.10:g.51067036G>A	-
rs377767369	p.Trp509Gly	missense variant	-	NC_000018.10:g.51078333T>G	-

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0000737	Abdominal Pain	phenotype	HPO
C0000768	Congenital Abnormality	group	BEFREE
C0001418	Adenocarcinoma	group	BEFREE;LHGDN
C0001430	Adenoma	group	BEFREE
C0002871	Anemia	disease	HPO
C0003123	Anorexia	disease	HPO
C0003486	Aortic Aneurysm	disease	BEFREE
C0003492	Aortic coarctation	disease	HPO
C0003507	Aortic Valve Stenosis	disease	HPO
C0003857	Congenital arteriovenous malformation	disease	BEFREE
C0003886	Arthrogryposis	disease	GENOMICS_ENGLAND
C0004352	Autistic Disorder	group	HPO
C0004604	Back Pain	phenotype	HPO
C0004763	Barrett Esophagus	disease	BEFREE
C0005398	Cholestasis, Extrahepatic	disease	HPO
C0005684	Malignant neoplasm of urinary bladder	disease	BEFREE
C0005695	Bladder Neoplasm	group	BEFREE
C0005744	Blepharophimosis	disease	HPO
C0005745	Blepharoptosis	disease	HPO
C0005940	Bone Diseases	group	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0006826	Malignant Neoplasms	group	CGI
C0007095	Carcinoid Tumor	group	BEFREE
C0007102	Malignant tumor of colon	disease	BEFREE
C0007103	Malignant neoplasm of endometrium	disease	BEFREE
C0007112	Adenocarcinoma of prostate	disease	CLINVAR
C0007113	Rectal Carcinoma	disease	BEFREE
C0007114	Malignant neoplasm of skin	disease	BEFREE
C0007115	Malignant neoplasm of thyroid	disease	BEFREE
C0007124	Noninfiltrating Intraductal Carcinoma	disease	LHGDN
C0007129	Merkel cell carcinoma	disease	BEFREE
C0007131	Non-Small Cell Lung Carcinoma	disease	BEFREE
C0007133	Carcinoma, Papillary	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE;LHGDN
C0007137	Squamous cell carcinoma	disease	BEFREE;LHGDN
C0007820	Cerebrovascular Disorders	group	GENOMICS_ENGLAND
C0007847	Malignant tumor of cervix	disease	BEFREE
C0007873	Uterine Cervical Neoplasm	disease	BEFREE
C0008073	Developmental Disabilities	group	BEFREE
C0008325	Cholecystitis	disease	HPO
C0009241	Cognition Disorders	group	CTD_human
C0009319	Colitis	disease	BEFREE
C0009375	Colonic Neoplasms	group	BEFREE;LHGDN
C0009402	Colorectal Carcinoma	disease	BEFREE;CTD_human
C0009404	Colorectal Neoplasms	group	BEFREE;CLINVAR;CTD_human;LHGDN
C0009806	Constipation	phenotype	BEFREE
C0010417	Cryptorchidism	disease	HPO
C0011052	Prelingual Deafness	disease	CTD_human
C0011053	Deafness	phenotype	CTD_human;HPO
C0011334	Dental caries	disease	BEFREE
C0011644	Scleroderma	disease	BEFREE
C0011860	Diabetes Mellitus, Non-Insulin-Dependent	disease	BEFREE;RGD
C0011993	Vipoma	disease	BEFREE
C0013274	Patent ductus arteriosus	disease	BEFREE;HPO
C0013336	Dwarfism	disease	HPO
C0013720	Ehlers-Danlos Syndrome	disease	GENOMICS_ENGLAND
C0014306	Enophthalmos	disease	HPO
C0014544	Epilepsy	disease	HPO
C0014591	Epistaxis	phenotype	HPO
C0014859	Esophageal Neoplasms	group	BEFREE
C0015625	Fanconi Anemia	disease	BEFREE
C0015934	Fetal Growth Retardation	phenotype	HPO
C0017150	Gastrinoma	disease	BEFREE
C0017155	Gastritis, Hypertrophic	disease	BEFREE
C0017185	Gastrointestinal Neoplasms	group	BEFREE;GENOMICS_ENGLAND
C0017601	Glaucoma	disease	BEFREE
C0017638	Glioma	disease	BEFREE
C0017661	IGA Glomerulonephritis	disease	BEFREE
C0018552	Hamartoma	group	BEFREE
C0018553	Hamartoma Syndrome, Multiple	disease	BEFREE
C0018772	Hearing Loss, Partial	phenotype	HPO
C0018816	Heart Septal Defects	group	HPO
C0018920	Hemangioma, Cavernous	disease	HPO
C0018932	Hematochezia	phenotype	HPO
C0019163	Hepatitis B	disease	BEFREE
C0019196	Hepatitis C	disease	BEFREE
C0019348	Herpes Simplex Infections	group	BEFREE
C0020490	Hyperopia	disease	HPO
C0020534	Orbital separation excessive	phenotype	HPO
C0020538	Hypertensive disease	group	HPO
C0020541	Hypertension, Portal	disease	HPO
C0020542	Pulmonary Hypertension	phenotype	RGD
C0020621	Hypokalemia	phenotype	HPO
C0021296	Infant, Small for Gestational Age	phenotype	HPO
C0021367	Mammary Ductal Carcinoma	disease	BEFREE;CTD_human
C0021670	insulinoma	disease	BEFREE
C0021847	Intestinal Pseudo-Obstruction	disease	HPO
C0022346	Icterus	phenotype	HPO
C0022602	Actinic keratosis	disease	BEFREE
C0023267	Fibroid Tumor	group	BEFREE
C0023418	leukemia	disease	BEFREE
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE
C0023643	Lichen disease	disease	BEFREE
C0023893	Liver Cirrhosis, Experimental	disease	CTD_human
C0023897	Liver Diseases, Parasitic	group	CTD_human
C0023903	Liver neoplasms	group	BEFREE
C0023931	Lobstein Disease	disease	MGD
C0024117	Chronic Obstructive Airway Disease	disease	RGD
C0024121	Lung Neoplasms	group	BEFREE
C0024232	Lymphatic Metastasis	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE;CTD_human
C0025202	melanoma	disease	BEFREE
C0025286	Meningioma	disease	BEFREE
C0025362	Mental Retardation	disease	HPO
C0026034	Microstomia	disease	HPO
C0026769	Multiple Sclerosis	disease	BEFREE
C0026848	Myopathy	group	CTD_human
C0026850	Muscular Dystrophy	disease	BEFREE
C0026936	Mycoplasma Infections	group	BEFREE
C0027051	Myocardial Infarction	disease	RGD
C0027627	Neoplasm Metastasis	phenotype	BEFREE;LHGDN
C0027651	Neoplasms	group	BEFREE
C0027672	Neoplastic Syndromes, Hereditary	group	CLINVAR
C0027819	Neuroblastoma	group	BEFREE
C0029434	Osteogenesis Imperfecta	disease	BEFREE;MGD
C0029463	Osteosarcoma	disease	BEFREE
C0029925	Ovarian Carcinoma	disease	BEFREE
C0030293	Pancreatic Insufficiency	disease	HPO
C0030297	Pancreatic Neoplasm	disease	BEFREE;CGI;CTD_human;HPO;LHGDN
C0031039	Pericardial effusion	disease	HPO
C0031106	Periodontitis, Juvenile	disease	BEFREE
C0031269	Peutz-Jeghers Syndrome	disease	BEFREE
C0032580	Adenomatous Polyposis Coli	disease	BEFREE
C0032584	polyps	phenotype	BEFREE
C0032927	Precancerous Conditions	group	BEFREE
C0033578	Prostatic Neoplasms	group	LHGDN
C0033581	prostatitis	disease	RGD
C0034069	Pulmonary Fibrosis	disease	BEFREE;RGD
C0034887	Rectal polyp	disease	BEFREE
C0035335	Retinoblastoma	disease	BEFREE
C0035369	Retroviridae Infections	group	BEFREE
C0035412	Rhabdomyosarcoma	disease	BEFREE
C0036421	Systemic Scleroderma	disease	BEFREE
C0036572	Seizures	phenotype	HPO
C0036631	Seminoma	disease	BEFREE
C0038356	Stomach Neoplasms	group	CTD_human;LHGDN
C0038379	Strabismus	disease	HPO
C0039445	Hereditary hemorrhagic telangiectasia	disease	BEFREE;GENOMICS_ENGLAND;ORPHANET
C0039446	Telangiectasis	disease	BEFREE;LHGDN
C0040028	Thrombocythemia, Essential	disease	BEFREE
C0040136	Thyroid Neoplasm	disease	BEFREE
C0042133	Uterine Fibroids	group	BEFREE
C0042373	Vascular Diseases	group	BEFREE
C0085576	Iron-Refractory Iron Deficiency Anemia	disease	HPO
C0086395	Hearing Loss, Extreme	phenotype	CTD_human
C0149521	Pancreatitis, Chronic	disease	BEFREE
C0149931	Migraine Disorders	group	HPO
C0151463	Abscess of breast	disease	BEFREE
C0151650	Renal fibrosis	disease	BEFREE
C0152013	Adenocarcinoma of lung (disorder)	disease	CLINVAR
C0152018	Esophageal carcinoma	disease	BEFREE;CLINVAR
C0152423	Congenital small ears	disease	HPO
C0153381	Malignant neoplasm of mouth	disease	BEFREE
C0153452	Malignant neoplasm of gallbladder	disease	BEFREE
C0153690	Secondary malignant neoplasm of bone	disease	BEFREE
C0158570	Vascular anomaly	phenotype	BEFREE
C0162119	Hemoglobin low	phenotype	HPO
C0162298	Joint stiffness	phenotype	HPO
C0162565	Acute intermittent porphyria	disease	BEFREE
C0162872	Aortic Aneurysm, Thoracic	disease	BEFREE;GENOMICS_ENGLAND
C0175754	Agenesis of corpus callosum	disease	BEFREE
C0178874	Tumor Progression	phenotype	BEFREE
C0205695	Carcinoid, Goblet Cell	disease	BEFREE
C0205851	Germ cell tumor	group	BEFREE
C0206656	Embryonal Rhabdomyosarcoma	disease	BEFREE
C0206696	Carcinoma, Signet Ring Cell	disease	BEFREE
C0206698	Cholangiocarcinoma	disease	BEFREE;CTD_human
C0206699	Cystadenocarcinoma, Mucinous	disease	BEFREE
C0206709	Cystadenoma, Serous	disease	BEFREE
C0206754	Neuroendocrine Tumors	group	BEFREE
C0220641	Lip and Oral Cavity Carcinoma	disease	BEFREE
C0220668	Congenital contractural arachnodactyly	disease	BEFREE
C0221273	Juvenile polyp	disease	BEFREE
C0221357	Brachydactyly	disease	CTD_human;HPO
C0231246	Failure to gain weight	phenotype	HPO
C0232462	Decrease in appetite	phenotype	HPO
C0232487	Abdominal discomfort	phenotype	HPO
C0235394	Wasting	disease	BEFREE
C0235782	Gallbladder Carcinoma	disease	BEFREE
C0235974	Pancreatic carcinoma	disease	BEFREE;CGI;CLINVAR;UNIPROT
C0236048	Polyposis, Gastric	disease	BEFREE;HPO
C0238463	Papillary thyroid carcinoma	disease	BEFREE
C0239234	Low set ears	phenotype	HPO
C0239594	Short finger	phenotype	HPO
C0239946	Fibrosis, Liver	disease	BEFREE
C0239981	Hypoalbuminemia	disease	HPO
C0240310	Hypoplasia of the maxilla	disease	HPO
C0241165	Thick skin	phenotype	HPO
C0242363	Islet Cell Tumor	disease	BEFREE
C0242379	Malignant neoplasm of lung	disease	BEFREE
C0242383	Age related macular degeneration	disease	BEFREE
C0262584	Carcinoma, Small Cell	disease	BEFREE
C0265610	Congenital clinodactyly	disease	HPO
C0267375	Chronic colitis	disease	BEFREE
C0267963	Exocrine pancreatic insufficiency	disease	HPO
C0268398	Familial lichen amyloidosis	disease	BEFREE
C0271633	Disorder of endocrine pancreas	group	BEFREE
C0276275	Disease due to Parvoviridae	disease	BEFREE
C0276496	Familial Alzheimer Disease (FAD)	disease	BEFREE
C0278701	Gastric Adenocarcinoma	disease	CLINVAR
C0278996	Malignant Head and Neck Neoplasm	disease	BEFREE
C0279607	Adult Hepatocellular Carcinoma	disease	RGD
C0279626	Squamous cell carcinoma of esophagus	disease	BEFREE
C0279628	Adenocarcinoma Of Esophagus	disease	BEFREE;CTD_human
C0279637	Anal carcinoma	disease	BEFREE
C0280100	Solid Neoplasm	phenotype	BEFREE
C0281361	Adenocarcinoma of pancreas	disease	BEFREE;CLINVAR;HPO
C0282160	Aplasia Cutis Congenita	disease	BEFREE
C0282313	Condition, Preneoplastic	phenotype	BEFREE
C0302501	Mandibular hyperplasia	phenotype	HPO
C0302592	Cervix carcinoma	disease	BEFREE
C0333519	Caries (morphologic abnormality)	disease	BEFREE
C0334108	Multiple polyps	disease	BEFREE
C0334299	Carcinoid tumor no ICD-O subtype	phenotype	BEFREE
C0334533	Arteriovenous hemangioma	disease	BEFREE
C0338106	Adenocarcinoma of colon	disease	BEFREE
C0339789	Congenital deafness	disease	HPO
C0345050	Congenital aneurysm of ascending aorta	disease	GENOMICS_ENGLAND
C0345832	Neoplasm of small intestine	disease	CGI
C0345893	Juvenile polyposis syndrome	disease	BEFREE;CLINGEN;CLINVAR;CTD_human;MGD;ORPHANET;UNIPROT
C0345905	Intrahepatic Cholangiocarcinoma	disease	BEFREE;CTD_human
C0346429	Multiple malignancy	phenotype	BEFREE
C0346627	Intestinal Cancer	group	BEFREE
C0346629	Malignant neoplasm of large intestine	disease	BEFREE
C0346647	Malignant neoplasm of pancreas	disease	BEFREE;CGI;CTD_human;HPO
C0346957	Disseminated Malignant Neoplasm	phenotype	BEFREE
C0347266	Polyp of duodenum	disease	BEFREE
C0347284	Benign tumor of pancreas	disease	CGI
C0349534	Carcinoma of anal margin	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0376634	Craniofacial Abnormalities	group	CTD_human
C0392885	High density lipoprotein measurement	phenotype	GWASDB
C0399526	Class III malocclusion	disease	HPO
C0410000	Overlap syndrome	disease	BEFREE
C0423112	Short palpebral fissure	phenotype	HPO
C0423224	Sunken eyes	phenotype	HPO
C0423867	Fine hair	phenotype	HPO
C0423903	Low intelligence	phenotype	HPO
C0424295	Hyperactive behavior	phenotype	BEFREE
C0424688	Small head	phenotype	HPO
C0432040	Simple syndactyly of toes, first web space	disease	HPO
C0476089	Endometrial Carcinoma	disease	BEFREE
C0476403	Electromyogram abnormal	phenotype	HPO
C0494165	Secondary malignant neoplasm of liver	disease	BEFREE
C0497156	Lymphadenopathy	group	HPO
C0497247	Increase in blood pressure	phenotype	HPO
C0518656	Chronic fatigue	phenotype	HPO
C0521525	Short neck	phenotype	HPO
C0546837	Malignant neoplasm of esophagus	disease	BEFREE
C0549473	Thyroid carcinoma	disease	BEFREE
C0553723	Squamous cell carcinoma of skin	disease	BEFREE
C0557874	Global developmental delay	disease	HPO
C0578038	Thin lips	phenotype	HPO
C0581883	Complete Hearing Loss	phenotype	CTD_human
C0585442	Osteosarcoma of bone	disease	BEFREE
C0586364	Moderate pancreatic duct dysplasia	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0597984	Biliary stricture	phenotype	BEFREE
C0598766	Leukemogenesis	disease	BEFREE
C0598935	Tumor Initiation	phenotype	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0677886	Epithelial ovarian cancer	disease	BEFREE
C0677898	invasive cancer	phenotype	BEFREE
C0677949	Stage III Colorectal Cancer	disease	BEFREE
C0677950	Stage IV Colorectal Cancer	disease	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0684249	Carcinoma of lung	disease	BEFREE
C0685409	Congenital Camptodactyly	disease	HPO
C0685938	Malignant neoplasm of gastrointestinal tract	disease	BEFREE
C0686619	Secondary malignant neoplasm of lymph node	disease	BEFREE
C0687713	Gastrointestinal pain	phenotype	HPO
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0699885	Carcinoma of bladder	disease	BEFREE
C0700095	Central neuroblastoma	disease	BEFREE
C0740277	Bile duct carcinoma	disease	BEFREE
C0740457	Malignant neoplasm of kidney	disease	BEFREE
C0741899	Poorly differentiated carcinoma	disease	BEFREE
C0744641	Intermittent migraine headaches	disease	HPO
C0750952	Biliary Tract Cancer	disease	BEFREE
C0751068	Deafness, Acquired	disease	CTD_human
C0751887	Medullary Neoplasms	disease	BEFREE
C0796081	Myhre syndrome	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C0850572	Adenomatous polyp of colon	disease	BEFREE
C0850666	Infection caused by Helicobacter pylori	disease	BEFREE
C0851887	Adenoviral infections	group	BEFREE
C0854778	Pancreatic carcinoma resectable	disease	BEFREE
C0858252	Breast adenocarcinoma	disease	BEFREE
C0860864	Decreased albumin	phenotype	HPO
C0878500	Intraepithelial Neoplasia	disease	BEFREE
C0887833	Carcinoma, Pancreatic Ductal	disease	BEFREE
C0917804	Arteriovenous Malformations, Cerebral	group	BEFREE
C0917816	Mental deficiency	disease	HPO
C0919267	ovarian neoplasm	disease	BEFREE
C0920299	Overriding toe	phenotype	HPO
C0940937	precancerous lesions	phenotype	BEFREE
C0948380	Colorectal cancer metastatic	disease	BEFREE
C0950123	Genetic Diseases, Inborn	group	CLINVAR
C1134719	Invasive Ductal Breast Carcinoma	disease	BEFREE;CTD_human
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE;CLINVAR
C1176475	Ductal Carcinoma	disease	BEFREE;LHGDN
C1260899	Anemia, Diamond-Blackfan	disease	BEFREE
C1261473	Sarcoma	group	BEFREE
C1262477	Weight decreased	phenotype	HPO
C1275122	Familial multiple trichoepitheliomata	disease	BEFREE
C1279945	Acute interstitial pneumonia	disease	BEFREE
C1301034	Pancreatic intraepithelial neoplasia	disease	BEFREE
C1302645	Polyp of small intestine	phenotype	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1319315	Adenocarcinoma of large intestine	disease	CGI
C1321551	Shprintzen-Goldberg syndrome	disease	BEFREE
C1333762	Gastric Cardia Adenocarcinoma	disease	BEFREE
C1333990	Hereditary Nonpolyposis Colorectal Cancer	disease	BEFREE
C1334274	Invasive Carcinoma	phenotype	BEFREE
C1335302	Pancreatic Ductal Adenocarcinoma	disease	BEFREE
C1335475	Primary Carcinoma	phenotype	BEFREE
C1378703	Renal carcinoma	disease	BEFREE
C1384666	hearing impairment	phenotype	HPO
C1386048	Intrauterine retardation	phenotype	HPO
C1402294	Primary Lesion	phenotype	BEFREE
C1402315	Vascular lesions	disease	BEFREE
C1458155	Mammary Neoplasms	group	BEFREE;CLINVAR;LHGDN
C1511789	Desmoplastic	disease	BEFREE
C1519346	Skin Carcinogenesis	disease	BEFREE
C1519670	Tumor Angiogenesis	phenotype	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE;CTD_human;GENOMICS_ENGLAND;UNIPROT
C1527349	Ductal Breast Carcinoma	disease	BEFREE
C1697453	Spontaneous hematomas	disease	HPO
C1704272	Benign Prostatic Hyperplasia	disease	BEFREE
C1708349	Hereditary Diffuse Gastric Cancer	disease	CTD_human
C1762616	Meningioma, benign, no ICD-O subtype	disease	BEFREE
C1812607	Aortic aneurysm and dissection	disease	BEFREE
C1832661	ANOPHTHALMIA AND PULMONARY HYPOPLASIA	disease	BEFREE
C1832940	JUVENILE POLYPOSIS OF STOMACH	disease	CLINGEN;CTD_human;MGD;ORPHANET;UNIPROT
C1832942	JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)	disease	BEFREE;CLINVAR;CTD_human;UNIPROT
C1835763	Vertebral body fusion	phenotype	HPO
C1836189	Radial deviation of finger	phenotype	HPO
C1836195	Short toe	phenotype	HPO
C1837770	Sparse hair	phenotype	HPO
C1842083	Abnormality of the ribs	phenotype	HPO
C1842408	increased risk of pancreatic cancer	phenotype	HPO
C1843108	Short palm	phenotype	HPO
C1843367	Poor school performance	phenotype	HPO
C1844548	Hypoplastic finger	phenotype	HPO
C1844704	Platyspondyly	phenotype	HPO
C1848654	Broad ribs	phenotype	HPO
C1849073	Fused vertebrae	phenotype	HPO
C1853242	Midface retrusion	phenotype	HPO
C1853487	Thick eyebrow	phenotype	HPO
C1854113	Prominent nasal bridge	phenotype	HPO
C1854912	Short long bone	phenotype	HPO
C1857108	Limitation of joint mobility	phenotype	HPO
C1858085	Malar flattening	phenotype	HPO
C1858452	Thickened calvaria	phenotype	HPO
C1860844	Thin, sparse hair	phenotype	HPO
C1861324	Short philtrum	phenotype	HPO
C1864897	Cognitive delay	phenotype	HPO
C1865017	Thin upper lip vermilion	phenotype	HPO
C1865027	Hypoplastic iliac wing	phenotype	HPO
C1865037	Cone-shaped epiphysis	phenotype	HPO
C1868081	Juvenile Polyposis Coli	disease	CLINGEN;CTD_human;MGD;ORPHANET;UNIPROT
C1868085	Craniofacial hyperostosis	phenotype	HPO
C1883486	Uterine Corpus Cancer	disease	BEFREE
C1961121	Congenital vascular anomaly	group	BEFREE
C1971624	Loss of appetite (finding)	phenotype	HPO
C2227134	mandibular excess (physical finding)	phenotype	HPO
C2239176	Liver carcinoma	disease	BEFREE
C2265792	Skeletal muscle hypertrophy	phenotype	HPO
C2315100	Pediatric failure to thrive	disease	HPO
C2673410	Small midface	phenotype	HPO
C2931038	Pancreatic carcinoma, familial	disease	BEFREE;ORPHANET
C2931039	Pancreatic islet cell tumors	disease	BEFREE
C2939420	Metastatic Neoplasm	phenotype	BEFREE
C2973725	Pulmonary arterial hypertension	disease	GENOMICS_ENGLAND
C2987145	Pancreatic Intraepithelial Neoplasia-3	disease	BEFREE
C3146251	Stage IV Colorectal Cancer AJCC v7	disease	BEFREE
C3203102	Idiopathic pulmonary arterial hypertension	disease	GENOMICS_ENGLAND
C3272802	Hamartomatous polyposis	phenotype	HPO
C3276815	Stiff skin	phenotype	HPO
C3277418	Gastrointestinal hamartomatous polyps	disease	BEFREE;HPO
C3278509	Spinal fusion	phenotype	HPO
C3469521	FANCONI ANEMIA, COMPLEMENTATION GROUP A (disorder)	disease	BEFREE
C3639956	Functional intestinal obstruction	phenotype	HPO
C3665473	Bilateral Deafness	phenotype	CTD_human
C3714239	Bmpr1a-Related Juvenile Polyposis	disease	CTD_human
C3714240	Smad4-Related Juvenile Polyposis	disease	CTD_human
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND;HPO
C3805278	Extrahepatic Cholangiocarcinoma	disease	BEFREE;CTD_human
C3805639	Generalized muscle hypertrophy	phenotype	HPO
C3806280	Laryngotracheal stenosis	phenotype	HPO
C3887461	Head and Neck Carcinoma	disease	BEFREE
C4020875	Mental and motor retardation	phenotype	HPO
C4020876	Dull intelligence	phenotype	HPO
C4020878	Diffusely thickened skin	phenotype	HPO
C4021611	Abnormality of epiphysis morphology	phenotype	HPO
C4021738	Abnormality of the pubic bone	phenotype	HPO
C4021776	Abnormality of the voice	phenotype	HPO
C4021977	Visceral angiomatosis	disease	HPO
C4022018	Telangiectasia of the skin	phenotype	HPO
C4024618	Large iliac wings	phenotype	HPO
C4024665	High-grade hypermetropia	phenotype	HPO
C4025303	Enlarged vertebral pedicles	phenotype	HPO
C4025790	Specific learning disability	disease	HPO
C4025814	Abnormality of the metaphysis	phenotype	HPO
C4048328	cervical cancer	disease	BEFREE
C4082243	Maxillary retrognathia	phenotype	HPO
C4082305	Deaf Mutism	disease	CTD_human
C4230640	Convex nasal bridge	phenotype	HPO
C4280304	Curvature of digit	phenotype	HPO
C4280320	Hypotrophic midface	phenotype	HPO
C4280321	Decreased projection of midface	phenotype	HPO
C4280516	Thick craniofacial bones	phenotype	HPO
C4280517	Enlargement of craniofacial bones	phenotype	HPO
C4280518	Hypertrophy of craniofacial bones	phenotype	HPO
C4280560	Increased thickness of cranium	phenotype	HPO
C4280640	Retrusion of upper jaw bones	phenotype	HPO
C4280641	Hypotrophic maxilla	phenotype	HPO
C4280642	Deficiency of upper jaw bones	phenotype	HPO
C4280643	Decreased projection of maxilla	phenotype	HPO
C4280644	Increased size of the mandible	phenotype	HPO
C4280645	Hypertrophy of lower jaw	phenotype	HPO
C4280651	Hypotrophic malar bone	phenotype	HPO
C4531021	Undergrowth	phenotype	HPO
C4531300	Frequent nosebleeds	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000978	RNA polymerase II cis-regulatory region sequence-specific DNA binding	IDA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISA
GO:0000981	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM
GO:0000987	cis-regulatory region sequence-specific DNA binding	IDA
GO:0001085	RNA polymerase II transcription factor binding	IEA
GO:0001223	transcription coactivator binding	IPI
GO:0001228	DNA-binding transcription activator activity, RNA polymerase II-specific	IDA
GO:0003682	chromatin binding	IEA
GO:0003712	transcription coregulator activity	IDA
GO:0005515	protein binding	IPI
GO:0005518	collagen binding	IEA
GO:0030616	transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	IDA
GO:0042802	identical protein binding	IPI
GO:0042803	protein homodimerization activity	IPI
GO:0043199	sulfate binding	IMP
GO:0044212	transcription regulatory region DNA binding	IDA
GO:0046872	metal ion binding	IEA
GO:0070411	I-SMAD binding	IPI
GO:0070412	R-SMAD binding	IPI
GO:0098772	molecular function regulator	IEA
GO:0003677	DNA binding	IDA
GO:0003700	DNA-binding transcription factor activity	IDA
GO:0043565	sequence-specific DNA binding	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0000122	negative regulation of transcription by RNA polymerase II	ISS
GO:0000122	negative regulation of transcription by RNA polymerase II	TAS
GO:0001541	ovarian follicle development	IEA
GO:0001658	branching involved in ureteric bud morphogenesis	IEA
GO:0001666	response to hypoxia	IMP
GO:0001701	in utero embryonic development	IEA
GO:0001702	gastrulation with mouth forming second	IEA
GO:0003148	outflow tract septum morphogenesis	ISS
GO:0003190	atrioventricular valve formation	ISS
GO:0003198	epithelial to mesenchymal transition involved in endocardial cushion formation	IEA
GO:0003220	left ventricular cardiac muscle tissue morphogenesis	ISS
GO:0003251	positive regulation of cell proliferation involved in heart valve morphogenesis	ISS
GO:0003360	brainstem development	IEA
GO:0006879	cellular iron ion homeostasis	ISS
GO:0007179	transforming growth factor beta receptor signaling pathway	ISS
GO:0007179	transforming growth factor beta receptor signaling pathway	IMP
GO:0007179	transforming growth factor beta receptor signaling pathway	IDA
GO:0007179	transforming growth factor beta receptor signaling pathway	TAS
GO:0007183	SMAD protein complex assembly	IDA
GO:0007283	spermatogenesis	IEA
GO:0007338	single fertilization	IEA
GO:0007411	axon guidance	IEA
GO:0008283	cell population proliferation	IEA
GO:0008285	negative regulation of cell population proliferation	IEA
GO:0010614	negative regulation of cardiac muscle hypertrophy	ISS
GO:0010718	positive regulation of epithelial to mesenchymal transition	ISS
GO:0010862	positive regulation of pathway-restricted SMAD protein phosphorylation	ISS
GO:0014033	neural crest cell differentiation	IEA
GO:0016579	protein deubiquitination	TAS
GO:0017015	regulation of transforming growth factor beta receptor signaling pathway	IMP
GO:0030308	negative regulation of cell growth	IDA
GO:0030509	BMP signaling pathway	ISS
GO:0030509	BMP signaling pathway	IDA
GO:0030509	BMP signaling pathway	TAS
GO:0030511	positive regulation of transforming growth factor beta receptor signaling pathway	IDA
GO:0030513	positive regulation of BMP signaling pathway	IMP
GO:0032525	somite rostral/caudal axis specification	IEA
GO:0032909	regulation of transforming growth factor beta2 production	IMP
GO:0033686	positive regulation of luteinizing hormone secretion	IEA
GO:0035019	somatic stem cell population maintenance	TAS
GO:0035556	intracellular signal transduction	IMP
GO:0036302	atrioventricular canal development	ISS
GO:0042118	endothelial cell activation	IEA
GO:0042733	embryonic digit morphogenesis	IEA
GO:0045892	negative regulation of transcription, DNA-templated	IDA
GO:0045893	positive regulation of transcription, DNA-templated	IDA
GO:0045944	positive regulation of transcription by RNA polymerase II	ISS
GO:0045944	positive regulation of transcription by RNA polymerase II	IDA
GO:0045944	positive regulation of transcription by RNA polymerase II	TAS
GO:0046881	positive regulation of follicle-stimulating hormone secretion	IEA
GO:0048382	mesendoderm development	IEA
GO:0048589	developmental growth	IEA
GO:0048663	neuron fate commitment	IEA
GO:0048733	sebaceous gland development	IEA
GO:0048859	formation of anatomical boundary	IEA
GO:0051098	regulation of binding	IEA
GO:0051571	positive regulation of histone H3-K4 methylation	ISS
GO:0051797	regulation of hair follicle development	IEA
GO:0060065	uterus development	IEA
GO:0060391	positive regulation of SMAD protein signal transduction	ISS
GO:0060395	SMAD protein signal transduction	IDA
GO:0060412	ventricular septum morphogenesis	ISS
GO:0060548	negative regulation of cell death	IEA
GO:0060956	endocardial cell differentiation	ISS
GO:0061040	female gonad morphogenesis	IEA
GO:0061614	pri-miRNA transcription by RNA polymerase II	IEA
GO:0062009	secondary palate development	ISS
GO:0070102	interleukin-6-mediated signaling pathway	ISS
GO:0070373	negative regulation of ERK1 and ERK2 cascade	ISS
GO:0071559	response to transforming growth factor beta	IDA
GO:0071773	cellular response to BMP stimulus	NAS
GO:0072133	metanephric mesenchyme morphogenesis	IEA
GO:0072134	nephrogenic mesenchyme morphogenesis	IEA
GO:0072520	seminiferous tubule development	IEA
GO:1901522	positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus	TAS
GO:1905305	negative regulation of cardiac myofibril assembly	ISS
GO:2000617	positive regulation of histone H3-K9 acetylation	ISS

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000790	nuclear chromatin	ISA
GO:0000790	nuclear chromatin	IDA
GO:0005623	cell	IEA
GO:0005634	nucleus	IDA
GO:0005654	nucleoplasm	IDA
GO:0005654	nucleoplasm	TAS
GO:0005667	transcription factor complex	IPI
GO:0005667	transcription factor complex	IDA
GO:0005737	cytoplasm	IDA
GO:0005813	centrosome	IDA
GO:0005829	cytosol	IDA
GO:0005829	cytosol	TAS
GO:0032444	activin responsive factor complex	IDA
GO:0071141	SMAD protein complex	IMP
GO:0071141	SMAD protein complex	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1181150	Signaling by NODAL	TAS
R-HSA-1266738	Developmental Biology	TAS
R-HSA-1502540	Signaling by Activin	TAS
R-HSA-162582	Signal Transduction	TAS
R-HSA-162582	Signal Transduction	IEA
R-HSA-1643685	Disease	TAS
R-HSA-170834	Signaling by TGF-beta Receptor Complex	TAS
R-HSA-170834	Signaling by TGF-beta Receptor Complex	IEA
R-HSA-201451	Signaling by BMP	TAS
R-HSA-212436	Generic Transcription Pathway	TAS
R-HSA-212436	Generic Transcription Pathway	IEA
R-HSA-2173789	TGF-beta receptor signaling activates SMADs	TAS
R-HSA-2173793	Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer	TAS
R-HSA-2173793	Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer	IEA
R-HSA-2173795	Downregulation of SMAD2/3:SMAD4 transcriptional activity	TAS
R-HSA-2173795	Downregulation of SMAD2/3:SMAD4 transcriptional activity	IEA
R-HSA-2173796	SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription	TAS
R-HSA-3304347	Loss of Function of SMAD4 in Cancer	TAS
R-HSA-3304349	Loss of Function of SMAD2/3 in Cancer	TAS
R-HSA-3304351	Signaling by TGF-beta Receptor Complex in Cancer	TAS
R-HSA-3311021	SMAD4 MH2 Domain Mutants in Cancer	TAS
R-HSA-3315487	SMAD2/3 MH2 Domain Mutants in Cancer	TAS
R-HSA-392499	Metabolism of proteins	TAS
R-HSA-452723	Transcriptional regulation of pluripotent stem cells	TAS
R-HSA-5663202	Diseases of signal transduction	TAS
R-HSA-5688426	Deubiquitination	TAS
R-HSA-5689880	Ub-specific processing proteases	TAS
R-HSA-597592	Post-translational protein modification	TAS
R-HSA-73857	RNA Polymerase II Transcription	TAS
R-HSA-73857	RNA Polymerase II Transcription	IEA
R-HSA-74160	Gene expression (Transcription)	TAS
R-HSA-74160	Gene expression (Transcription)	IEA
R-HSA-8878159	Transcriptional regulation by RUNX3	TAS
R-HSA-8878166	Transcriptional regulation by RUNX2	TAS
R-HSA-8941326	RUNX2 regulates bone development	TAS
R-HSA-8941855	RUNX3 regulates CDKN1A transcription	TAS
R-HSA-8952158	RUNX3 regulates BCL2L11 (BIM) transcription	TAS
R-HSA-9006936	Signaling by TGF-beta family members	TAS
R-HSA-9006936	Signaling by TGF-beta family members	IEA
R-HSA-9614085	FOXO-mediated transcription	IEA
R-HSA-9614085	FOXO-mediated transcription	TAS
R-HSA-9615017	FOXO-mediated transcription of oxidative stress, metabolic and neuronal genes	IEA
R-HSA-9617828	FOXO-mediated transcription of cell cycle genes	IEA
R-HSA-9617828	FOXO-mediated transcription of cell cycle genes	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
C049325	1,2-dithiol-3-thione	1,2-dithiol-3-thione results in decreased expression of SMAD4 mRNA	19162173
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of SMAD4 mRNA	25234470
C070055	2,3',4,4',5-pentachlorobiphenyl	2,3',4,4',5-pentachlorobiphenyl results in increased expression of SMAD4 mRNA	31388691
C016403	2,4-dinitrotoluene	2,4-dinitrotoluene affects the expression of SMAD4 mRNA	21346803
D015073	2-Acetylaminofluorene	2-Acetylaminofluorene results in decreased expression of SMAD4 mRNA	22213190
C583074	4,4'-hexafluorisopropylidene diphenol	4,4'-hexafluorisopropylidene diphenol results in increased expression of SMAD4 mRNA	25912373
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SMAD4 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of SMAD4 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SMAD4 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide inhibits the reaction [TGFB3 protein affects the localization of SMAD4 protein]	21586554
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in decreased expression of SMAD4 mRNA	20018196
D000079	Acetaldehyde	SMAD4 protein promotes the reaction [Acetaldehyde results in increased expression of COL1A2 mRNA]	16025520
D000082	Acetaminophen	Acetaminophen results in decreased expression of SMAD4 mRNA	27761495
D000082	Acetaminophen	Acetaminophen results in decreased expression of SMAD4 mRNA	22610607
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of SMAD4 gene	27153756
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of SMAD4 mRNA	19770486
D024502	alpha-Tocopherol	SMAD4 results in decreased susceptibility to [Fluorouracil co-treated with alpha-Tocopherol]	20562578
D000077410	Aluminum Chloride	Aluminum Chloride inhibits the reaction [SMAD2 protein binds to SMAD3 protein binds to SMAD4 protein]	26658030
D000077410	Aluminum Chloride	Aluminum Chloride results in decreased expression of [SMAD2 protein binds to SMAD3 protein binds to SMAD4 protein]	27720690
D000077410	Aluminum Chloride	Aluminum Chloride results in decreased expression of SMAD4 mRNA	26658030; 27720690;
D000077410	Aluminum Chloride	Aluminum Chloride results in increased expression of SMAD4 mRNA	26658030
D000077410	Aluminum Chloride	TGFB1 protein inhibits the reaction [Aluminum Chloride results in decreased expression of [SMAD2 protein binds to SMAD3 protein binds to SMAD4 protein]]	27720690
D017311	Amlodipine	Amlodipine inhibits the reaction [[Doxorubicin co-treated with TGFB1 protein] results in increased expression of SMAD4 mRNA]	21337027
D017311	Amlodipine	Amlodipine inhibits the reaction [[Doxorubicin co-treated with TGFB1 protein] results in increased expression of SMAD4 protein]	21337027
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of SMAD4 mRNA	16483693
D000643	Ammonium Chloride	Ammonium Chloride results in increased expression of SMAD4 protein	16483693
D001151	Arsenic	Arsenic affects the methylation of SMAD4 gene	25304211
D001205	Ascorbic Acid	[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA	26492236
D001205	Ascorbic Acid	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride inhibits the reaction [[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA]	26492236
C031463	beta-glycerophosphoric acid	[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA	26492236
C031463	beta-glycerophosphoric acid	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride inhibits the reaction [[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA]	26492236
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of SMAD4 mRNA	25912373
C006780	bisphenol A	bisphenol A affects the expression of SMAD4 mRNA	21786754
C006780	bisphenol A	bisphenol A affects the methylation of SMAD4 promoter	27334623
C006780	bisphenol A	bisphenol A results in decreased expression of SMAD4 mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased expression of SMAD4 mRNA	30816183
C006780	bisphenol A	bisphenol A results in increased methylation of SMAD4 gene	28505145
C077793	candesartan cilexetil	candesartan cilexetil inhibits the reaction [sodium arsenite results in increased expression of SMAD4 protein]	27889505
D002220	Carbamazepine	Carbamazepine affects the expression of SMAD4 mRNA	24752500; 25979313;
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased expression of SMAD4 mRNA	16570350
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased expression of SMAD4 protein	17334410; 25150141;
D002251	Carbon Tetrachloride	FR 167653 inhibits the reaction [Carbon Tetrachloride results in increased expression of SMAD4 protein]	17334410
D020111	Chlorodiphenyl (54% Chlorine)	Chlorodiphenyl (54% Chlorine) results in decreased expression of SMAD4 mRNA	16934159
D002791	Cholesterol, Dietary	Cholesterol, Dietary results in increased expression of SMAD4 mRNA	27239252
D002791	Cholesterol, Dietary	Rutin inhibits the reaction [Cholesterol, Dietary results in increased expression of SMAD4 mRNA]	27239252
D002857	Chromium	Chromium results in increased expression of SMAD4 mRNA	17692352
D019327	Copper Sulfate	Copper Sulfate results in decreased expression of SMAD4 mRNA	19549813
D003474	Curcumin	Curcumin results in decreased expression of SMAD4 mRNA	27237783
D003474	Curcumin	Curcumin inhibits the reaction [[SMAD4 protein binds to SMAD3 protein] which binds to PPARG promoter]	16959952
D016572	Cyclosporine	Cyclosporine results in increased expression of SMAD4 mRNA	20106945
C107676	deguelin	deguelin inhibits the reaction [TGFB1 protein affects the localization of SMAD4 protein]	22986522
D003703	Demecolcine	Demecolcine results in increased expression of SMAD4 mRNA	23649840
D003907	Dexamethasone	[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA	26492236
D003907	Dexamethasone	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride inhibits the reaction [[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA]	26492236
D004008	Diclofenac	Diclofenac affects the expression of SMAD4 mRNA	24752500
D004041	Dietary Fats	[Diethylnitrosamine co-treated with Dietary Fats] results in increased expression of SMAD4 protein	30826251
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with Dietary Fats] results in increased expression of SMAD4 protein	30826251
D004052	Diethylnitrosamine	Diethylnitrosamine affects the expression of SMAD4 protein	18971187
D013196	Dihydrotestosterone	Dihydrotestosterone results in decreased expression of SMAD4 mRNA	16597033
C547156	dimethylthioarsinic acid	dimethylthioarsinic acid results in increased expression of SMAD4 mRNA	19945496
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SMAD4 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of SMAD4 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SMAD4 mRNA	27188386
D017292	Doxazosin	Doxazosin results in increased expression of SMAD4 mRNA	12771931; 16007219;
D017292	Doxazosin	Doxazosin results in increased expression of SMAD4 protein	12771931; 16007219;
D017292	Doxazosin	SERPINB5 protein promotes the reaction [Doxazosin results in increased expression of SMAD4 mRNA]	16007219
D017292	Doxazosin	SERPINB5 protein promotes the reaction [Doxazosin results in increased expression of SMAD4 protein]	16007219
D004317	Doxorubicin	Amlodipine inhibits the reaction [[Doxorubicin co-treated with TGFB1 protein] results in increased expression of SMAD4 mRNA]	21337027
D004317	Doxorubicin	Amlodipine inhibits the reaction [[Doxorubicin co-treated with TGFB1 protein] results in increased expression of SMAD4 protein]	21337027
D004317	Doxorubicin	[Doxorubicin co-treated with TGFB1 protein] results in increased expression of SMAD4 mRNA	21337027
D004317	Doxorubicin	[Doxorubicin co-treated with TGFB1 protein] results in increased expression of SMAD4 protein	21337027
D004317	Doxorubicin	Doxorubicin results in decreased expression of SMAD4 mRNA	29803840
D004317	Doxorubicin	Doxorubicin results in decreased expression of SMAD4 protein	18606404
D004317	Doxorubicin	Doxorubicin results in increased expression of SMAD4 mRNA	21337027
D004791	Enzyme Inhibitors	[Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of SMAD4 protein	23301498
D004855	Equilenin	Equilenin results in increased expression of SMAD4 mRNA	25611945
D000431	Ethanol	BMP6 protein inhibits the reaction [Ethanol results in decreased expression of SMAD4 mRNA]	24746831
D000431	Ethanol	Ethanol results in increased expression of SMAD4 mRNA	23378141
D000431	Ethanol	BMP6 protein affects the reaction [Ethanol affects the localization of SMAD4 protein]	24746831
D000431	Ethanol	BMP6 protein affects the reaction [Ethanol inhibits the reaction [SMAD4 protein binds to HAMP promoter]]	24746831
D000431	Ethanol	Ethanol affects the localization of SMAD4 protein	24746831
D000431	Ethanol	Ethanol inhibits the reaction [Iron Carbonyl Compounds results in increased expression of SMAD4 protein]	24746831
D000431	Ethanol	Ethanol inhibits the reaction [SMAD4 protein binds to HAMP promoter]	24746831
D000431	Ethanol	Ethanol results in decreased expression of SMAD4 mRNA	24746831
D000431	Ethanol	Ethanol results in decreased expression of SMAD4 protein	24746831
D000431	Ethanol	Quercetin affects the reaction [Ethanol affects the localization of SMAD4 protein]	24746831
D000431	Ethanol	Quercetin inhibits the reaction [Ethanol inhibits the reaction [SMAD4 protein binds to HAMP promoter]]	24746831
D000431	Ethanol	Quercetin inhibits the reaction [Ethanol results in decreased expression of SMAD4 mRNA]	24746831
D000431	Ethanol	Quercetin inhibits the reaction [Ethanol results in decreased expression of SMAD4 protein]	24746831
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of SMAD4 mRNA	17606305
D004997	Ethinyl Estradiol	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of SMAD4 mRNA	17942748
D005038	Ethylnitrosourea	Ethylnitrosourea results in increased mutagenesis of SMAD4 gene	16724327
D011345	Fenofibrate	Fenofibrate inhibits the reaction [SMAD4 protein results in increased expression of SERPINE1 mRNA]	19593819
D011345	Fenofibrate	NR0B2 protein promotes the reaction [Fenofibrate inhibits the reaction [SMAD4 protein results in increased expression of SERPINE1 mRNA]]	19593819
D005472	Fluorouracil	SMAD4 results in decreased susceptibility to [Fluorouracil co-treated with alpha-Tocopherol]	20562578
C104334	FR 167653	FR 167653 inhibits the reaction [Carbon Tetrachloride results in increased expression of SMAD4 protein]	17334410
C037032	galangin	galangin results in increased expression of SMAD4 mRNA	25268046
C037032	galangin	SMAD4 mutant form inhibits the reaction [galangin results in increased expression of ATG12 protein]	25268046
C037032	galangin	SMAD4 mutant form inhibits the reaction [galangin results in increased expression of ATG16L1 protein]	25268046
C037032	galangin	SMAD4 mutant form inhibits the reaction [galangin results in increased expression of ATG3 protein]	25268046
C037032	galangin	SMAD4 mutant form inhibits the reaction [galangin results in increased expression of BECN1 protein]	25268046
D005839	Gentamicins	Gentamicins results in increased expression of SMAD4 mRNA	22061828
D005947	Glucose	Glucose results in increased expression of SMAD4 protein	21367880
D005947	Glucose	isoangustone A inhibits the reaction [Glucose results in increased expression of SMAD4 protein]	21367880
C010974	glyphosate	glyphosate results in increased expression of SMAD4 mRNA	17984146
C056599	icariin	icariin results in increased expression of SMAD4 mRNA	19747809
C056599	icariin	NOG protein inhibits the reaction [icariin results in increased expression of SMAD4 mRNA]	19747809
D054354	Iron Carbonyl Compounds	Ethanol inhibits the reaction [Iron Carbonyl Compounds results in increased expression of SMAD4 protein]	24746831
D054354	Iron Carbonyl Compounds	Iron Carbonyl Compounds results in increased expression of SMAD4 protein	24746831
D054354	Iron Carbonyl Compounds	Quercetin inhibits the reaction [Iron Carbonyl Compounds results in increased expression of SMAD4 protein]	24746831
C551631	isoangustone A	isoangustone A inhibits the reaction [Glucose results in increased expression of SMAD4 protein]	21367880
C410337	K 7174	K 7174 results in increased expression of SMAD4 mRNA	24086573
C038753	leptomycin B	[leptomycin B results in decreased activity of XPO1 protein] which results in decreased export of SMAD4 protein	26354774
C440499	lipopolysaccharide, Escherichia coli O111 B4	lipopolysaccharide, Escherichia coli O111 B4 results in increased expression of SMAD4 protein	25234611
C440499	lipopolysaccharide, Escherichia coli O111 B4	Resveratrol inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased expression of SMAD4 protein]	25234611
D008694	Methamphetamine	Methamphetamine results in increased expression of SMAD4 mRNA	29802913
C014085	methotrexate polyglutamate	SMAD4 gene affects the abundance of methotrexate polyglutamate	19066393
D008746	Methylazoxymethanol Acetate	Methylazoxymethanol Acetate affects the expression of SMAD4 mRNA	28349193
C005219	methyl cellosolve	methyl cellosolve results in increased expression of SMAD4 mRNA	19643169
C004925	methylmercuric chloride	methylmercuric chloride results in decreased expression of SMAD4 mRNA	26272509; 28001369;
C004925	methylmercuric chloride	methylmercuric chloride results in increased expression of SMAD4 mRNA	20061341
D008770	Methylnitrosourea	SMAD4 gene mutant form results in increased susceptibility to Methylnitrosourea	12096346
C000622638	MLN7243	MLN7243 results in increased sumoylation of SMAD4 protein	31285264
C406082	monomethylarsonous acid	monomethylarsonous acid results in increased expression of SMAD4 protein	24625837
D037742	Nanotubes, Carbon	Nanotubes, Carbon affects the expression of SMAD4 mRNA	23845593
D009569	Nitric Oxide	Nitric Oxide results in increased activity of [SMAD4 protein binds to SMAD3 protein]	15949472
D009569	Nitric Oxide	[SMAD4 protein co-treated with SMAD3 protein] affects the susceptibility to Nitric Oxide	15949472
C007350	nitrofen	nitrofen results in decreased expression of SMAD4 mRNA	12149686
C572573	N-nitroso-tris-chloroethylurea	N-nitroso-tris-chloroethylurea results in increased expression of SMAD4 mRNA	27935865
C434926	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride	N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride inhibits the reaction [[Ascorbic Acid co-treated with Dexamethasone co-treated with beta-glycerophosphoric acid] results in increased expression of SMAD4 mRNA]	26492236
C046627	osthol	[platycodin D co-treated with osthol] results in decreased expression of SMAD4 mRNA	23603464
C046627	osthol	[platycodin D co-treated with osthol] results in decreased expression of SMAD4 protein	23603464
D010042	Ouabain	Ouabain results in decreased expression of SMAD4 mRNA	28795476
D052638	Particulate Matter	Particulate Matter affects the expression of SMAD4 mRNA	30806761
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SMAD4 mRNA	27188386
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in decreased expression of SMAD4 mRNA	26272509
C108953	platycodin D	[platycodin D co-treated with osthol] results in decreased expression of SMAD4 mRNA	23603464
C108953	platycodin D	[platycodin D co-treated with osthol] results in decreased expression of SMAD4 protein	23603464
D011374	Progesterone	Progesterone affects the expression of SMAD4 mRNA	17251523
D011794	Quercetin	Quercetin inhibits the reaction [SMAD2 protein modified form binds to SMAD3 protein modified form binds to SMAD4 protein]	15580028
D011794	Quercetin	Quercetin results in decreased expression of SMAD4 protein	15580028
D011794	Quercetin	Quercetin affects the reaction [Ethanol affects the localization of SMAD4 protein]	24746831
D011794	Quercetin	Quercetin inhibits the reaction [Ethanol inhibits the reaction [SMAD4 protein binds to HAMP promoter]]	24746831
D011794	Quercetin	Quercetin inhibits the reaction [Ethanol results in decreased expression of SMAD4 mRNA]	24746831
D011794	Quercetin	Quercetin inhibits the reaction [Ethanol results in decreased expression of SMAD4 protein]	24746831
D011794	Quercetin	Quercetin inhibits the reaction [Iron Carbonyl Compounds results in increased expression of SMAD4 protein]	24746831
D000077185	Resveratrol	Resveratrol results in decreased expression of SMAD4 mRNA	18089832; 25721869; 27008654;
D000077185	Resveratrol	Resveratrol results in decreased expression of SMAD4 protein	25721869; 27008654;
D000077185	Resveratrol	Resveratrol inhibits the reaction [lipopolysaccharide, Escherichia coli O111 B4 results in increased expression of SMAD4 protein]	25234611
D000077185	Resveratrol	Resveratrol results in increased expression of SMAD4 mRNA	19228061
D012431	Rutin	Rutin inhibits the reaction [Cholesterol, Dietary results in increased expression of SMAD4 mRNA]	27239252
C110881	S-nitro-N-acetylpenicillamine	S-nitro-N-acetylpenicillamine results in increased activity of [SMAD4 protein binds to SMAD3 protein]	15949472
C017947	sodium arsenite	sodium arsenite results in increased expression of SMAD4 mRNA	12016162; 12760830;
C017947	sodium arsenite	candesartan cilexetil inhibits the reaction [sodium arsenite results in increased expression of SMAD4 protein]	27889505
C017947	sodium arsenite	sodium arsenite results in increased expression of SMAD4 protein	27889505
D013311	Streptozocin	SOD1 protein inhibits the reaction [Streptozocin results in decreased expression of SMAD4 mRNA]	27629361
D013311	Streptozocin	Streptozocin results in decreased expression of SMAD4 mRNA	27629361
D013311	Streptozocin	Streptozocin results in increased expression of SMAD4 mRNA	16973718; 18246672;
D013311	Streptozocin	Streptozocin results in increased expression of SMAD4 protein	18246672
D013311	Streptozocin	Trientine inhibits the reaction [Streptozocin results in increased expression of SMAD4 mRNA]	16973718
C061133	tamibarotene	tamibarotene results in decreased expression of SMAD4 mRNA	15498508
C004648	testosterone enanthate	testosterone enanthate affects the expression of SMAD4 mRNA	17440010
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of SMAD4 mRNA	24058054; 28213091;
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of SMAD4 mRNA	17942748
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in decreased expression of SMAD4 mRNA	11752688
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution affects the expression of SMAD4 mRNA	27237783
D014112	Toxaphene	Toxaphene results in increased expression of SMAD4 mRNA	21220043
D014212	Tretinoin	Tretinoin inhibits the reaction [TGFB1 results in increased expression of SMAD4 protein]	21274875
D014212	Tretinoin	Tretinoin results in decreased expression of SMAD4 mRNA	15498508
C012589	trichostatin A	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of SMAD4 mRNA	27188386
C012589	trichostatin A	trichostatin A results in increased expression of SMAD4 mRNA	26272509
D014266	Trientine	Trientine inhibits the reaction [Streptozocin results in increased expression of SMAD4 mRNA]	16973718
C016805	tris(1,3-dichloro-2-propyl)phosphate	tris(1,3-dichloro-2-propyl)phosphate results in increased expression of SMAD4 mRNA	26179874
D000077288	Troglitazone	Troglitazone results in decreased expression of SMAD4 mRNA	28973697
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SMAD4 mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of SMAD4 mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in decreased expression of SMAD4 mRNA	23179753; 24383497; 24935251; 25192806; 26272509; 28001369;
D014635	Valproic Acid	Valproic Acid results in decreased expression of SMAD4 mRNA	20546886; 21427059;
D014635	Valproic Acid	Valproic Acid results in increased expression of SMAD4 mRNA	27237783
C034028	vanadyl sulfate	vanadyl sulfate results in decreased expression of SMAD4 mRNA	16330358
D014750	Vincristine	Vincristine results in increased expression of SMAD4 mRNA	23649840
D000077337	Vorinostat	Vorinostat results in decreased expression of SMAD4 mRNA	27188386

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0007	Acetylation
KW-0963	Cytoplasm
KW-0225	Disease mutation
KW-0238	DNA-binding
KW-1017	Isopeptide bond
KW-0479	Metal-binding
KW-0539	Nucleus
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0804	Transcription
KW-0805	Transcription regulation
KW-0832	Ubl conjugation
KW-0862	Zinc

Interpro

InterPro ID	InterPro Term
IPR013790	Dwarfin
IPR003619	MAD_homology1_Dwarfin-type
IPR013019	MAD_homology_MH1
IPR017855	SMAD-like_dom_sf
IPR001132	SMAD_dom_Dwarfin-type
IPR008984	SMAD_FHA_dom_sf
IPR036578	SMAD_MH1_sf

PROSITE

PROSITE ID	PROSITE Term
PS51075	MH1
PS51076	MH2

Pfam

Pfam ID	Pfam Term
PF03165	MH1
PF03166	MH2

Gene: SMAD4

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction