CleftGeneDB-Search

Gene: IHH

Basic information

Tag	Content
Uniprot ID	Q14623; B9EGM5; O43322; Q8N4B9;
Entrez ID	3549
Genbank protein ID	AAH34757.2; AAI36589.1; EAW70675.1; AAI36588.1; AAA62178.1; BAA33523.2;
Genbank nucleotide ID	NM_002181.3
Ensembl protein ID	ENSP00000295731
Ensembl nucleotide ID	ENSG00000163501
Gene name	Indian hedgehog protein
Gene symbol	IHH
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Intercellular signal essential for a variety of patterning events during development. Binds to the patched (PTC) receptor, which functions in association with smoothened (SMO), to activate the transcription of target genes. Implicated in endochondral ossification: may regulate the balance between growth and ossification of the developing bones. Induces the expression of parathyroid hormone-related protein (PTHRP) (By similarity).
Sequence	MSPARLRPRL HFCLVLLLLL VVPAAWGCGP GRVVGSRRRP PRKLVPLAYK QFSPNVPEKT 60 LGASGRYEGK IARSSERFKE LTPNYNPDII FKDEENTGAD RLMTQRCKDR LNSLAISVMN 120 QWPGVKLRVT EGWDEDGHHS EESLHYEGRA VDITTSDRDR NKYGLLARLA VEAGFDWVYY 180 ESKAHVHCSV KSEHSAAAKT GGCFPAGAQV RLESGARVAL SAVRPGDRVL AMGEDGSPTF 240 SDVLIFLDRE PHRLRAFQVI ETQDPPRRLA LTPAHLLFTA DNHTEPAARF RATFASHVQP 300 GQYVLVAGVP GLQPARVAAV STHVALGAYA PLTKHGTLVV EDVVASCFAA VADHHLAQLA 360 FWPLRLFHSL AWGSWTPGEG VHWYPQLLYR LGRLLLEEGS FHPLGMSGAG S 411

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
3K7G
3K7H
3K7I
3K7J
3N1F
3N1M
3N1O
3N1P
3K7I

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Developmental stage	Species	Evidence	Details
1:1 ortholog	IHH	102179616	A0A452EW38			Capra hircus	Prediction	More>>
1:1 ortholog	IHH	3549	Q14623			Homo sapiens	Prediction	More>>
1:1 ortholog	Ihh	16147	P97812	CLP	E14.5	Mus musculus	Publication	More>>
1:1 ortholog	IHH	470652	H2QJG1			Pan troglodytes	Prediction	More>>
1:1 ortholog	IHH	100008942	G1U6S4			Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Ihh	84399	F1LP42			Rattus norvegicus	Prediction	More>>
1:1 ortholog	ihha		B0S8K0			Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1276798591	p.Pro3Leu	missense variant	-	NC_000002.12:g.219060460G>A	TOPMed
rs1233903791	p.Ala4Asp	missense variant	-	NC_000002.12:g.219060457G>T	TOPMed
rs1343928445	p.Ala4Ser	missense variant	-	NC_000002.12:g.219060458C>A	gnomAD
rs1249255858	p.Arg5Leu	missense variant	-	NC_000002.12:g.219060454C>A	gnomAD
rs1331119432	p.Arg7Trp	missense variant	-	NC_000002.12:g.219060449G>A	gnomAD
rs761363200	p.Arg7Gln	missense variant	-	NC_000002.12:g.219060448C>T	ExAC,TOPMed,gnomAD
rs1345415443	p.Pro8His	missense variant	-	NC_000002.12:g.219060445G>T	gnomAD
rs1403591976	p.Pro8Thr	missense variant	-	NC_000002.12:g.219060446G>T	gnomAD
rs904571891	p.Arg9Gly	missense variant	-	NC_000002.12:g.219060443G>C	TOPMed,gnomAD
rs751093402	p.Arg9Gln	missense variant	-	NC_000002.12:g.219060442C>T	ExAC,TOPMed,gnomAD
rs904571891	p.Arg9Ter	stop gained	-	NC_000002.12:g.219060443G>A	TOPMed,gnomAD
rs1394617005	p.Leu10Met	missense variant	-	NC_000002.12:g.219060440G>T	gnomAD
rs762517039	p.His11Tyr	missense variant	-	NC_000002.12:g.219060437G>A	ExAC,TOPMed,gnomAD
rs762517039	p.His11Asn	missense variant	-	NC_000002.12:g.219060437G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.His11Arg	missense variant	-	NC_000002.12:g.219060436T>C	NCI-TCGA
rs775302381	p.Cys13Arg	missense variant	-	NC_000002.12:g.219060431A>G	ExAC,TOPMed,gnomAD
rs1483875270	p.Leu20Val	missense variant	-	NC_000002.12:g.219060410G>C	TOPMed,gnomAD
rs1194822379	p.Val21Leu	missense variant	-	NC_000002.12:g.219060407C>G	gnomAD
rs902553944	p.Pro23Leu	missense variant	-	NC_000002.12:g.219060400G>A	TOPMed,gnomAD
rs902553944	p.Pro23Arg	missense variant	-	NC_000002.12:g.219060400G>C	TOPMed,gnomAD
rs1042787562	p.Ala25Thr	missense variant	-	NC_000002.12:g.219060395C>T	TOPMed,gnomAD
rs1042787562	p.Ala25Ser	missense variant	-	NC_000002.12:g.219060395C>A	TOPMed,gnomAD
rs776751822	p.Cys28Tyr	missense variant	-	NC_000002.12:g.219060385C>T	ExAC,gnomAD
rs759516215	p.Cys28Ser	missense variant	-	NC_000002.12:g.219060386A>T	ExAC,gnomAD
rs772253913	p.Gly29Arg	missense variant	-	NC_000002.12:g.219060383C>T	ExAC,gnomAD
rs946706547	p.Gly31Arg	missense variant	-	NC_000002.12:g.219060377C>G	TOPMed
rs1334302726	p.Arg32Trp	missense variant	-	NC_000002.12:g.219060374G>A	gnomAD
rs748187623	p.Arg32Pro	missense variant	-	NC_000002.12:g.219060373C>G	ExAC,gnomAD
rs931261157	p.Val33Ala	missense variant	-	NC_000002.12:g.219060370A>G	gnomAD
rs931261157	p.Val33Gly	missense variant	-	NC_000002.12:g.219060370A>C	gnomAD
rs774600015	p.Gly35Asp	missense variant	-	NC_000002.12:g.219060364C>T	ExAC,gnomAD
rs768851392	p.Arg37Ser	missense variant	-	NC_000002.12:g.219060359G>T	ExAC,gnomAD
rs1469349097	p.Arg39Leu	missense variant	-	NC_000002.12:g.219060352C>A	gnomAD
COSM3838623	p.Arg39Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219060352C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg39Ter	stop gained	-	NC_000002.12:g.219060353G>A	NCI-TCGA
rs749484451	p.Pro40Thr	missense variant	-	NC_000002.12:g.219060350G>T	ExAC,TOPMed,gnomAD
rs780451969	p.Arg42Ser	missense variant	-	NC_000002.12:g.219060344G>T	ExAC,gnomAD
rs1471050898	p.Arg42His	missense variant	-	NC_000002.12:g.219060343C>T	gnomAD
rs746341121	p.Lys43Arg	missense variant	-	NC_000002.12:g.219060340T>C	ExAC,TOPMed,gnomAD
rs1442704492	p.Val45Met	missense variant	-	NC_000002.12:g.219060335C>T	gnomAD
rs781629669	p.Val45Gly	missense variant	-	NC_000002.12:g.219060334A>C	ExAC,TOPMed,gnomAD
RCV000009420	p.Pro46Leu	missense variant	Acrocapitofemoral dysplasia (ACFD)	NC_000002.12:g.219060331G>A	ClinVar
rs121917856	p.Pro46Leu	missense variant	Acrocapitofemoral dysplasia (acfd)	NC_000002.12:g.219060331G>A	-
rs121917856	p.Pro46Leu	missense variant	Acrocapitofemoral dysplasia (ACFD)	NC_000002.12:g.219060331G>A	UniProt,dbSNP
VAR_015981	p.Pro46Leu	missense variant	Acrocapitofemoral dysplasia (ACFD)	NC_000002.12:g.219060331G>A	UniProt
rs751004659	p.Leu47Phe	missense variant	-	NC_000002.12:g.219060329G>A	ExAC,gnomAD
rs752362743	p.Ala48Val	missense variant	-	NC_000002.12:g.219060325G>A	ExAC,TOPMed,gnomAD
rs758059980	p.Ala48Thr	missense variant	-	NC_000002.12:g.219060326C>T	ExAC,gnomAD
rs1245966925	p.Tyr49Cys	missense variant	-	NC_000002.12:g.219060322T>C	gnomAD
RCV000508633	p.Gln51Lys	missense variant	Hirschsprung disease 1 (HSCR1)	NC_000002.12:g.219060317G>T	ClinVar
rs1553540620	p.Gln51Lys	missense variant	-	NC_000002.12:g.219060317G>T	-
rs1342556433	p.Ser53Gly	missense variant	-	NC_000002.12:g.219060311T>C	gnomAD
rs765052865	p.Asn55Ser	missense variant	-	NC_000002.12:g.219060304T>C	ExAC,gnomAD
rs1244198503	p.Asn55Asp	missense variant	-	NC_000002.12:g.219060305T>C	TOPMed
COSM1405562	p.Val56Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219060301A>G	NCI-TCGA Cosmic
rs1329465985	p.Pro57Ser	missense variant	-	NC_000002.12:g.219060299G>A	TOPMed,gnomAD
rs759450426	p.Thr60Ser	missense variant	-	NC_000002.12:g.219060289G>C	ExAC,gnomAD
rs776586756	p.Leu61Val	missense variant	-	NC_000002.12:g.219060287G>C	ExAC,gnomAD
rs1321173179	p.Ala63Thr	missense variant	-	NC_000002.12:g.219060281C>T	gnomAD
COSM3838622	p.Gly65Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219060274C>T	NCI-TCGA Cosmic
rs760689652	p.Arg66Cys	missense variant	-	NC_000002.12:g.219060272G>A	ExAC,gnomAD
rs774431630	p.Arg66His	missense variant	-	NC_000002.12:g.219060271C>T	ExAC,gnomAD
rs768675737	p.Tyr67Cys	missense variant	-	NC_000002.12:g.219060268T>C	ExAC,TOPMed,gnomAD
rs749520435	p.Glu68Gly	missense variant	-	NC_000002.12:g.219060265T>C	ExAC,gnomAD
rs1285043208	p.Gly69Ser	missense variant	-	NC_000002.12:g.219060263C>T	TOPMed
NCI-TCGA novel	p.Gly69Val	missense variant	-	NC_000002.12:g.219060262C>A	NCI-TCGA
rs1172909679	p.Lys70Arg	missense variant	-	NC_000002.12:g.219060259T>C	gnomAD
rs1248153001	p.Ala72Thr	missense variant	-	NC_000002.12:g.219060254C>T	gnomAD
rs928107041	p.Ala72Val	missense variant	-	NC_000002.12:g.219060253G>A	TOPMed
COSM3798651	p.Arg73His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219060250C>T	NCI-TCGA Cosmic
RCV000303662	p.Glu76Ala	missense variant	Brachydactyly	NC_000002.12:g.219060241T>G	ClinVar
rs576284122	p.Glu76Ala	missense variant	-	NC_000002.12:g.219060241T>G	1000Genomes,ExAC,gnomAD
rs886043368	p.GluArg76GluSer	missense variant	-	NC_000002.12:g.219060239_219060240delinsTT	-
RCV000348092	p.Arg77Ser	missense variant	Brachydactyly	NC_000002.12:g.219060239G>T	ClinVar
rs142036701	p.Arg77Ser	missense variant	-	NC_000002.12:g.219060239G>T	1000Genomes,ExAC,TOPMed,gnomAD
RCV000367731	p.Arg77Ser	missense variant	-	NC_000002.12:g.219060239_219060240delinsTT	ClinVar
rs777335507	p.Lys79Asn	missense variant	-	NC_000002.12:g.219060231C>G	ExAC,TOPMed,gnomAD
rs1210814208	p.Lys79Arg	missense variant	-	NC_000002.12:g.219060232T>C	gnomAD
rs777335507	p.Lys79Asn	missense variant	-	NC_000002.12:g.219060231C>A	ExAC,TOPMed,gnomAD
rs143046822	p.Thr82Ala	missense variant	-	NC_000002.12:g.219060224T>C	ESP,ExAC,gnomAD
rs752375465	p.Thr82Ile	missense variant	-	NC_000002.12:g.219060223G>A	ExAC,TOPMed,gnomAD
rs1015309029	p.Pro83Leu	missense variant	-	NC_000002.12:g.219060220G>A	TOPMed,gnomAD
rs1400719929	p.Phe91Tyr	missense variant	-	NC_000002.12:g.219060196A>T	TOPMed
NCI-TCGA novel	p.Asp93Glu	missense variant	-	NC_000002.12:g.219060189G>C	NCI-TCGA
RCV000009422	p.Glu95Gly	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219060184T>C	ClinVar
RCV000009416	p.Glu95Lys	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219060185C>T	ClinVar
rs121917852	p.Glu95Lys	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219060185C>T	UniProt,dbSNP
VAR_015982	p.Glu95Lys	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219060185C>T	UniProt
rs121917852	p.Glu95Lys	missense variant	-	NC_000002.12:g.219060185C>T	-
rs121917859	p.Glu95Gly	missense variant	-	NC_000002.12:g.219060184T>C	-
rs1395468336	p.Asn96Lys	missense variant	-	NC_000002.12:g.219060180G>T	TOPMed
rs565981937	p.Ala99Thr	missense variant	-	NC_000002.12:g.219060173C>T	1000Genomes,ExAC,gnomAD
rs565981937	p.Ala99Ser	missense variant	-	NC_000002.12:g.219060173C>A	1000Genomes,ExAC,gnomAD
rs121917855	p.Asp100Asn	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219060170C>T	UniProt,dbSNP
VAR_015984	p.Asp100Asn	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219060170C>T	UniProt
rs121917855	p.Asp100Asn	missense variant	-	NC_000002.12:g.219060170C>T	gnomAD
RCV000009418	p.Asp100Glu	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219060168G>T	ClinVar
RCV000009419	p.Asp100Asn	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219060170C>T	ClinVar
rs121917854	p.Asp100Glu	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219060168G>T	UniProt,dbSNP
VAR_015983	p.Asp100Glu	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219060168G>T	UniProt
rs121917854	p.Asp100Glu	missense variant	-	NC_000002.12:g.219060168G>T	-
rs1379301732	p.Arg101Ser	missense variant	-	NC_000002.12:g.219060167G>T	TOPMed
rs1200136536	p.Gln105Leu	missense variant	-	NC_000002.12:g.219060154T>A	gnomAD
rs1239402017	p.Gln105Ter	stop gained	-	NC_000002.12:g.219060155G>A	gnomAD
rs775959009	p.Arg106Cys	missense variant	-	NC_000002.12:g.219057694G>A	TOPMed
rs775959009	p.Arg106Ser	missense variant	-	NC_000002.12:g.219057694G>T	TOPMed
rs1317408368	p.Arg110His	missense variant	-	NC_000002.12:g.219057681C>T	gnomAD
rs748917622	p.Arg110Ser	missense variant	-	NC_000002.12:g.219057682G>T	ExAC,TOPMed,gnomAD
rs748917622	p.Arg110Cys	missense variant	-	NC_000002.12:g.219057682G>A	ExAC,TOPMed,gnomAD
rs748917622	p.Arg110Gly	missense variant	-	NC_000002.12:g.219057682G>C	ExAC,TOPMed,gnomAD
rs1315245540	p.Ala115Thr	missense variant	-	NC_000002.12:g.219057667C>T	gnomAD
NCI-TCGA novel	p.Ala115Ser	missense variant	-	NC_000002.12:g.219057667C>A	NCI-TCGA
rs1454141074	p.Val118Met	missense variant	-	NC_000002.12:g.219057658C>T	gnomAD
NCI-TCGA novel	p.Trp122Arg	missense variant	-	NC_000002.12:g.219057646A>T	NCI-TCGA
rs1217838827	p.Pro123Ser	missense variant	-	NC_000002.12:g.219057643G>A	gnomAD
rs1458273352	p.Gly124Ala	missense variant	-	NC_000002.12:g.219057639C>G	gnomAD
rs937019915	p.Gly124Ser	missense variant	-	NC_000002.12:g.219057640C>T	gnomAD
rs267606873	p.Arg128Gln	missense variant	-	NC_000002.12:g.219057627C>T	-
RCV000009425	p.Arg128Gln	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219057627C>T	ClinVar
RCV000009426	p.Thr130Asn	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219057621G>T	ClinVar
rs267606872	p.Thr130Asn	missense variant	-	NC_000002.12:g.219057621G>T	-
RCV000009417	p.Glu131Lys	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219057619C>T	ClinVar
rs121917853	p.Glu131Lys	missense variant	-	NC_000002.12:g.219057619C>T	-
rs121917853	p.Glu131Lys	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219057619C>T	UniProt,dbSNP
VAR_015985	p.Glu131Lys	missense variant	Brachydactyly A1 (BDA1)	NC_000002.12:g.219057619C>T	UniProt
NCI-TCGA novel	p.Trp133Arg	missense variant	-	NC_000002.12:g.219057613A>G	NCI-TCGA
NCI-TCGA novel	p.Asp134Asn	missense variant	-	NC_000002.12:g.219057610C>T	NCI-TCGA
rs781056728	p.Gly137Asp	missense variant	-	NC_000002.12:g.219057600C>T	ExAC,gnomAD
rs751582748	p.Glu142Lys	missense variant	-	NC_000002.12:g.219057586C>T	ExAC,gnomAD
rs765272765	p.His145Tyr	missense variant	-	NC_000002.12:g.219057577G>A	ExAC,gnomAD
rs765272765	p.His145Asn	missense variant	-	NC_000002.12:g.219057577G>T	ExAC,gnomAD
NCI-TCGA novel	p.Arg149His	missense variant	-	NC_000002.12:g.219057564C>T	NCI-TCGA
rs1262414128	p.Ile153Val	missense variant	-	NC_000002.12:g.219057553T>C	gnomAD
RCV000009423	p.Thr154Ile	missense variant	Type A1 brachydactyly (BDA1)	NC_000002.12:g.219057549G>A	ClinVar
rs121917861	p.Thr154Ile	missense variant	-	NC_000002.12:g.219057549G>A	-
NCI-TCGA novel	p.Ser156Leu	missense variant	-	NC_000002.12:g.219057543G>A	NCI-TCGA
NCI-TCGA novel	p.Arg160Leu	missense variant	-	NC_000002.12:g.219057531C>A	NCI-TCGA
rs1316070321	p.Asn161Ser	missense variant	-	NC_000002.12:g.219057528T>C	gnomAD
rs949833722	p.Asn161His	missense variant	-	NC_000002.12:g.219057529T>G	TOPMed,gnomAD
rs1247774141	p.Lys162Asn	missense variant	-	NC_000002.12:g.219057524C>A	gnomAD
rs1429547159	p.Tyr163His	missense variant	-	NC_000002.12:g.219057523A>G	TOPMed
rs773386517	p.Leu166Met	missense variant	-	NC_000002.12:g.219057514G>T	ExAC,TOPMed,gnomAD
COSM1405560	p.Arg168His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219057507C>T	NCI-TCGA Cosmic
rs767980207	p.Arg168Gly	missense variant	-	NC_000002.12:g.219057508G>C	ExAC,TOPMed,gnomAD
rs767980207	p.Arg168Cys	missense variant	-	NC_000002.12:g.219057508G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala173Thr	missense variant	-	NC_000002.12:g.219057493C>T	NCI-TCGA
rs1446009927	p.Gly174Arg	missense variant	-	NC_000002.12:g.219057490C>G	TOPMed,gnomAD
rs768257762	p.Tyr180Ter	stop gained	-	NC_000002.12:g.219057470G>C	ExAC,TOPMed,gnomAD
rs1366539763	p.Glu181Gln	missense variant	-	NC_000002.12:g.219057469C>G	gnomAD
NCI-TCGA novel	p.Ser182Ter	stop gained	-	NC_000002.12:g.219057465G>C	NCI-TCGA
rs868103206	p.Ala184Asp	missense variant	-	NC_000002.12:g.219057459G>T	gnomAD
rs868103206	p.Ala184Val	missense variant	-	NC_000002.12:g.219057459G>A	gnomAD
rs1423023362	p.His185Arg	missense variant	-	NC_000002.12:g.219057456T>C	gnomAD
rs1384826965	p.Val186Met	missense variant	-	NC_000002.12:g.219057454C>T	gnomAD
RCV000009421	p.Val190Ala	missense variant	Acrocapitofemoral dysplasia (ACFD)	NC_000002.12:g.219057441A>G	ClinVar
rs1246462808	p.Val190Ile	missense variant	-	NC_000002.12:g.219057442C>T	TOPMed
rs121917857	p.Val190Ala	missense variant	Acrocapitofemoral dysplasia (ACFD)	NC_000002.12:g.219057441A>G	UniProt,dbSNP
VAR_015986	p.Val190Ala	missense variant	Acrocapitofemoral dysplasia (ACFD)	NC_000002.12:g.219057441A>G	UniProt
rs121917857	p.Val190Ala	missense variant	Acrocapitofemoral dysplasia (acfd)	NC_000002.12:g.219057441A>G	-
rs745592533	p.Glu193Lys	missense variant	-	NC_000002.12:g.219057433C>T	ExAC,gnomAD
rs1425556554	p.Glu193Asp	missense variant	-	NC_000002.12:g.219055864C>G	TOPMed
rs1394595013	p.His194Tyr	missense variant	-	NC_000002.12:g.219055863G>A	gnomAD
COSM3577877	p.Ser195Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219055859G>A	NCI-TCGA Cosmic
rs775129096	p.Ser195Trp	missense variant	-	NC_000002.12:g.219055859G>C	ExAC,gnomAD
rs866706196	p.Ala196Val	missense variant	-	NC_000002.12:g.219055856G>A	gnomAD
rs746768477	p.Ala197Ser	missense variant	-	NC_000002.12:g.219055854C>A	ExAC,gnomAD
rs746768477	p.Ala197Thr	missense variant	-	NC_000002.12:g.219055854C>T	ExAC,gnomAD
rs1376896593	p.Ala198Thr	missense variant	-	NC_000002.12:g.219055851C>T	gnomAD
rs200082799	p.Thr200Met	missense variant	-	NC_000002.12:g.219055844G>A	1000Genomes,gnomAD
rs777551994	p.Thr200Ala	missense variant	-	NC_000002.12:g.219055845T>C	ExAC,gnomAD
rs779989510	p.Gly201Asp	missense variant	-	NC_000002.12:g.219055841C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly201Val	missense variant	-	NC_000002.12:g.219055841C>A	NCI-TCGA
rs750588083	p.Gly202Cys	missense variant	-	NC_000002.12:g.219055839C>A	ExAC,gnomAD
rs750588083	p.Gly202Ser	missense variant	-	NC_000002.12:g.219055839C>T	ExAC,gnomAD
rs781424397	p.Gly202Asp	missense variant	-	NC_000002.12:g.219055838C>T	ExAC
rs751916533	p.Ala206Ser	missense variant	-	NC_000002.12:g.219055827C>A	ExAC,gnomAD
rs563824337	p.Gly207Glu	missense variant	-	NC_000002.12:g.219055823C>T	1000Genomes,ExAC,gnomAD
rs148084426	p.Gly207Arg	missense variant	-	NC_000002.12:g.219055824C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs148084426	p.Gly207Arg	missense variant	-	NC_000002.12:g.219055824C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs3731880	p.Arg211Cys	missense variant	-	NC_000002.12:g.219055812G>A	ESP,ExAC,TOPMed,gnomAD
rs200898513	p.Arg211Leu	missense variant	-	NC_000002.12:g.219055811C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs200898513	p.Arg211His	missense variant	-	NC_000002.12:g.219055811C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1401393747	p.Glu213Lys	missense variant	-	NC_000002.12:g.219055806C>T	gnomAD
rs772975827	p.Ser214Asn	missense variant	-	NC_000002.12:g.219055802C>T	ExAC,TOPMed,gnomAD
rs1455090670	p.Gly215Arg	missense variant	-	NC_000002.12:g.219055800C>T	gnomAD
rs142245478	p.Ala216Glu	missense variant	-	NC_000002.12:g.219055796G>T	ESP,ExAC,TOPMed,gnomAD
rs771917189	p.Ala216Thr	missense variant	-	NC_000002.12:g.219055797C>T	ExAC,gnomAD
rs142245478	p.Ala216Val	missense variant	-	NC_000002.12:g.219055796G>A	ESP,ExAC,TOPMed,gnomAD
rs142245478	p.Ala216Gly	missense variant	-	NC_000002.12:g.219055796G>C	ESP,ExAC,TOPMed,gnomAD
rs1244499290	p.Arg217Cys	missense variant	-	NC_000002.12:g.219055794G>A	TOPMed,gnomAD
rs145192358	p.Arg217His	missense variant	-	NC_000002.12:g.219055793C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg217Leu	missense variant	-	NC_000002.12:g.219055793C>A	NCI-TCGA
rs1461317589	p.Val218Met	missense variant	-	NC_000002.12:g.219055791C>T	gnomAD
rs575127642	p.Ala219Thr	missense variant	-	NC_000002.12:g.219055788C>T	1000Genomes
rs553377564	p.Ala219Val	missense variant	-	NC_000002.12:g.219055787G>A	1000Genomes,ExAC,gnomAD
rs1348928573	p.Ser221Leu	missense variant	-	NC_000002.12:g.219055781G>A	gnomAD
rs778251745	p.Val223Met	missense variant	-	NC_000002.12:g.219055776C>T	ExAC,TOPMed,gnomAD
rs369651063	p.Arg224Ser	missense variant	-	NC_000002.12:g.219055771C>G	ESP,ExAC,TOPMed,gnomAD
rs572724795	p.Pro225Leu	missense variant	-	NC_000002.12:g.219055769G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1301637650	p.Gly226Arg	missense variant	-	NC_000002.12:g.219055767C>T	TOPMed
rs759968348	p.Asp227Asn	missense variant	-	NC_000002.12:g.219055764C>T	ExAC,gnomAD
rs753334217	p.Arg228His	missense variant	-	NC_000002.12:g.219055760C>T	ExAC,TOPMed,gnomAD
rs765861007	p.Val229Ala	missense variant	-	NC_000002.12:g.219055757A>G	ExAC,gnomAD
rs1424969376	p.Met232Val	missense variant	-	NC_000002.12:g.219055749T>C	gnomAD
rs771831287	p.Gly233Glu	missense variant	-	NC_000002.12:g.219055745C>T	ExAC,TOPMed,gnomAD
rs1327303182	p.Glu234Lys	missense variant	-	NC_000002.12:g.219055743C>T	TOPMed
rs774042639	p.Asp235Ala	missense variant	-	NC_000002.12:g.219055739T>G	ExAC,gnomAD
rs768570919	p.Ser237Gly	missense variant	-	NC_000002.12:g.219055734T>C	ExAC,gnomAD
rs547226063	p.Thr239Ile	missense variant	-	NC_000002.12:g.219055727G>A	gnomAD
NCI-TCGA novel	p.Phe240Leu	missense variant	-	NC_000002.12:g.219055723G>T	NCI-TCGA
rs771174829	p.Asp242Asn	missense variant	-	NC_000002.12:g.219055719C>T	ExAC,TOPMed,gnomAD
rs368103042	p.Phe246Ile	missense variant	-	NC_000002.12:g.219055707A>T	ESP,TOPMed,gnomAD
rs368103042	p.Phe246Leu	missense variant	-	NC_000002.12:g.219055707A>G	ESP,TOPMed,gnomAD
NCI-TCGA novel	p.Phe246Leu	missense variant	-	NC_000002.12:g.219055705G>T	NCI-TCGA
rs778096124	p.Arg249His	missense variant	-	NC_000002.12:g.219055697C>T	ExAC,TOPMed,gnomAD
rs1270728079	p.Arg249Cys	missense variant	-	NC_000002.12:g.219055698G>A	TOPMed,gnomAD
COSM6157022	p.Glu250Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.219055695C>A	NCI-TCGA Cosmic
rs779162629	p.Pro251Thr	missense variant	-	NC_000002.12:g.219055692G>T	ExAC,TOPMed,gnomAD
RCV000293234	p.His252Arg	missense variant	Brachydactyly	NC_000002.12:g.219055688T>C	ClinVar
rs76479554	p.His252Arg	missense variant	-	NC_000002.12:g.219055688T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM1405559	p.Arg253Ter	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.219055683_219055686GCCT>-	NCI-TCGA Cosmic
rs1404279164	p.Arg255Thr	missense variant	-	NC_000002.12:g.219055679C>G	gnomAD
rs755666903	p.Ala256Pro	missense variant	-	NC_000002.12:g.219055677C>G	ExAC,TOPMed,gnomAD
rs749956866	p.Ala256Val	missense variant	-	NC_000002.12:g.219055676G>A	ExAC,gnomAD
rs755666903	p.Ala256Thr	missense variant	-	NC_000002.12:g.219055677C>T	ExAC,TOPMed,gnomAD
rs767114404	p.Phe257Tyr	missense variant	-	NC_000002.12:g.219055673A>T	ExAC,gnomAD
rs774428201	p.Gln258Ter	stop gained	-	NC_000002.12:g.219055671G>A	ExAC,gnomAD
rs1490926405	p.Gln258His	missense variant	-	NC_000002.12:g.219055669C>G	gnomAD
rs774137730	p.Val259Phe	missense variant	-	NC_000002.12:g.219055668C>A	ExAC,TOPMed,gnomAD
rs774137730	p.Val259Ile	missense variant	-	NC_000002.12:g.219055668C>T	ExAC,TOPMed,gnomAD
rs762916918	p.Glu261Lys	missense variant	-	NC_000002.12:g.219055662C>T	ExAC,TOPMed,gnomAD
rs1315995534	p.Gln263His	missense variant	-	NC_000002.12:g.219055654C>A	gnomAD
rs1212877137	p.Gln263Ter	stop gained	-	NC_000002.12:g.219055656G>A	gnomAD
rs747049125	p.Asp264Glu	missense variant	-	NC_000002.12:g.219055651G>T	ExAC,TOPMed,gnomAD
rs775340016	p.Asp264Val	missense variant	-	NC_000002.12:g.219055652T>A	ExAC,gnomAD
RCV000762321	p.Asp264Val	missense variant	-	NC_000002.12:g.219055652T>A	ClinVar
COSM1405558	p.Pro266HisPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.219055646G>-	NCI-TCGA Cosmic
rs773432715	p.Pro266Leu	missense variant	-	NC_000002.12:g.219055646G>A	ExAC,gnomAD
rs773432715	p.Pro266Arg	missense variant	-	NC_000002.12:g.219055646G>C	ExAC,gnomAD
RCV000375895	p.Arg267Ser	missense variant	Brachydactyly	NC_000002.12:g.219055644G>T	ClinVar
rs748379688	p.Arg267Gly	missense variant	-	NC_000002.12:g.219055644G>C	ExAC,TOPMed,gnomAD
rs1036487197	p.Arg267His	missense variant	-	NC_000002.12:g.219055643C>T	TOPMed,gnomAD
rs748379688	p.Arg267Ser	missense variant	-	NC_000002.12:g.219055644G>T	ExAC,TOPMed,gnomAD
rs748379688	p.Arg267Cys	missense variant	-	NC_000002.12:g.219055644G>A	ExAC,TOPMed,gnomAD
rs371913717	p.Arg268Leu	missense variant	-	NC_000002.12:g.219055640C>A	ESP,ExAC,TOPMed,gnomAD
rs779327335	p.Arg268Cys	missense variant	-	NC_000002.12:g.219055641G>A	ExAC,gnomAD
rs371913717	p.Arg268His	missense variant	-	NC_000002.12:g.219055640C>T	ESP,ExAC,TOPMed,gnomAD
rs749777278	p.Ala270Val	missense variant	-	NC_000002.12:g.219055634G>A	ExAC,TOPMed,gnomAD
rs749868998	p.Pro273Leu	missense variant	-	NC_000002.12:g.219055625G>A	ExAC,TOPMed,gnomAD
rs756644181	p.Pro273Thr	missense variant	-	NC_000002.12:g.219055626G>T	ExAC,gnomAD
rs756644181	p.Pro273Ser	missense variant	-	NC_000002.12:g.219055626G>A	ExAC,gnomAD
rs148349850	p.Ala274Thr	missense variant	-	NC_000002.12:g.219055623C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe278ThrPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.219055611_219055612insGAGCAGGT	NCI-TCGA
rs776499803	p.Thr279Met	missense variant	-	NC_000002.12:g.219055607G>A	ExAC,TOPMed,gnomAD
COSM1016565	p.Ala280LeuPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.219055605C>-	NCI-TCGA Cosmic
COSM4839768	p.Asp281Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219055601T>C	NCI-TCGA Cosmic
rs1257383778	p.Thr284Met	missense variant	-	NC_000002.12:g.219055592G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Glu285Lys	missense variant	-	NC_000002.12:g.219055590C>T	NCI-TCGA
RCV000261343	p.Pro286Leu	missense variant	Brachydactyly	NC_000002.12:g.219055586G>A	ClinVar
rs775460776	p.Pro286Ser	missense variant	-	NC_000002.12:g.219055587G>A	ExAC,gnomAD
rs140093604	p.Pro286Leu	missense variant	-	NC_000002.12:g.219055586G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1368717565	p.Ala287Val	missense variant	-	NC_000002.12:g.219055583G>A	TOPMed
rs1373609433	p.Ala288Ser	missense variant	-	NC_000002.12:g.219055581C>A	TOPMed,gnomAD
rs13415309	p.Arg289Pro	missense variant	-	NC_000002.12:g.219055577C>G	ExAC,TOPMed,gnomAD
rs138163374	p.Arg289Cys	missense variant	-	NC_000002.12:g.219055578G>A	ESP,ExAC,TOPMed,gnomAD
rs13415309	p.Arg289His	missense variant	-	NC_000002.12:g.219055577C>T	ExAC,TOPMed,gnomAD
rs13415309	p.Arg289Leu	missense variant	-	NC_000002.12:g.219055577C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg289TrpPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.219055544_219055578GGCTGCACGTGGCTGGCAAATGTGGCCCGGAAGCG>-	NCI-TCGA
rs1375466917	p.Phe290Ser	missense variant	-	NC_000002.12:g.219055574A>G	gnomAD
rs370408334	p.Arg291Gln	missense variant	-	NC_000002.12:g.219055571C>T	ESP,ExAC,TOPMed,gnomAD
rs374817008	p.Arg291Trp	missense variant	-	NC_000002.12:g.219055572G>A	ESP,ExAC,TOPMed,gnomAD
rs1000671214	p.Ala292Ser	missense variant	-	NC_000002.12:g.219055569C>A	gnomAD
rs969196812	p.Thr293Ala	missense variant	-	NC_000002.12:g.219055566T>C	TOPMed,gnomAD
rs1192290798	p.Phe294Ile	missense variant	-	NC_000002.12:g.219055563A>T	gnomAD
rs780399315	p.Ser296Cys	missense variant	-	NC_000002.12:g.219055557T>A	ExAC,gnomAD
rs527633446	p.His297Gln	missense variant	-	NC_000002.12:g.219055552G>C	ExAC,TOPMed,gnomAD
rs142182864	p.Val298Met	missense variant	-	NC_000002.12:g.219055551C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs142182864	p.Val298Leu	missense variant	-	NC_000002.12:g.219055551C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs142182864	p.Val298Leu	missense variant	-	NC_000002.12:g.219055551C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs751104269	p.Gln299His	missense variant	-	NC_000002.12:g.219055546C>A	ExAC,TOPMed,gnomAD
rs777252539	p.Gly301Asp	missense variant	-	NC_000002.12:g.219055541C>T	ExAC,gnomAD
rs758078057	p.Tyr303Ter	stop gained	-	NC_000002.12:g.219055534G>T	ExAC,TOPMed,gnomAD
rs752484924	p.Val304Leu	missense variant	-	NC_000002.12:g.219055533C>A	ExAC,TOPMed,gnomAD
rs752484924	p.Val304Leu	missense variant	-	NC_000002.12:g.219055533C>G	ExAC,TOPMed,gnomAD
rs752484924	p.Val304Met	missense variant	-	NC_000002.12:g.219055533C>T	ExAC,TOPMed,gnomAD
rs1012327477	p.Val306Leu	missense variant	-	NC_000002.12:g.219055527C>A	TOPMed
rs1163877821	p.Val306Ala	missense variant	-	NC_000002.12:g.219055526A>G	TOPMed
rs765186273	p.Gly308Trp	missense variant	-	NC_000002.12:g.219055521C>A	ExAC,gnomAD
rs753863508	p.Val309Gly	missense variant	-	NC_000002.12:g.219055517A>C	ExAC,gnomAD
rs759546196	p.Val309Met	missense variant	-	NC_000002.12:g.219055518C>T	ExAC,TOPMed,gnomAD
rs761748117	p.Pro310Ser	missense variant	-	NC_000002.12:g.219055515G>A	ExAC,gnomAD
rs563762011	p.Gln313Lys	missense variant	-	NC_000002.12:g.219055506G>T	1000Genomes,TOPMed
rs563762011	p.Gln313Glu	missense variant	-	NC_000002.12:g.219055506G>C	1000Genomes,TOPMed
rs775818911	p.Pro314Leu	missense variant	-	NC_000002.12:g.219055502G>A	ExAC,gnomAD
rs763174681	p.Pro314Ser	missense variant	-	NC_000002.12:g.219055503G>A	ExAC,TOPMed,gnomAD
rs775818911	p.Pro314His	missense variant	-	NC_000002.12:g.219055502G>T	ExAC,gnomAD
rs542378884	p.Ala315Thr	missense variant	-	NC_000002.12:g.219055500C>T	1000Genomes
rs745408084	p.Arg316His	missense variant	-	NC_000002.12:g.219055496C>T	ExAC,TOPMed,gnomAD
rs745408084	p.Arg316Pro	missense variant	-	NC_000002.12:g.219055496C>G	ExAC,TOPMed,gnomAD
rs771622789	p.Arg316Cys	missense variant	-	NC_000002.12:g.219055497G>A	ExAC,TOPMed,gnomAD
RCV000278072	p.Val317Met	missense variant	-	NC_000002.12:g.219055494C>T	ClinVar
rs886044074	p.Val317Met	missense variant	-	NC_000002.12:g.219055494C>T	gnomAD
rs1181169500	p.Ala318Thr	missense variant	-	NC_000002.12:g.219055491C>T	gnomAD
rs1486135981	p.Ala319Thr	missense variant	-	NC_000002.12:g.219055488C>T	gnomAD
rs1211149163	p.Val320Ile	missense variant	-	NC_000002.12:g.219055485C>T	TOPMed,gnomAD
rs1211149163	p.Val320Leu	missense variant	-	NC_000002.12:g.219055485C>G	TOPMed,gnomAD
rs1214160350	p.Ser321Cys	missense variant	-	NC_000002.12:g.219055481G>C	gnomAD
rs746441526	p.Thr322Ala	missense variant	-	NC_000002.12:g.219055479T>C	ExAC,gnomAD
rs76578869	p.His323Gln	missense variant	-	NC_000002.12:g.219055474G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs370788126	p.Val324Met	missense variant	-	NC_000002.12:g.219055473C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1040660544	p.Leu326Pro	missense variant	-	NC_000002.12:g.219055466A>G	gnomAD
NCI-TCGA novel	p.Gly327Arg	missense variant	-	NC_000002.12:g.219055464C>T	NCI-TCGA
RCV000734376	p.Ala328Ter	frameshift	-	NC_000002.12:g.219055464del	ClinVar
rs754864301	p.Ala330Thr	missense variant	-	NC_000002.12:g.219055455C>T	ExAC,gnomAD
rs367575081	p.Pro331Leu	missense variant	-	NC_000002.12:g.219055451G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro331Ser	missense variant	-	NC_000002.12:g.219055452G>A	NCI-TCGA
rs1305132342	p.Gly336Val	missense variant	-	NC_000002.12:g.219055436C>A	gnomAD
rs1422855719	p.Val339Met	missense variant	-	NC_000002.12:g.219055428C>T	gnomAD
NCI-TCGA novel	p.Glu341Gln	missense variant	-	NC_000002.12:g.219055422C>G	NCI-TCGA
rs557425123	p.Ala349Ser	missense variant	-	NC_000002.12:g.219055398C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs777059543	p.Ala349Val	missense variant	-	NC_000002.12:g.219055397G>A	ExAC,TOPMed,gnomAD
rs557425123	p.Ala349Thr	missense variant	-	NC_000002.12:g.219055398C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs143959492	p.Val351Met	missense variant	-	NC_000002.12:g.219055392C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000398677	p.Val351Met	missense variant	-	NC_000002.12:g.219055392C>T	ClinVar
rs1487290982	p.Ala352Thr	missense variant	-	NC_000002.12:g.219055389C>T	gnomAD
rs1487290982	p.Ala352Ser	missense variant	-	NC_000002.12:g.219055389C>A	gnomAD
COSM6090504	p.His355Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219055380G>A	NCI-TCGA Cosmic
rs1309783315	p.Ala357Ser	missense variant	-	NC_000002.12:g.219055374C>A	gnomAD
rs1288500385	p.Ala357Asp	missense variant	-	NC_000002.12:g.219055373G>T	TOPMed
rs771656568	p.Gln358Pro	missense variant	-	NC_000002.12:g.219055370T>G	ExAC,gnomAD
rs763496709	p.Phe361Leu	missense variant	-	NC_000002.12:g.219055362A>G	TOPMed,gnomAD
rs778656169	p.Trp362Ser	missense variant	-	NC_000002.12:g.219055358C>G	ExAC,gnomAD
rs1390269799	p.Pro363His	missense variant	-	NC_000002.12:g.219055355G>T	gnomAD
rs931968868	p.Leu364Val	missense variant	-	NC_000002.12:g.219055353G>C	TOPMed,gnomAD
rs778358400	p.Arg365Lys	missense variant	-	NC_000002.12:g.219055349C>T	ExAC,TOPMed,gnomAD
rs778358400	p.Arg365Ile	missense variant	-	NC_000002.12:g.219055349C>A	ExAC,TOPMed,gnomAD
rs1168400033	p.Ser369Gly	missense variant	-	NC_000002.12:g.219055338T>C	gnomAD
rs750440817	p.Leu370Trp	missense variant	-	NC_000002.12:g.219055334A>C	ExAC,gnomAD
rs755991378	p.Leu370Met	missense variant	-	NC_000002.12:g.219055335A>T	ExAC,gnomAD
rs1429802102	p.Ala371Val	missense variant	-	NC_000002.12:g.219055331G>A	gnomAD
rs574926285	p.Ala371Pro	missense variant	-	NC_000002.12:g.219055332C>G	1000Genomes
rs764058706	p.Gly373Asp	missense variant	-	NC_000002.12:g.219055325C>T	ExAC,gnomAD
rs1381498688	p.Trp375Ter	stop gained	-	NC_000002.12:g.219055318C>T	gnomAD
rs758424526	p.Thr376Ala	missense variant	-	NC_000002.12:g.219055317T>C	ExAC,TOPMed,gnomAD
rs752807252	p.Thr376Ile	missense variant	-	NC_000002.12:g.219055316G>A	ExAC,gnomAD
NCI-TCGA novel	p.Thr376Ser	missense variant	-	NC_000002.12:g.219055317T>A	NCI-TCGA
COSM3577873	p.Pro377Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219055314G>A	NCI-TCGA Cosmic
rs532767918	p.Pro377Leu	missense variant	-	NC_000002.12:g.219055313G>A	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro377ArgPheSerTerUnkUnk	frameshift	-	NC_000002.12:g.219055315A>-	NCI-TCGA
rs201214780	p.Gly378Glu	missense variant	-	NC_000002.12:g.219055310C>T	ExAC,gnomAD
rs201214780	p.Gly378Val	missense variant	-	NC_000002.12:g.219055310C>A	ExAC,gnomAD
NCI-TCGA novel	p.Gly378Arg	missense variant	-	NC_000002.12:g.219055311C>G	NCI-TCGA
COSM1016563	p.Glu379Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000002.12:g.219055307T>C	NCI-TCGA Cosmic
COSM5081746	p.Glu379ArgPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.219055308C>-	NCI-TCGA Cosmic
rs761059577	p.Glu379Asp	missense variant	-	NC_000002.12:g.219055306C>A	ExAC,TOPMed,gnomAD
rs773814022	p.Gly380Cys	missense variant	-	NC_000002.12:g.219055305C>A	ExAC,TOPMed,gnomAD
rs772724697	p.Gly380Asp	missense variant	-	NC_000002.12:g.219055304C>T	ExAC,TOPMed,gnomAD
rs773814022	p.Gly380Ser	missense variant	-	NC_000002.12:g.219055305C>T	ExAC,TOPMed,gnomAD
rs1330758481	p.Pro385Ser	missense variant	-	NC_000002.12:g.219055290G>A	gnomAD
rs1485282541	p.Pro385Arg	missense variant	-	NC_000002.12:g.219055289G>C	gnomAD
rs1399979548	p.Gln386His	missense variant	-	NC_000002.12:g.219055285C>A	TOPMed
rs1307920153	p.Gln386Arg	missense variant	-	NC_000002.12:g.219055286T>C	gnomAD
COSM1405556	p.Gln386SerPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000002.12:g.219055287G>-	NCI-TCGA Cosmic
RCV000293197	p.Arg390His	missense variant	-	NC_000002.12:g.219055274C>T	ClinVar
rs774000427	p.Arg390Cys	missense variant	-	NC_000002.12:g.219055275G>A	ExAC,TOPMed,gnomAD
rs150661368	p.Arg390Leu	missense variant	-	NC_000002.12:g.219055274C>A	ESP,ExAC,TOPMed,gnomAD
rs150661368	p.Arg390His	missense variant	-	NC_000002.12:g.219055274C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu391Pro	missense variant	-	NC_000002.12:g.219055271A>G	NCI-TCGA
rs1465095930	p.Gly392Glu	missense variant	-	NC_000002.12:g.219055268C>T	TOPMed,gnomAD
rs1465095930	p.Gly392Val	missense variant	-	NC_000002.12:g.219055268C>A	TOPMed,gnomAD
rs779709195	p.Arg393His	missense variant	-	NC_000002.12:g.219055265C>T	ExAC,TOPMed,gnomAD
rs749026365	p.Arg393Cys	missense variant	-	NC_000002.12:g.219055266G>A	ExAC
NCI-TCGA novel	p.Arg393ValPheSerTerUnk	frameshift	-	NC_000002.12:g.219055267C>-	NCI-TCGA
rs1174114135	p.Leu394Arg	missense variant	-	NC_000002.12:g.219055262A>C	gnomAD
rs894789291	p.Leu395Val	missense variant	-	NC_000002.12:g.219055260G>C	TOPMed
rs748831066	p.Glu398Asp	missense variant	-	NC_000002.12:g.219055249C>G	ExAC,TOPMed,gnomAD
rs1376736357	p.Glu398Lys	missense variant	-	NC_000002.12:g.219055251C>T	gnomAD
rs745673493	p.Gly399Cys	missense variant	-	NC_000002.12:g.219055248C>A	ExAC,TOPMed,gnomAD
rs745673493	p.Gly399Ser	missense variant	-	NC_000002.12:g.219055248C>T	ExAC,TOPMed,gnomAD
rs1177452772	p.Ser400Gly	missense variant	-	NC_000002.12:g.219055245T>C	gnomAD
rs1462205737	p.Ser400Asn	missense variant	-	NC_000002.12:g.219055244C>T	gnomAD
rs765362312	p.His402Tyr	missense variant	-	NC_000002.12:g.219055239G>A	ExAC,gnomAD
rs1484081466	p.Pro403Ser	missense variant	-	NC_000002.12:g.219055236G>A	TOPMed
rs1003678965	p.Gly405Asp	missense variant	-	NC_000002.12:g.219055229C>T	TOPMed
rs1344706805	p.Gly405Ser	missense variant	-	NC_000002.12:g.219055230C>T	gnomAD
rs1241509400	p.Met406Ile	missense variant	-	NC_000002.12:g.219055225C>T	TOPMed,gnomAD
rs755191317	p.Met406Val	missense variant	-	NC_000002.12:g.219055227T>C	ExAC,TOPMed,gnomAD
rs200216644	p.Gly408Arg	missense variant	-	NC_000002.12:g.219055221C>T	1000Genomes,TOPMed,gnomAD
rs766634456	p.Gly408Val	missense variant	-	NC_000002.12:g.219055220C>A	ExAC,TOPMed,gnomAD
rs761046773	p.Gly410Glu	missense variant	-	NC_000002.12:g.219055214C>T	ExAC,gnomAD
rs1383459688	p.Gly410Arg	missense variant	-	NC_000002.12:g.219055215C>G	gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001430	Adenoma	group	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0005940	Bone Diseases	group	LHGDN
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0006413	Burkitt Lymphoma	disease	BEFREE
C0007102	Malignant tumor of colon	disease	BEFREE
C0007137	Squamous cell carcinoma	disease	BEFREE
C0008479	Chondrosarcoma	disease	BEFREE;LHGDN
C0010093	Corpus Luteum Cyst	disease	CTD_human
C0010278	Craniosynostosis	disease	BEFREE;GENOMICS_ENGLAND
C0010709	Cyst	phenotype	BEFREE
C0013336	Dwarfism	disease	BEFREE
C0014175	Endometriosis	disease	CTD_human
C0019569	Hirschsprung Disease	disease	BEFREE;MGD
C0021294	Infant, Premature	phenotype	BEFREE
C0024003	Lordosis	phenotype	HPO
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025995	Micromelia	disease	HPO
C0027627	Neoplasm Metastasis	phenotype	LHGDN
C0029408	Degenerative polyarthritis	disease	BEFREE
C0029422	Osteochondrodysplasias	group	HPO
C0029423	Cartilaginous exostosis	disease	BEFREE
C0029434	Osteogenesis Imperfecta	disease	GENOMICS_ENGLAND
C0029927	Ovarian Cysts	disease	CTD_human
C0030297	Pancreatic Neoplasm	disease	LHGDN
C0032580	Adenomatous Polyposis Coli	disease	BEFREE
C0032584	polyps	phenotype	BEFREE
C0035344	Retinopathy of Prematurity	disease	BEFREE
C0037932	Curvature of spine	phenotype	HPO
C0038013	Ankylosing spondylitis	disease	BEFREE
C0039075	Syndactyly	disease	BEFREE
C0149521	Pancreatitis, Chronic	disease	BEFREE
C0149955	Annular pancreas	disease	BEFREE;MGD
C0152427	Polydactyly	disease	BEFREE
C0157946	Osteoarthrosis, localized, not specified whether primary or secondary	disease	RGD
C0158731	Congenital pectus carinatum	disease	HPO
C0162809	Kallmann Syndrome	disease	BEFREE
C0205874	Papilloma, Squamous Cell	disease	BEFREE
C0206637	Mesenchymal Chondrosarcoma	disease	LHGDN
C0206762	Limb Deformities, Congenital	group	BEFREE
C0221357	Brachydactyly	disease	BEFREE;HPO
C0235974	Pancreatic carcinoma	disease	BEFREE
C0238198	Gastrointestinal Stromal Tumors	group	CTD_human
C0239138	Hip joint varus deformity - observation	phenotype	HPO
C0263523	Micronychia (disorder)	phenotype	HPO
C0264142	Spade-like hand	disease	HPO
C0266617	Congenital anomaly of face	group	BEFREE
C0269102	Endometrioma	disease	CTD_human
C0333983	Hyperplastic Polyp	disease	BEFREE
C0342384	Idiopathic hypogonadotropic hypogonadism	disease	BEFREE
C0345375	Congenital hypoplasia of femur	disease	HPO
C0346647	Malignant neoplasm of pancreas	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0392514	Hereditary hemochromatosis	disease	BEFREE
C0410530	Metachondromatosis	disease	BEFREE
C0426790	Narrow thorax	phenotype	HPO
C0426817	Short ribs	phenotype	HPO
C0426826	Flared ribs	phenotype	HPO
C0431890	Hypoplasia of thumb	disease	HPO
C0432282	Dysplasia epiphysealis hemimelica	disease	BEFREE
C0541764	Delayed bone age	phenotype	HPO
C0544755	Genu varum	phenotype	HPO
C0596263	Carcinogenesis	phenotype	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0685381	Congenital hypoplasia of radius	disease	HPO
C0686619	Secondary malignant neoplasm of lymph node	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0700208	Acquired scoliosis	phenotype	HPO
C0750952	Biliary Tract Cancer	disease	BEFREE
C0796147	Acrocallosal Syndrome	disease	BEFREE
C0796154	SIMPSON-GOLABI-BEHMEL SYNDROME, TYPE 1	disease	BEFREE
C0878659	Disproportionate short stature	phenotype	HPO
C1184923	Lumbar hyperlordosis	phenotype	HPO
C1302401	Adenoma of large intestine	disease	BEFREE
C1335302	Pancreatic Ductal Adenocarcinoma	disease	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1704356	Enchondroma	disease	BEFREE
C1832117	Short humerus	phenotype	HPO
C1832590	Craniosynostosis, Philadelphia Type	disease	BEFREE
C1836184	Short femoral neck	phenotype	HPO
C1837084	Short metacarpal	phenotype	HPO
C1839829	Short distal phalanx of finger	phenotype	HPO
C1840087	Radial ray hypoplasia	phenotype	HPO
C1841684	Delayed ossification of carpal bones	phenotype	HPO
C1843096	Acrocapitofemoral Dysplasia	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C1843105	Enlargement of the distal femoral epiphysis	phenotype	HPO
C1843108	Short palm	phenotype	HPO
C1843112	Broad nail	phenotype	HPO
C1844709	Radial deviation of the 2nd finger	phenotype	HPO
C1846157	Cone-shaped capital femoral epiphysis	phenotype	HPO
C1846797	Short stature, severe disproportionate	phenotype	HPO
C1846950	Short middle phalanx of finger	phenotype	HPO
C1848673	Hypoplastic feet	phenotype	HPO
C1849075	Relative macrocephaly	disease	HPO
C1849937	Disproportionate short-limb short stature	phenotype	HPO
C1850049	Clinodactyly of the 5th finger	disease	HPO
C1850259	Short tibia	phenotype	HPO
C1855091	Short proximal phalanx of thumb	phenotype	HPO
C1855239	Cone-shaped metacarpal epiphyses	phenotype	HPO
C1855665	Ovoid vertebral bodies	phenotype	HPO
C1860606	Short proximal phalanx of finger	phenotype	HPO
C1860614	ULNAR HYPOPLASIA	phenotype	HPO
C1861349	Absent distal interphalangeal creases	phenotype	HPO
C1862132	Short ulnae	phenotype	HPO
C1862151	BRACHYDACTYLY, TYPE A1 (disorder)	disease	BEFREE;CLINVAR;CTD_human;MGD;ORPHANET;UNIPROT
C1862156	Thin proximal phalanges with broad epiphyses	phenotype	HPO
C1862157	Proportionate shortening of all digits	phenotype	HPO
C1862158	Terminal symphalangism of hands	phenotype	HPO
C1862159	Short proximal phalanx of hallux	phenotype	HPO
C1864298	Fibular overgrowth	phenotype	HPO
C1865027	Hypoplastic iliac wing	phenotype	HPO
C1865037	Cone-shaped epiphysis	phenotype	HPO
C1865039	Cupped ribs	phenotype	HPO
C1865841	Flared iliac wings	phenotype	HPO
C1865992	Short hallux	phenotype	HPO
C2051831	Pectus excavatum	phenotype	HPO
C3179349	Gastrointestinal Stromal Sarcoma	disease	CTD_human
C3495488	Axenfeld-Rieger syndrome	disease	BEFREE
C3536714	Renal dysplasia	disease	BEFREE
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND
C4020844	Bullet vertebral body	phenotype	HPO
C4021251	Dysplasia of the femoral head	phenotype	HPO
C4021790	Abnormality of the skeletal system	phenotype	BEFREE
C4024106	Cone-shaped epiphysis of the 1st metacarpal	phenotype	HPO
C4024345	Radial deviation of the 3rd finger	phenotype	HPO
C4024473	Radial deviation of the 4th finger	phenotype	HPO
C4025077	Slender metacarpals	phenotype	HPO
C4025079	Thin proximal phalanges with broad epiphyses of the hand	phenotype	HPO
C4025088	Broad metacarpal epiphyses	phenotype	HPO
C4025240	Flattened metatarsal heads	phenotype	HPO
C4225399	SHORT STATURE WITH NONSPECIFIC SKELETAL ABNORMALITIES	disease	BEFREE
C4280377	Abnormality of femoral head development	phenotype	HPO
C4280538	Curvature of little finger	phenotype	HPO
C4280567	Abnormal skeletal development	phenotype	HPO
C4280599	Delayed maturation of wrist bone	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0005113	patched binding	IPI
GO:0005113	patched binding	IBA
GO:0005509	calcium ion binding	IDA
GO:0005509	calcium ion binding	IBA
GO:0005515	protein binding	IPI
GO:0008233	peptidase activity	IEA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001501	skeletal system development	IMP
GO:0001569	branching involved in blood vessel morphogenesis	IEA
GO:0001649	osteoblast differentiation	IEA
GO:0001701	in utero embryonic development	IEA
GO:0001708	cell fate specification	IBA
GO:0001947	heart looping	ISS
GO:0002053	positive regulation of mesenchymal cell proliferation	IEA
GO:0003382	epithelial cell morphogenesis	IEA
GO:0003406	retinal pigment epithelium development	IEA
GO:0003413	chondrocyte differentiation involved in endochondral bone morphogenesis	IEA
GO:0006029	proteoglycan metabolic process	IEA
GO:0007224	smoothened signaling pathway	IDA
GO:0007224	smoothened signaling pathway	IBA
GO:0007267	cell-cell signaling	IEA
GO:0009612	response to mechanical stimulus	IEA
GO:0009880	embryonic pattern specification	IEA
GO:0010468	regulation of gene expression	IBA
GO:0016539	intein-mediated protein splicing	IEA
GO:0030704	vitelline membrane formation	IEA
GO:0031016	pancreas development	IEA
GO:0032355	response to estradiol	IEA
GO:0032967	positive regulation of collagen biosynthetic process	IEA
GO:0033085	negative regulation of T cell differentiation in thymus	ISS
GO:0033088	negative regulation of immature T cell proliferation in thymus	ISS
GO:0033089	positive regulation of T cell differentiation in thymus	ISS
GO:0035264	multicellular organism growth	IEA
GO:0035988	chondrocyte proliferation	IEA
GO:0040008	regulation of growth	IEA
GO:0042733	embryonic digit morphogenesis	IEA
GO:0043066	negative regulation of apoptotic process	IEA
GO:0045453	bone resorption	IEA
GO:0045880	positive regulation of smoothened signaling pathway	ISS
GO:0045944	positive regulation of transcription by RNA polymerase II	IEA
GO:0046638	positive regulation of alpha-beta T cell differentiation	ISS
GO:0046639	negative regulation of alpha-beta T cell differentiation	ISS
GO:0048074	negative regulation of eye pigmentation	IEA
GO:0048469	cell maturation	IEA
GO:0048557	embryonic digestive tract morphogenesis	IEA
GO:0048596	embryonic camera-type eye morphogenesis	IEA
GO:0048666	neuron development	IEA
GO:0048745	smooth muscle tissue development	IEA
GO:0050679	positive regulation of epithelial cell proliferation	IEA
GO:0060135	maternal process involved in female pregnancy	IEA
GO:0060220	camera-type eye photoreceptor cell fate commitment	IEA
GO:0060323	head morphogenesis	IEA
GO:0061053	somite development	ISS
GO:0072498	embryonic skeletal joint development	IEA
GO:0090136	epithelial cell-cell adhesion	IEA
GO:0097421	liver regeneration	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005615	extracellular space	IBA
GO:0005886	plasma membrane	IDA
GO:0031012	extracellular matrix	IEA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-162582	Signal Transduction	IEA
R-HSA-162582	Signal Transduction	TAS
R-HSA-1643685	Disease	TAS
R-HSA-212436	Generic Transcription Pathway	IEA
R-HSA-372790	Signaling by GPCR	IEA
R-HSA-373080	Class B/2 (Secretin family receptors)	IEA
R-HSA-500792	GPCR ligand binding	IEA
R-HSA-5358346	Hedgehog ligand biogenesis	IEA
R-HSA-5358346	Hedgehog ligand biogenesis	TAS
R-HSA-5358351	Signaling by Hedgehog	IEA
R-HSA-5358351	Signaling by Hedgehog	TAS
R-HSA-5362798	Release of Hh-Np from the secreting cell	IEA
R-HSA-5362798	Release of Hh-Np from the secreting cell	TAS
R-HSA-5387390	Hh mutants abrogate ligand secretion	TAS
R-HSA-5632681	Ligand-receptor interactions	TAS
R-HSA-5632681	Ligand-receptor interactions	IEA
R-HSA-5632684	Hedgehog 'on' state	IEA
R-HSA-5632684	Hedgehog 'on' state	TAS
R-HSA-5635838	Activation of SMO	TAS
R-HSA-5658034	HHAT G278V abrogates palmitoylation of Hh-Np	TAS
R-HSA-5663202	Diseases of signal transduction	TAS
R-HSA-73857	RNA Polymerase II Transcription	IEA
R-HSA-74160	Gene expression (Transcription)	IEA
R-HSA-8878166	Transcriptional regulation by RUNX2	IEA
R-HSA-8941284	RUNX2 regulates chondrocyte maturation	IEA
R-HSA-8941326	RUNX2 regulates bone development	IEA

Drugs and compounds information

ID	Drug Name	Action	PubMed
D019813	1,2-Dimethylhydrazine	[APC protein affects the susceptibility to 1,2-Dimethylhydrazine] which results in decreased expression of IHH mRNA	27840820
C028474	1,4-bis(2-(3,5-dichloropyridyloxy))benzene	1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in decreased expression of IHH mRNA	28903501
D015085	2,4,5-Trichlorophenoxyacetic Acid	2,4,5-Trichlorophenoxyacetic Acid results in increased expression of IHH mRNA	18579281
C016403	2,4-dinitrotoluene	2,4-dinitrotoluene affects the expression of IHH mRNA	21346803
C023514	2,6-dinitrotoluene	2,6-dinitrotoluene affects the expression of IHH mRNA	21346803
C486184	4,4',4''-(4-propyl-((1)H)-pyrazole-1,3,5-triyl) tris-phenol	4,4',4''-(4-propyl-((1)H)-pyrazole-1,3,5-triyl) tris-phenol results in decreased expression of IHH mRNA	17109907
C035207	4-amino-2,6-dinitrotoluene	4-amino-2,6-dinitrotoluene affects the expression of IHH mRNA	21346803
D000082	Acetaminophen	Acetaminophen affects the expression of IHH mRNA	17562736
D000082	Acetaminophen	Acetaminophen results in decreased expression of IHH mRNA	30723492
D020106	Acrylamide	Acrylamide results in increased expression of IHH mRNA	30807115
D020106	Acrylamide	Acrylamide results in increased expression of IHH mRNA	28959563
D000452	Aldrin	Aldrin results in increased expression of IHH mRNA	18579281
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of IHH mRNA	16483693
D001151	Arsenic	[Arsenic co-treated with Cadmium co-treated with Lead] results in decreased expression of IHH protein	23604592
D000077237	Arsenic Trioxide	Arsenic Trioxide results in increased expression of IHH mRNA	29767511
C015001	arsenite	arsenite results in increased methylation of IHH promoter	23974009
D001205	Ascorbic Acid	Ascorbic Acid results in increased expression of IHH mRNA	20530736
D001397	Azoxymethane	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of IHH mRNA	29950665
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of IHH mRNA	22228805
C006703	benzo(b)fluoranthene	benzo(b)fluoranthene results in increased expression of IHH mRNA	26377693
D019324	beta-Naphthoflavone	[Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of IHH mRNA	18164116
C006780	bisphenol A	bisphenol A results in decreased expression of IHH mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased expression of IHH mRNA	30816183
D002104	Cadmium	[Arsenic co-treated with Cadmium co-treated with Lead] results in decreased expression of IHH protein	23604592
D019256	Cadmium Chloride	[sodium arsenite co-treated with Cadmium Chloride co-treated with lead acetate] results in decreased expression of IHH protein	23604592
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of IHH mRNA	31150632
D002251	Carbon Tetrachloride	schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of IHH mRNA]	31150632
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of IHH mRNA	20938992
D003300	Copper	Copper results in increased expression of IHH mRNA	30556269
D019327	Copper Sulfate	Copper Sulfate results in increased expression of IHH mRNA	18579281
C107676	deguelin	deguelin results in increased expression of IHH mRNA	19861542
D003907	Dexamethasone	Dexamethasone results in increased expression of IHH mRNA	27608943
D016264	Dextran Sulfate	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of IHH mRNA	29950665
C492519	diarylpropionitrile	diarylpropionitrile results in decreased expression of IHH mRNA	17109907
D003999	Dichloroacetic Acid	Dichloroacetic Acid results in decreased expression of IHH mRNA	28962523
D004052	Diethylnitrosamine	[Piperonyl Butoxide co-treated with Diethylnitrosamine] affects the methylation of IHH gene	23968726
D004052	Diethylnitrosamine	[Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of IHH mRNA	18164116
D004237	Diuron	Diuron results in increased expression of IHH mRNA	25152437
D004365	Drugs, Chinese Herbal	Drugs, Chinese Herbal results in increased expression of IHH mRNA	23262642
D004726	Endosulfan	Endosulfan results in decreased expression of IHH mRNA	29391264
D004958	Estradiol	[Estradiol co-treated with IGF1 protein] results in increased expression of IHH mRNA	22811575
D004958	Estradiol	Estradiol inhibits the reaction [Progesterone results in increased expression of IHH mRNA]	16794005
D004958	Estradiol	[Estradiol co-treated with Progesterone] results in decreased expression of IHH mRNA	20660070
D004958	Estradiol	ESR1 protein promotes the reaction [[Estradiol co-treated with Progesterone] results in increased expression of IHH mRNA]	25210133
D004958	Estradiol	[Estradiol co-treated with Progesterone] results in increased expression of IHH mRNA	22958837; 25210133;
D004958	Estradiol	Estradiol promotes the reaction [Plant Preparations results in decreased expression of IHH mRNA]	26945725
D004958	Estradiol	Estradiol results in decreased expression of IHH mRNA	26945725
D004958	Estradiol	Estradiol results in increased expression of IHH mRNA	20232216
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of IHH mRNA	17109907
D004997	Ethinyl Estradiol	Fulvestrant inhibits the reaction [Ethinyl Estradiol results in decreased expression of IHH mRNA]	17109907
D017313	Fenretinide	Fenretinide results in increased expression of IHH mRNA	28973697
C082360	fipronil	fipronil results in decreased expression of IHH mRNA	23962444
D005472	Fluorouracil	Fluorouracil results in decreased expression of IHH mRNA	25190613
D005472	Fluorouracil	Fluorouracil results in decreased expression of IHH protein	25190613
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of IHH mRNA	20938992
D000077267	Fulvestrant	Fulvestrant inhibits the reaction [Ethinyl Estradiol results in decreased expression of IHH mRNA]	17109907
D000077267	Fulvestrant	Fulvestrant results in decreased expression of IHH mRNA	20232216
D019833	Genistein	Genistein affects the expression of IHH mRNA	21810550
C004312	glycidol	glycidol results in decreased expression of IHH mRNA	24915197
D006025	Glycosaminoglycans	Glycosaminoglycans affects the activity of IHH protein	20807638
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of IHH mRNA	25613284
D048628	Ketolides	Ketolides analog results in increased expression of IHH mRNA	24967691
D007854	Lead	[Arsenic co-treated with Cadmium co-treated with Lead] results in decreased expression of IHH protein	23604592
C008261	lead acetate	[sodium arsenite co-treated with Cadmium Chloride co-treated with lead acetate] results in decreased expression of IHH protein	23604592
D058185	Magnetite Nanoparticles	[Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of IHH mRNA	26378955
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of IHH mRNA	20938992
D008727	Methotrexate	Methotrexate affects the expression of IHH mRNA	18502557
C028577	monobutyl phthalate	monobutyl phthalate results in increased expression of IHH mRNA	29162477
D009151	Mustard Gas	Mustard Gas results in increased expression of IHH mRNA	15674843
D009538	Nicotine	Nicotine results in increased expression of IHH mRNA	27782041
C025589	ochratoxin A	ochratoxin A results in decreased expression of IHH mRNA	23358140
D009966	Orphenadrine	Orphenadrine affects the expression of IHH mRNA	23665939
D010634	Phenobarbital	NR1I3 protein affects the reaction [Phenobarbital results in increased expression of IHH mRNA]	19482888
D010634	Phenobarbital	NR1I3 protein promotes the reaction [Phenobarbital results in increased expression of IHH mRNA]	19482888
D010634	Phenobarbital	Phenobarbital affects the expression of IHH mRNA	23091169
D010634	Phenobarbital	Phenobarbital results in increased expression of IHH mRNA	19482888
D010672	Phenytoin	Phenytoin results in increased expression of IHH mRNA	16141649
D010882	Piperonyl Butoxide	[Piperonyl Butoxide co-treated with Diethylnitrosamine] affects the methylation of IHH gene	23968726
C006253	pirinixic acid	pirinixic acid results in decreased expression of IHH mRNA	17950772
D010936	Plant Extracts	Plant Extracts results in increased expression of IHH mRNA	23262642
D028321	Plant Preparations	Estradiol promotes the reaction [Plant Preparations results in decreased expression of IHH mRNA]	26945725
D028321	Plant Preparations	Plant Preparations results in decreased expression of IHH mRNA	26945725
D011192	Potassium Dichromate	Potassium Dichromate results in decreased expression of IHH mRNA	23608068
C009006	potassium perchlorate	potassium perchlorate results in decreased expression of IHH mRNA	29673971
D011285	Pregnenolone Carbonitrile	Pregnenolone Carbonitrile results in decreased expression of IHH mRNA	28903501
D011374	Progesterone	Progesterone results in decreased expression of IHH mRNA	23018184
D011374	Progesterone	Estradiol inhibits the reaction [Progesterone results in increased expression of IHH mRNA]	16794005
D011374	Progesterone	Progesterone results in increased expression of IHH mRNA	16794005
D011374	Progesterone	[Estradiol co-treated with Progesterone] results in decreased expression of IHH mRNA	20660070
D011374	Progesterone	ESR1 protein promotes the reaction [[Estradiol co-treated with Progesterone] results in increased expression of IHH mRNA]	25210133
D011374	Progesterone	[Estradiol co-treated with Progesterone] results in increased expression of IHH mRNA	22958837; 25210133;
D011374	Progesterone	Progesterone affects the expression of IHH	16794005
D011374	Progesterone	Progesterone results in increased expression of IHH	20232216
D011374	Progesterone	Progesterone results in increased expression of IHH mRNA	22238285
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of IHH mRNA	24780913
C043680	ptaquiloside	ptaquiloside results in decreased expression of IHH mRNA	23274088
D011794	Quercetin	Quercetin results in decreased expression of IHH protein	28431985
D000077185	Resveratrol	Resveratrol results in decreased expression of IHH mRNA	25190613
D000077185	Resveratrol	Resveratrol results in decreased expression of IHH protein	25190613
C015499	schizandrin B	schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of IHH mRNA]	31150632
D012906	Smoke	Smoke results in increased expression of IHH mRNA	23693141
C017947	sodium arsenite	[sodium arsenite co-treated with Cadmium Chloride co-treated with lead acetate] results in decreased expression of IHH protein	23604592
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of IHH mRNA	27862939
D004113	Succimer	[Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of IHH mRNA	26378955
D013605	T-2 Toxin	T-2 Toxin results in increased expression of IHH mRNA	31299295
D013750	Tetrachloroethylene	Tetrachloroethylene results in decreased expression of IHH mRNA	28973375
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of IHH mRNA	25613284
D013806	Theophylline	Theophylline results in increased expression of IHH mRNA	16083514
C009495	titanium dioxide	[titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of IHH mRNA	29950665
C009495	titanium dioxide	titanium dioxide results in decreased expression of IHH mRNA	30012374
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased expression of IHH mRNA	18087596
D014118	Toxins, Biological	Toxins, Biological affects the expression of IHH mRNA	19682533
D014212	Tretinoin	Tretinoin results in decreased expression of IHH mRNA	16350840
D014241	Trichloroethylene	Trichloroethylene results in decreased expression of IHH mRNA	25549359; 27618143;
D014241	Trichloroethylene	Trichloroethylene results in increased methylation of IHH gene	27618143
D014241	Trichloroethylene	Trichloroethylene results in increased methylation of IHH promoter	25549359
D014241	Trichloroethylene	Trichloroethylene results in decreased expression of IHH mRNA	27618143
D014260	Triclosan	Triclosan results in increased expression of IHH mRNA	29596926
D014303	Trinitrotoluene	Trinitrotoluene affects the expression of IHH mRNA	21346803
D014520	Urethane	Urethane results in increased expression of IHH mRNA	28818685
D014635	Valproic Acid	Valproic Acid affects the expression of IHH mRNA	17963808
D001335	Vehicle Emissions	Vehicle Emissions results in increased methylation of IHH gene	25560391
C025643	vinclozolin	vinclozolin results in increased expression of IHH mRNA	23034163
D014752	Vinyl Chloride	Vinyl Chloride results in increased expression of IHH mRNA	18579281

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0068	Autocatalytic cleavage
KW-0106	Calcium
KW-1003	Cell membrane
KW-0217	Developmental protein
KW-0225	Disease mutation
KW-0325	Glycoprotein
KW-0378	Hydrolase
KW-0449	Lipoprotein
KW-0472	Membrane
KW-0479	Metal-binding
KW-0564	Palmitate
KW-0645	Protease
KW-1185	Reference proteome
KW-0964	Secreted
KW-0732	Signal
KW-0862	Zinc

Interpro

InterPro ID	InterPro Term
IPR001657	Hedgehog
IPR001767	Hedgehog_Hint
IPR009045	Hedgehog_sig/DD-Pept_Zn-bd_sf
IPR000320	Hedgehog_signalling_dom
IPR003586	Hint_dom_C
IPR003587	Hint_dom_N
IPR036844	Hint_dom_sf
IPR033385	IHH
IPR006141	Intein_N

PROSITE

PROSITE ID	PROSITE Term
PS50817	INTEIN_N_TER

Pfam

Pfam ID	Pfam Term
PF01085	HH_signal
PF01079	Hint

Gene: IHH

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction