CleftGeneDB-Search

Gene: LBR

Basic information

Tag	Content
Uniprot ID	Q14739; B2R5P3; Q14740; Q53GU7; Q59FE6;
Entrez ID	3930
Genbank protein ID	EAW69741.1; AAA59495.1; AAA59494.1; AAH20079.1; BAD96554.1; BAD92751.1; BAG35190.1;
Genbank nucleotide ID	XM_011544185.2; NM_002296.3; NM_194442.2;
Ensembl protein ID	ENSP00000272163; ENSP00000339883;
Ensembl nucleotide ID	ENSG00000143815
Gene name	Delta(14)-sterol reductase LBR
Gene symbol	LBR
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Catalyzes the reduction of the C14-unsaturated bond of lanosterol, as part of the metabolic pathway leading to cholesterol biosynthesis (PubMed:9630650, PubMed:12618959, PubMed:16784888, PubMed:21327084, PubMed:27336722). Plays a critical role in myeloid cell cholesterol biosynthesis which is essential to both myeloid cell growth and functional maturation (By similarity). Mediates the activation of NADPH oxidases, perhaps by maintaining critical levels of cholesterol required for membrane lipid raft formation during neutrophil differentiation (By similarity). Anchors the lamina and the heterochromatin to the inner nuclear membrane (PubMed:10828963).
Sequence	MPSRKFADGE VVRGRWPGSS LYYEVEILSH DSTSQLYTVK YKDGTELELK ENDIKPLTSF 60 RQRKGGSTSS SPSRRRGSRS RSRSRSPGRP PKSARRSASA SHQADIKEAR REVEVKLTPL 120 ILKPFGNSIS RYNGEPEHIE RNDAPHKNTQ EKFSLSQESS YIATQYSLRP RREEVKLKEI 180 DSKEEKYVAK ELAVRTFEVT PIRAKDLEFG GVPGVFLIMF GLPVFLFLLL LMCKQKDPSL 240 LNFPPPLPAL YELWETRVFG VYLLWFLIQV LFYLLPIGKV VEGTPLIDGR RLKYRLNGFY 300 AFILTSAVIG TSLFQGVEFH YVYSHFLQFA LAATVFCVVL SVYLYMRSLK APRNDLSPAS 360 SGNAVYDFFI GRELNPRIGT FDLKYFCELR PGLIGWVVIN LVMLLAEMKI QDRAVPSLAM 420 ILVNSFQLLY VVDALWNEEA LLTTMDIIHD GFGFMLAFGD LVWVPFIYSF QAFYLVSHPN 480 EVSWPMASLI IVLKLCGYVI FRGANSQKNA FRKNPSDPKL AHLKTIHTST GKNLLVSGWW 540 GFVRHPNYLG DLIMALAWSL PCGFNHILPY FYIIYFTMLL VHREARDEYH CKKKYGVAWE 600 KYCQRVPYRI FPYIY 615

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
2DIG

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	LBR	509348	A6QQV8		Bos taurus	Prediction	More>>
1:1 ortholog	LBR	490391	E2QV27		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	LBR	100056997	A0A3Q2GWX9		Equus caballus	Prediction	More>>
1:1 ortholog	LBR	3930	Q14739		Homo sapiens	Prediction	More>>
1:1 ortholog	Lbr	98386	Q3U9G9	CPO	Mus musculus	Publication	More>>
1:1 ortholog	LBR	457776	H2Q178		Pan troglodytes	Prediction	More>>
1:1 ortholog	LBR		M3VH35		Sus scrofa	Prediction	More>>
1:1 ortholog	LBR	100345014	G1SCZ4		Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog			A0A0G2JU83		Rattus norvegicus	Prediction	More>>
1:1 ortholog	lbr		Q5RJ97		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1250803200	p.Pro2Gln	missense variant	-	NC_000001.11:g.225424071G>T	gnomAD
rs1250803200	p.Pro2Leu	missense variant	-	NC_000001.11:g.225424071G>A	gnomAD
rs746311894	p.Ser3Asn	missense variant	-	NC_000001.11:g.225424068C>T	ExAC,TOPMed,gnomAD
rs1481485031	p.Ser3Gly	missense variant	-	NC_000001.11:g.225424069T>C	gnomAD
rs781666925	p.Arg4Gly	missense variant	-	NC_000001.11:g.225424066T>C	ExAC,gnomAD
rs1274464371	p.Arg4Ser	missense variant	-	NC_000001.11:g.225424064C>A	gnomAD
rs764873714	p.Asp8Tyr	missense variant	-	NC_000001.11:g.225424054C>A	ExAC,TOPMed,gnomAD
rs764873714	p.Asp8Asn	missense variant	-	NC_000001.11:g.225424054C>T	ExAC,TOPMed,gnomAD
RCV000087266	p.Val11Ter	frameshift	Pelger-Hu?t anomaly (PHA)	NC_000001.11:g.225424041_225424044del	ClinVar
RCV000087265	p.Val11Ter	frameshift	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225424041_225424044del	ClinVar
rs766117275	p.Val12Ile	missense variant	-	NC_000001.11:g.225424042C>T	ExAC,gnomAD
rs773037367	p.Gly14Ser	missense variant	-	NC_000001.11:g.225424036C>T	ExAC,gnomAD
rs767247360	p.Arg15Gln	missense variant	-	NC_000001.11:g.225424032C>T	ExAC,gnomAD
rs192681330	p.Arg15Ter	stop gained	-	NC_000001.11:g.225424033G>A	1000Genomes,TOPMed,gnomAD
rs1411225492	p.Trp16Ter	stop gained	-	NC_000001.11:g.225424028C>T	gnomAD
rs188150385	p.Pro17Ser	missense variant	-	NC_000001.11:g.225424027G>A	1000Genomes,ExAC,gnomAD
rs774206199	p.Ser19Gly	missense variant	-	NC_000001.11:g.225424021T>C	ExAC,gnomAD
rs1408381788	p.Ser19Asn	missense variant	-	NC_000001.11:g.225424020C>T	gnomAD
rs1190304682	p.Ser20Leu	missense variant	-	NC_000001.11:g.225424017G>A	gnomAD
rs1355280287	p.Leu21Phe	missense variant	-	NC_000001.11:g.225424015G>A	gnomAD
rs768631027	p.Tyr22Cys	missense variant	-	NC_000001.11:g.225424011T>C	ExAC,gnomAD
rs749442728	p.Tyr23Cys	missense variant	-	NC_000001.11:g.225424008T>C	ExAC,TOPMed,gnomAD
rs749442728	p.Tyr23Phe	missense variant	-	NC_000001.11:g.225424008T>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Tyr23Ser	missense variant	-	NC_000001.11:g.225424008T>G	NCI-TCGA
COSM3484206	p.Glu24Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225424006C>T	NCI-TCGA Cosmic
rs1464048602	p.Val25Leu	missense variant	-	NC_000001.11:g.225424003C>G	gnomAD
rs1268100510	p.Glu26Gly	missense variant	-	NC_000001.11:g.225423999T>C	gnomAD
NCI-TCGA novel	p.Glu26AlaPheSerTerUnk	frameshift	-	NC_000001.11:g.225423999_225424000insAG	NCI-TCGA
rs1214241760	p.Ile27Val	missense variant	-	NC_000001.11:g.225423997T>C	gnomAD
rs149920625	p.Asp31Asn	missense variant	-	NC_000001.11:g.225423985C>T	ESP,ExAC,TOPMed,gnomAD
rs1382928751	p.Ser32Asn	missense variant	-	NC_000001.11:g.225423981C>T	gnomAD
RCV000403170	p.Thr33Ala	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225423979T>C	ClinVar
rs200756121	p.Thr33Ala	missense variant	-	NC_000001.11:g.225423979T>C	ExAC,TOPMed,gnomAD
rs747525564	p.Ser34Phe	missense variant	-	NC_000001.11:g.225423975G>A	ExAC,gnomAD
rs1387958612	p.Leu36Pro	missense variant	-	NC_000001.11:g.225423969A>G	gnomAD
rs778289657	p.Leu36Phe	missense variant	-	NC_000001.11:g.225423970G>A	ExAC,gnomAD
rs1042815153	p.Thr38Ala	missense variant	-	NC_000001.11:g.225423964T>C	TOPMed,gnomAD
rs555819295	p.Thr38Asn	missense variant	-	NC_000001.11:g.225423963G>T	ExAC,TOPMed,gnomAD
rs555819295	p.Thr38Ile	missense variant	-	NC_000001.11:g.225423963G>A	ExAC,TOPMed,gnomAD
rs1042815153	p.Thr38Ser	missense variant	-	NC_000001.11:g.225423964T>A	TOPMed,gnomAD
rs755810631	p.Lys40Arg	missense variant	-	NC_000001.11:g.225423957T>C	ExAC,TOPMed
rs1320764205	p.Tyr41Cys	missense variant	-	NC_000001.11:g.225423954T>C	gnomAD
rs1249866637	p.Lys42Arg	missense variant	-	NC_000001.11:g.225423951T>C	TOPMed
rs1481655481	p.Gly44Arg	missense variant	-	NC_000001.11:g.225423946C>G	TOPMed
rs767302539	p.Glu46Ala	missense variant	-	NC_000001.11:g.225423939T>G	ExAC,gnomAD
rs762108686	p.Glu48Lys	missense variant	-	NC_000001.11:g.225423934C>T	gnomAD
rs762108686	p.Glu48Gln	missense variant	-	NC_000001.11:g.225423934C>G	gnomAD
COSM904648	p.Glu48Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225423933T>G	NCI-TCGA Cosmic
rs1448407807	p.Leu49Val	missense variant	-	NC_000001.11:g.225423931A>C	gnomAD
rs1177590790	p.Glu51Lys	missense variant	-	NC_000001.11:g.225423925C>T	TOPMed
rs920973479	p.Asn52Lys	missense variant	-	NC_000001.11:g.225423920A>T	TOPMed,gnomAD
NCI-TCGA novel	p.Asn52Ser	missense variant	-	NC_000001.11:g.225423921T>C	NCI-TCGA
NCI-TCGA novel	p.Asn52Lys	missense variant	-	NC_000001.11:g.225423920A>C	NCI-TCGA
rs761536767	p.Ile54Val	missense variant	-	NC_000001.11:g.225423916T>C	ExAC,gnomAD
rs761536767	p.Ile54Phe	missense variant	-	NC_000001.11:g.225423916T>A	ExAC,gnomAD
rs1254466472	p.Pro56Ser	missense variant	-	NC_000001.11:g.225422277G>A	TOPMed
rs1254466472	p.Pro56Thr	missense variant	-	NC_000001.11:g.225422277G>T	TOPMed
COSM3864576	p.Ser59Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225422267G>A	NCI-TCGA Cosmic
rs763775687	p.Phe60Leu	missense variant	-	NC_000001.11:g.225422265A>G	ExAC,gnomAD
rs924146540	p.Arg63Lys	missense variant	-	NC_000001.11:g.225422255C>T	gnomAD
NCI-TCGA novel	p.Arg63LysPheSerTerUnkUnk	frameshift	-	NC_000001.11:g.225422252_225422255TTCC>-	NCI-TCGA
rs765365854	p.Gly65Cys	missense variant	-	NC_000001.11:g.225422250C>A	ExAC,gnomAD
rs765365854	p.Gly65Ser	missense variant	-	NC_000001.11:g.225422250C>T	ExAC,gnomAD
COSM6124905	p.Gly65Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225422249C>T	NCI-TCGA Cosmic
rs776841930	p.Gly66Ser	missense variant	-	NC_000001.11:g.225422247C>T	ExAC,gnomAD
rs1393957671	p.Ser67Pro	missense variant	-	NC_000001.11:g.225422244A>G	gnomAD
RCV000280387	p.Ser69Phe	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225422237G>A	ClinVar
rs369299493	p.Ser69Phe	missense variant	-	NC_000001.11:g.225422237G>A	ESP,ExAC,TOPMed,gnomAD
rs369299493	p.Ser69Cys	missense variant	-	NC_000001.11:g.225422237G>C	ESP,ExAC,TOPMed,gnomAD
rs1462087829	p.Ser70Thr	missense variant	-	NC_000001.11:g.225422234C>G	TOPMed,gnomAD
rs927660579	p.Ser71Phe	missense variant	-	NC_000001.11:g.225422231G>A	TOPMed
rs1367356844	p.Pro72Leu	missense variant	-	NC_000001.11:g.225422228G>A	TOPMed,gnomAD
rs773644529	p.Ser73Phe	missense variant	-	NC_000001.11:g.225422225G>A	ExAC,gnomAD
rs760953170	p.Ser73Ala	missense variant	-	NC_000001.11:g.225422226A>C	ExAC,gnomAD
rs978293896	p.Arg74Thr	missense variant	-	NC_000001.11:g.225422222C>G	TOPMed
COSM6124906	p.Arg74Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000001.11:g.225422223T>A	NCI-TCGA Cosmic
rs553554966	p.Arg75Cys	missense variant	-	NC_000001.11:g.225422220G>A	ExAC,TOPMed,gnomAD
rs553554966	p.Arg75Gly	missense variant	-	NC_000001.11:g.225422220G>C	ExAC,TOPMed,gnomAD
rs755984972	p.Arg75His	missense variant	-	NC_000001.11:g.225422219C>T	ExAC,TOPMed,gnomAD
RCV000210455	p.Arg76Ter	nonsense	Anadysplasia-like, spontaneously remitting spondylometaphyseal dysplasia	NC_000001.11:g.225422217G>A	ClinVar
rs749991297	p.Arg76Gln	missense variant	-	NC_000001.11:g.225422216C>T	ExAC,TOPMed,gnomAD
rs869312905	p.Arg76Ter	stop gained	-	NC_000001.11:g.225422217G>A	-
rs539965123	p.Ser78Arg	missense variant	-	NC_000001.11:g.225422211T>G	1000Genomes
rs1363715209	p.Arg79Ter	stop gained	-	NC_000001.11:g.225422208G>A	gnomAD
rs150911670	p.Arg79Gln	missense variant	-	NC_000001.11:g.225422207C>T	ESP,ExAC,TOPMed,gnomAD
rs1197749961	p.Ser82Ter	stop gained	-	NC_000001.11:g.225422198G>C	gnomAD
rs917913308	p.Ser82Pro	missense variant	-	NC_000001.11:g.225422199A>G	TOPMed
rs780648797	p.Arg83His	missense variant	-	NC_000001.11:g.225422195C>T	ExAC,TOPMed,gnomAD
rs745448849	p.Arg83Ser	missense variant	-	NC_000001.11:g.225422196G>T	ExAC,TOPMed,gnomAD
rs745448849	p.Arg83Gly	missense variant	-	NC_000001.11:g.225422196G>C	ExAC,TOPMed,gnomAD
rs745448849	p.Arg83Cys	missense variant	-	NC_000001.11:g.225422196G>A	ExAC,TOPMed,gnomAD
rs751124930	p.Ser84Phe	missense variant	-	NC_000001.11:g.225422192G>A	ExAC,gnomAD
rs751124930	p.Ser84Cys	missense variant	-	NC_000001.11:g.225422192G>C	ExAC,gnomAD
rs1293819920	p.Arg85Gly	missense variant	-	NC_000001.11:g.225422190G>C	gnomAD
rs758063579	p.Arg85Pro	missense variant	-	NC_000001.11:g.225422189C>G	ExAC,TOPMed,gnomAD
rs758063579	p.Arg85Gln	missense variant	-	NC_000001.11:g.225422189C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro87Ser	missense variant	-	NC_000001.11:g.225422184G>A	NCI-TCGA
rs754965227	p.Gly88Ser	missense variant	-	NC_000001.11:g.225422181C>T	ExAC,TOPMed,gnomAD
rs754965227	p.Gly88Arg	missense variant	-	NC_000001.11:g.225422181C>G	ExAC,TOPMed,gnomAD
rs766513028	p.Arg89Gln	missense variant	-	NC_000001.11:g.225422177C>T	ExAC,TOPMed,gnomAD
rs754015696	p.Arg89Ter	stop gained	-	NC_000001.11:g.225422178G>A	ExAC,gnomAD
rs1323238325	p.Pro90Gln	missense variant	-	NC_000001.11:g.225422174G>T	gnomAD
COSM904646	p.Pro90Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225422175G>A	NCI-TCGA Cosmic
rs201003932	p.Pro91Ser	missense variant	-	NC_000001.11:g.225422172G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs773238630	p.Pro91His	missense variant	-	NC_000001.11:g.225422171G>T	ExAC,gnomAD
rs1170157436	p.Lys92Glu	missense variant	-	NC_000001.11:g.225422169T>C	TOPMed
rs1390400468	p.Lys92Thr	missense variant	-	NC_000001.11:g.225422168T>G	TOPMed
COSM115904	p.Ala94Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225422162G>C	NCI-TCGA Cosmic
rs11551873	p.Arg95Cys	missense variant	-	NC_000001.11:g.225422160G>A	ExAC,TOPMed,gnomAD
rs371428900	p.Arg95His	missense variant	-	NC_000001.11:g.225422159C>T	ESP,ExAC,TOPMed,gnomAD
rs769191817	p.Arg96Leu	missense variant	-	NC_000001.11:g.225422156C>A	ExAC,TOPMed,gnomAD
rs769191817	p.Arg96Gln	missense variant	-	NC_000001.11:g.225422156C>T	ExAC,TOPMed,gnomAD
rs769191817	p.Arg96Pro	missense variant	-	NC_000001.11:g.225422156C>G	ExAC,TOPMed,gnomAD
rs776142084	p.Ser97Pro	missense variant	-	NC_000001.11:g.225422154A>G	ExAC,gnomAD
COSM1473449	p.Ser97Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225422154A>C	NCI-TCGA Cosmic
rs770390134	p.Ala98Ser	missense variant	-	NC_000001.11:g.225422151C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser99Phe	missense variant	-	NC_000001.11:g.225422147G>A	NCI-TCGA
rs1438793970	p.Ala100Pro	missense variant	-	NC_000001.11:g.225422145C>G	TOPMed
rs199784853	p.His102Gln	missense variant	-	NC_000001.11:g.225422137G>C	1000Genomes,ExAC,gnomAD
rs557489420	p.Asp105Asn	missense variant	-	NC_000001.11:g.225422130C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1308755479	p.Asp105Glu	missense variant	-	NC_000001.11:g.225422128G>T	gnomAD
rs200648839	p.Ile106Val	missense variant	-	NC_000001.11:g.225422127T>C	1000Genomes,ExAC,gnomAD
rs778823931	p.Ala109Thr	missense variant	-	NC_000001.11:g.225422118C>T	ExAC,gnomAD
rs568717962	p.Ala109Val	missense variant	-	NC_000001.11:g.225422117G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs568717962	p.Ala109Gly	missense variant	-	NC_000001.11:g.225422117G>C	1000Genomes,ExAC,TOPMed,gnomAD
COSM4937800	p.Ala109Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225422118C>A	NCI-TCGA Cosmic
rs1215691620	p.Arg110Thr	missense variant	-	NC_000001.11:g.225422114C>G	gnomAD
rs766568195	p.Arg111Lys	missense variant	-	NC_000001.11:g.225422111C>T	ExAC,gnomAD
rs756086565	p.Arg111Ser	missense variant	-	NC_000001.11:g.225422110C>A	ExAC,gnomAD
rs1344726084	p.Glu112Asp	missense variant	-	NC_000001.11:g.225422107T>G	gnomAD
NCI-TCGA novel	p.Glu114Lys	missense variant	-	NC_000001.11:g.225422103C>T	NCI-TCGA
rs138380180	p.Thr118Ile	missense variant	-	NC_000001.11:g.225422090G>A	ESP
rs137852605	p.Pro119Leu	missense variant	-	NC_000001.11:g.225422087G>A	-
rs137852605	p.Pro119Leu	missense variant	Pelger-Huet anomaly (PHA)	NC_000001.11:g.225422087G>A	UniProt,dbSNP
VAR_017841	p.Pro119Leu	missense variant	Pelger-Huet anomaly (PHA)	NC_000001.11:g.225422087G>A	UniProt
rs1252909629	p.Ile121Val	missense variant	-	NC_000001.11:g.225422082T>C	TOPMed
rs1320847992	p.Lys123Glu	missense variant	-	NC_000001.11:g.225419798T>C	gnomAD
rs201699817	p.Pro124Arg	missense variant	-	NC_000001.11:g.225419794G>C	TOPMed
rs1383169780	p.Pro124Ser	missense variant	-	NC_000001.11:g.225419795G>A	gnomAD
rs201699817	p.Pro124Gln	missense variant	-	NC_000001.11:g.225419794G>T	TOPMed
rs1383169780	p.Pro124Thr	missense variant	-	NC_000001.11:g.225419795G>T	gnomAD
rs1375201039	p.Gly126Glu	missense variant	-	NC_000001.11:g.225419788C>T	gnomAD
rs1375201039	p.Gly126Val	missense variant	-	NC_000001.11:g.225419788C>A	gnomAD
rs756072693	p.Ser128Asn	missense variant	-	NC_000001.11:g.225419782C>T	ExAC,gnomAD
rs572094033	p.Tyr132Asn	missense variant	-	NC_000001.11:g.225419771A>T	1000Genomes
rs775733565	p.Tyr132Cys	missense variant	-	NC_000001.11:g.225419770T>C	TOPMed
rs553765740	p.Asn133Ile	missense variant	-	NC_000001.11:g.225419767T>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1485232908	p.Glu135Asp	missense variant	-	NC_000001.11:g.225419760C>G	gnomAD
rs763247153	p.His138Tyr	missense variant	-	NC_000001.11:g.225419753G>A	ExAC,gnomAD
rs763247153	p.His138Asp	missense variant	-	NC_000001.11:g.225419753G>C	ExAC,gnomAD
rs765734421	p.Ile139Leu	missense variant	-	NC_000001.11:g.225419750T>G	ExAC,TOPMed,gnomAD
rs760061264	p.Ile139Thr	missense variant	-	NC_000001.11:g.225419749A>G	ExAC,TOPMed,gnomAD
rs1456627121	p.Asn142Ser	missense variant	-	NC_000001.11:g.225419740T>C	TOPMed
rs772650538	p.Ala144Pro	missense variant	-	NC_000001.11:g.225419735C>G	ExAC,TOPMed,gnomAD
rs772650538	p.Ala144Thr	missense variant	-	NC_000001.11:g.225419735C>T	ExAC,TOPMed,gnomAD
rs1355260895	p.Pro145Ser	missense variant	-	NC_000001.11:g.225419732G>A	gnomAD
rs1399788307	p.His146Pro	missense variant	-	NC_000001.11:g.225419728T>G	TOPMed
NCI-TCGA novel	p.His146Arg	missense variant	-	NC_000001.11:g.225419728T>C	NCI-TCGA
rs1311372717	p.Lys147Glu	missense variant	-	NC_000001.11:g.225419726T>C	TOPMed,gnomAD
rs771566608	p.Gln150Glu	missense variant	-	NC_000001.11:g.225419717G>C	ExAC,gnomAD
rs1444198102	p.Lys152Arg	missense variant	-	NC_000001.11:g.225419448T>C	TOPMed
rs1324751698	p.Lys152Glu	missense variant	-	NC_000001.11:g.225419449T>C	gnomAD
NCI-TCGA novel	p.Lys152Asn	missense variant	-	NC_000001.11:g.225419447T>A	NCI-TCGA
RCV000245894	p.Ser154Asn	missense variant	-	NC_000001.11:g.225419442C>T	ClinVar
RCV000712172	p.Ser154Asn	missense variant	-	NC_000001.11:g.225419442C>T	ClinVar
rs759988663	p.Ser154Gly	missense variant	-	NC_000001.11:g.225419443T>C	ExAC,TOPMed
rs2230419	p.Ser154Thr	missense variant	-	NC_000001.11:g.225419442C>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs2230419	p.Ser154Asn	missense variant	-	NC_000001.11:g.225419442C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000287243	p.Ser154Asn	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225419442C>T	ClinVar
rs766946228	p.Leu155Val	missense variant	-	NC_000001.11:g.225419440A>C	ExAC,gnomAD
rs536366620	p.Gln157Glu	missense variant	-	NC_000001.11:g.225419434G>C	1000Genomes,ExAC,gnomAD
rs1298858382	p.Gln157Arg	missense variant	-	NC_000001.11:g.225419433T>C	TOPMed
NCI-TCGA novel	p.Gln157Lys	missense variant	-	NC_000001.11:g.225419434G>T	NCI-TCGA
rs773992626	p.Ser160Ile	missense variant	-	NC_000001.11:g.225419424C>A	ExAC,gnomAD
rs768462183	p.Ile162Thr	missense variant	-	NC_000001.11:g.225419418A>G	ExAC,gnomAD
rs144270114	p.Ala163Pro	missense variant	-	NC_000001.11:g.225419416C>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala163GluPheSerTerUnk	frameshift	-	NC_000001.11:g.225419391_225419415CTTGGACGAAGGCTATACTGTGTTG>-	NCI-TCGA
rs1219132368	p.Thr164Lys	missense variant	-	NC_000001.11:g.225419412G>T	TOPMed
rs769591237	p.Thr164Ala	missense variant	-	NC_000001.11:g.225419413T>C	ExAC,gnomAD
rs1216043543	p.Gln165Arg	missense variant	-	NC_000001.11:g.225419409T>C	TOPMed,gnomAD
rs565648951	p.Ser167Gly	missense variant	-	NC_000001.11:g.225419404T>C	1000Genomes,ExAC,gnomAD
rs565648951	p.Ser167Arg	missense variant	-	NC_000001.11:g.225419404T>G	1000Genomes,ExAC,gnomAD
rs565648951	p.Ser167Cys	missense variant	-	NC_000001.11:g.225419404T>A	1000Genomes,ExAC,gnomAD
rs1457364634	p.Leu168Phe	missense variant	-	NC_000001.11:g.225419401G>A	TOPMed
rs2230420	p.Arg169Cys	missense variant	-	NC_000001.11:g.225419398G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs375181558	p.Arg169His	missense variant	-	NC_000001.11:g.225419397C>T	ESP,ExAC,TOPMed,gnomAD
rs747160424	p.Pro170Ser	missense variant	-	NC_000001.11:g.225419395G>A	ExAC,TOPMed,gnomAD
rs777823620	p.Pro170Arg	missense variant	-	NC_000001.11:g.225419394G>C	ExAC,gnomAD
rs923198022	p.Arg172Ile	missense variant	-	NC_000001.11:g.225419388C>A	TOPMed,gnomAD
rs923198022	p.Arg172Lys	missense variant	-	NC_000001.11:g.225419388C>T	TOPMed,gnomAD
rs1368849417	p.Val175Ile	missense variant	-	NC_000001.11:g.225419380C>T	gnomAD
rs1458312127	p.Lys176Ile	missense variant	-	NC_000001.11:g.225419376T>A	gnomAD
rs1040197581	p.Leu177Val	missense variant	-	NC_000001.11:g.225419374A>C	TOPMed
COSM275829	p.Glu179Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000001.11:g.225419368C>A	NCI-TCGA Cosmic
rs1344394948	p.Ile180Thr	missense variant	-	NC_000001.11:g.225419364A>G	TOPMed,gnomAD
rs1344394948	p.Ile180Arg	missense variant	-	NC_000001.11:g.225419364A>C	TOPMed,gnomAD
COSM1961401	p.Asp181Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225419362C>A	NCI-TCGA Cosmic
rs1156597590	p.Ser182Ala	missense variant	-	NC_000001.11:g.225419359A>C	gnomAD
rs370431555	p.Ser182Phe	missense variant	-	NC_000001.11:g.225419358G>A	ESP,ExAC,TOPMed,gnomAD
rs370431555	p.Ser182Cys	missense variant	-	NC_000001.11:g.225419358G>C	ESP,ExAC,TOPMed,gnomAD
rs1408315845	p.Glu184Ala	missense variant	-	NC_000001.11:g.225419352T>G	gnomAD
rs1192593707	p.Glu185Asp	missense variant	-	NC_000001.11:g.225419348T>G	TOPMed,gnomAD
COSM1339250	p.Lys186Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225419346T>G	NCI-TCGA Cosmic
rs199796274	p.Val188Ile	missense variant	-	NC_000001.11:g.225419341C>T	ESP,ExAC,TOPMed,gnomAD
rs1196056286	p.Ala189Thr	missense variant	-	NC_000001.11:g.225419338C>T	TOPMed,gnomAD
rs754133766	p.Lys190Arg	missense variant	-	NC_000001.11:g.225419334T>C	ExAC,TOPMed,gnomAD
rs149760565	p.Leu192Arg	missense variant	-	NC_000001.11:g.225419328A>C	ESP,ExAC,TOPMed,gnomAD
rs139988587	p.Val194Met	missense variant	-	NC_000001.11:g.225419323C>T	ESP,ExAC,TOPMed,gnomAD
rs200288588	p.Thr200Asn	missense variant	-	NC_000001.11:g.225419304G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs775167348	p.Arg203Trp	missense variant	-	NC_000001.11:g.225419296G>A	ExAC,TOPMed,gnomAD
RCV000379289	p.Arg203Trp	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225419296G>A	ClinVar
rs142747191	p.Arg203Gln	missense variant	-	NC_000001.11:g.225419295C>T	ESP,ExAC,TOPMed,gnomAD
rs776256289	p.Ala204Thr	missense variant	-	NC_000001.11:g.225419293C>T	ExAC,gnomAD
rs776256289	p.Ala204Ser	missense variant	-	NC_000001.11:g.225419293C>A	ExAC,gnomAD
NCI-TCGA novel	p.Glu208Gly	missense variant	-	NC_000001.11:g.225419280T>C	NCI-TCGA
rs565288775	p.Gly210Val	missense variant	-	NC_000001.11:g.225419274C>A	1000Genomes,ExAC,gnomAD
rs531768440	p.Gly211Glu	missense variant	-	NC_000001.11:g.225419271C>T	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Gly211Ter	stop gained	-	NC_000001.11:g.225419272C>A	NCI-TCGA
rs772068458	p.Val212Gly	missense variant	-	NC_000001.11:g.225419268A>C	ExAC,TOPMed,gnomAD
rs772068458	p.Val212Ala	missense variant	-	NC_000001.11:g.225419268A>G	ExAC,TOPMed,gnomAD
rs773288901	p.Val212Ile	missense variant	-	NC_000001.11:g.225419269C>T	ExAC,gnomAD
rs776545053	p.Val215Leu	missense variant	-	NC_000001.11:g.225418178C>G	ExAC,gnomAD
rs766101498	p.Leu217Ile	missense variant	-	NC_000001.11:g.225418172G>T	ExAC,TOPMed,gnomAD
RCV000656652	p.Ile218Ter	frameshift	PELGER-HUET ANOMALY WITH MILD SKELETAL ANOMALIES (PHASK)	NC_000001.11:g.225418168_225418170delinsTTTCTCATCA	ClinVar
rs2230421	p.Met219Thr	missense variant	-	NC_000001.11:g.225418165A>G	ESP,ExAC,TOPMed,gnomAD
rs760606703	p.Met219Val	missense variant	-	NC_000001.11:g.225418166T>C	ExAC,gnomAD
rs572319132	p.Pro223Ser	missense variant	-	NC_000001.11:g.225418154G>A	1000Genomes,ExAC,gnomAD
rs768982188	p.Val224Leu	missense variant	-	NC_000001.11:g.225418151C>A	ExAC,gnomAD
rs1342326976	p.Phe225Ser	missense variant	-	NC_000001.11:g.225418147A>G	TOPMed
rs1317016745	p.Leu226Ile	missense variant	-	NC_000001.11:g.225418145G>T	gnomAD
rs1453350254	p.Phe227Leu	missense variant	-	NC_000001.11:g.225418142A>G	gnomAD
rs1164798368	p.Met232Ile	missense variant	-	NC_000001.11:g.225418125C>A	TOPMed,gnomAD
rs1164798368	p.Met232Ile	missense variant	-	NC_000001.11:g.225418125C>T	TOPMed,gnomAD
rs749414790	p.Cys233Tyr	missense variant	-	NC_000001.11:g.225418123C>T	ExAC,gnomAD
rs1474443369	p.Cys233Arg	missense variant	-	NC_000001.11:g.225418124A>G	TOPMed,gnomAD
NCI-TCGA novel	p.Cys233HisLeuIleLysThr	insertion	-	NC_000001.11:g.225418121_225418122insTGTTTTAATAAGATG	NCI-TCGA
rs770244436	p.Lys234Arg	missense variant	-	NC_000001.11:g.225418120T>C	ExAC,gnomAD
rs780571341	p.Lys234Glu	missense variant	-	NC_000001.11:g.225418121T>C	ExAC,gnomAD
rs1248666020	p.Gln235Ter	stop gained	-	NC_000001.11:g.225418118G>A	gnomAD
rs746399322	p.Gln235Arg	missense variant	-	NC_000001.11:g.225418117T>C	ExAC,TOPMed,gnomAD
rs373221926	p.Asp237Gly	missense variant	-	NC_000001.11:g.225418111T>C	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp237Glu	missense variant	-	NC_000001.11:g.225418110A>C	NCI-TCGA
NCI-TCGA novel	p.Pro238His	missense variant	-	NC_000001.11:g.225418108G>T	NCI-TCGA
rs1272518792	p.Leu240Val	missense variant	-	NC_000001.11:g.225418103G>C	gnomAD
rs886046053	p.Asn242Asp	missense variant	-	NC_000001.11:g.225418097T>C	-
RCV000322395	p.Asn242Asp	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225418097T>C	ClinVar
COSM904644	p.Asn242Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225418096T>A	NCI-TCGA Cosmic
rs757805606	p.Phe243Ile	missense variant	-	NC_000001.11:g.225418094A>T	ExAC,TOPMed,gnomAD
rs1237899420	p.Pro244Leu	missense variant	-	NC_000001.11:g.225418090G>A	gnomAD
rs752316294	p.Pro244Ser	missense variant	-	NC_000001.11:g.225418091G>A	ExAC,TOPMed,gnomAD
rs778270986	p.Pro245Ser	missense variant	-	NC_000001.11:g.225418088G>A	ExAC,gnomAD
rs1217973085	p.Pro246His	missense variant	-	NC_000001.11:g.225418084G>T	TOPMed
rs140008883	p.Pro248Leu	missense variant	-	NC_000001.11:g.225418078G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000264843	p.Ala249Asp	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225418075G>T	ClinVar
rs200781118	p.Ala249Asp	missense variant	-	NC_000001.11:g.225418075G>T	ESP,ExAC,TOPMed,gnomAD
rs943153158	p.Glu252Asp	missense variant	-	NC_000001.11:g.225418065C>A	gnomAD
COSM3804082	p.Glu252Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225418065C>G	NCI-TCGA Cosmic
rs1393344778	p.Trp254Arg	missense variant	-	NC_000001.11:g.225418061A>G	TOPMed,gnomAD
rs766188080	p.Trp254Leu	missense variant	-	NC_000001.11:g.225418060C>A	ExAC
rs1393344778	p.Trp254Gly	missense variant	-	NC_000001.11:g.225418061A>C	TOPMed,gnomAD
rs752867763	p.Arg257Ile	missense variant	-	NC_000001.11:g.225418051C>A	ExAC,gnomAD
rs752867763	p.Arg257Thr	missense variant	-	NC_000001.11:g.225418051C>G	ExAC,gnomAD
rs750192278	p.Val258Gly	missense variant	-	NC_000001.11:g.225418048A>C	ExAC,gnomAD
COSM1339249	p.Phe259Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225418046A>G	NCI-TCGA Cosmic
rs989833855	p.Tyr262Cys	missense variant	-	NC_000001.11:g.225418036T>C	TOPMed
rs774504905	p.Leu263Pro	missense variant	-	NC_000001.11:g.225418033A>G	ExAC,gnomAD
rs761645957	p.Leu263Phe	missense variant	-	NC_000001.11:g.225418034G>A	ExAC,TOPMed,gnomAD
rs1191678063	p.Ile268Val	missense variant	-	NC_000001.11:g.225418019T>C	gnomAD
rs571188946	p.Val270Ile	missense variant	-	NC_000001.11:g.225418013C>T	1000Genomes
rs775806204	p.Phe272Val	missense variant	-	NC_000001.11:g.225418007A>C	ExAC,gnomAD
rs770117907	p.Phe272Leu	missense variant	-	NC_000001.11:g.225418005G>T	ExAC,TOPMed,gnomAD
rs771523780	p.Leu275Val	missense variant	-	NC_000001.11:g.225417998G>C	ExAC,TOPMed,gnomAD
rs754401622	p.Ile277Thr	missense variant	-	NC_000001.11:g.225417991A>G	ExAC,gnomAD
rs369086850	p.Ile277Phe	missense variant	-	NC_000001.11:g.225417992T>A	ESP,ExAC,TOPMed,gnomAD
rs1324743572	p.Ile277Met	missense variant	-	NC_000001.11:g.225417990A>C	gnomAD
rs369086850	p.Ile277Val	missense variant	-	NC_000001.11:g.225417992T>C	ESP,ExAC,TOPMed,gnomAD
rs1325056362	p.Val280Gly	missense variant	-	NC_000001.11:g.225415331A>C	gnomAD
rs1375140616	p.Glu282Gly	missense variant	-	NC_000001.11:g.225415325T>C	TOPMed,gnomAD
rs937215428	p.Gly283Arg	missense variant	-	NC_000001.11:g.225415323C>T	gnomAD
RCV000757430	p.Thr284Met	missense variant	-	NC_000001.11:g.225415319G>A	ClinVar
rs371750924	p.Thr284Lys	missense variant	-	NC_000001.11:g.225415319G>T	ESP,ExAC,TOPMed,gnomAD
rs371750924	p.Thr284Met	missense variant	-	NC_000001.11:g.225415319G>A	ESP,ExAC,TOPMed,gnomAD
rs201093644	p.Ile287Thr	missense variant	-	NC_000001.11:g.225415310A>G	1000Genomes,ExAC,gnomAD
rs1425669232	p.Asp288Asn	missense variant	-	NC_000001.11:g.225415308C>T	gnomAD
rs1425669232	p.Asp288His	missense variant	-	NC_000001.11:g.225415308C>G	gnomAD
rs148541545	p.Gly289Glu	missense variant	-	NC_000001.11:g.225415304C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000202858	p.Gly289Glu	missense variant	-	NC_000001.11:g.225415304C>T	ClinVar
RCV000766850	p.Gly289Glu	missense variant	-	NC_000001.11:g.225415304C>T	ClinVar
rs1168968932	p.Arg291Ser	missense variant	-	NC_000001.11:g.225415297T>G	TOPMed
rs755779401	p.Leu292Phe	missense variant	-	NC_000001.11:g.225415296G>A	ExAC,gnomAD
rs1255016152	p.Lys293Arg	missense variant	-	NC_000001.11:g.225415292T>C	gnomAD
rs1064797142	p.Tyr294Cys	missense variant	-	NC_000001.11:g.225415289T>C	-
RCV000488130	p.Tyr294Cys	missense variant	-	NC_000001.11:g.225415289T>C	ClinVar
rs1163102510	p.Phe299Leu	missense variant	-	NC_000001.11:g.225412643A>G	gnomAD
rs2230422	p.Tyr300Cys	missense variant	-	NC_000001.11:g.225412639T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000362903	p.Tyr300Cys	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225412639T>C	ClinVar
rs756298358	p.Ala301Val	missense variant	-	NC_000001.11:g.225412636G>A	ExAC,gnomAD
rs1165682529	p.Ile303Asn	missense variant	-	NC_000001.11:g.225412630A>T	gnomAD
NCI-TCGA novel	p.Ile303SerPheSerTerUnk	frameshift	-	NC_000001.11:g.225412631T>-	NCI-TCGA
rs762215626	p.Ala307Ser	missense variant	-	NC_000001.11:g.225412619C>A	ExAC,TOPMed,gnomAD
rs1259631860	p.Ala307Val	missense variant	-	NC_000001.11:g.225412618G>A	TOPMed
rs1458202605	p.Ile309Val	missense variant	-	NC_000001.11:g.225412613T>C	gnomAD
rs773059198	p.Gly310Arg	missense variant	-	NC_000001.11:g.225412610C>T	ExAC,TOPMed,gnomAD
rs2275601	p.Thr311Pro	missense variant	-	NC_000001.11:g.225412607T>G	1000Genomes,ExAC,TOPMed,gnomAD
rs2275601	p.Thr311Ala	missense variant	-	NC_000001.11:g.225412607T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1265688339	p.Leu313Val	missense variant	-	NC_000001.11:g.225412601G>C	gnomAD
rs532717763	p.Phe314Leu	missense variant	-	NC_000001.11:g.225412598A>G	1000Genomes,ExAC,gnomAD
rs772870100	p.Gly316Asp	missense variant	-	NC_000001.11:g.225412591C>T	ExAC,gnomAD
NCI-TCGA novel	p.Gly316Cys	missense variant	-	NC_000001.11:g.225412592C>A	NCI-TCGA
rs778842130	p.Val317Ala	missense variant	-	NC_000001.11:g.225412588A>G	ExAC,gnomAD
rs532068854	p.Val317Leu	missense variant	-	NC_000001.11:g.225412589C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs532068854	p.Val317Ile	missense variant	-	NC_000001.11:g.225412589C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs780032261	p.Phe319Ser	missense variant	-	NC_000001.11:g.225412582A>G	ExAC,gnomAD
RCV000276302	p.His320Arg	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225412579T>C	ClinVar
rs1408746181	p.His320Gln	missense variant	-	NC_000001.11:g.225412578A>C	gnomAD
rs201654506	p.His320Arg	missense variant	-	NC_000001.11:g.225412579T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM679385	p.His320Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225412580G>A	NCI-TCGA Cosmic
rs145104817	p.Val322Met	missense variant	-	NC_000001.11:g.225412574C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs757467143	p.Tyr323His	missense variant	-	NC_000001.11:g.225412571A>G	ExAC,TOPMed,gnomAD
rs372399119	p.Tyr323Ser	missense variant	-	NC_000001.11:g.225412570T>G	ESP
COSM4817289	p.Leu327Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225412559G>C	NCI-TCGA Cosmic
rs201609720	p.Leu331Val	missense variant	-	NC_000001.11:g.225412547G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs201609720	p.Leu331Phe	missense variant	-	NC_000001.11:g.225412547G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs141647564	p.Ala332Gly	missense variant	-	NC_000001.11:g.225412543G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs141647564	p.Ala332Val	missense variant	-	NC_000001.11:g.225412543G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs765826557	p.Val335Leu	missense variant	-	NC_000001.11:g.225412535C>G	ExAC,gnomAD
rs950583872	p.Val335Gly	missense variant	-	NC_000001.11:g.225412534A>C	TOPMed,gnomAD
rs1486157539	p.Val339Phe	missense variant	-	NC_000001.11:g.225412523C>A	TOPMed
rs772814364	p.Val342Met	missense variant	-	NC_000001.11:g.225412514C>T	ExAC,gnomAD
NCI-TCGA novel	p.Leu344Phe	missense variant	-	NC_000001.11:g.225412508G>A	NCI-TCGA
rs916315587	p.Met346Thr	missense variant	-	NC_000001.11:g.225412501A>G	gnomAD
rs141837466	p.Arg347Cys	missense variant	-	NC_000001.11:g.225412499G>A	ESP,ExAC,TOPMed,gnomAD
rs761503513	p.Arg347His	missense variant	-	NC_000001.11:g.225412498C>T	ExAC,TOPMed,gnomAD
rs774295347	p.Leu349Ser	missense variant	-	NC_000001.11:g.225412492A>G	ExAC,gnomAD
NCI-TCGA novel	p.Leu349Phe	missense variant	-	NC_000001.11:g.225412491C>G	NCI-TCGA
rs1454335895	p.Ala351Thr	missense variant	-	NC_000001.11:g.225412487C>T	TOPMed,gnomAD
rs560305402	p.Ala351Val	missense variant	-	NC_000001.11:g.225412486G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs372090173	p.Pro352Leu	missense variant	-	NC_000001.11:g.225412483G>A	ESP,ExAC,TOPMed,gnomAD
rs1438230432	p.Pro352Ser	missense variant	-	NC_000001.11:g.225412484G>A	TOPMed
rs368253687	p.Arg353Gln	missense variant	-	NC_000001.11:g.225412480C>T	ESP,ExAC,TOPMed,gnomAD
rs138731836	p.Arg353Trp	missense variant	-	NC_000001.11:g.225412481G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asn354Ser	missense variant	-	NC_000001.11:g.225412477T>C	NCI-TCGA
rs149077819	p.Ser357Leu	missense variant	-	NC_000001.11:g.225412468G>A	ESP,ExAC,TOPMed,gnomAD
rs778139850	p.Pro358Leu	missense variant	-	NC_000001.11:g.225412465G>A	ExAC,gnomAD
rs145328578	p.Pro358Ser	missense variant	-	NC_000001.11:g.225412466G>A	ESP,ExAC,TOPMed,gnomAD
rs61731741	p.Ser361Phe	missense variant	-	NC_000001.11:g.225412456G>A	gnomAD
rs61731741	p.Ser361Cys	missense variant	-	NC_000001.11:g.225412456G>C	gnomAD
COSM904643	p.Gly362Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225412454C>T	NCI-TCGA Cosmic
rs192884088	p.Ala364Thr	missense variant	-	NC_000001.11:g.225411435C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1385535432	p.Val365Ile	missense variant	-	NC_000001.11:g.225411432C>T	gnomAD
rs760213489	p.Tyr366Cys	missense variant	-	NC_000001.11:g.225411428T>C	ExAC,TOPMed,gnomAD
rs1211967159	p.Asp367Glu	missense variant	-	NC_000001.11:g.225411424A>C	TOPMed
rs1316644897	p.Asp367Gly	missense variant	-	NC_000001.11:g.225411425T>C	TOPMed
rs1189063395	p.Ile370Thr	missense variant	-	NC_000001.11:g.225411416A>G	gnomAD
rs200180113	p.Arg372Cys	missense variant	-	NC_000001.11:g.225411411G>A	ESP,ExAC,TOPMed,gnomAD
RCV000010141	p.Arg372Cys	missense variant	Reynolds syndrome	NC_000001.11:g.225411411G>A	ClinVar
rs747250396	p.Arg372His	missense variant	-	NC_000001.11:g.225411410C>T	ExAC,TOPMed,gnomAD
rs977194928	p.Asn375Ser	missense variant	-	NC_000001.11:g.225411401T>C	TOPMed
rs778014876	p.Pro376Arg	missense variant	-	NC_000001.11:g.225411398G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro376Leu	missense variant	-	NC_000001.11:g.225411398G>A	NCI-TCGA
rs750036742	p.Arg377Gln	missense variant	-	NC_000001.11:g.225411395C>T	ExAC,TOPMed,gnomAD
RCV000756302	p.Arg377Gln	missense variant	-	NC_000001.11:g.225411395C>T	ClinVar
rs748609557	p.Gly379Cys	missense variant	-	NC_000001.11:g.225411390C>A	ExAC,gnomAD
rs779092617	p.Thr380Ala	missense variant	-	NC_000001.11:g.225411387T>C	ExAC,gnomAD
COSM3984772	p.Phe381Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225411382A>T	NCI-TCGA Cosmic
rs199944519	p.Tyr385Cys	missense variant	-	NC_000001.11:g.225411371T>C	1000Genomes,gnomAD
rs780875833	p.Phe386Val	missense variant	-	NC_000001.11:g.225411369A>C	ExAC,gnomAD
rs1444402654	p.Cys387Gly	missense variant	-	NC_000001.11:g.225411366A>C	TOPMed,gnomAD
rs751082807	p.Cys387Tyr	missense variant	-	NC_000001.11:g.225411365C>T	ExAC,gnomAD
rs1444402654	p.Cys387Arg	missense variant	-	NC_000001.11:g.225411366A>G	TOPMed,gnomAD
rs763875580	p.Leu389Ser	missense variant	-	NC_000001.11:g.225411359A>G	ExAC,TOPMed,gnomAD
rs752549085	p.Arg390His	missense variant	-	NC_000001.11:g.225411356C>T	ExAC,TOPMed,gnomAD
rs762500645	p.Arg390Cys	missense variant	-	NC_000001.11:g.225411357G>A	ExAC,TOPMed,gnomAD
rs1164592698	p.Pro391Leu	missense variant	-	NC_000001.11:g.225411353G>A	gnomAD
RCV000515924	p.Gly392Arg	missense variant	Jeune thoracic dystrophy (ATD1)	NC_000001.11:g.225411351C>T	ClinVar
rs1236962991	p.Gly392Arg	missense variant	-	NC_000001.11:g.225411351C>T	gnomAD
rs759500897	p.Gly395Glu	missense variant	-	NC_000001.11:g.225411341C>T	ExAC,gnomAD
NCI-TCGA novel	p.Val397Leu	missense variant	-	NC_000001.11:g.225410416C>A	NCI-TCGA
rs1261585802	p.Val398Phe	missense variant	-	NC_000001.11:g.225410413C>A	TOPMed
COSM6124907	p.Met403Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225410398T>C	NCI-TCGA Cosmic
rs760590170	p.Ala406Thr	missense variant	-	NC_000001.11:g.225410389C>T	ExAC,gnomAD
rs1307658193	p.Met408Lys	missense variant	-	NC_000001.11:g.225410382A>T	gnomAD
rs773349855	p.Gln411His	missense variant	-	NC_000001.11:g.225410372C>G	ExAC,gnomAD
rs1218508469	p.Gln411Arg	missense variant	-	NC_000001.11:g.225410373T>C	gnomAD
COSM679387	p.Asp412Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225410371C>A	NCI-TCGA Cosmic
rs534522882	p.Arg413His	missense variant	-	NC_000001.11:g.225410367C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs144672633	p.Arg413Cys	missense variant	-	NC_000001.11:g.225410368G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs765875442	p.Ala414Thr	missense variant	-	NC_000001.11:g.225410365C>T	ExAC,TOPMed,gnomAD
rs749737302	p.Ser417Pro	missense variant	-	NC_000001.11:g.225410356A>G	ExAC,gnomAD
COSM3984771	p.Ser417Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225410355G>C	NCI-TCGA Cosmic
rs1039551489	p.Met420Val	missense variant	-	NC_000001.11:g.225410347T>C	TOPMed
COSM282377	p.Met420Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225410345C>A	NCI-TCGA Cosmic
rs1433169701	p.Ile421Val	missense variant	-	NC_000001.11:g.225410344T>C	gnomAD
NCI-TCGA novel	p.Asn424Asp	missense variant	-	NC_000001.11:g.225410335T>C	NCI-TCGA
COSM3400364	p.Ser425Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225410331C>T	NCI-TCGA Cosmic
rs139059920	p.Phe426Leu	missense variant	-	NC_000001.11:g.225410327G>C	ESP,ExAC,TOPMed,gnomAD
rs138769892	p.Tyr430Cys	missense variant	-	NC_000001.11:g.225410316T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs373006705	p.Tyr430His	missense variant	-	NC_000001.11:g.225410317A>G	ESP
rs1354117075	p.Val432Met	missense variant	-	NC_000001.11:g.225410311C>T	TOPMed
NCI-TCGA novel	p.Val432Leu	missense variant	-	NC_000001.11:g.225410311C>A	NCI-TCGA
rs777371608	p.Asp433Asn	missense variant	-	NC_000001.11:g.225410308C>T	ExAC,gnomAD
rs141750416	p.Ala434Thr	missense variant	-	NC_000001.11:g.225410305C>T	ESP,ExAC,TOPMed,gnomAD
rs141750416	p.Ala434Ser	missense variant	-	NC_000001.11:g.225410305C>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala434Asp	missense variant	-	NC_000001.11:g.225410304G>T	NCI-TCGA
NCI-TCGA novel	p.Leu435Phe	missense variant	-	NC_000001.11:g.225410302G>A	NCI-TCGA
rs1301532168	p.Asn437Ser	missense variant	-	NC_000001.11:g.225410295T>C	TOPMed,gnomAD
rs1209489811	p.Glu438Ala	missense variant	-	NC_000001.11:g.225410292T>G	TOPMed,gnomAD
rs747674311	p.Ala440Thr	missense variant	-	NC_000001.11:g.225406829C>T	ExAC,TOPMed,gnomAD
rs747674311	p.Ala440Pro	missense variant	-	NC_000001.11:g.225406829C>G	ExAC,TOPMed,gnomAD
rs778378796	p.Ala440Val	missense variant	-	NC_000001.11:g.225406828G>A	ExAC,gnomAD
rs531565954	p.Thr443Lys	missense variant	-	NC_000001.11:g.225406819G>T	1000Genomes,ExAC,gnomAD
RCV000335811	p.Thr443Met	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225406819G>A	ClinVar
rs531565954	p.Thr443Met	missense variant	-	NC_000001.11:g.225406819G>A	1000Genomes,ExAC,gnomAD
rs531565954	p.Thr443Arg	missense variant	-	NC_000001.11:g.225406819G>C	1000Genomes,ExAC,gnomAD
rs186333444	p.Thr444Ser	missense variant	-	NC_000001.11:g.225406816G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs186333444	p.Thr444Asn	missense variant	-	NC_000001.11:g.225406816G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs148033978	p.Met445Val	missense variant	-	NC_000001.11:g.225406814T>C	ESP,ExAC,TOPMed,gnomAD
rs374446877	p.Ile447Met	missense variant	-	NC_000001.11:g.225406806G>C	ESP,ExAC,TOPMed,gnomAD
rs1453936270	p.Ile447Asn	missense variant	-	NC_000001.11:g.225406807A>T	gnomAD
rs1415649191	p.His449Tyr	missense variant	-	NC_000001.11:g.225406802G>A	TOPMed
rs775804258	p.Asp450Asn	missense variant	-	NC_000001.11:g.225406799C>T	ExAC,gnomAD
rs762651731	p.Phe452Ser	missense variant	-	NC_000001.11:g.225406792A>G	ExAC,gnomAD
rs369788407	p.Met455Leu	missense variant	-	NC_000001.11:g.225406784T>G	ESP,ExAC,gnomAD
RCV000763831	p.Leu456Val	missense variant	Pelger-Hu?t anomaly (PHA)	NC_000001.11:g.225406781G>C	ClinVar
rs377110126	p.Leu456Val	missense variant	-	NC_000001.11:g.225406781G>C	ESP,ExAC,gnomAD
rs1445718271	p.Leu456Pro	missense variant	-	NC_000001.11:g.225406780A>G	TOPMed
RCV000489302	p.Leu456Val	missense variant	-	NC_000001.11:g.225406781G>C	ClinVar
rs372303989	p.Val462Leu	missense variant	-	NC_000001.11:g.225406763C>A	ESP,ExAC,TOPMed,gnomAD
rs954946766	p.Val464Ile	missense variant	-	NC_000001.11:g.225406757C>T	gnomAD
rs954946766	p.Val464Phe	missense variant	-	NC_000001.11:g.225406757C>A	gnomAD
rs1227606098	p.Pro465Ala	missense variant	-	NC_000001.11:g.225406754G>C	TOPMed
NCI-TCGA novel	p.Pro465Leu	missense variant	-	NC_000001.11:g.225406753G>A	NCI-TCGA
rs1049341078	p.Phe466Val	missense variant	-	NC_000001.11:g.225406751A>C	TOPMed,gnomAD
rs201212744	p.Ile467Phe	missense variant	-	NC_000001.11:g.225406748T>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000087267	p.Tyr468Ter	frameshift	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225406747del	ClinVar
COSM4028652	p.Phe470Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225406737G>C	NCI-TCGA Cosmic
rs1242076313	p.Ala472Ser	missense variant	-	NC_000001.11:g.225406733C>A	gnomAD
COSM3484205	p.Ala472Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225406733C>T	NCI-TCGA Cosmic
RCV000506162	p.Leu475Ile	missense variant	-	NC_000001.11:g.225406724A>T	ClinVar
rs779726211	p.Leu475Ser	missense variant	-	NC_000001.11:g.225406723A>G	ExAC,gnomAD
rs1553395780	p.Leu475Ile	missense variant	-	NC_000001.11:g.225406724A>T	-
rs371531855	p.Ser477Thr	missense variant	-	NC_000001.11:g.225406717C>G	ESP,ExAC,TOPMed,gnomAD
rs376070025	p.Ser477Gly	missense variant	-	NC_000001.11:g.225406718T>C	ESP,ExAC,gnomAD
NCI-TCGA novel	p.Pro479Leu	missense variant	-	NC_000001.11:g.225406711G>A	NCI-TCGA
rs1376867105	p.Asn480Tyr	missense variant	-	NC_000001.11:g.225406709T>A	gnomAD
rs780983309	p.Ser483Ala	missense variant	-	NC_000001.11:g.225406700A>C	ExAC,TOPMed,gnomAD
rs751503823	p.Trp484Ser	missense variant	-	NC_000001.11:g.225406696C>G	ExAC,gnomAD
NCI-TCGA novel	p.Trp484Ter	stop gained	-	NC_000001.11:g.225406695C>T	NCI-TCGA
rs1440124856	p.Pro485Thr	missense variant	-	NC_000001.11:g.225406694G>T	gnomAD
rs778020291	p.Met486Val	missense variant	-	NC_000001.11:g.225406691T>C	ExAC,TOPMed,gnomAD
rs1053523660	p.Ala487Ser	missense variant	-	NC_000001.11:g.225406688C>A	TOPMed
rs1367673808	p.Ser488Pro	missense variant	-	NC_000001.11:g.225406685A>G	gnomAD
rs900536861	p.Leu489Val	missense variant	-	NC_000001.11:g.225406682G>C	gnomAD
rs934709705	p.Ile490Ser	missense variant	-	NC_000001.11:g.225406678A>C	TOPMed,gnomAD
rs886046052	p.Ile491Val	missense variant	-	NC_000001.11:g.225406676T>C	TOPMed
RCV000297273	p.Ile491Val	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225406676T>C	ClinVar
rs541202772	p.Leu495Phe	missense variant	-	NC_000001.11:g.225406664G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs541202772	p.Leu495Ile	missense variant	-	NC_000001.11:g.225406664G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs746777423	p.Leu495His	missense variant	-	NC_000001.11:g.225404706A>T	ExAC,TOPMed,gnomAD
rs1192433983	p.Cys496Trp	missense variant	-	NC_000001.11:g.225404702A>C	TOPMed,gnomAD
rs1487027204	p.Tyr498Asn	missense variant	-	NC_000001.11:g.225404698A>T	gnomAD
COSM4028651	p.Val499Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225404694A>G	NCI-TCGA Cosmic
rs549177877	p.Phe501Leu	missense variant	-	NC_000001.11:g.225404687G>T	1000Genomes,ExAC,gnomAD
RCV000493673	p.Arg502Gly	missense variant	-	NC_000001.11:g.225404686G>C	ClinVar
rs1131691304	p.Arg502Gly	missense variant	-	NC_000001.11:g.225404686G>C	gnomAD
rs758405025	p.Arg502Gln	missense variant	-	NC_000001.11:g.225404685C>T	ExAC,TOPMed,gnomAD
rs752877544	p.Ala504Val	missense variant	-	NC_000001.11:g.225404679G>A	ExAC,gnomAD
rs987262840	p.Ala504Thr	missense variant	-	NC_000001.11:g.225404680C>T	TOPMed,gnomAD
rs752877544	p.Ala504Gly	missense variant	-	NC_000001.11:g.225404679G>C	ExAC,gnomAD
rs967498079	p.Asn505Asp	missense variant	-	NC_000001.11:g.225404677T>C	TOPMed,gnomAD
rs78828796	p.Ala510Thr	missense variant	-	NC_000001.11:g.225404662C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs373561199	p.Arg512Trp	missense variant	-	NC_000001.11:g.225404656G>A	ESP,ExAC,TOPMed,gnomAD
RCV000483832	p.Arg512Gln	missense variant	-	NC_000001.11:g.225404655C>T	ClinVar
rs754049402	p.Arg512Gln	missense variant	-	NC_000001.11:g.225404655C>T	ExAC,TOPMed,gnomAD
rs1320447431	p.Asn514Ser	missense variant	-	NC_000001.11:g.225404649T>C	gnomAD
COSM3484204	p.Pro515Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225404647G>A	NCI-TCGA Cosmic
rs1170693139	p.Ser516Asn	missense variant	-	NC_000001.11:g.225404643C>T	gnomAD
rs761070731	p.Pro518Ser	missense variant	-	NC_000001.11:g.225404638G>A	ExAC,gnomAD
COSM4028650	p.Lys519Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225404635T>C	NCI-TCGA Cosmic
rs201172537	p.Leu520Val	missense variant	-	NC_000001.11:g.225404632G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs372250618	p.Ala521Pro	missense variant	-	NC_000001.11:g.225404629C>G	ESP,ExAC,TOPMed,gnomAD
rs372250618	p.Ala521Ser	missense variant	-	NC_000001.11:g.225404629C>A	ESP,ExAC,TOPMed,gnomAD
rs753611856	p.His522Tyr	missense variant	-	NC_000001.11:g.225404626G>A	ExAC,TOPMed,gnomAD
rs372078910	p.His522Leu	missense variant	-	NC_000001.11:g.225404526T>A	ESP,TOPMed
rs753611856	p.His522Asp	missense variant	-	NC_000001.11:g.225404626G>C	ExAC,TOPMed,gnomAD
rs760341951	p.Lys524Asn	missense variant	-	NC_000001.11:g.225404519T>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Thr525ProPheSerTerUnkUnk	frameshift	-	NC_000001.11:g.225404518T>-	NCI-TCGA
rs1306305066	p.Thr528Ile	missense variant	-	NC_000001.11:g.225404508G>A	gnomAD
rs773141972	p.Ser529Leu	missense variant	-	NC_000001.11:g.225404505G>A	ExAC,gnomAD
rs773141972	p.Ser529Ter	stop gained	-	NC_000001.11:g.225404505G>T	ExAC,gnomAD
rs748116336	p.Thr530Met	missense variant	-	NC_000001.11:g.225404502G>A	ExAC,TOPMed,gnomAD
rs771949470	p.Thr530Ala	missense variant	-	NC_000001.11:g.225404503T>C	ExAC,TOPMed,gnomAD
rs387906416	p.AsnLeuLeu533AsnTerLys	stop gained	Pelger-huet anomaly (pha)	NC_000001.11:g.225404486_225404492delinsCTTCTAG	-
rs1352864124	p.Leu534Ile	missense variant	-	NC_000001.11:g.225404491G>T	TOPMed
RCV000010137	p.Leu534Ter	nonsense	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225404486_225404492delinsCTTCTAG	ClinVar
RCV000087262	p.Leu534Ter	nonsense	Pelger-Hu?t anomaly (PHA)	NC_000001.11:g.225404486_225404492delinsCTTCTAG	ClinVar
rs774389031	p.Leu535Val	missense variant	-	NC_000001.11:g.225404488G>C	ExAC,TOPMed,gnomAD
RCV000224710	p.Ser537Ala	missense variant	-	NC_000001.11:g.225404482A>C	ClinVar
rs80299691	p.Ser537Ala	missense variant	-	NC_000001.11:g.225404482A>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs749446927	p.Gly541Arg	missense variant	-	NC_000001.11:g.225404470C>G	ExAC,TOPMed,gnomAD
rs1156536082	p.Val543Phe	missense variant	-	NC_000001.11:g.225404464C>A	TOPMed,gnomAD
rs1444693890	p.Arg544His	missense variant	-	NC_000001.11:g.225404460C>T	TOPMed,gnomAD
COSM4844755	p.Arg544Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225404461G>A	NCI-TCGA Cosmic
rs779944455	p.Pro546Ser	missense variant	-	NC_000001.11:g.225404455G>A	ExAC
rs587777171	p.Asn547Asp	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225404452T>C	UniProt,dbSNP
VAR_081220	p.Asn547Asp	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225404452T>C	UniProt
rs587777171	p.Asn547Asp	missense variant	-	NC_000001.11:g.225404452T>C	gnomAD
rs374343844	p.Asn547Ser	missense variant	-	NC_000001.11:g.225404451T>C	ESP,ExAC,TOPMed,gnomAD
rs374343844	p.Asn547Ser	missense variant	Pelger-Huet anomaly with mild skeletal anomalies (PHASK)	NC_000001.11:g.225404451T>C	UniProt,dbSNP
VAR_081006	p.Asn547Ser	missense variant	Pelger-Huet anomaly with mild skeletal anomalies (PHASK)	NC_000001.11:g.225404451T>C	UniProt
RCV000210471	p.Asn547Ser	missense variant	Anadysplasia-like, spontaneously remitting spondylometaphyseal dysplasia	NC_000001.11:g.225404451T>C	ClinVar
RCV000087263	p.Asn547Asp	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225404452T>C	ClinVar
rs374343844	p.Asn547Ile	missense variant	-	NC_000001.11:g.225404451T>A	ESP,ExAC,TOPMed,gnomAD
rs781561574	p.Tyr548Cys	missense variant	-	NC_000001.11:g.225404448T>C	ExAC,gnomAD
rs1176137959	p.Leu552Phe	missense variant	-	NC_000001.11:g.225404437G>A	TOPMed
rs751837075	p.Met554Thr	missense variant	-	NC_000001.11:g.225404430A>G	ExAC,TOPMed,gnomAD
rs764727862	p.Leu556Phe	missense variant	-	NC_000001.11:g.225404423C>A	ExAC,gnomAD
rs202123513	p.Ala557Val	missense variant	-	NC_000001.11:g.225404421G>A	1000Genomes,ExAC,TOPMed,gnomAD
RCV000284385	p.Ala557Val	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225404421G>A	ClinVar
rs1374598658	p.Ser559Phe	missense variant	-	NC_000001.11:g.225404415G>A	TOPMed
rs192296368	p.Pro561Ala	missense variant	-	NC_000001.11:g.225404410G>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1337761262	p.Cys562Phe	missense variant	-	NC_000001.11:g.225404406C>A	TOPMed
rs779730656	p.Phe564Leu	missense variant	-	NC_000001.11:g.225403459A>C	ExAC,TOPMed,gnomAD
rs755731775	p.His566Tyr	missense variant	-	NC_000001.11:g.225403455G>A	ExAC,TOPMed,gnomAD
rs767339628	p.Ile567Leu	missense variant	-	NC_000001.11:g.225403452T>G	ExAC,gnomAD
rs137852606	p.Pro569Arg	missense variant	-	NC_000001.11:g.225403445G>C	-
rs137852606	p.Pro569Arg	missense variant	Pelger-Huet anomaly (PHA)	NC_000001.11:g.225403445G>C	UniProt,dbSNP
VAR_017842	p.Pro569Arg	missense variant	Pelger-Huet anomaly (PHA)	NC_000001.11:g.225403445G>C	UniProt
rs146204188	p.Tyr570His	missense variant	-	NC_000001.11:g.225403443A>G	ESP,ExAC,TOPMed,gnomAD
rs897450329	p.Phe571Leu	missense variant	-	NC_000001.11:g.225403438G>C	TOPMed,gnomAD
rs1409601053	p.Ile573Met	missense variant	-	NC_000001.11:g.225403432T>C	TOPMed
rs1427564477	p.Ile574Met	missense variant	-	NC_000001.11:g.225403429A>C	gnomAD
rs1179013007	p.Tyr575Cys	missense variant	-	NC_000001.11:g.225403427T>C	TOPMed,gnomAD
rs143181005	p.Thr577Ile	missense variant	-	NC_000001.11:g.225403421G>A	ESP,ExAC,TOPMed,gnomAD
rs1358335705	p.Met578Ile	missense variant	-	NC_000001.11:g.225403417C>A	TOPMed
rs1262705462	p.Leu579Phe	missense variant	-	NC_000001.11:g.225403414C>A	gnomAD
rs1317084127	p.Leu580His	missense variant	-	NC_000001.11:g.225403412A>T	gnomAD
rs1486861811	p.Val581Ile	missense variant	-	NC_000001.11:g.225403410C>T	TOPMed,gnomAD
rs1486861811	p.Val581Phe	missense variant	-	NC_000001.11:g.225403410C>A	TOPMed,gnomAD
COSM4028649	p.His582Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225403406T>C	NCI-TCGA Cosmic
rs587777172	p.Arg583Gln	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225403403C>T	UniProt,dbSNP
VAR_081221	p.Arg583Gln	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225403403C>T	UniProt
rs587777172	p.Arg583Gln	missense variant	-	NC_000001.11:g.225403403C>T	ExAC,TOPMed,gnomAD
rs587777172	p.Arg583Leu	missense variant	-	NC_000001.11:g.225403403C>A	ExAC,TOPMed,gnomAD
rs1057516045	p.Arg583Ter	stop gained	-	NC_000001.11:g.225403404G>A	gnomAD
RCV000087264	p.Arg583Gln	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225403403C>T	ClinVar
RCV000480212	p.Arg583Leu	missense variant	-	NC_000001.11:g.225403403C>A	ClinVar
RCV000626821	p.Arg583Ter	nonsense	-	NC_000001.11:g.225403404G>A	ClinVar
RCV000656653	p.Arg586His	missense variant	PELGER-HUET ANOMALY WITH MILD SKELETAL ANOMALIES (PHASK)	NC_000001.11:g.225403394C>T	ClinVar
rs199675363	p.Arg586Cys	missense variant	-	NC_000001.11:g.225403395G>A	ExAC,TOPMed,gnomAD
rs573510559	p.Arg586His	missense variant	Pelger-Huet anomaly with mild skeletal anomalies (PHASK)	NC_000001.11:g.225403394C>T	UniProt,dbSNP
VAR_081007	p.Arg586His	missense variant	Pelger-Huet anomaly with mild skeletal anomalies (PHASK)	NC_000001.11:g.225403394C>T	UniProt
rs573510559	p.Arg586His	missense variant	-	NC_000001.11:g.225403394C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs149534786	p.Asp587Glu	missense variant	-	NC_000001.11:g.225403390G>C	ESP,ExAC,TOPMed,gnomAD
rs138067182	p.Glu588Lys	missense variant	-	NC_000001.11:g.225403389C>T	ESP,ExAC,TOPMed,gnomAD
rs1215843389	p.His590Arg	missense variant	-	NC_000001.11:g.225403382T>C	TOPMed,gnomAD
rs772275229	p.Cys591Tyr	missense variant	-	NC_000001.11:g.225403379C>T	ExAC,gnomAD
rs758568680	p.Tyr595Ter	stop gained	-	NC_000001.11:g.225403366G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Tyr595His	missense variant	-	NC_000001.11:g.225403368A>G	NCI-TCGA
rs779601553	p.Gly596Val	missense variant	-	NC_000001.11:g.225403364C>A	ExAC
rs371589487	p.Val597Met	missense variant	-	NC_000001.11:g.225403362C>T	ESP,ExAC,TOPMed,gnomAD
rs371589487	p.Val597Leu	missense variant	-	NC_000001.11:g.225403362C>G	ESP,ExAC,TOPMed,gnomAD
rs371589487	p.Val597Leu	missense variant	-	NC_000001.11:g.225403362C>A	ESP,ExAC,TOPMed,gnomAD
rs751127239	p.Ala598Val	missense variant	-	NC_000001.11:g.225403358G>A	ExAC,gnomAD
rs1439795101	p.Trp599Arg	missense variant	-	NC_000001.11:g.225403356A>T	TOPMed
rs141243190	p.Lys601Thr	missense variant	-	NC_000001.11:g.225403349T>G	ESP,ExAC,TOPMed,gnomAD
rs762700017	p.Tyr602His	missense variant	-	NC_000001.11:g.225403347A>G	ExAC,TOPMed,gnomAD
rs1455371337	p.Gln604Lys	missense variant	-	NC_000001.11:g.225403341G>T	TOPMed
rs377008758	p.Arg605His	missense variant	-	NC_000001.11:g.225403337C>T	ESP,ExAC,gnomAD
rs918778528	p.Arg605Cys	missense variant	-	NC_000001.11:g.225403338G>A	TOPMed,gnomAD
rs765213528	p.Pro607Ala	missense variant	-	NC_000001.11:g.225403332G>C	ExAC,gnomAD
rs779151785	p.Pro607His	missense variant	-	NC_000001.11:g.225403331G>T	ExAC,gnomAD
rs765213528	p.Pro607Ser	missense variant	-	NC_000001.11:g.225403332G>A	ExAC,gnomAD
rs1332502900	p.Tyr608Ser	missense variant	-	NC_000001.11:g.225403328T>G	TOPMed
rs776693237	p.Arg609Ser	missense variant	-	NC_000001.11:g.225403326G>T	ExAC,TOPMed,gnomAD
rs766329359	p.Arg609His	missense variant	-	NC_000001.11:g.225403325C>T	ExAC,TOPMed,gnomAD
rs776693237	p.Arg609Cys	missense variant	-	NC_000001.11:g.225403326G>A	ExAC,TOPMed,gnomAD
rs886046051	p.Ile610Val	missense variant	-	NC_000001.11:g.225403323T>C	-
RCV000376521	p.Ile610Val	missense variant	Greenberg dysplasia (GRBGD)	NC_000001.11:g.225403323T>C	ClinVar
rs760973933	p.Phe611Val	missense variant	-	NC_000001.11:g.225403320A>C	ExAC,gnomAD
rs773353718	p.Pro612Thr	missense variant	-	NC_000001.11:g.225403317G>T	ExAC,gnomAD
NCI-TCGA novel	p.Pro612Ser	missense variant	-	NC_000001.11:g.225403317G>A	NCI-TCGA
rs911065623	p.Tyr613Cys	missense variant	-	NC_000001.11:g.225403313T>C	TOPMed
rs911065623	p.Tyr613Phe	missense variant	-	NC_000001.11:g.225403313T>A	TOPMed
COSM1470256	p.Ile614Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000001.11:g.225403311T>C	NCI-TCGA Cosmic

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001361	Acute tonsillitis	disease	BEFREE
C0001418	Adenocarcinoma	group	BEFREE
C0003864	Arthritis	disease	HPO
C0004096	Asthma	disease	BEFREE
C0004135	Ataxia Telangiectasia	disease	BEFREE
C0004943	Behcet Syndrome	disease	BEFREE
C0005699	Blast Phase	disease	BEFREE
C0005859	Bloom Syndrome	disease	BEFREE
C0006118	Brain Neoplasms	group	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0006413	Burkitt Lymphoma	disease	BEFREE
C0006663	Calcinosis	phenotype	HPO
C0006664	Calcinosis cutis	disease	HPO
C0007102	Malignant tumor of colon	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE
C0008312	Primary biliary cirrhosis	disease	HPO
C0008626	Congenital chromosomal disease	group	BEFREE
C0009402	Colorectal Carcinoma	disease	BEFREE
C0009447	Common Variable Immunodeficiency	disease	BEFREE
C0010346	Crohn Disease	disease	BEFREE
C0011168	Deglutition Disorders	group	HPO
C0011615	Dermatitis, Atopic	disease	BEFREE
C0011644	Scleroderma	disease	BEFREE;HPO
C0011854	Diabetes Mellitus, Insulin-Dependent	disease	BEFREE
C0013080	Down Syndrome	disease	BEFREE
C0013238	Dry Eye Syndromes	group	HPO
C0013595	Eczema	disease	BEFREE
C0015230	Exanthema	phenotype	HPO
C0015672	Fatigue	phenotype	HPO
C0015927	Fetal Death	phenotype	HPO
C0015967	Fever	phenotype	HPO
C0017168	Gastroesophageal reflux disease	disease	HPO
C0017181	Gastrointestinal Hemorrhage	phenotype	HPO
C0018133	Graft-vs-Host Disease	disease	BEFREE
C0018553	Hamartoma Syndrome, Multiple	disease	BEFREE
C0018800	Cardiomegaly	phenotype	HPO
C0018834	Heartburn	phenotype	HPO
C0019209	Hepatomegaly	phenotype	HPO
C0019214	Hepatosplenomegaly	phenotype	HPO
C0019348	Herpes Simplex Infections	group	BEFREE
C0019693	HIV Infections	group	BEFREE
C0020224	Polyhydramnios	phenotype	HPO
C0020305	Hydrops Fetalis	disease	GENOMICS_ENGLAND
C0020534	Orbital separation excessive	phenotype	HPO
C0020757	Ichthyoses	disease	BEFREE
C0020758	Congenital ichthyosis	disease	BEFREE
C0021051	Immunologic Deficiency Syndromes	group	BEFREE
C0022346	Icterus	phenotype	HPO
C0022408	Arthropathy	group	HPO
C0022575	Keratoconjunctivitis Sicca	disease	HPO
C0023418	leukemia	disease	BEFREE
C0023443	Hairy Cell Leukemia	disease	BEFREE
C0023449	Acute lymphocytic leukemia	disease	BEFREE
C0023467	Leukemia, Myelocytic, Acute	disease	BEFREE
C0023470	Myeloid Leukemia	disease	BEFREE
C0023473	Myeloid Leukemia, Chronic	disease	BEFREE
C0023485	Precursor B-Cell Lymphoblastic Leukemia-Lymphoma	disease	BEFREE
C0023487	Acute Promyelocytic Leukemia	disease	BEFREE
C0023492	Leukemia, T-Cell	disease	BEFREE
C0023892	Biliary cirrhosis	disease	HPO
C0024141	Lupus Erythematosus, Systemic	disease	MGD
C0024236	Lymphedema	disease	HPO
C0024299	Lymphoma	group	BEFREE
C0024530	Malaria	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025007	Measles	disease	BEFREE
C0025202	melanoma	disease	BEFREE
C0025990	Micrognathism	disease	HPO
C0025995	Micromelia	disease	HPO
C0026269	Mitral Valve Stenosis	disease	BEFREE
C0026499	Monosomy	group	BEFREE
C0026769	Multiple Sclerosis	disease	BEFREE
C0026946	Mycoses	group	BEFREE
C0030779	Pelger-Huet Anomaly	disease	BEFREE;CLINVAR;CTD_human;HPO;LHGDN;MGD;UNIPROT
C0032227	Pleural effusion disorder	group	HPO
C0032914	Pre-Eclampsia	phenotype	HPO
C0033774	Pruritus	phenotype	HPO
C0034734	Raynaud Disease	disease	HPO
C0034735	Raynaud Phenomenon	disease	HPO
C0037299	Skin Ulcer	phenotype	HPO
C0038002	Splenomegaly	phenotype	HPO
C0038238	Steatorrhea	phenotype	HPO
C0038522	Subacute Sclerosing Panencephalitis	disease	BEFREE
C0039101	synovial sarcoma	disease	BEFREE
C0041408	Turner Syndrome	disease	BEFREE
C0042769	Virus Diseases	group	BEFREE
C0043144	Wheezing	phenotype	BEFREE
C0043346	Xeroderma Pigmentosum	disease	BEFREE
C0043349	Xerophthalmia	disease	HPO
C0043352	Xerostomia	disease	HPO
C0079584	Ichthyosis Vulgaris	disease	MGD
C0085077	Sweet Syndrome	disease	BEFREE
C0085110	Severe Combined Immunodeficiency	disease	BEFREE
C0086565	Liver Dysfunction	phenotype	HPO
C0086981	Sicca Syndrome	disease	BEFREE
C0150988	Sclerodactyly	disease	HPO
C0151766	Liver function tests abnormal finding	phenotype	HPO
C0151849	Alkaline phosphatase raised	phenotype	HPO
C0152009	White blood cell abnormality	group	HPO
C0152013	Adenocarcinoma of lung (disorder)	disease	BEFREE
C0152427	Polydactyly	disease	GENOMICS_ENGLAND;HPO
C0162678	Neurofibromatoses	group	BEFREE
C0206620	Lymphangioma, Cystic	disease	HPO
C0221026	X-linked agammaglobulinemia	disease	BEFREE
C0221210	Congenital malrotation of intestine	disease	HPO
C0221357	Brachydactyly	disease	HPO
C0231528	Myalgia	phenotype	HPO
C0235996	Elevated liver enzymes	phenotype	HPO
C0239234	Low set ears	phenotype	HPO
C0239676	High forehead	phenotype	HPO
C0240083	Abnormal joint morphology	phenotype	HPO
C0240278	Lymphatic obstruction	phenotype	HPO
C0240310	Hypoplasia of the maxilla	disease	HPO
C0241521	Ulnar deviation of hand	phenotype	HPO
C0264142	Spade-like hand	disease	HPO
C0264172	Barrel chest	phenotype	HPO
C0264324	Calcification of trachea	disease	HPO
C0265783	Congenital hypoplasia of lung	disease	HPO
C0266617	Congenital anomaly of face	group	BEFREE
C0278883	Metastatic melanoma	disease	BEFREE
C0280100	Solid Neoplasm	phenotype	BEFREE
C0280449	secondary acute myeloid leukemia	disease	BEFREE
C0311468	Increased bilirubin level (finding)	phenotype	HPO
C0334634	Malignant lymphoma, lymphocytic, intermediate differentiation, diffuse	disease	BEFREE
C0346647	Malignant neoplasm of pancreas	disease	BEFREE
C0410916	Neonatal Death	disease	HPO
C0426790	Narrow thorax	phenotype	HPO
C0426808	Long clavicle	phenotype	HPO
C0426817	Short ribs	phenotype	HPO
C0431904	Ulnar polydactyly of fingers	disease	HPO
C0432073	Defect of skull ossification	group	HPO
C0432412	Chromosome 8, trisomy	disease	BEFREE
C0438237	Liver enzymes abnormal	phenotype	HPO
C0438717	Transaminases increased	phenotype	HPO
C0455988	Hydrops Fetalis, Non-Immune	disease	HPO
C0478077	Other osteochondrodysplasia with defects of growth of tubular bones and spine	disease	CLINGEN
C0549306	Mesomelia	disease	HPO
C0557874	Global developmental delay	disease	HPO
C0595939	Stillbirth	phenotype	HPO
C0597167	Islets of Langerhans hyperplasia	phenotype	HPO
C0678222	Breast Carcinoma	disease	BEFREE
C0685695	Abnormal lung lobation	disease	HPO
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0748397	Reynolds syndrome	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C0795690	Congenital omphalocele	disease	HPO
C0812413	Malignant Pleural Mesothelioma	disease	BEFREE
C0851135	In situ cancer	phenotype	BEFREE
C0877165	Short phalanx of finger	phenotype	HPO
C0877359	Increased liver function tests	phenotype	HPO
C0878659	Disproportionate short stature	phenotype	CLINVAR
C1274233	T-lymphocyte immunodeficiency	disease	BEFREE
C1274865	Scleroderma-like secondary cutaneous sclerosis	disease	HPO
C1292120	Extramedullary erythropoiesis	phenotype	HPO
C1527249	Colorectal Cancer	disease	BEFREE
C1696466	Hepatic calcification	disease	HPO
C1832983	Absent or minimally ossified vertebral bodies	phenotype	HPO
C1835229	Onset of lymphedema around puberty	phenotype	HPO
C1835473	Diaphyseal thickening	phenotype	HPO
C1836542	Depressed nasal bridge	phenotype	HPO
C1837082	Metaphyseal cupping	phenotype	HPO
C1837260	Prominent forehead	phenotype	HPO
C1839731	11 pairs of ribs	phenotype	HPO
C1840069	Sandal gap	phenotype	HPO
C1842003	Subclinical abnormal liver function tests	phenotype	HPO
C1844555	Absent toenail	disease	HPO
C1844704	Platyspondyly	phenotype	HPO
C1848701	Elevated hepatic transaminases	phenotype	HPO
C1849937	Disproportionate short-limb short stature	phenotype	HPO
C1850135	Flared metaphysis	phenotype	HPO
C1850558	Horizontal sacrum	phenotype	HPO
C1851714	Sclerosis of skull base	phenotype	HPO
C1852504	Misalignment of teeth	phenotype	HPO
C1853171	Multiple prenatal fractures	phenotype	HPO
C1853242	Midface retrusion	phenotype	HPO
C1854912	Short long bone	phenotype	CLINVAR
C1855340	Bowing of the long bones	phenotype	HPO
C1855710	Bone marrow hypocellularity	phenotype	HPO
C1856786	Hypoplastic fingernail	phenotype	HPO
C1857130	Hypoplastic mandible condyle	phenotype	HPO
C1857697	Lip telangiectasia	phenotype	HPO
C1858085	Malar flattening	phenotype	HPO
C1859120	Anterior rib punctate calcifications	phenotype	HPO
C1859121	Sternal punctate calcifications	phenotype	HPO
C1859126	Stippled epiphyses	phenotype	HPO
C1859158	Laryngeal calcification	disease	HPO
C1859461	Femoral bowing	phenotype	CLINVAR
C1860105	Severe short-limb dwarfism	disease	HPO
C1860236	Irregular hyperpigmentation	phenotype	HPO
C1863353	Hypoplastic vertebral bodies	phenotype	HPO
C1864897	Cognitive delay	phenotype	HPO
C1866048	Severe hydrops fetalis	phenotype	HPO
C1866730	Rhizomelia	disease	HPO
C1867446	Bulging forehead	phenotype	HPO
C1955934	Trichothiodystrophy Syndromes	disease	BEFREE
C1960397	Philadelphia chromosome-positive acute lymphoblastic leukemia	disease	BEFREE
C1969532	Rhizomelic arm shortening	phenotype	CLINVAR
C2112129	Postaxial foot polydactyly	disease	HPO
C2239176	Liver carcinoma	disease	BEFREE
C2613439	Extramedullary Hematopoiesis (disorder)	disease	HPO
C2673410	Small midface	phenotype	HPO
C2930821	Keratitis sicca	disease	HPO
C2931048	HEM dysplasia	disease	BEFREE;CLINVAR;CTD_human;ORPHANET
C2936664	Acquired Hypogammaglobulinemia	disease	BEFREE
C3179244	Pseudo Pelger-Huet Anomaly	phenotype	CTD_human
C3494422	Retrognathia	phenotype	CLINVAR
C3550546	Depressed nasal root/bridge	phenotype	HPO
C3662483	Allergic sensitization	disease	BEFREE
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND
C4020768	Abnormal ossification involving bones of the feet	phenotype	HPO
C4020865	Fibular polydactyly	disease	HPO
C4020875	Mental and motor retardation	phenotype	HPO
C4020948	Palmar telangiectasia	phenotype	HPO
C4020966	Abnormal vertebral ossification	phenotype	HPO
C4021241	Abnormal foot bone ossification	phenotype	HPO
C4021245	Patchy variation in bone mineral density	phenotype	HPO
C4021525	Abnormal pelvis bone ossification	phenotype	HPO
C4021626	Lethal skeletal dysplasia	phenotype	HPO
C4022018	Telangiectasia of the skin	phenotype	HPO
C4022020	Mucosal telangiectasiae	phenotype	HPO
C4023039	Rhizomelic leg shortening	phenotype	CLINVAR
C4023351	Hyposegmentation of neutrophil nuclei	phenotype	HPO
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4024595	Abnormal ossification involving the femoral head and neck	phenotype	HPO
C4024661	Abnormality of the vertebral spinous processes	phenotype	HPO
C4024678	Punctate vertebral calcifications	phenotype	HPO
C4024689	Abnormality of the calcaneus	phenotype	HPO
C4025309	Supernumerary vertebral ossification centers	phenotype	HPO
C4025362	Abnormality of the gastric mucosa	phenotype	HPO
C4025656	Abnormality of cholesterol metabolism	phenotype	HPO
C4025670	Abnormality of chromosome segregation	phenotype	HPO
C4025787	Calvarial skull defect	phenotype	HPO
C4025815	Short diaphyses	phenotype	HPO
C4025828	Abnormality of the scapula	phenotype	HPO
C4072847	HyperCalcification of skull base	phenotype	HPO
C4072848	HyperMineralization of skull base	phenotype	HPO
C4082243	Maxillary retrognathia	phenotype	HPO
C4083076	Increased head circumference	phenotype	HPO
C4255213	Increased size of skull	phenotype	HPO
C4277690	Ciliopathies	group	GENOMICS_ENGLAND
C4280320	Hypotrophic midface	phenotype	HPO
C4280321	Decreased projection of midface	phenotype	HPO
C4280367	Abnormal maturation of foot bones	phenotype	HPO
C4280402	Abnormal maturation of the pelvis bone	phenotype	HPO
C4280495	Concave bridge of nose	phenotype	HPO
C4280533	Decreased calcification of skull	phenotype	HPO
C4280596	Calvarial defect	phenotype	HPO
C4280610	Abnormality of position of teeth	phenotype	HPO
C4280640	Retrusion of upper jaw bones	phenotype	HPO
C4280641	Hypotrophic maxilla	phenotype	HPO
C4280642	Deficiency of upper jaw bones	phenotype	HPO
C4280643	Decreased projection of maxilla	phenotype	HPO
C4280651	Hypotrophic malar bone	phenotype	HPO
C4280664	Big calvaria	phenotype	HPO
C4280670	Spider veins of the lip	phenotype	HPO
C4280671	Angioectasias of the lip	phenotype	HPO
C4317146	Acid reflux	phenotype	HPO
C4476523	Decreased projection of lower jaw	phenotype	HPO
C4476524	Decreased projection of mandible	phenotype	HPO
C4476525	Retrusion of lower jaw	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0003677	DNA binding	IEA
GO:0003723	RNA binding	HDA
GO:0005515	protein binding	IPI
GO:0005521	lamin binding	TAS
GO:0016627	oxidoreductase activity, acting on the CH-CH group of donors	IBA
GO:0050613	delta14-sterol reductase activity	IMP
GO:0050613	delta14-sterol reductase activity	IDA
GO:0050613	delta14-sterol reductase activity	TAS
GO:0070087	chromo shadow domain binding	IPI
GO:0070402	NADPH binding	IMP

GO:Biological Process

GO ID	GO Term	Evidence
GO:0006695	cholesterol biosynthetic process	IEA
GO:0006695	cholesterol biosynthetic process	IDA
GO:0006695	cholesterol biosynthetic process	IMP
GO:0006695	cholesterol biosynthetic process	TAS
GO:0016126	sterol biosynthetic process	IBA
GO:0030223	neutrophil differentiation	ISS
GO:0055114	oxidation-reduction process	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005634	nucleus	IDA
GO:0005635	nuclear envelope	TAS
GO:0005637	nuclear inner membrane	IBA
GO:0005639	integral component of nuclear inner membrane	TAS
GO:0005737	cytoplasm	IDA
GO:0005789	endoplasmic reticulum membrane	IDA
GO:0016020	membrane	HDA
GO:0016021	integral component of membrane	IDA
GO:0031965	nuclear membrane	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1430728	Metabolism	TAS
R-HSA-191273	Cholesterol biosynthesis	TAS
R-HSA-212436	Generic Transcription Pathway	TAS
R-HSA-556833	Metabolism of lipids	TAS
R-HSA-73857	RNA Polymerase II Transcription	TAS
R-HSA-74160	Gene expression (Transcription)	TAS
R-HSA-8957322	Metabolism of steroids	TAS
R-HSA-8986944	Transcriptional Regulation by MECP2	TAS
R-HSA-9022692	Regulation of MECP2 expression and activity	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of LBR mRNA	28628672
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of LBR mRNA	28628672
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of LBR protein	26558463
C029790	2,2',3',4,4',5-hexachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of LBR mRNA	25510870
C070055	2,3',4,4',5-pentachlorobiphenyl	2,3',4,4',5-pentachlorobiphenyl results in increased expression of LBR mRNA	31388691
C081766	2,4,4'-trichlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of LBR mRNA	25510870
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of LBR mRNA	25510870
C009828	2,4,5,2',5'-pentachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of LBR mRNA	25510870
C009407	2,5,2',5'-tetrachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of LBR mRNA	25510870
C023035	3,4,5,3',4'-pentachlorobiphenyl	3,4,5,3',4'-pentachlorobiphenyl results in increased expression of LBR mRNA	23196670
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in decreased expression of LBR mRNA	19150397
C496492	abrine	abrine results in decreased expression of LBR mRNA	31054353
D000082	Acetaminophen	Acetaminophen affects the expression of LBR mRNA	17562736
D000082	Acetaminophen	[Clofibrate co-treated with Acetaminophen] affects the expression of LBR mRNA	17585979
D000082	Acetaminophen	PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of LBR mRNA]	17585979
D020106	Acrylamide	Acrylamide results in decreased expression of LBR protein	29784925
D016604	Aflatoxin B1	Aflatoxin B1 results in increased expression of LBR mRNA	19770486
D000395	Air Pollutants, Occupational	Air Pollutants, Occupational results in decreased expression of LBR mRNA	23195993
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of LBR mRNA	16483693
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of LBR mRNA	20064835
C006780	bisphenol A	bisphenol A affects the expression of LBR mRNA	21786754
C006780	bisphenol A	bisphenol A results in increased expression of LBR mRNA	25047013
C006780	bisphenol A	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of LBR mRNA	28628672
C006780	bisphenol A	bisphenol A results in decreased expression of LBR mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased expression of LBR protein	24552547
C006780	bisphenol A	bisphenol A results in increased methylation of LBR gene	28505145
C000611646	bisphenol F	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of LBR mRNA	28628672
D002104	Cadmium	Cadmium results in decreased expression of LBR mRNA	24376830
D019256	Cadmium Chloride	Cadmium Chloride results in increased expression of LBR mRNA	23644582
D019256	Cadmium Chloride	Cadmium Chloride results in increased methylation of LBR promoter	22457795
D002117	Calcitriol	Calcitriol results in decreased expression of LBR mRNA	21592394
D002117	Calcitriol	[Testosterone co-treated with Calcitriol] results in decreased expression of LBR mRNA	21592394
C074702	chromium hexavalent ion	chromium hexavalent ion affects the expression of LBR mRNA	28472532
D002945	Cisplatin	Cisplatin affects the reaction [Piroxicam results in increased expression of LBR mRNA]	21858171
D002994	Clofibrate	[Clofibrate co-treated with Acetaminophen] affects the expression of LBR mRNA	17585979
D002994	Clofibrate	PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of LBR mRNA]	17585979
D019327	Copper Sulfate	Copper Sulfate results in decreased expression of LBR mRNA	19549813
D003375	Coumestrol	[Coumestrol co-treated with Resveratrol] results in increased expression of LBR mRNA	19167446
D003375	Coumestrol	Coumestrol results in increased expression of LBR mRNA	19167446
D016572	Cyclosporine	Cyclosporine results in decreased expression of LBR mRNA	25562108
D003907	Dexamethasone	Dexamethasone results in increased expression of LBR mRNA	25047013
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of LBR mRNA	28628672
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of LBR mRNA	28628672
D004041	Dietary Fats	Dietary Fats results in decreased expression of LBR mRNA	30120929
D004147	Dioxins	Dioxins affects the expression of LBR mRNA	20463971
D004317	Doxorubicin	Doxorubicin results in decreased expression of LBR mRNA	29803840
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in increased expression of LBR mRNA	17942748
D004997	Ethinyl Estradiol	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of LBR mRNA	17942748
D017313	Fenretinide	Fenretinide results in increased expression of LBR mRNA	28973697
D005419	Flavonoids	Flavonoids results in decreased expression of LBR mRNA	18035473
D005557	Formaldehyde	Formaldehyde results in decreased expression of LBR mRNA	23649840
C004312	glycidol	glycidol results in increased expression of LBR mRNA	24395379
D006861	Hydrogen Peroxide	Hydrogen Peroxide affects the expression of LBR mRNA	20044591
D006861	Hydrogen Peroxide	Hydrogen Peroxide results in decreased expression of LBR mRNA	12414654
C026262	imidazopyrazole	imidazopyrazole analog results in increased expression of LBR mRNA	30388846
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of LBR mRNA	28628672
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of LBR mRNA	28628672
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of LBR mRNA	25613284
D000077339	Leflunomide	Leflunomide results in decreased expression of LBR mRNA	28988120
D008294	Malathion	Malathion results in decreased expression of LBR mRNA	26494550
D008748	Methylcholanthrene	Methylcholanthrene results in increased expression of LBR mRNA	18804290
D008767	Methylmercury Compounds	Methylmercury Compounds results in increased expression of LBR protein	26558463
D008741	Methyl Methanesulfonate	Methyl Methanesulfonate results in decreased expression of LBR mRNA	23649840
D008777	Methyltestosterone	Methyltestosterone results in increased expression of LBR mRNA	29458080
D009532	Nickel	Nickel results in decreased expression of LBR mRNA	23195993
C029938	nickel sulfate	nickel sulfate results in decreased expression of LBR mRNA	22714537
C464660	obeticholic acid	obeticholic acid results in decreased expression of LBR mRNA	27939613
D000077150	Oxaliplatin	[Oxaliplatin co-treated with Topotecan] results in decreased expression of LBR mRNA	25729387
C410127	PCB 180	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in increased expression of LBR mRNA	25510870
D010416	Pentachlorophenol	Pentachlorophenol results in increased expression of LBR mRNA	24642059
D010894	Piroxicam	Cisplatin affects the reaction [Piroxicam results in increased expression of LBR mRNA]	21858171
D010894	Piroxicam	Piroxicam results in increased expression of LBR mRNA	21858171
D010936	Plant Extracts	Plant Extracts results in increased expression of LBR mRNA	23557933
D011794	Quercetin	Quercetin results in decreased expression of LBR mRNA	21632981
D000077185	Resveratrol	[Coumestrol co-treated with Resveratrol] results in increased expression of LBR mRNA	19167446
C017947	sodium arsenite	sodium arsenite results in decreased expression of LBR mRNA	19072884
D013605	T-2 Toxin	T-2 Toxin results in decreased expression of LBR mRNA	31299295
D020122	tert-Butylhydroperoxide	tert-Butylhydroperoxide results in decreased expression of LBR mRNA	12414654
D013739	Testosterone	[Testosterone co-treated with Calcitriol] results in decreased expression of LBR mRNA	21592394
D013739	Testosterone	Testosterone results in decreased expression of LBR mRNA	21592394
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of LBR mRNA	11007951
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of LBR mRNA	21570461
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of LBR mRNA	17942748
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of LBR mRNA	25613284
D013853	Thioacetamide	Thioacetamide results in increased expression of LBR mRNA	23411599
D014028	Tobacco Smoke Pollution	Tobacco Smoke Pollution results in decreased expression of LBR mRNA	28065790
D019772	Topotecan	[Oxaliplatin co-treated with Topotecan] results in decreased expression of LBR mRNA	25729387
D014241	Trichloroethylene	Trichloroethylene results in increased methylation of LBR gene	27618143
C012589	trichostatin A	trichostatin A results in decreased expression of LBR mRNA	15901671
D014635	Valproic Acid	Valproic Acid results in decreased expression of LBR mRNA	15901671
D014635	Valproic Acid	Valproic Acid affects the expression of LBR mRNA	25979313
D014635	Valproic Acid	Valproic Acid affects the expression of LBR mRNA	17292431; 17963808;
D001335	Vehicle Emissions	Vehicle Emissions results in decreased methylation of LBR gene	25560391
D024483	Vitamin K 3	Vitamin K 3 results in decreased expression of LBR mRNA	12414654

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0007	Acetylation
KW-0152	Cholesterol biosynthesis
KW-0153	Cholesterol metabolism
KW-0963	Cytoplasm
KW-0225	Disease mutation
KW-0238	DNA-binding
KW-0242	Dwarfism
KW-0256	Endoplasmic reticulum
KW-0444	Lipid biosynthesis
KW-0443	Lipid metabolism
KW-0472	Membrane
KW-0539	Nucleus
KW-0560	Oxidoreductase
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-0675	Receptor
KW-1185	Reference proteome
KW-0752	Steroid biosynthesis
KW-0753	Steroid metabolism
KW-0756	Sterol biosynthesis
KW-1207	Sterol metabolism
KW-0812	Transmembrane
KW-1133	Transmembrane helix

Interpro

InterPro ID	InterPro Term
IPR001171	Ergosterol_biosynth_ERG4_ERG24
IPR019023	Lamin-B_rcpt_of_tudor
IPR018083	Sterol_reductase_CS
IPR002999	Tudor

PROSITE

PROSITE ID	PROSITE Term
PS01017	STEROL_REDUCT_1
PS01018	STEROL_REDUCT_2

Pfam

Pfam ID	Pfam Term
PF01222	ERG4_ERG24
PF09465	LBR_tudor

Gene: LBR

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction